Content uploaded by Stefan Hertwig
Author content
All content in this area was uploaded by Stefan Hertwig on May 19, 2022
Content may be subject to copyright.
ORIGINAL ARTICLE
From a lost world: an integrative phylogenetic analysis of Ansonia
Stoliczka, 1870 (Lissamphibia: Anura: Bufonidae),
with the description of a new species
Lea E. Waser
1,2
&Manuel Schweizer
1,2
&Alexander Haas
3
&Indraneil Das
4
&
André Jankowski
3
&Pui Yong Min
4
&Stefan T. Hertwig
1,2
Received: 18 December 2015 /Accepted: 30 June 2016
#Gesellschaft für Biologische Systematik 2016
Abstract While the island of Borneo is considered a global
biodiversity hotspot, the species richness in many groups re-
mains unknown and appears underestimated. During herpeto-
logical surveys carried out in the interior of Sarawak, East
Malaysia, several individuals of a small species of the genus
Ansonia Stoliczka 1870 were collected on the Usun Apau
plateau and in the Gunung Hose mountain range (Ansonia
sp. Usun Apau). An integrative taxonomic approach compris-
ing phylogenetic (2.4 kb mitochondrial rDNA fragment,
Bayesian Inference and Maximum Likelihood, >5.1 % to its
closest relative) and morphometric analyses (25 measure-
ments, multivariate ratio analysis and linear discriminant anal-
ysis), as well as morphological comparisons support the status
of this operational taxonomic unit as a separate taxon at spe-
cies level. The obtained phylogenetic hypothesis corroborates
the two major clades within Ansonia found in previous stud-
ies. Within Clade One Ansonia sp. Usun Apau and the enig-
matic Ansonia torrentis are part of a monophyletic group of
the Bornean species Ansonia hanitschi,Ansonia minuta,
Ansonia platysoma,Ansonia spinulifer,Ansonia vidua,and
two additional undescribed taxa. This subclade must be con-
sidered as the result of an on-island radiation in the complex
evolution of Ansonia. The new species is formally described
including the identification of diagnostic morphometric traits.
Ansonia sp. Usun Apau is endemic to two isolated mountain
ridges in central Sarawak and must be considered as a new
element of the unique diversity of the Bornean amphibian
fauna that is potentially threatened by habitat loss at least in
parts of its range.
Keywords Ansonia teneritas .New species .Integrative
taxonomy .Phylogeny .Diversity .Evolution .
Morphometrics .Usun Apau .Borneo .Mitochondrial DNA
Introduction
The Usun Apau plateau is one of the last inaccessible and
uninhabited areas of Sarawak, Borneo, in East Malaysia. A
volcanic plateau located at the headwaters of the Baram and
Rajang rivers near the Indonesian border, it is protected today as
a national park but was unknown to western science until 1951,
when Tom Harrisson, the curator of the Sarawak Museum in
Kuching, visited the site (Arnold 1957). During our herpetolog-
ical expedition to the Usun Apau NationalParkin2010,aseries
of individuals of a small species of the genus Ansonia Stoliczka
1870 was collected (Fig. 1). These were initially regarded dur-
ing field work as conspecific with either Ansonia hanitschi,
Ansonia minuta,orAnsonia platysoma due to their small size
and overall similarity in external morphology. Subsequent
Electronic supplementary material The online version of this article
(doi:10.1007/s13127-016-0294-2) contains supplementary material,
which is available to authorized users.
*Stefan T. Hertwig
stefan.hertwig@nmbe.ch
Alexander Haas
alexander.haas@uni-hamburg.de
Indraneil Das
idas@ibec.unimas.my
1
Naturhistorisches Museum der Burgergemeinde Bern, Bernastrasse
15, CH-3005 Bern, Switzerland
2
Institute of Ecology and Evolution, University of Bern, Baltzerstrasse
6, CH-3012 Bern, Switzerland
3
Biozentrum Grindel und Zoologisches Museum Hamburg,
Martin-Luther-King-Platz 3, 20146 Hamburg, Germany
4
Institute of Biodiversity and Environmental Conservation, Universiti
Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia
Org Divers Evol
DOI 10.1007/s13127-016-0294-2
examinations of the collected material, including genetic anal-
yses (see below), however, cast doubt on this initial assignment
and on the taxonomic status of this new operational taxonomic
unit (OTU). A single specimen collected in 2011 in the Gunung
Hose National Park, Sarawak, East Malaysia, was, on the basis
of genetic evidence, also assigned to this OTU (hereinafter
termed Ansonia sp. Usun Apau).
The 28 species of Ansonia, known as slender or stream
toads, currently described are distributed primarily on
Sundaland but also on mainland South-east Asia and the
Philippines (Frost 2015). Species of this genus are character-
ized as adults by the combination of a slender body, indistinct
subarticular tubercles, long and slender legs (relative to other
bufonids), membranous digital webbing, the absence of parot-
id glands, and a visible tympanum. Additionally, the larval
forms exhibit oral suckers as an adaptation for life in streams
or rivers with a moderate to strong current (Inger 1960,1966),
except for Ansonia leptopus (Inger 1992). According to cur-
rent knowledge of the phylogenetic relationships within
Ansonia, the Bornean species do not form a monophyletic
group but are divided over two major clades (Hertwig et al.
2014;Matsuietal.2010). Clade One consists of species from
the Malay Peninsula, Thailand, and the following species
from Borneo: Ansonia hanitschi,Ansonia spinulifer,
Ansonia platysoma,Ansonia minuta,andAnsonia vidua,
and one undescribed species not identical with Ansonia sp.
Usun Apau (Hertwig et al. 2014;Matsuietal.2010). Clade
Two comprises species from the Malay Peninsula, the
Philippines, and the Bornean taxa Ansonia albomaculata,
Ansonia longidigita,Ansonia leptopus,Ansonia fuliginea,
Ansonia guibei, as well as one undescribed species (Hertwig
et al. 2014;Matsuietal.2010). In the study by Matsui et al.
(2010), Ansonia torrentis was also assigned to the Clade Two
but its position was later questioned by Hertwig et al. (2014).
The real diversity of Ansonia is still unclear, as demonstrated
by the fact that several new species have been described in
recent years. Ansonia lumut from Terengganu, West Malaysia,
and Ansonia vidua from Sarawak, East Malaysia, for example,
were only described in 2014 (Chan et al. 2014; Hertwig et al.
2014). Matsui et al. (2010) identified five additional OTUs
using molecular data, but these remain unnamed.
This study examines the phylogenetic relationships and
taxonomic status of Ansonia sp. Usun Apau using morpho-
logical, morphometric, and genetic analyses. The phylogenet-
ic hypothesis obtained is based on a larger sample of Ansonia
than that featured in previous studies and is used to discuss the
evolutionary and biogeographic relationships between this
OTU and related taxa. As the result of the investigation, we
provide a formal description of Ansonia sp. Usun Apau as a
new species of Ansonia. In addition, we discuss the contribu-
tion of morphometric measurements to the diagnosis and de-
termination of cryptic species (according to the definition of
Bickford et al. 2006) within this genus.
Material and methods
Sampling and markers
Specimens and tissue samples of Ansonia from Borneo, now
held in the collection of the Natural History Museum Bern
(NMBE), the Zoological Museum Hamburg (ZMH), and the
Institute of Biodiversity and Environmental Conservation
(IBEC, UNIMAS), were collected between the years 2009
and 2014 during several field trips to Sabah and Sarawak with
the kind permission of the Sabah Parks and the Sarawak Forest
Fig. 1 Known records of Ansonia sp. Usun Apau and related species
L.E. Waser et al.
Department (NPW.907.4.2(IV)-3, NPW.907.4.4(V)-63,
NPW.907.4.4(V)-99, NCCD.907.4.4(Jld.VI)-106,
NCCD.907.4.4(Jld.9)-19; park permits 3/2009, 23/2010, 53/
2010, 56/2011, 62/2011, 038/2012, 035/2013; export permits
08169, 08961, 09813, 10644, 14603). Specimens were anes-
thetized and euthanized in ca. 2 % aqueous Chlorobutanol so-
lution (1,1,1-trichloro-2-methyl-2-propanol). Tissue samples
were taken from either liver or femoral muscles in adult toads
or from the tail musculature in tadpoles and stored in RNALater
buffer solution (Ambion/Applied Biosystems). Specimens
were then preserved in 4 % neutral buffered formalin for at least
2 weeks, washed in tap water, and transferred to 75 % ethanol in
incremental steps of 30 and50%toavoidshrinkage.
We examined DNA sequences of the mitochondrial 12S and
16S rRNA genes and the intervening tRNA valine from 40
specimens (Table 1,Appendix), in combination with 79 se-
quences from GenBank (Hertwig et al. 2014;Matsuietal.
2010). The outgroup was selected following Matsui et al.
(2010) and Pyrons and Wiens (2011)andcomprised
Pedostibes maculatus (Sabahphrynus maculatus,Chanetal.
2016), Pedostibes hosii (Rentapia hosii,Chanetal.2016),
Leptophryne borbonica,Duttaphrynus melanostictus and
Pelophryne brevipes (Appendix).
