ArticlePDF Available

Vitamin C inhibits the activation of the NLRP3 inflammasome by scavenging mitochondrial ROS

Article

Vitamin C inhibits the activation of the NLRP3 inflammasome by scavenging mitochondrial ROS

Abstract and Figures

Inflammasomes are intracellular protein complexes that mediate maturation and secretion of the pro-inflammatory cytokines IL-1β and IL-18. Inflammasomes have been connected with various diseases, therefore the regulation of inflammasome activation is important for the development of novel therapies for many inflammatory syndromes. Vitamin C is an essential nutrient and has regulatory effects on immune cells. Here we report that vitamin C has an inhibitory effect on the activation of the NLRP3 inflammasome in vitro and in vivo. Mechanistically, this inhibition is through scavenging mitochondrial ROS but not through NF-κB inhibition. Moreover, specificity tests show that the AIM2 inflammasome and the NLRC4 inflammasome can also be inhibited by vitamin C. Our results have thus identified a new inflammasome regulator and provide therapeutic potential for inflammasome-associated diseases.
Content may be subject to copyright.
Inflammasome 2016; 2: 13–19
melanoma 2; NLRC4/IPAF, NLR family, CARD domain-
containing 4; ROS, reactive oxygen species; BMDM,
bone marrow derived macrophages; i.p., intraperitoneal
injection; Vitamin C, Vc.
1 Introduction
Vitamin C, also known as L-ascorbate, is an essential
nutrient for humans and other primates that lack L-gulono-
γ-lactone oxidase, the terminal enzyme in the vitamin C
biosynthetic pathway [1]. Vitamin C is involved in multiple
vital physiological and metabolic processes. As an
antioxidant molecule, vitamin C scavenges free radicals to
protect cellular molecules from oxidative damage [2]. As
a cofactor, vitamin C is involved in collagen,carnitineand
norepinephrine biosynthesis [3-4]. Moreover, vitamin C
has anti-inflammatory effect and thus has a therapeutic
role in sepsis, a systemic inflammatory syndrome
mediated by inflammasome-dependent pyroptosis and
pro-inflammatory cytokines such as IL-1β [5-8].
The inflammasome is an intracellular multi-protein
complex which senses pathogen-associated molecular
patterns (PAMPs) or host danger-associated molecular
patters (DAMPs), and mediates the maturation and
secretion of the pro-inflammatory cytokines IL-1β and IL-18
[9-10]. A number of inflammasomes have been identified,
including the NLRP1 inflammasome which recognizes the
anthrax lethal toxin from Bacillus anthracis, the NAIP/
NLRC4 inflammasome which recognizes bacterial proteins,
the AIM2 inflammasome which recognizes bacterial and
viral DNA, as well as the NLRP3 inflammasome which
recognizes multiple PAMPs and DAMPs [11-12]. The NLRP3
inflammasome comprises three core proteins: the receptor
NLRP3, the adaptor ASC, and the effector pro-caspase-1.
NLRP3 is a member of the nucleotide-binding domain
and leucine-rich repeat containing receptor(NLR) family.
It has a C-terminal leucine rich repeat (LRR) motif
which is thought to mediate ligand binding, a central
NACHT domain which mediates oligomerization, and an
N-terminal Pyrin domain which mediates interaction with
DOI 10.1515/infl-2016-0001
Received November 10, 2015; accepted January 10, 2016
Abstract: Inflammasomes are intracellular protein
complexes that mediate maturation and secretion
of the pro-inflammatory cytokines IL-1β and IL-18.
Inflammasomes have been connected with various
diseases, therefore the regulation of inflammasome
activation is important for the development of novel
therapies for many inflammatory syndromes. Vitamin C is
an essential nutrient and has regulatory effects on immune
cells. Here we report that vitamin C has an inhibitory effect
on the activation of the NLRP3 inflammasome in vitro
and in vivo. Mechanistically, this inhibition is through
scavenging mitochondrial ROS but not through NF-κB
inhibition. Moreover, specificity tests show that the AIM2
inflammasome and the NLRC4 inflammasome can also be
inhibited by vitamin C. Our results have thus identified
a new inflammasome regulator and provide therapeutic
potential for inflammasome-associated diseases.