Laboratory protocols
Total genomic DNAwas extracted from liver tissue or macerated
muscle using Wizard SV Genomic DNA Purification System
(Promega, Switzerland). Eight primer combinations were used
(Table 1). For PCR reactions, a 25-μl PCR reaction volume
containing 2 μl of DNA, 12.5 μl of GoTaq Hot Start Green
Master Mix (Promega), 2 μl of each primer (10 μM), (for 16S
rDNA 1 μl[20μM]), and 6.5 μl ddH
2
O (for 16S rDNA 8.5 μl
ddH
2
O) was used. Cycling conditions for 12S rRNA and tRNA-
Valweredenaturationat94°Cfor2min;35cyclesat95°Cfor
30 s, 52 °C for 30 s, and 72 °C for 1 h and 10 min and then one
final extension cycle at 72 °C for 7 min. The cycling conditions
for 16S rRNA were as follows: denaturation at 94 °C for 2 min,
35 cycles at 94 °C for 30 s, 48.2 °C for 30 s, and 72 °C for 1 min,
followed by one final extension at 72 °C for 5 min. PCR
products from 16S rDNA were cleaned using Wizard® SV Gel
and PCR Clean-Up System (Promega). 12s and tRNA-Val PCR
products were purified and sequenced by Microsynth
(Microsynth GmbH, Balgach, Switzerland). Sequences were
checked manually for ambiguities in Geneious Pro 7.0.6
(Kearse et al. 2012) and assigned standard IUB codes.
Phylogenetic analyses
The markers were aligned using the MAFFT plug-in in
Geneious Pro (Katoh and Standley 2013). After each marker
had been checked for contamination and sequencing and
laboratory errors separately, the sequences were concatenat-
ed. Uncorrected genetic p-distances were calculated in
Geneious Pro. The best-fitting models of sequence evolution
for subsequent analyses were chosen for each gene partition
using PartitionFinder v1.0.1 (Lanfear et al. 2012)with
linked branch lengths.
Bayesian inference (BI) was carried out in MrBayes 3.2
(Huelsenbeck and Ronquist 2001). Two independent runs of
Metropolis-coupled Markov chain Monte Carlo analyses were
conducted, each consisting of three heated and one cold chain
with a default temperature of 0.2. The analyses were run for 50
million generations with a sampling frequency of 100. The
first 25 % of samples were discarded as burn-in (12,500,000
trees) once trace files had been checked with Tracer v.1.5
(Rambaut et al. 2014) to assess convergence between the
two independent runs.
Maximum likelihood (ML) analysis was performed in
RAxML V8 (Stamatakis 2014) using the GTR GAMMA
model of nucleotide substitution. Internal node support was
verified with 300 bootstrap replicates. The appropriate
bootstrapping number was estimated using bootstopping
criteria as recommended by Pattengale et al. (2009).
Clades were considered to be robustly supported when
clade credibility values were ≥0.95 in BI (Huelsenbeck
and Ronquist 2001) and with bootstrap values ≥70 % in
ML (Hillis and Bull 1993). The number of autapomorphic
substitutions was calculated in MacClade v.4.08a
(Maddison and Maddison 2005).
Tabl e 1 Primers used for the
amplification of the ∼2400 bp
mitochondrial rDNA fragment
Marker Primer name Primer sequence (5′-3′) Reference
rDNA tRNAphe GCRCTGAARATGCTGAGATGARCCC Goebel et al. (1999)
tRNAval-H GGTGTAAGCGARAGGCTTTKGTTAAG Goebel et al. (1999)
12 L1 AAAAAGCTTCAAACTGGGATTAGATACCCCACT Goebel et al. (1999)
16SH GCTAGACCATKATGCAAAAGGTA Goebel et al. (1999)
12Sm GGCAAGTCGTAACATGGTAAG Pauly et al. (2004)
16Sa ATGTTTTTGGTAAACAGGCG Goebel et al. (1999)
16SC GTRGGCCTAAAAGCAGCCAC Pauly et al. (2004)
16SD CTCCGGTCTGAACTCAGATCACGTAG Pauly et al. (2004)
New Bornean Ansonia
Morphometric analyses
For morphometric analyses, 25 traits (Fig. 2,seeTable2
for abbreviations, supplementary material) were measured
in 13 individuals of the Ansonia sp. Usun Apau including
the single specimen from Gunung Hose, 17 Ansonia
minuta,13Ansonia platysoma,5Ansonia hanitschi,and
3Ansonia torrentis (supplementary material). These taxa
were selected on the basis of their close phylogenetic
relationships with and similarity in external morphology
to Ansonia sp. Usun Apau. Ansonia vidua was not con-
sidered due to its significantly larger body size and diver-
gent morphology (Hertwig et al. 2014). The sex of the
specimens was determined on the basis of differences in
snout-vent length (SVL) (presence or absence of nuptial
pads, vocal sacs, and ova visible through skin at the in-
guinal region). Specimens that could not be sexed with
certainty on the basis of external traits were dissected
anddeterminedbyinspectingtheprimarysexualorgans.
Morphometric traits and corresponding abbreviations
(Table 2and Fig. 2) conform to those used in previous
studies (e.g., Boulenger 1880,1897;Gasconetal.1996;
Heyer 1984;Matsui1984; Okada 1931). Measurements
were taken from formalin- and ethanol-preserved speci-
mens using a calibrated Leica DFC420 camera on a Leica
MZ16 with motorfocus and measured from digital images
in ImageJ (Schneider et al. 2012). Two characters (HDP
and HDA) were measured using a digital caliper. The mea-
surements were taken from the side of the specimen that
was in better shape in terms of quality of preservation.
We carried out the multivariate ratio analysis (MRA) put
forward by Baur and Leuenberger (2011), which permits a
strict separation of differences in size and shape and the inter-
pretation of principal components as ratios (cf. Bauer and
Leuenberger 2011). We used the geometric mean of the orig-
inal measurements to define an isometric size axis (Bisosize^).
This resulting isosize axis comprises differences in scaling of
size only. We then obtained size-independent shape variables
by projecting the measurements orthogonal to isosize. This
allowed us to calculate a principal component analysis
(PCA) accounting exclusively for differences in proportions
in the covariance matrix of the shape parameters. Matrix
scatterplots were produced to show error variance. After a
preliminary analysis, body width (BW) and axilla to groin
distance (AGD) were omitted from the dataset due to an ob-
viously high level of measurement errors caused by preserva-
tion artifacts. Separate analyses of the sexes led to an im-
proved separation of the OTUs. Only for the linear discrimi-
nant analysis (LDA) ratio extractor (Baur and Leuenberger
2010) were the sexes combined to obtain a larger sample size
for each species. The LDA ratio extractor was used to find
those body ratios that permitted pairwise differentiation be-
tween the species. R language for statistical computing was
used for data analysis (R Studio, integrated development en-
vironment for R; version 0.98.1073).
Following comparative material was examined (institutional
abbreviations are based on Sabaj Pérez (2012), except following
local usage, we retain ZRC for the Lee Kong Chian Museum of
Natural History, National University of Singapore, the abbrevi-
ation used in Sabaj Pérez 2012 is USDZ):
Fig. 2 Morphometric
measurements used in this study
(see Table 2)
L.E. Waser et al.
Ansonia albomaculata Inger, 1960. FMNH 81975
(holotype) and SM (uncataloged), in Bottle 51 (paratype),
from B1400 to 2000 ft above sea level, in the headwaters of
the Baleh River, Third Division, Sarawak^; UBD 266, 309,
318, 337, 389, 396, 412, 472, 476, 481, 487, 508, 539, 617,
Batu Apoi Forest Reserve, Temburong District, Brunei
Darussalam.
Ansonia guibei Inger, 1966. UNIMAS 7746; 8058, 8060.
Mesilau, Gunung Kinabalu Park, Sabah, Malaysia.
Ansonia hanitschi Inger, 1960. UNIMAS 8050, 8081,
Liwagu Trail, Gunung Kinabalu Park, Sabah, Malaysia;
UNIMAS 8055, 8470, ZRC 1.11911, Mesilau, Gunung
Kinabalu Park, Sabah, Malaysia; UNIMAS 7800, Poring,
Gunung Kinabalu Park, Sabah, Malaysia; NMBE 1056271–
1056280, Sungei Tapin, Gunung Mulu, Sarawak, Malaysia.
Ansonia latidisca Inger, 1966. UNIMAS-OJJ 009–011,
NMBE 1061497, 1061498, Gunung Penrissen, Sarawak,
Malaysia.
Ansonia leptopus (Günther, 1872). UBD 289, 382, 293,
397, 420, 506, 510, 517, 618–19, Batu Apoi Forest Reserve,
Temburong District, Brunei Darussalam; NMBE 1056582,
1056591, 1057156, 1057168, 1057169, 1057172, 1059721–
1059723, UNIMAS 8393, 8402, Kubah National Park,
Sarawak, Malaysia; NMBE 1056281–1056283, Camp 5,
Gunung Mulu National Park, Sarawak, Malaysia; UNIMAS
8725, Gunung Santubong, Sarawak, Malaysia.
Ansonia longidigita Inger, 1960. BMNH 99.8.19.12 (holo-
type), B…4200 ft on Mount Kina Balu, North Borneo^;
UNIMAS 7925–26. Gunung Santubong, Sarawak, Malaysia;
UBD 90, 94–98, 135, 160, Batu Apoi Forest Reserve,
Tabl e 2 Abbreviations of
morphometric measurements
used in this study (see Fig. 1)
Abbreviation Character name Definition
SVL Snout-vent length From tip of snout to vent
BW Body width Greatest width of body
AGD Axilla to groin distance Distance between posterior edge of fore limb
insertion and anterior edge of hind limb insertion
HL Head length Distance between angle of jaws and tip of snout
HWAE Head width at the anterior of
the eye
Width of the head taken anterior of the eye
HWAJ Head width at the angle of jaws Distance between angle of jaws
SL Snout length Distance from anterior margin of eye to tip of snout
NS Nostril-snout distance Distance between centre of nostril and tip of snout
EN Eye-nostril distance Distance between anteriormost point of eye and
centre of nostril
TNL Tympanum-nostril length Distance from anterior margin to centre of nostril
TML Tympanum-mouth length Shortest distance between anterior rim of the tympanum to
mouth (maxilla)
NML Nostril-mouth length Shortest distance between the centre of the nostril
to mouth (maxilla)
IN Internarial distance Distance between outer rims of nostrils
ED Eye diameter Horizontal diameter of exposed portion of eyeball
UE Upper eyelid width Greatest transverse width of upper eyelid
IO Interorbital distance Smallest distance between upper eyelids
TED Tympanum-eye distance Shortest distance between anterior rim of tympanum
and posterior edge of eye
HTYD Horizontal tympanum
diameter
Maximum horizontal tympanum diameter, measured
from the outside edges of tympanic annulus
VTYD Vertical tympanum diameter Maximum vertical tympanum diameter, measured
from the outside edges of tympanic annulus
TBL Tibia length Distance between anterior surface of knee and posterior
surface of heel with both tibia and tarsus flexed
THL Thigh length From cloaca to most distal apex of knee
HND Hand length Distance from base of palmar tubercle to tip of third finger
FOT Foot length Distance from base of inner metatarsal tubercle to tip of fourth
toe
HDP Head depth posterior of the eye Greatest depth of head, taken posterior of eye
HDA Head depth anterior of the eye Greatest depth of head, taken anterior of eye
New Bornean Ansonia
Temburong District, Brunei Darussalam; NMBE 1056284–
1056288, ZMH A09368, A09371, ZRC 1.12012–13, Camp
2, Gunung Mulu National Park, Sarawak, Malaysia; ZMH
A09370 8th Mile, Crocker Range Park, Sabah, Malaysia.
Ansonia minuta Inger, 1960. NMBE 1056601, 1057163,
1059725–1059728, ZMH A10003–06, ZRC 1.2215, Kubah
National Park, Sarawak, Malaysia; NMBE 1057516–
1057518, 1057527, 1057528, 1058244, 1061560, 1061561,
Mount Penrissen, Sarawak, Malaysia; NMBE 1059717–
1059719, Santubong National Park, Sarawak, Malaysia.
Ansonia platysoma Inger, 1960. ZMH A10007-09, ZRC
1.12004, 1.12007, Camp 2, Gunung Mulu National Park,
Sarawak, Malaysia; UNIMAS 7371, 7373, 7384, 7385,
7413, 7414, 7415, 7417, 7418, 7420, 7421, Crocker Range
Park, Sabah, Malaysia; UNIMAS 9047, 9056, Sayap
Substation, Gunung Kinabalu, Sabah, Malaysia.
Ansonia spinulifer (Mocquard, 1890). SBC A.00001,
Gunung Meraja, Bau, Sarawak, Malaysia; SBC A.00032,
Gunung Pambor, Bau, Sarawak, Malaysia; SBC A.00045,
Gunung Ropih, Bau, Sarawak, Malaysia; SBC A.00065–67,
Gunung Tai Ton, Bau, Sarawak, Malaysia; SBC A.00093,
Gunung Batu Payong, Bau, Sarawak, Malaysia; SBC
A.00165–66, Gunung Umbut, Bau, Sarawak, Malaysia;
SBC A.00288, Gunung Podam, Bau, Sarawak, Malaysia;
UNIMAS 7875, Anna Rais, base of Gunung Penrissen,
Sarawak, Malaysia; UNIMAS 7020–22. Ranchan Pool,
Serian, Sarawak, Malaysia; UNIMAS 7580. Gunung
Gading, Sarawak, Malaysia; NMBE 1057085, 1057086,
1057171, Kubah National Park, Sarawak, Malaysia.
Ansonia torrentis Dring, 1983. NMBE 1056296–1056298,
Sungei Tapin, Gunung Mulu, Sarawak, Malaysia.
Ansonia vidua Hertwig, Pui, Haas & Das, 2014. NMBE
1061645, holotype and NMBE 1066153, paratype), summit trail,
Gunung Murud, Pulong Tau National Park, Sarawak, Malaysia.
Results
Phylogenetic analyses
The final concatenated alignment comprised 2465 bp, including
958 bp of 12S (1-958), 70 bp of tRNA-Val (959-1028), and
1437 bp of 16S rRNA (1029-2465). Following sequence evolu-
tion models were applied based on the test results obtained with
PartitionFinder: 12S: GTR + I + G, tRNA-Val: SYM + I + G,
16S: GTR + I + G (details available upon request). Both
Bayesian and ML analyses resulted in congruent consensus trees
(Fig. 3) that corroborate the two major clades found in previous
phylogenetic studies (Matsui et al. 2010; Hertwig et al. 2014).
Within Clade One Ansonia torrentis and Ansonia sp. Usun Apau
are part of a subclade consisting of the Bornean species Ansonia
hanitschi,Ansonia minuta,Ansonia platysoma,Ansonia
spinulifer,Ansonia vidua, and the undescribed taxa referred to
by Matsui et al. (2010)asAnsonia sp. 3 and Ansonia sp.4.The
enigmatic species Ansonia torrentis is closely related to these
small- to medium-sized montane Ansonia species from Borneo
(Fig. 3).
The OTU Ansonia sp. Usun Apau, including the single spec-
imen from Gunung Hose, is robustly supported as a monophy-
letic group (100 % bootstrapping support and 57 autapomorphic
substitutions). The sister group is a clade consisting of Ansonia
platysoma,Ansonia vidua,Ansonia torrentis,andAnsonia sp. 3
(Fig. 3). The genetic p-distance between the individual
from Gunung Hose and the specimens from Usun Apau is
0.4–0.8 %. The genetic p-distance from this species to the valid
species of Ansonia from Borneo is 13.4–13.8 % to Ansonia
albomaculata, 10.1–10.9 % to Ansonia fuliginea,10.4–10.7 %
to Ansonia guibei,6.2–6.5 % to Ansonia hanitschi,11.8–12.4 %
to Ansonia leptopus, 11.8–12.6 % to Ansonia longidigita,
8.3–9.5 % to Ansonia minuta,6.8–7.5 % to Ansonia platysoma,
11.6–12.1 % to Ansonia spinulifer, 5.1–5.4 % to Ansonia
torrentis, and 6.3–6.6 % to Ansonia vidua.
Morphometric analyses
Neither the females nor the males of Ansonia hanitschi,
Ansonia minuta, Ansonia platysoma,Ansonia torrentis,and
Ansonia sp.UsunApauareseparatedbythecombinationof
shape PC1 and shape PC2 (Online Resources 1and 2), and this
is particularly striking in the males. The isometric size in males
and females in Ansonia hanitschi,Ansonia minuta, Ansonia
platysoma,Ansonia torrentis,andAnsonia sp. Usun Apau dif-
fers gradually, with Ansonia platysoma and Ansonia sp. Usun
Apau being isometrically smallest, followed by Ansonia minuta
and Ansonia hanitschi.ThemalesofAnsonia torrentis are iso-
metrically largest (Online Resources 1and 2). These results
were partly influenced by allometric relationships, as shown
in the ratio spectra (Online Resources 3).
The LDA ratio extractor requires an a priori assignment of
individuals to an OTU. According to the LDA ratio extractor,
the combination of the ratios between SVL/HD and internarial
distance (IN)/nostril-mouth length (NML) separates Ansonia
sp. Usun Apau and Ansonia platysoma (Fig. 4a), the combi-
nation of NML/ foot length (FOT) and thigh length (THL)/
FOT separates Ansonia sp. Usun Apau and Ansonia minuta
(Fig. 4b), and the combination of SVL/HD and SVL/THL
separates Ansonia minuta and Ansonia platysoma (Fig. 4c).
In Ansonia hanitschi, the number of available specimens was
too low for the LDA ratio extractor.
In conclusion, we consider the apomorphic combination of
genetic and external morphological characters (see description
and diagnosis below) as well as the level of genetic distance and
morphometric difference to be a reliable indication of the dis-
tinctiveness of Ansonia sp. Usun Apau as a separate taxon in the
rank of a species in accordance with the phylogenetic species
concept (Cracraft 1992; Nixon and Wheeler 1990), the
L.E. Waser et al.
Fig. 3 Majority rule consensus tree of the BI analysis. The first value shows the Bayesian posterior probability of the node; the second value shows the
ML bootstrap support
New Bornean Ansonia
evolutionary species concept (Wiley 1978), and the unified spe-
cies concept (de Queiroz 2007).
Ansonia teneritas, sp. nov.
Holotype: NMBE 1057364, from a small stream on the
upper reaches of the Sungei Julan on the northern side of the
Usun Apau Plateau just above the falls of the Sungei Julan
Valley, Usun Apau National Park, Sarawak, East Malaysia
(Borneo). GPS N 03.03292°, E 114.66647°, 1002 m a.s.l, coll.
A. Haas, Pui Yong Min, S.T. Hertwig & A. Jankowski, 28.
August 2010. Adult male.