Keywords: Vitamin C, Inflammasome, NLRP3,
AIM2,NLRC4
Abbreviations: NLRP3, NLR (Nucleotide-binding domain
and Leucine-rich repeat containing Receptor) family,
pyrin domain-containing 3; ASC, Apoptosis-associated
speck-like protein containing a CARD; AIM2, absent in
Research Article Open Access
© 2016 Xuesong Sang, et al., published by De Gruyter Open.
This work is licensed under the Creative Commons Attribution-NonCommercial-NoDerivs 3.0 License.
Xuesong Sang#, Hongbin Wang#, Yihui Chen, Qiuhong Guo, Ailing Lu, Xiaoli Zhu,
Guangxun Meng*
Vitamin C inhibits the activation of the NLRP3
inflammasome by scavenging mitochondrial ROS
*Corresponding author Guangxun Meng, Key Laboratory of
Molecular Virology & Immunology, Institut Pasteur of Shanghai,
Shanghai Institutes for Biological Sciences, Chinese Academy of
Sciences, Shanghai, 200031, China, E-mail: gxmeng@ips.ac.cn
Xuesong Sang, Xiaoli Zhu, School of Life Sciences, Shanghai Univer-
sity, Shanghai, 200444, China
Xuesong Sang, Hongbin Wang, Yihui Chen, Qiuhong Guo, Ailing Lu,
Key Laboratory of Molecular Virology & Immunology, Institut Pasteur
of Shanghai, Shanghai Institutes for Biological Sciences, Chinese
Academy of Sciences, Shanghai, 200031, China
#These authors contributed equally to this work.
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
14 X. Sang, et al.
the adaptor protein ASC[13]. Once activated, oligomerized
NLRP3 recruits and clusters ASC, which in turn recruits
pro-caspase-1 and induces its auto-cleavage and activation
[14]. Activated caspase-1 cleaves pro-IL-1β and pro-IL-18 to
their mature forms and promotes their secretion through
GSDMD [15-16].
Although vitamin C is able to attenuate sepsis,
the molecular mechanism is not fully understood. The
generation of ROS is proposed to be one of the mechanisms
that leads to activation of the NLRP3 inflammasome, and
mitochondrial ROS production is dramatically increased
in the presence of NLRP3 inflammasome activators such
as ATP and nigericin[17]. Therefore the antioxidant effect
of Vitamin C may contribute to the regulation of NLRP3
inflammasome activation via the inhibition of ROS
production. Indeed, our current study reveals that vitamin
C inhibits the activity of the NLRP3 inflammasome and the
production of IL-in vitro and in a mouse model of septic
shock in vivo.
2 Methods
2.1 Cells
Mouse bone marrow-derived macrophages (BMDMs)
were prepared as described by Mao et al. [5]. Briefly, bone
marrow cells were flushed from the femurs and tibias of
C57BL/6 mice and cultured in IMDM medium (Gibico)
supplemented with 10% FBS and 33% L cell supernatant
(containing M-CSF) for 6 days. Mature BMDMs were
collected for experiments.
2.2 Mice
6-8 week old female C57BL/6 mice were employed
for in vivo experiments. Animals were housed under
standard conditions with 12 hour light and dark cycles. All
experimental procedures were performed in compliance
with national guidelines and were approved by the Animal
Care and Use Committeeat Institut Pasteur of Shanghai.
2.3 Experimentally induced septic shock
model
All mice were divided into 3 groups (n - 4 per group): the
vitamin C (Vc, Sigma, 11140) treatment group received i.p.
injection of Vc 200 mg/kg and LPS (sigma, L2880) 10mg/
kg at the same time [18], and received another dose of Vc
6 hours post LPS injection.The LPS group was i.p. injected
with 10 mg/kg LPS, and the control group received an
equal volume of PBS. Mice were sacrificed by cervical
dislocation after collecting blood through the venous
sinus. Blood samples from all mice (PBS, LPS, and LPS
with Vc) were collected 24 hours post LPS injection. Serum
was separated by centrifuging each sample at 3000rpm
for 10min. Serum levels of IL-1 band IL-6 were monitored
using ELISA kits obtained from eBiosciences.
2.4 ASC oligomerization detection
The methods for ASC oligomerization detection were
carried out as described by Wang et al. [19]. In brief, BMDM
cells were lysed by 1% NP40 buffer on ice. Lysates were
vortexed and centrifuged at 3,500 g at 4°C. The pellets of
spinned-lysates were washed with PBS and cross-linked
by fresh DSS (final 2 mM) at 37°C for 30 min. Cross-linked
pellets and supernatants of spinned-lysates were then
analyzed by western blot with antibodies against ASC.