Paratypes: NMBE 1057318–1057327, ZRC 1.12525-
12526, from the same locality as holotype, coll. A. Haas,
Pui Yong Min, S.T. Hertwig & A. Jankowski, 27 and 28
August 2010; ZMH A11568, from Gunung Hose, Sarawak,
East Malaysia (Borneo), GPS N 02.23526°, E 113.68693°,
1104 m asl., coll. A. Haas & Y.M. Pui, 25. August 2011.
Diagnosis
The new species is assigned to the genus Ansonia on the basis
of a robustly supported phylogenetic hypothesis (Fig. 3)and
the presence of the following morphological characters: body
slender, subarticular tubercles indistinct, limbs long and slen-
der, webbing membranous, parotid glands absent, and tympa-
num visible (Inger 1960,1966).
Ansonia teneritas sp. nov. can be distinguished from all
congeners by the following combination of characters: (1)
SVL in males <22 mm, in females <25 mm; (2) snout clearly
projecting in profile; (3) head depressed; (4) longitudinal inter-
orbital ridges absent; (5) first finger short, not reaching base of
tip of second finger when adpressed; (6) no sharp tarsal ridge;
(7) skin flaps on posterior thigh near vent absent; (8) warts on
temporal regions not enlarged; (9) coloration olive-green with a
contrasting dark brown pattern on head and dorsum; (10)
whitish pattern below the eye on upper lip; (11) white warts
behind jaw joint, on shoulders and flanks; (12) iris bright red-
orange with an irregular network of black reticulations.
Description of holotype
Habitus very slender (Fig. 5); body slightly wider than head;
head depressed (Fig. 6); head shorter than it is wide; rostrum
truncate in dorsal view; tip of snout rounded, longer than
canthus, protruding in lateral view, clearly projecting beyond
tip of mandible; rostral length shorter than eye diameter; nos-
tril lateral, closer to snout tip than to eye; indistinct vertical
ridge between tip of snout and centre of maxilla; canthus
rounded; lores vertical and slightly concave; eye diameter
greater than eye-nostril distance; interorbital distance slightly
larger than the upper eyelid; tympanum round and distinct;
eye diameter 3.48 times greater than tympanic diameter; dis-
tance from eye to tympanum 0.43 mm
Fingers slender; tips slightly expanded forming small, spatu-
late discs; first finger significantly shorter than second; nuptial
pads with blackish brown spines on first finger; subarticular
Fig. 4 First and second-best morphometric ratio for the separation of aAnsonia sp. Usun Apau and Ansonia platysoma,bAnsonia sp. Usun Apau and
Ansonia minuta,andcAnsonia platysoma and Ansonia minuta
Fig. 5 Coloration in life of a female Ansonia teneritas sp. nov. from the
type locality on the Usun Apau plateau
L.E. Waser et al.
tubercles weak and indistinct, exclusively below the proximal
articulation of the first phalange, absent below distal phalanges;
palm smooth with large, distinct rounded palmar tubercles; tips
of all toes rounded; fifth toe slightly longer than third; membra-
nous web reaching disc of first toe, disc on both sides of second
toe, third toe with one and two-thirds phalanges free, fourth with
three phalanges free, fifth toe with two phalanges free of web.
Subarticular tubercles indistinct; two metatarsal tubercles, both
oval and slightly raised; tarsal fold absent.
Skin of head, dorsum, flanks, and dorsal surfaces of limbs
with scattered, isolated, flat, rounded warts of heterogeneous
size, warts on temporal and dorsolateral regions not significantly
larger (Figs. 5and 7); warts on head, dorsum, flanks, and limbs
often terminating in fine brown keratinous spines or caps; spines
below the symphysis of mandibles absent, but one row of very
small, spineless tubercles along the ventral face of the lower jaw;
skin flaps on posterior thigh near vent absent.
Colour in preservative grayish brown with a contrasting dark
gray pattern of bands and spots on head and dorsum beginning
at the eyes and running to the forehead and shoulders, forming
an x with a light spot in its center; irregular light spot below the
eye on upper lip; limbs gray brown with contrasting lighter
cross bands; venter pale yellowish white with dark mottling
on throat, chest, and belly; small, whitish tubercles present on
the pectoral region and the venter (Fig. 7).
Coloration in life olive-green with a contrasting dark brown
pattern of irregular spots and bands, often forming an x-shape
between the eyes, on forehead, and on shoulders; larger warts
on dorsum yellow to orange, whitish warts ventrolaterally on
flanks and from jaw joint to shoulder, an irregular whitish spot
below the eye on the upper lip, limbs dark brown with yellow
crossbars (Fig. 5); venter pale yellowish white with brown mot-
tling, especially on throat and chest, and interspersed with whit-
ish tubercles. Iris bright red-orange with an irregular network of
black reticulations (Fig. 5).
Variation
The extent of the dark pattern on throat, chest, and venter varies
from a few markings on the anterior part of the throat to intense
mottling on throat, chest, and belly (Fig. 7). Some specimens
possess up to three rows of very small, spineless tubercles along
the ventral face of the lower jaws, while in other specimens, such
Fig. 6 Head of holotype of Ansonia teneritas sp. nov. in lateral view
Fig. 7 Preserved type material of
Ansonia teneritas sp.nov.: a
dorsal view, eventral view of
male holotype (NMBE 1057364);
bdorsal view, fventral view of
male paratype 1 (NMBE
1057326); cdorsal view, gventral
view of female paratype 2
(NMBE 1057321); ddorsal view,
hventral view of female paratype
3 (NMBE 1057327)
New Bornean Ansonia
tubercles are lacking. There is no noticeable variation in the
described characters between the specimens from Usun Apau
National Park and the single female specimen from Gunung
Hose, Sarawak.
Sexual dimorphism
Males are smaller (SVL 19.16–21.53 mm) than females
(21.37–24.4 mm); males possess vocal sacs and nuptial pads
with numerous blackish brown spines. Females have less ex-
tensive webbing: the first toe is fully webbed, the second toe is
about one phalange free of web, the third toe about two, the
fourth about three to three and a half, and the fifth about two to
two and a half free of web.
Comparison
The following characters distinguish Ansonia teneritas sp. nov.
from its other Bornean congeners: Ansonia albomaculata Inger
1960: tympanum obscured by skin; head not depressed; sharp
tarsal ridge present; skin of body and limbs uniformly covered
with small, round warts; an oblique light band from the posterior
corner of the eye to axilla; no contrasting pattern on head, dor-
sum, or limbs (Inger 1966; Inger and Stuebing 2005). Ansonia
echinata: black spines under mandible, large ventrolateral tuber-
cles tipped with small black spines; spinose tubercles on top of
snout with black spines, no contrasting pattern on head, dorsum,
or limbs (Inger and Stuebing 2009). Ansonia fuliginea:larger
body size (males 32–36 mm, females 38–44 mm); snout vertical
in profile; head not depressed; no contrasting pattern on head,
dorsum, or limbs, blackish on sides and underside (Inger 1960,
1966; Inger and Stuebing 2005). Ansonia guibei Inger 1966:
snout vertical in profile; head not depressed; first finger long,
reaching base of second when adpressed; fourth and second
finger equal in length; membranous web reaching tips of third
and fifth toes; skin dorsally and dorsolaterally with numerous
round warts with clusters of dark spinules; oblique flap of skin
present on each side of the vent; no contrasting pattern on head,
dorsum, or limbs (Inger 1966; Inger and Stuebing 2005).
Ansonia hanitschi: larger body size (males 20–28 mm, females
28–35 mm); males with a few spinose tubercles below symphy-
sis of the mandibles; colour pattern on head, dorsum, and limbs
obscure and less contrasting (Dring 1983;Inger1966; Inger and
Stuebing 2005); Ansonia latidisca: larger body size (males
35 mm, females 55 mm); head not depressed; snout almost
vertical in profile; tips of the three outer fingers dilated into
truncate discs, that of third as wide as tympanum; forelimb very
long and slender; two rows of interorbital, conical tubercles;
different colour pattern on head and back consisting of a bright
green background with a distinct pattern of blackish brown spots
and scattered orange or red warts (Inger 1966;Matsuietal.2012
Ansonia leptopus: larger body size (males 35 mm, females
55 mm); head not depressed; first finger long, reaching disc of
second; dorsolateral warts larger, males with rows of brown
spines under mandible; no contrasting pattern on head, dorsum,
or limbs (Inger 1966; Inger and Dring 1988; Inger and Stuebing
2005). Ansonia longidigita: larger body size (males 50 mm, fe-
males 65 mm); head not depressed; first finger long, reaching tip
of disc of second; snout almost vertical in profile; a pair of
longitudinal rows of tubercles in interorbital space; males with
three to six rows of brown or black spines under mandible; no
contrasting pattern on head or dorsum (Inger 1966; Inger and
Dring 1988; Inger and Stuebing 2005;Matsuietal.2010).
Ansonia minuta: head not depressed; distinct tarsal ridge; nuptial
pads absent; third and fifth toes webbed to disc in males; more
warts on dorsal face of the head; warts on dorsum and flanks not
spinose, dark pattern on dorsum less contrasting (Inger 1960,
1966; Inger and Stuebing 2005). Ansonia platysoma:wartson
dorsum and flanks often without or with indistinct keratinous
spines or caps; nuptial pads consisting of spines with a paler
brown coloration; third toe usually webbed to disc in males; no
white pattern on upper lip; no white warts on shoulders or flanks;
colour pattern on head, dorsum, and limbs obscure and less
contrasting (Inger 1960,1966). Ansonia spinulifer: larger body
size (males 30–40, females 40–45); head not depressed; first
finger reaching tip of second when adpressed; dorsal and dorso-
lateral warts large, elevated and juxtaposed, tipped with one or
three strong melanistic spines; males with spinose tubercles un-
der mandibular symphysis and lower jaw; adults black on top
with a light spot between the shoulders but without a contrasting
pattern on head, dorsum, or limbs (Inger and Dring 1988; Inger
and Stuebing 2005). Ansonia torrentis Dring 1983: larger body
size (males 30–33 mm); head relatively wide in comparison to
body; warts on dorsum without keratinous spines; males with
spinose tubercles under mandibular symphysis and lower jaw
(Dring 1983). Ansonia vidua: larger body size (females 30–
34 mm); head not depressed; two low, curved longitudinal ridges
present on the interorbital region; skin of back, flanks and upper
surfaces of the limbs covered with numerous small, regular, flat,
rounded warts resulting in a velvet-like appearance; coloration of
head, body and limbs uniformly black-brown with no markings
(Hertwig et al. 2014).
Etymology
The species name teneritas, Latin for ‘tenderness’,refersto
the gracile body shape and small body size of this species in
comparison to congeners. We suggest the English name
‘Gracile Slender Toad’.
Ecological notes
The type locality of Ansonia teneritas sp. nov. is a small tributary
of the upper reaches of the Sungei Julan, just above the spectac-
ular falls of the Sungei Julan Valley on the northern side of the
Usun Apau plateau (Fig. 8). The Usun Apau plateau is part of the
L.E. Waser et al.
Central Bornean plateau and forms the watershed between the
Rejang and Baram river basins in central Sarawak (Hutchison
2005; Rousseau 1977). The Sungei Julan is a tributary of
the Baram drainage system. It consist of several tablelands and
smaller plateaus with an elevation of approximately 760–1000 m
with sharply cut edges, precipitous cliffs, and deep marginal
embayments (Hutchison 2005). The Usun Apau highlands were
formed by extensive volcanic activity during the Upper Miocene
to Quaternary, and the few mountains that stand over 300 m
above the tablelands are relicts of former volcanoes (Hutchison
2005). As a result of their volcanic formation history the high
tablelands of the central area are built up of dacite tuff and ag-
glomerate, while the southern mountains are covered by basalt
lava (Hutchison 2005; Campbell 1956). The area covers about
700 sq. km of forest and has been protected as the Usun Apau
National Park since 2005.
The small stream at the type locality is presumably perma-
nent and has a moderate gradient. The stream bed consists of
alternating small shallow rocky pools (20 to 50 cm depth) and
fast-running sections on bedrock (0.5 to 1.5 m in width, de-
pending on the amount of precipitation) (Fig. 8). Below the
type locality the stream flows to the Sungei Julan just below
the upper tier of the Eastern Julan falls in the steep Sungei Julan
Valley. The vegetation at the type locality is primary lower
montane forest. On the surrounding hills the forest type changes
to kerangas (Bornean heath) forest. All specimens of Ansonia
teneritas sp. nov. were collected at night from rocks or low
vegetation along the stream. Males call at night from saplings
on the stream banks or on bedrock.
Adult frogs of the following species were detected in the
immediate vicinity of the stream and the surrounding forest:
Ansonia longidigita Inger, 1960; Hylarana picturata
(Boulenger 1920); Leptobrachella mjobergi Smith, 1925;
Limnonectes cf. kuhlii (Tschudi, 1838); Limnonectes ibanorum
(Inger 1964); Meristogenys sp., Metaphrynella sundana
(Peters, 1867); Microhyla petrigena Inger and Frogner 1979;
Occidozyga laevis (Günther 1858); Philautus hosii (Boulenger
1895); Philautus macroscelis (Boulenger 1896); Philautus cf.
mjobergi Smith, 1925; Philautus tectus Dring, 1987; and
Staurois parvus Inger and Haile, 1959.
The second locality from where Ansonia teneritas is known
is the Gunung Hose, a relatively isolated, remote, and poorly
explored mountain range in central Sarawak. The Gunung
Hose range is composed of volcanic rock forming frequently
steep cliff faces (Lee, 2002). The single specimen was found
on low vegetation by a deeply entrenched small stream in a
selectively logged secondary forest near a logging road. At the
same locality adults of Ansonia longidigita Inger, 1960 and
Staurois guttatus (Günther, 1858) were found; additionally,
Rhacophorus borneensis Matsui, Shimada, and Sudin, 2013
was heard calling.
The larval stages and call of the new Ansonia remain
undocumented.
Discussion
The phylogenetic hypothesis presented here suggest that
Ansonia teneritas sp.nov.andAnsonia torrentis are members
of a robustly supported monophyletic group consisting exclu-
sively of species from Borneo: Ansonia hanitschi,Ansonia
minuta,Ansonia platysoma,Ansonia spinulifer,Ansonia vidua
and the undescribed taxa referred to as Ansonia sp. 3 and
Ansonia sp. 4 (Fig. 3). Certain phylogenetic relationships with-
in that clade, however, received moderate support values.
Especially the sister group relationship of Ansonia teneritas to
the group consisting of Ansonia torrentis,Ansonia platysoma,
Ansonia sp.5 and Ansonia vidua was only moderately support-
ed. We explain the limited support in BI and ML analyses of our
sequence data in favor of the phylogenetic position of the new
taxon as a result of analyzing only mitochondrial markers. In
subsequent studies the closest relatives of Ansonia teneritas
should be confirmed, therefore, by using additional mitochon-
drial data and, in particular, fast evolving nuclear markers.
Nevertheless we present robust genetic evidence that Ansonia
torrentis is not a close relative of Ansonia longidigita, Ansonia
leptopus,Ansonia latifii or Ansonia sp. 5 (Matsui et al. 2010,
Fig. 3). In contrast, the sample AB435296, labeled as Ansonia
torrentis by Matsui et al. (2010), clustered with Ansonia
longidigita in previous phylogenetic analyses (Hertwig et al.
2014;Matsuietal.2010)andalsointhetreepresentedhere
(Fig. 3). We assume, therefore, that sample AB435296 has been
erroneously assigned to Ansonia torrentis and must be regarded
instead as a sample belonging to Ansonia longidigita.
Fig. 8 Habitat at the type locality of Ansonia teneritas sp. nov. on the
Usun Apau plateau
New Bornean Ansonia
Within the above mentioned group Ansonia hanitschi,
Ansonia minuta,Ansonia platysoma,Ansonia teneritas and
Ansonia torrentis are genetically clearly distinct but superficially
similar in size, shape, and colour pattern, and therefore represent
so called cryptic species. The results of our integrative approach
support the taxonomic status of Ansonia teneritas as a distinct
species on the basis of a unique combination of genetic, morpho-
metric, and morphological traits. In scientific descriptions of an-
urans a considerable number of body measurements are com-
monly documented in order to distinguish between related spe-
cies. In recent taxonomic studies on Ansonia up to 30 measure-
ments were used (e.g., Boulenger 1880,1897;Gasconetal.
1996; Heyer 1984;Matsui1984; Okada 1931). Beyond the un-
disputed descriptive value of these measurements their utility in
the unequivocal diagnosis and determination of cryptic species in
Ansonia has not been demonstrated. This study therefore made
use of the approach proposed by Baur and Leuenberger (2011)to
test the discriminatory power of the morphometric measurements
traditionally used. The combination of shape PCA 1 and 2 failed
to separate the species from each other due to a significant over-
lap in morphometric ratios in both sexes, but particularly in
males. Nevertheless, we identified a set of morphometric ratios
that permitted the reliable discrimination of Ansonia minuta,
Ansonia platysoma and Ansonia teneritas from each other on
the basis of just six measurements (SVL, HD, IN, NML, FOT,
THL, Fig. 4). The contribution of HD to the separation of
Ansonia platysoma from the remaining species is in accordance
with the original description of this species by Inger (1966), who
mentioned a flattened habitus and depressed head.
The four morphometric measurements AGD, BW,
tympanum-eye distance (TED), and tympanum-mouth length
(TML) exhibited exceptionally high variance and were therefore
excluded from the final statistical analysis (see also Hayek et al.
2001). The observed variance can be explained as the result of a
combination of natural variability, preservation artifacts, and/or
measurement errors. TED and TML may additionally be influ-
enced by accuracy issues, as both are especially short distances
with one point of reference formed by the circular tympanum.
AGD and BW are particularly likely to be influenced by preser-
vation artifacts, as well as being subject to high natural variability
caused by reproductive cycle and nutritional status.
Morphometric measurements that are defined by osseous land-
marks should therefore be preferred over soft body measure-
ments in species descriptions and morphometric analyses
(Hayek et al. 2001;Lee1982). Measurement errors should only
play a minor role in our data because we used carefully adjusted
photos for each morphometric distance and a calibrated,
industry-standard system which offers much greater accuracy
than the use of hand-held calipers.