2.5 Real-time PCR
Total RNA was extracted from the BMDM cells by
using TRIzol reagent (Invitrogen) and pro-IL-1β mRNA
expression was determined by quantitative real-time PCR.
Relative quantification of genes was normalized against
an endogenous control GAPDH via the formula [2–ΔCt(target
gene-GAPDH)].
The primers used were:
pro-IL-1β: 5’-CACGATGCACCTGTACGATCA-3’,
5’-GTTGCTCCATATCC TGTCCCT-3’;
GAPDH: 5’- GGTATCGTGGAAGGACTCATGAC -3’,
5’- ATGCCAGTGAGCTTCCCGTTCAGC -3’.
2.6 Cytokine ELISA and immunoblotting
Supernatants were analyzed for cytokine secretion via
ELISA kits (eBiosciences) and immunoblotting was
performed as described by Xu et al. [20]. The antibodies
used for immunoblotting were rabbit anti-mouse ASC
(SC-22514-R, Santa Cruz), rabbit anti-mouse caspase-1 (sc-
514, Santa Cruz), rabbit anti-mouse mature and pro-IL-1β
(sc-7884, Santa-Cruz), mouse anti-mouse β-actin (Sigma).
Appropriate HRP-conjugated secondary antibodies were
applied for signal detection via ECL reagent (Perkin
Elmer).
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
Vitamin C Inhibits Inflammasomes  15
2.7 Flow cytometry
Mitochondrial ROS was measured in cells by MitoSOX
(Invitrogen) staining (5 µM for 15 min at 37°C). The cells
were then stimulated with ATP for 15 min followed by
washing with warm IMDM (without FBS) 4 times. The
data were acquired with a FACSCanto II (BD Biosciences)
and analyzed with FlowJo analytical software (TreeStar)
as described by Chen et al. [21].
2.8 Florescence Microscopy
Macrophages were plated overnight on coverslips.
Mitochondrial ROS were measured in cells by MitoSOX
(Invitrogen) staining (5 µM for 15 min at 37°C). The cells
were then stimulated with ATP for 15 min. After washing
with warm IMDM (without FBS) 4 times, the cells were
stained with DAPI. The florescence analyses were
performed using a Leica TCS SP2 as described by de Zoete
et al. [21].
2.9 In vitro stimulation of macrophages
Stimulationof macrophages was performed as described
by Mao et al. [22]. Briefly, BMDMs were primed with
500 ng/ml LPS for 4 h and then washed out before
stimulation with 5 mM ATP for 30 min, or primed with
500 ng/ml LPS for 6h before stimulation with poly
(deoxyadenylic-thymidylic) acid [poly(dA:dT)] for
3.5 h. Poly(dA:dT) was transfected with Lipofectamine
2000 (Invitrogen) according to the manufacturer’s
recommendations. Salmonella typhimurium was grown
at 37°C overnight (16-18 h) in Luria-Bertani broth with
streptomycin and inoculated at 1:50 in fresh Luria-Bertani
Broth (antibiotic free), followed by another 2.5-3 h culture.
When the bacteria came into its log phase, the bacteria
were diluted in fresh IMDM medium and added to the
macrophages for infection (MOI = 10).
2.10 Statistical analysis
Data were analyzed for statistical significance by two-
tailed student’s t test. Differences in P values ≤ 0.05 were
considered statistically significant.
3 Results
3.1 Vitamin C inhibits the NLRP3
inflammasome
To test whether vitamin C could affect NLRP3
inflammasome activation, we treated mouse bone
marrow-derived macrophages (BMDMs) with increasing
concentrations of vitamin C while inducing NLRP3
inflammasome activation through LPS+ATP. The result
showed that vitamin C, dose-dependently, decreased
IL-1β secretion, indicating that the NLRP3 inflammasome
was inhibited by vitamin C (Fig. 1A). This was not due
to cytotoxic effect of vitamin C, as the cell viability test
result showed that there was no cell death induced by
vitamin C (Fig. 1B). To further confirm this point, we next
performed western blot analysis to check mature IL-
and caspase-1secretion in the cell culture supernatant, as
well as ASC oligomerization in macrophages. As shown
in figures 1C and 1D, vitamin C treatment indeed depleted
the secretion of both mature caspase-1 and IL-1β (Fig. 1C),
ASC oligomerization was also strongly inhibited (Fig.
1D). Since vitamin C has been reported to inhibit NF-κB
activation [23-24], we analysed the expression of pro-
IL-1β in vitamin C treated cells. It was found that vitamin
C could indeed slightly inhibit pro-IL-1β expression
(Fig. 1E), but this moderate inhibition could not be the
key reason behind the significant decrease of mature
caspase-1 and IL-1β secretion. Furthermore, as shown in
figure 1C, the western blot result also showed that there
was no significant inhibition of pro-IL-1β protein synthesis
by vitamin C. Taken together, these data indicate that
vitamin C exhibitsan inhibitory effect on the activation of
the NLRP3 inflammasome.
3.2 Vitamin C also inhibits AIM2 and NLRC4
inflammasomes
Next we investigated whether vitamin C has an inhibitory
effect on other inflammasomes. As shown in figures 2A
and 2B, vitamin C treatment inhibited both poly(dA:dT)
and S. typhimurium-induced IL-1β secretion from LPS
primed mouse macrophages, indicating that the AIM2
inflammasome and the NLRC4 inflammasome were also
inhibited by vitamin C. Thus, vitamin C might be targeting
the common adaptor molecule ASC, or multiple pattern
recognition receptors (PRRs) involved in the assembly of
inflammasomes.
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
16 X. Sang, et al.
Figure 1. Vitamin C inhibits NLRP3 inflammasome activation.(A) Mouse BMDMs were primed with LPS (500ng/ml) in the absence or presence
of increased concentrations of vitamin C (Vc) (1 mM and 10 mM, respectively) for 4 h, followed with a pulse of ATP (5 mM) for 30 min. IL-1β
secretion was measured via ELISA. (B) BMDMs were untreated or treated with Vc (1 mM and 10 mM) for 6 h. Supernatants were collected to
test LDH release. (C and D) Mouse BMDMs were treated as in (A), IL-1β and Caspase-1 from cell lysate or culture supernatant (Sup.) (C), as
well as ASC oligomer from cell pellets (D) were detected via western blotting. (E) Mouse BMDMs were primed with LPS (500 ng/ml) in the
absence or presence of vitamin C (10 mM) for 4 h. The mRNA level of pro-IL-1β was monitoredvia real-time PCR. Values represent the mean of
triplicate samples ± SEM. **, p < 0.01; ***, p < 0.001.
Figure 2. Vitamin C inhibits the activation of AIM2 and NLRC4 inflammasomes. (A) LPS primed (6 h) BMDMs were stimulated with poly(dA:dT)
in the absence or presence ofvitamin C (10 mM) for 3.5 h. IL-1β from cell lysate or culture supernatant (Sup.) was detected via western blot-
ting. (B) BMDMs were infected with Salmonella typhimurium in the absence or presence of Vitamin C (10 mM) for 8 h. IL-1β was detected as
in (A).
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
Vitamin C Inhibits Inflammasomes  17
3.3 Vitamin C inhibits mitochondrial ROS
production
Vitamin C scavenges reactive oxygen species (ROS) in
cells. There are several sources of intracellular ROS such
as mitochondria, NADPH oxidase and 5-lipoxygenase
[25]. It has been reported that vitamin C could inhibit
ROS generation from NADPH oxidase in endothelial cells
[26], whether vitamin C could inhibit ROS generated
from mitochondria in myeloid cells is not yet clear. As
mitochondrial ROS is necessary for NLRP3 inflammasome
activation [27], we detected mitochondrial ROS generation
after vitamin C treatment in BMDMs. Fluorescence
staining results showed that vitamin C dramatically
blocked LPS+ATP -induced mitochondrial ROS generation
(Fig. 3A and 3B). Flow cytometry analysis also showed
that mitochondrial ROS was inhibited by vitamin C (Fig.
3C and 3D). Therefore, these data indicate that vitamin
C inhibits NLRP3 inflammasome activation through
scavenging mitochondrial ROS.
3.4 Vitamin C inhibits LPS -induced IL-1β
production in vivo
Endotoxin-induced septic shock is a devastating syndrome
that causes mortality among hospitalized patients [8].