Ansonia spinulifer, which represents the sister taxon to the
closely related species of the Bornean clade described above,
is a relatively large species widespread in hilly lowland to
lower montane forests in Sarawak, Brunei, and Sabah. In
contrast, Ansonia hanitschi,Ansonia minuta,Ansonia
platysoma,Ansonia teneritas and Ansonia vidua are only
known from a few isolated spots of suitable habitat at varying
elevations and, except for the two syntopic species Ansonia
hanitschi and Ansonia torrentis on Gunung Mulu, exhibit al-
lopatric or parapatric distribution patterns the two syntopic
species Ansonia hanitschi and Ansonia torrentis on Gunung
Mulu (Fig. 1). We regard the allopatric/parapatric species as
mutual ecological replacements that have resulted from a non-
adaptive radiation on Borneo (Rundell and Price 2009). We
have to stress, however, that the phylogenetic relationships
and taxonomic status of several isolated populations within
the ranges of the described species and the undescribed taxa
have yet to be confirmed. We expect the biogeography and
evolutionary history of this monophyletic group of Bornean
Ansonia to be more complex than current knowledge may
suggest. The pronounced difference in body size between
the syntopic species Ansonia hanitschi and Ansonia torrentis
(Dring, 1983) can be explained as the result of character dis-
placement. In the case of Ansonia vidua, which is morpholog-
ically distinct from the other species of this clade in its larger
body size, skin structure and colour pattern, a lack of detailed
ecological data prevents a reliable interpretation of the evolu-
tionary history of this enigmatic taxon.
Ansonia teneritas is currently only known from elevations
above 1100 m asl in the Gunung Hose range and the Usun Apau
plateau in central Sarawak and must be regarded as being en-
demic to central Sarawak and having a disjunct, montane distri-
bution (Fig. 1). The only known localities in which Ansonia
teneritas have been found so far are small, clear streams in mon-
tane forest (Fig. 8) in the two isolated mountain ranges Usun
Apau and Gunung Hose (Fig. 1). According to data available on
other species of this genus, the adaptability of Ansonia teneritas
to disturbed habitats and its ability to survive episodes of intense
logging and resulting high siltation in the streams used for breed-
ing is probably limited. However, the single specimen from
Gunung Hose found in a disturbed forest creates the hope that
this species may be able to adapt to secondary habitats of accept-
able quality. Further studies into the ecology of Ansonia teneritas
and its close relatives are urgently needed in order to close the
gap in our knowledge of the habitat preferences, abundance,
adaptability, and distribution of this species. The high altitude
and extremely rugged topography of Usun Apau and Gunung
Hose have prevented logging activity at higher elevations in the
past. However, strict protection of montane forests to avoid deg-
radation or loss—particularly of the water bodies suitable for
reproduction—will be crucial to the long-term survival of these
endemic toads of central Sarawak. Future conservation efforts
directed toward Ansonia teneritas and the related montane
Ansonia will need to focus on enduringly preserving the highly
diverse fauna and flora of montane forests in the mountain
ranges of Sarawak and Sabah. So far, only the Usun Apau pla-
teau is protected by law as a national park.
L.E. Waser et al.
Acknowledgments The Economic Planning Unit of the Prime
Minister’s Department, Malaysia, especially Munirah Abd. Manan,
helped by issuing permission to conduct research in Malaysia. We thank
the Sarawak Forest Department and Sarawak Forestry Corporation, in
particular Nur Afiza binti Umar, Dayang Nuriza binti Abang Abdillah,
Mohamad bin Kohdi, Engkamat anak Lading, Oswald Braken Tisen,
Datu Haji Ali Yusop, and Mohd. Shabudin Sabki, for providing advice
and issuing permits. Our Usun Apau expedition benefited significantly
from Willie Kajan’s knowledge and organization. Hannes Baur is thanked
for his help with morphometric analyses, while Beatrice Blöchlinger and
Chris Sherry performed technical tasks with admirable skills. We are
particularly grateful to the Burgergemeinde Bern and Leder Fuchs,
Göppingen, for their generous support of our fieldwork. For permission
to examine material under their care, we thank Colin McCarthy (BMNH),
Alan Resetar and Robert Inger (FMNH), Margarita Naming (SBC),
Charles Leh Moi Ung (SM), David Edwards and Helen Pang (UBD),
and Peter Kee Lin Ng and Kelvin Kok Peng Lim (ZRC). PYM and ID
were supported by NRGS/1087/2013(01). Finally, we thank Lucy
Cathrow who revised the language of this manuscript and two anony-
mous reviewers whose helpful comments contributed significantly to the
improvement of this publication.
All applicable international, national, and/or institutional guidelines
for the care and use of animals were followed.
Compliance with ethical standards All applicable international, na-
tional, and/or institutional guidelines for the care and use of animals were
followed.
Appendix
Tabl e 3 Locality data, collection numbers, and GenBank accession numbers of the specimens used in the phylogenetic analysis of this study
Species Locality Voucher Genbank Author
Ansonia albomaculata East Malaysia, Sarawak, Lanjak Entimau KUHE 17377 AB435303 Matsui et al. (2010)
Ansonia albomaculata East Malaysia, Sarawak, Lanjak Entimau KUHE 17499 AB435304 Matsui et al. (2010)
Ansonia albomaculata East Malaysia, Sarawak, Lanjak Entimau KUHE 17503 AB435305 Matsui et al. (2010)
Ansonia endauensis West Malaysia, Johor, Endau-Rompin LSUHC 7726 AB435257 Matsui et al. (2010)
Ansonia fuliginea East Malaysia, Sabah, Kinabalu, Pakka BOR 22770 AB331709 Matsui et al. (2010)
Ansonia fuliginea East Malaysia, Sabah, Kinabalu, Pakka KUHE 17537 AB435308 Matsui et al. (2010)
Ansonia guibei East Malaysia, Sabah, Kinabalu, Mesilau BOR 22928 AB435306 Matsui et al. (2010)
Ansonia guibei East Malaysia, Sabah, Kinabalu, Mesilau KUHE L06B054 AB435307 Matsui et al. (2010)
Ansonia hanitschi East Malaysia, Sabah, Gunung Kinabalu NP ZMH A09248 KX259286 This study
Ansonia hanitschi East Malaysia, Sabah, Gunung Kinabalu NP ZMH A12560 KX259283 This study
Ansonia hanitschi East Malaysia, Sabah, Kinabalu Park ZMH A12559 KX259284 This study
Ansonia hanitschi East Malaysia, Sabah, Kinabalu, Silau Silau BOR 22640 AB331710 Matsui et al. (2010)
Ansonia hanitschi East Malaysia, Sabah, Kinabalu, Silau Silau BOR 22641 AB435277 Matsui et al. (2010)
Ansonia hanitschi East Malaysia, Sabah, Kinabalu, Silau Silau BOR 22642 AB435278 Matsui et al. (2010)
Ansonia inthanon Thailand, Doi Inthanon KUHE 19050 AB435253 Matsui et al. (2010)
Ansonia jeetskumarani West Malaysia, Pahang, Fraser’s Hill LSUHC 8049 AB435265 Matsui et al. (2010)
Ansonia jeetskumarani West Malaysia, Pahang, Fraser’s Hill LSUHC 8050 AB435266 Matsui et al. (2010)
Ansonia kraensis Thailand, Ranong KUHE 23517 AB435250 Matsui et al. (2010)
Ansonia kraensis Thailand, Ranong KUHE 35814 AB435251 Matsui et al. (2010)
Ansonia kraensis Thailand, Ranong KUHE 35817 AB435252 Matsui et al. (2010)
Ansonia latiffi West Malaysia, Pahang, Sg. Lembing LSUHC 4991 AB435299 Matsui et al. (2010)
Ansonia latiffi West Malaysia, Pahang, Sg. Lembing LSUHC 4992 AB435300 Matsui et al. (2010)
Ansonia latirostra West Malaysia, Pahang, Sg. Lembing LSUHC 4923 AB435260 Matsui et al. (2010)
Ansonia latirostra West Malaysia, Pahang, Sg. Lembing LSUHC 4924 AB435261 Matsui et al. (2010)
Ansonia leptopus East Malaysia, Sabah, Tawau Hills NP UNIMAS X8961 KX259316 This study
Ansonia leptopus East Malaysia, Sabah, Tawau Hills NP BOR 22139 AB435297 Matsui et al. (2010)
Ansonia leptopus East Malaysia, Sarawak, Gunung Gading NP KUHE 17109 AB435298 Matsui et al. (2010)
Ansonia leptopus East Malaysia, Sarawak, Gunung Gading NP NMBE 1059720 KX259312 This study
Ansonia leptopus East Malaysia, Sarawak, Gunung Mulu NP UNIMAS 8968 KX259289 This study
Ansonia leptopus East Malaysia, Sarawak, Kampung Sebako ZMH A12558 KX259291 This study
Ansonia leptopus East Malaysia, Sarawak, Kampung Sebako ZMH A12557 KX259290 This study
Ansonia longidigita East Malaysia, Sabah, Bundu Tuhan KUHE L04B133 AB435294 Matsui et al. (2010)
Ansonia longidigita East Malaysia, Sabah, Crocker Range NP ZMH A09370 KX259285 This study
Ansonia longidigita East Malaysia, Sabah, Crocker, Mahua BOR 12463 AB331711 Matsui et al. (2010)
New Bornean Ansonia
Tabl e 3 (continued)
Species Locality Voucher Genbank Author
Ansonia longidigita East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 12862 AB435293 Matsui et al. (2010)
Ansonia longidigita East Malaysia, Sabah, Sungai Kemantis trail UNIMAS X9043 KX259317 This study
Ansonia longidigita East Malaysia, Sarawak, Bario KUHE-12405 AB435295 Matsui et al. (2010)
Ansonia longidigita East Malaysia, Sarawak, Gunung Mulu NP NMBE 1056284 KX259280 This study
Ansonia longidigita East Malaysia, Sarawak, Pulong Tau NP NMBE 1061668 KX259308 This study
Ansonia longidigita East Malaysia, Sarawak, Usun Apau NP NMBE 1057282 KX259294 This study
Ansonia longidigita
(Ansonia torrentis)
East Malaysia, Sarawak, Gn. Mulu NP ZRC 1.11918 AB435296 Matsui et al. (2010)
Ansonia malayana West Malaysia, Larut KUHE 15467 AB331712 Matsui et al. (2010)
Ansonia malayana West Malaysia, Larut KUHE 15472 AB435264 Matsui et al. (2010)
Ansonia mcgregori Philippines, Mindanao ACD3600 AB435316 Matsui et al. (2010)
Ansonia mcgregori Philippines, Mindanao ACD3601 AB435317 Matsui et al. (2010)
Ansonia minuta East Malaysia, Sarawak, Mount Penrissen NMBE 1057517 KX259306 This study
Ansonia minuta East Malaysia, Sarawak, Mount Penrissen NMBE 1057518 KX259307 This study
Ansonia minuta East Malaysia, Sarawak, Mount Penrissen NMBE 1061561 KX259309 This study
Ansonia minuta East Malaysia, Sarawak, Kubah NP NMBE 1059724 KX259310 This study
Ansonia minuta East Malaysia, Sarawak, Kubah NP NMBE 1059725 KX259311 This study
Ansonia minuta East Malaysia, Sarawak, Kubah NP ZMH A12555 KX259293 This study
Ansonia minuta East Malaysia, Sarawak, Kubah NP UNIMAS 8862 KX259288 This study
Ansonia minuta East Malaysia, Sarawak, Kuching KUHE 12058 AB435281 Matsui et al. (2010)
Ansonia minuta East Malaysia, Sarawak, Kuching KUHE 17233 AB435282 Matsui et al. (2010)
Ansonia minuta East Malaysia, Sarawak, Kuching KUHE 17274 AB435283 Matsui et al. (2010)
Ansonia minuta East Malaysia, Sarawak, Santubong NP NMBE 1059717 KX259313 This study
Ansonia minuta East Malaysia, Sarawak, Santubong NP NMBE 1059718 KX259314 This study
Ansonia minuta East Malaysia, Sarawak, Santubong NP NMBE 1059719 KX259315 This study
Ansonia muelleri Philippines, Mindanao ACD3543 AB435309 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Davao City RMB 639 AB435310 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Davao City RMB 642 AB435311 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Davao, Mt. Apo ACD 1617 AB435312 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Davao, Mt. Apo ACD 1640 AB435313 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Mt. Hamigitan ACD 2631 AB435314 Matsui et al. (2010)
Ansonia muelleri Philippines, Mindanao, Mt. Hamigitan ACD 2702 AB435315 Matsui et al. (2010)
Ansonia penangensis West Malaysia, Penang Is. KUHE UNL AB435262 Matsui et al. (2010)
Ansonia penangensis West Malaysia, Penang Is. KUHE UNL AB435263 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Crocker Range BOR 12499 AB435267 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Crocker Range BOR 12500 AB435268 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Gunung Kinabalu NP ZMH A12556 KX259287 This study
Ansonia platysoma East Malaysia, Sabah, Kinabalu, Bundu Tuhan KUHE L04B131 AB435270 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Kinabalu, Bundu Tuhan KUHE L04B132 AB435271 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Kinabalu, Poring ZRC 1.11917 AB435272 Matsui et al. (2010)
Ansonia platysoma East Malaysia, Sabah, Kinabalu, Sayap BOR 23347 AB435269 Matsui et al. (2010)
Ansonia siamensis Thailand, Khaochong KUHE 23438 AB435255 Matsui et al. (2010)
Ansonia siamensis Thailand, Khaochong KUHE 23515 AB435256 Matsui et al. (2010)
Ansonia sp. 1 Thailand, Kanchanaburi, Pilok KUHE 35066 AB435249 Matsui et al. (2010)
Ansonia sp. 2 Thailand, Pukhet KUHE 38071 AB435254 Matsui et al. (2010)
Ansonia sp. 3 East Malaysia, Sarawak, Bario KUHE 12380 AB435273 Matsui et al. (2010)
Ansonia sp. 4 East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 08475 AB435280 Matsui et al. (2010)
Ansonia sp. 4 East Malaysia, Sarawak, Bario KUHE 12433 AB435274 Matsui et al. (2010)
Ansonia sp. 4 East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 08424 AB435279 Matsui et al. (2010)
Ansonia sp. 5 East Malaysia, Sarawak, Bario KUHE 12434 AB435275 Matsui et al. (2010)
Ansonia sp. 5 East Malaysia, Sarawak, Lanjak Entimau KUHE 17381 AB435301 Matsui et al. (2010)
Ansonia sp. 5 East Malaysia, Sarawak, Lanjak Entimau KUHE 17486 AB435302 Matsui et al. (2010)
Ansonia sp. 6 East Malaysia, Sarawak, Bario KUHE 12448 AB435276 Matsui et al. (2010)
L.E. Waser et al.
References
Arnold, G. (1957). The Usun Apau Plateau. The Geographical Journal,
123(2), 167–178.
Baur, H., & Leuenberger, C. (2011). Analysis of ratios in multivariate
morphometry. Systematic Biology, 60(6), 813–825.
Bickford, D., Lohman, D. J., Sodhi, N. S., Ng, P. K., Meier, R., Winker,
K., Ingram, K. K., & Das, I. (2006). Cryptic species as a window on
diversity and conservation. Trends in Ecology and Evolution,22(3),
148–155.
Boulenger, G. (1880). On the Palearctic and Ethiopian species Bufo.
Proceedings of the Zoological Society of London, 1880,545–574.
Boulenger, G. A. (1895). Descriptions of four new batrachians discovered
by Mr. Charles Hose in Borneo. Annals and Magazines of Natural
History, 6(16), 169–171.
Boulenger, G. A. (1896). Descriptions of new batrachians in the British
Museum. Annals and Magazines of Natural History, 17(6), 401–403.
Boulenger, G. A. (1897). The tailless batrachians of Europe. London:
Ray Society.
Boulenger, G. A. (1920). A monograph of the South Asian, Papuan,
Melanesian, and Australian frogs of the genus Rana. Records of
the Indian Museum, 20,1–226.
Tabl e 3 (continued)
Species Locality Voucher Genbank Author
Ansonia spinulifer East Malaysia, Sabah, Crocker, Ulu Kimanis KUHE L04B138 AB435286 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sabah, Crocker, Ulu Kimanis KUHE L04B139 AB435287 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 08433 AB435288 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sabah, Maliau KUHE L05B005 AB435285 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sabah, Tawau BOR 09247 AB435284 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sarawak, Gading KUHE 17182 AB435292 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sarawak, Kuching KUHE 12065 AB435289 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sarawak, Sadong River LSUHC 4046 AB435290 Matsui et al. (2010)
Ansonia spinulifer East Malaysia, Sarawak, Sadong River LSUHC 4047 AB435291 Matsui et al. (2010)
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Gunung Hose ZMH A11568 KX259292 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP ZRC 1.12526 KX259296 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057325 KX259302 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057320 KX259297 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057364 KX259305 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP ZRC 1.12525 KX259295 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057326 KX259303 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057323 KX259300 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057322 KX259299 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057327 KX259304 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057321 KX259298 This study
Ansonia teneritas sp.nov. East Malaysia, Sarawak, Usun Apau NP NMBE 1057324 KX259301 This study
Ansonia tiomanica West Malaysia, Pahang, Tioman Is. LSUHC 2616 AB435258 Matsui et al. (2010)
Ansonia tiomanica West Malaysia, Pahang, Tioman Is. LSUHC 4443 AB435259 Matsui et al. (2010)
Ansonia torrentis East Malaysia, Sarawak, Gunung Mulu NP NMBE 1056297 KX259281 This study
Ansonia torrentis East Malaysia, Sarawak, Gunung Mulu NP NMBE 1056298 KX259282 This study
Ansonia vidua East Malaysia, Sarawak, Pulong Tau NP NMBE 1066153 KJ488547 This study
Ansonia vidua East Malaysia, Sarawak, Pulong Tau NP NMBE 1061645 KJ488546 This study
Duttaphrynus melanostictus
(=Bufo melanostictus)
West Malaysia, Penang Is. KUHE 39029 AB435318 Matsui et al. (2010)
Leptophryne borbonica East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 08127 AB331716 Matsui et al. (2010)
Pelophylyne signata West Malaysia, Genting KUHE 35585 AB331720 Matsui et al. (2010)
Pelostibes hosii East Malaysia, Sabah, Tawau BOR 22088 AB331717 Matsui et al. (2010)
Sabahphrynus maculatus
(=Pedostibes maculatus)
East Malaysia, Sabah, Crocker, Ulu Kimanis BOR 08425 AB331718 Matsui et al. (2010)
Sabahphrynus maculatus
(=Ansonia anotis)
East Malaysia, Sabah, Kinabalu SP 26033 AB331708 Matsui et al. (2010)
NP national park
New Bornean Ansonia
Campbell, C. (1956). Geology of the Usun Apau area. British Borneo
Geological Survey Annual Report., 1956,86–120.
Chan, K. O., Wood, P. L., Jr., Anuar, S., Muin, M. A., Quah, E. S. H., &
Sumarli, A. X. (2014). A new species of upland Stream Toad of the
genus Ansonia Stoliczka, 1870 (Anura: Bufonidae) from northeast-
ern Peninsular Malaysia. Zootaxa, 3764(4), 427–440.