The NLRP3 inflammasome plays an important role in this
disease process [28]. Since vitamin C has a therapeutic
effect on sepsis [29], we tested the in vivo effect of vitamin
Figure 3. Vitamin C inhibits mitochondrial ROS production. (A) LPS primed (500 ng/ml, 4 h)mouse BMDMs were treated with or without Vc
(10 mM) followed by labeling of mitochondrial ROS with MitoSOX or nucleus with DAPI for 15 min and ATP treatment for 15 min, then cells
were photographed using fluorescencemicroscopy. (B) The proportion of ROS positive cells in (A) was determined through cell counting.
(C) Flow cytometric analysis of the cells treated as in (A). (D) Median fluorescence intensity (MFI) of cells in (C) was determined. Values repre-
sent the mean of triplicate samples ± SEM. *, p < 0.05; ***, p < 0.001.
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
18 X. Sang, et al.
C on inflammasome activation through a LPS -induced
mouse septic shock model. As shown in Figure 4, vitamin
C treatment decreased inflammasome-dependent IL-
production in the sera at differential time points after
LPS injection, whereas the production of inflammasome
independent IL-6 was not affected. Thus, inhibition
of inflammasome activation should be an important
mechanism for the therapeutic role of vitamin C for sepsis.
4 Discussion
In the current work, we found that vitamin C inhibited
the NLRP3 inflammasome in vitro and in vivo. Scavenging
of mitochondrial ROS by vitamin C was found to be one
mechanism for the inhibition. We observed a reduction in
ASC speck formation upon treatment with vitamin C, and
previous reports demonstrated that ASC phosphorylation
is required for inflammasome activation, therefore it is
possible that vitamin C may exert its suppressive effect
through altering the phosphorylation status of ASC [30].
This will be an interesting topic for future investigation.
Moreover, vitamin C also inhibited the activation of the
AIM2- and NLRC4- inflammasome. AIM2 inflammasome
activation requires ASC whereas the activation of the
NLRC4 inflammasome is not strictly dependent on ASC,
and there are both ASC-dependent and –independent
cases for NLRC4 -induced IL-1β secretion [31-32]. Therefore,
there should be multiple targets of vitamin C in cells
accounting for its inhibition on different inflammasomes.
However, vitamin C is unlikely targeting caspase-1 directly.
As in that case, ASC oligomerization would have been
enhanced as reported previously [5].
As an essential nutrient in human and other animal
species, vitamin C plays multiple functions in anti-
oxidative stress, anti-inflammation, improving visual
health and even anti-cancer. Importantly, continuous
uptake of vitamin C may not cause any side effect to our
bodies. This is true in our experiment in that we did not
observe any toxicity of vitamin C in vitro and in vivo. It
would be interesting to investigate the anti-inflammasome
potential of vitamin C by continuous lower-level uptake
rather than several high dose injections in future studies.
Activation of inflammasomes has been connected
with a wide spectrum of diseases. For example, over
activation of the NLRP3 inflammasome contributes to
multiple autoinflammatory diseases and metabolic
disorders such as Muckle–Wells syndrome (MWS),
familial cold autoinflammatory syndrome (FCAS), type 2
diabetes, atherosclerosis, obesity and gout [33-34]. Since
vitamin C could broadly block inflammasome activation,
it may have application potential for treatment of these
inflammasome-associated diseases in the future.
Acknowledgments: This work was supported by grants
from Natural Science Foundation of China (31370892,
31300712, 91429307, 31570895, 81560339), National Key
Basic Research Programs (2014CB541905, 2015CB554302)
and National Major Projects for Science and Technology
(2014ZX0801011B-001).
Conflict of interest: The authors have no financial
conflicts of interest.
Figure 4.Vitamin C inhibits LPS -induced IL-1β production in mice. C57BL/6 mice were intraperitoneally (i.p.) injected with or without Vc
(200mg/kg) at 0 h and 3h after injection of LPS (10mg/kg). Sera were collected at 6, 12 and 24 hours post-injection. IL-1β and IL-6 levels in
sera were measured via ELISA. Values represent the mean of triplicate samples ± SEM. *, p < 0.05.
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
Vitamin C Inhibits Inflammasomes  19
References
[1] Englard S., Seifter S., The biochemical functions of ascorbic
acid, Annual review of nutrition, 1986, 6, 365-406.
[2] Beyer R.E., The role of ascorbate in antioxidant protection
of biomembranes: interaction with vitamin E and coenzyme
Q, Journal of bioenergetics and biomembranes, 1994, 26,
349-358.