Chan, K. O., Grismer, L. L., Zachariah, A., Brown, R.M., & Abraham, R.
K. (2016). Polyphyly of Asian tree toads, genus Pedostibes Günther,
1876 (Anura: Bufonidae), and the description of a new genus from
Southeast Asia. Plos One,11(1): 1–13.
Cracraft, J. (1992). The species of the birds of paradise (Paradisaeidae):
applying the phylogenetic species concept to a complex pattern of
diversification. Cladistics, 8(1), 1–43.
de Queiroz, K. (2007). Species concepts and species delimitation.
Systematic Biology, 56(6), 879–886.
Dring, J. (1983). Some new frogs from Sarawak. Amphibia-Reptilia, 4(2),
103–115.
Dring, J. (1987). Bornean treefrogs of the genus Philautus
(Rhacophoridae). Amphibia-Reptilia, 8(1), 19–47.
Frost, D. R. (2015). Amphibian species of the world: An online reference.
Version 6.0. Electronic Database. American Museum of Natural
History, New York, USA. http://research.amnh.
org/herpetology/amphibia/index.html. Accessed 20 Jul 2015.
Gascon, C., Lougheed, S. C., & Bogart, J. P. (1996). Genetic and mor-
phological variation in Vanzolinius discodactylus: a test of the river
hypothesis of speciation. Biotropica, 28(3), 376–387.
Goebel, A. M., Donnelly, J. M., & Atz, M. E. (1999). PCR primers and
amplification methods for 125 ribosomal DNA, the control region,
cytochrome oxidase I, and cytochrome b in bufonids and other
frogs, and an overview of PCR primers which have amplified
DNA in amphibians successfully. Molecular Phylogenetics and
Evolution, 11(1), 163–199.
Günther, A. (1858). Neue Batrachier in der Sammlung des britischen
Museums. Archiv für Naturgeschichte, 24(1), 319–328.
Hayek, L.-A., Heyer, W. R., & Gascon, C. (2001). Frog morphometries: a
cautionary tale. Alytes, 18(3–4), 153–177.
Hertwig, S.T., Min, P. Y., Haas,A., & Das, I. (2014). Dressed in black. A
new Ansonia Stoliczka, 1870 (Lissamphibia: Anura: Bufonidae)
from Gunung Murud, Sarawak, East Malaysia (Borneo). Zootaxa,
3814(3), 419–431.
Heyer, W. R. (1984). Variation, systematics, and zoogeography of
Eleutherodactylus guentheri and closely related species
(Amphibia: Anura: Leptodactylidae). Smithsonian Contributions
to Zoology, 402,1–42.
Hillis, D. M., & Bull, J. J. (1993). An empirical test of bootstrapping as a
method for assessing confidence in phylogenetic analysis.
Systematic Biology, 42(2), 182–192.
Huelsenbeck, J. P., & Ronquist, F. (2001). MRBAYES: Bayesian infer-
ence of phylogenetic trees. Bioinformatics, 17(8), 754–755.
Hutchison, C. S. (2005). Geology of North-west Borneo: Sarawak,
Brunei and Sabah.Amsterdam:Elsevier.
Inger, R. F. (1960). A review of the oriental toads of the genus Ansonia
Stoliczka. Fieldiana Zoology, 39,473–503.
Inger, R. F. (1964). Two new species of frogs from Borneo. Fieldiana
Zoology, 44,151–159.
Inger, R. F. (1966). The systematics and zoogeography of the Amphibia
of Borneo. Fieldiana Zoology, 52,1–402.
Inger, R. F. (1992). Variation of apomorphic characters in stream-
dwelling tadpoles of the bufonid genus Ansonia (Amphibia:
Anura). Zoological Journal of the Linnean Society, 105,225–237.
Inger, R., & Dring, J. (1988). Taxonomic and ecological relations of
Bornean stream toads allied to Ansonia leptopus (Günther)
(Anura: Bufonidae). Malayan Nature Journal, 41(4), 461–471.
Inger, R. F., & Frogner, K. J. (1979). New species of narrow-mouth frogs
(genus Microhyla) from Borneo. Sarawak Museum Journal, 27(48),
311–322.
Inger, R. F., & Haile, N. S. (1959). Two new frogs from Sarawak.
Sarawak Museum Journal, 9(13–14), 270–276.
Inger, R. F., & Stuebing, R. B. (2005). A field guide to the frogs of Borneo
(2nd ed.). Kota Kinabalu: Natural History Publications (Borneo).
Inger, R. F., & Stuebing, R. B. (2009). New species and new records of
Bornean frogs (Amphibia: Anura). Raffles Bulletin of Zoology,
57(2), 527–535.
Katoh, K., & Standley, D. M. (2013). MAFFT multiple sequence align-
ment software version 7: improvements in performance and usabil-
ity. Molecular Biology and Evolution, 30(4), 772–780.
Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M.,
Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C.,
Thierer, T., Ashton, B., Mentjies, P., & Drummond, A. (2012).
Geneious basic: an integrated and extendable desktop software plat-
form for the organization and analysis of sequence data.
Bioinformatics, 28(12), 1647–1649.
Lanfear, R., Calcott, B., Ho, S. Y., & Guindon, S. (2012). PartitionFinder:
combined selection of partitioning schemes and substitution models
for phylogenetic analyses. Molecular Biology and Evolution, 29(6),
1695–1701.
Lee, J. C. (1982). Accuracy and precision in anuran morphometrics:
artifacts of preservation. Systematic Biology, 31(3), 266–281.
Lee, C. (2002). Nepenthes species of the Hose Mountains in Sarawak,
Borneo. Proceedings of the 4th International Carnivorous Plant
Conference, Tokyo, Japan, 2002.
Maddison, D. R., & Maddison W. P. (2005). MacClade 4: Analysis of
phylogeny and character evolution. Version 4.08a.
Matsui, M. (1984). Morphometric variation analyses and revision of the
Japanese toads (genus Bufo, Bufonidae). Contributions of the
Biology Laboratory, Kyoto University, 26(3–4), 209–428.
Matsui, M., Tominaga, A., Liu, W., Khonsue, W., Grismer, L. L., Diesmos,
A. C., Das, I., Sudin, A., Yambun, P., Yong, H., Sukumaran, J., &
Brown, R. (2010). Phylogenetic relationships of Ansonia from
Southeast Asia inferred from mitochondrial DNA sequences: system-
atic and biogeographic implications (Anura: Bufonidae). Molecular
Phylogenetics and Evolution, 54(2), 561–570.
Matsui, M., Nishikawa, K., Yeo, S. T., & Eto, K. (2012). Notes on a rare
Bornean bufonid Ansonia latidisca Inger, 1966, with special refer-
ence to its phylogenetic position. Current Herpetology,31(2), 87–
96.
Nixon, K. C., & Wheeler, Q. D. (1990). An amplification of the phylo-
genetic species concept. Cladistics, 6(3), 211–223.
Okada, Y. (1931). The tailless batrachians of the Japanese Empire.
Nishigahara: Imperial Agricultural Experiment Station.
Pattengale, N. D., Alipour, M., Bininda-Emonds, O. R. P., Moret, B. M.
E., & Stamatakis, A. (2009). How many bootstrap replicates are
necessary? Research in Computational Molecular Biology,
Proceedings, 5541,184–200.
Pauly, G. B., Hillis, D. M., & Cannatella, D. C. (2004). The history of a
Nearctic colonization: molecular phylogenetics and biogeography
of the Nearctic toads (Bufo). Evolution, 58(11), 2517–2535.
Pyron, R. A. & Wiens, J. J. (2011). A large-scale phylogeny of Amphibia
including over 2800 species, and a revised classification of extant
frogs, salamanders, and caecilians. Molecular Phylogenetics and
Evolution,61,543–583.
Rambaut, A., Suchard, M., Xie, D., & Drummond, A. (2014). Trac er
version 1.6.
Rousseau, J. (1977). The Usan Apau: development and land claims in
Central Borneo. Borneo Research Bulletin, 9(1), 30–33.
Rundell, R. J., & Price, T. D. (2009). Adaptive radiation, nonadaptive
radiation, ecological speciation and nonecological speciation.
Trends in Ecology & Evolution, 24,3
94–399.
Sabaj Pérez, M. H. (2012). Standard symbolic codes for institutional
resource collections in herpetology and ichthyology. Version 5.0.
Online reference. American Society of Ichthyologists and
L.E. Waser et al.
Herpetologists. http://www.asih.org/files/%20Col_Abbr_v3.0_
SabajPerez_23_Feb2012.pdf. Accessed 5 Apr 2015.
Schneider, C. A., Rasband, W. S., Eliceiri, K. W., Schindelin, J., Arganda-
Carreras, I., & Frise, E. (2012). NIH image to ImageJ: 25 years of
image analysis. Nature Methods, 9(7), 671–675.
Smith, M. A. (1925). Contributions to the herpetology of Borneo.
Sarawak Museum Journal, 3(11), 15–34.
Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and
post-analysis of large phylogenies. Bioinformatics, 30(9), 1312–1313.
Stoliczka, F. (1870). Observations on some Indian and Malayan
Amphibia and Reptilia. Journal of the Asiatic Society of Bengal,
39(2), 134–157.
Wiley, E. O. (1978). The evolutionary species concept reconsidered.
Systematic Biology, 27(1), 17–26.
New Bornean Ansonia