[3] Rice M.E., Ascorbate regulation and its neuroprotective role in
the brain, Trends in neurosciences, 2000, 23, 209-216.
[4] Hediger M.A., New view at C, Nature medicine, 2002, 8,
445-446.
[5] Mao K., Chen S., Chen M., Ma Y., Wang Y., Huang B., He Z.,
Zeng Y., Hu Y., Sun S., et al., Nitric oxide suppresses NLRP3
inflammasome activation and protects against LPS-induced
septic shock, Cell research, 2013, 23, 201-212.
[6] Fisher B.J., Kraskauskas D., Martin E.J., Farkas D., Puri P.,
Massey H.D., Idowu M.O., Brophy D.F., Voelkel N.F., Fowler A.A.,
3rd, et al., Attenuation of sepsis-induced organ injury in mice
by vitamin C, JPEN. Journal of parenteral and enteral nutrition,
2014, 38, 825-839.
[7] Berger M.M., Oudemans-van Straaten H.M., Vitamin C supple-
mentation in the critically ill patient, Current opinion in clinical
nutrition and metabolic care, 2015, 18, 193-201.
[8] Matsuda A., Jacob A., Wu R., Aziz M., Yang W.L., Matsutani T.,
Suzuki H., Furukawa K., Uchida E., Wang P., Novel therapeutic
targets for sepsis: regulation of exaggerated inflammatory
responses, Journal of Nippon Medical School = Nippon Ika
Daigaku zasshi, 2012, 79, 4-18.
[9] Chen M., Wang H., Chen W., Meng G., Regulation of adaptive
immunity by the NLRP3 inflammasome, Int Immunopharmacol,
2011, 11, 549-554.
[10] Schroder K., Tschopp J., The inflammasomes, Cell, 2010, 140,
821-832.
[11] Davis B.K., Wen H., Ting J.P., The inflammasome NLRs in
immunity, inflammation, and associated diseases, Annual
review of immunology, 2011, 29, 707-735.
[12] de Zoete M.R., Palm N.W., Zhu S., Flavell R.A., Inflammasomes,
Cold Spring Harbor perspectives in biology, 2014,
[13] Franchi L., Munoz-Planillo R., Nunez G., Sensing and reacting
to microbes through the inflammasomes, Nature immunology,
2012, 13, 325-332.
[14] Lu A., Magupalli V.G., Ruan J., Yin Q., Atianand M.K., Vos M.R.,
Schroder G.F., Fitzgerald K.A., Wu H., Egelman E.H., Unified
polymerization mechanism for the assembly of ASC-dependent
inflammasomes, Cell, 2014, 156, 1193-1206.
[15] Shi J., Zhao Y., Wang K., Shi X., Wang Y., Huang H., Zhuang Y.,
Cai T., Wang F., Shao F., Cleavage of GSDMD by inflammatory
caspases determines pyroptotic cell death, Nature, 2015,
[16] Kayagaki N., Stowe I.B., Lee B.L., O’Rourke K., Anderson K.,
Warming S., Cuellar T., Haley B., Roose-Girma M., Phung Q.T.,
et al., Caspase-11 cleaves gasdermin D for non-canonical
inflammasome signaling, Nature, 2015,
[17] Dan Dunn J., Alvarez L.A., Zhang X., Soldati T., Reactive oxygen
species and mitochondria: A nexus of cellular homeostasis,
Redox Biol, 2015, 6, 472-485.
[18] Mohammed B.M., Fisher B.J., Huynh Q.K., Wijesinghe D.S.,
Chalfant C.E., Brophy D.F., Fowler A.A., 3rd, Natarajan
R., Resolution of sterile inflammation: role for vitamin C,
Mediators of inflammation, 2014, 2014, 173403.
[19] Wang H., Lei X., Xiao X., Yang C., Lu W., Huang Z., Leng Q.,
Jin Q., He B., Meng G., et al., Reciprocal Regulation between
Enterovirus 71 and the NLRP3 Inflammasome, Cell reports,
2015, 12, 42-48.
[20] Xu Y., Li H., Chen W., Yao X., Xing Y., Wang X., Zhong J., Meng
G., Mycoplasma hyorhinis activates the NLRP3 inflammasome
and promotes migration and invasion of gastric cancer cells,
PloS one, 2013, 8, e77955.
[21] Chen M., Xing Y., Lu A., Fang W., Sun B., Chen C., Liao W.,
Meng G., Internalized Cryptococcus neoformans Activates the
Canonical Caspase-1 and the Noncanonical Caspase-8 Inflam-
masomes, J Immunol, 2015,
[22] Mao K., Chen S., Wang Y., Zeng Y., Ma Y., Hu Y., Zhang H., Sun
S., Wu X., Meng G., et al., beta-arrestin1 is critical for the full
activation of NLRP3 and NLRC4 inflammasomes, Journal of
immunology, 2015, 194, 1867-1873.
[23] Bowie A.G., O’Neill L.A., Vitamin C inhibits NF-kappa B
activation by TNF via the activation of p38 mitogen-activated
protein kinase, Journal of immunology, 2000, 165, 7180-7188.
[24] Huang Y.N., Lai C.C., Chiu C.T., Lin J.J., Wang J.Y., L-ascorbate
attenuates the endotoxin-induced production of inflammatory
mediators by inhibiting MAPK activation and NF-kappaB
translocation in cortical neurons/glia Cocultures, PloS one,
2014, 9, e97276.
[25] Novo E., Parola M., Redox mechanisms in hepatic chronic
wound healing and fibrogenesis, Fibrogenesis & tissue repair,
2008, 1, 5.
[26] Wu F., Schuster D.P., Tyml K., Wilson J.X., Ascorbate inhibits
NADPH oxidase subunit p47phox expression in microvascular
endothelial cells, Free radical biology & medicine, 2007, 42,
124-131.
[27] Zhou R., Yazdi A.S., Menu P., Tschopp J., A role for mitochondria
in NLRP3 inflammasome activation, Nature, 2011, 469, 221-225.
[28] Deutschman C.S., Tracey K.J., Sepsis: current dogma and new
perspectives, Immunity, 2014, 40, 463-475.
[29] Wilson J.X., Wu F., Vitamin C in sepsis, Sub-cellular
biochemistry, 2012, 56, 67-83.
[30] Hara H., Tsuchiya K., Kawamura I., Fang R., Hernandez-Cuellar
E., Shen Y., Mizuguchi J., Schweighoffer E., Tybulewicz V.,
Mitsuyama M., Phosphorylation of the adaptor ASC acts as
a molecular switch that controls the formation of speck-like
aggregates and inflammasome activity, Nature immunology,
2013, 14, 1247-1255.
[31] Case C.L., Shin S., Roy C.R., Asc and Ipaf Inflammasomes
direct distinct pathways for caspase-1 activation in response
to Legionella pneumophila, Infection and immunity, 2009, 77,
1981-1991.
[32] Broz P., von Moltke J., Jones J.W., Vance R.E., Monack D.M.,
Differential requirement for Caspase-1 autoproteolysis in
pathogen-induced cell death and cytokine processing, Cell host
& microbe, 2010, 8, 471-483.
[33] Wen H., Ting J.P., O’Neill L.A., A role for the NLRP3
inflammasome in metabolic diseases--did Warburg miss
inflammation?, Nature immunology, 2012, 13, 352-357.
[34] Masters S.L., Simon A., Aksentijevich I., Kastner D.L., Horror
autoinflammaticus: the molecular pathophysiology of autoin-
flammatory disease (*), Annual review of immunology, 2009,
27, 621-668.
- 10.1515/infl-2016-0001
Downloaded from PubFactory at 08/02/2016 04:40:26PM
via free access
... The pre-operative and post-operative sperm count and motility are compared, and results show an increment in these specific semen parameters in the group undergoing VitE supplementation [88]. Another study investigates the specific role of vitamin C (VitC) in VC patients after surgery [89]. A total of 115 patients with abnormal semen analysis are recruited. ...
... These vitamins, acting as free radical scavengers, also contribute to immune defense, by modulating inflammatory genes and the inflammasome complexes. Indeed, in a 2016 study, researchers show the inhibitory potential of VitC on NLRP3 inflammasome and IL-1β activation through scavenging of mitochondrial ROS, in vitro, and in a septic shock murine model [89]. Mouse bone marrow-derived macrophages (BMDMs) are treated with different concentrations of lipopolysaccharide (LPS) + ATP to induce NLRP3 inflammasome activation. ...
... Different concentrations of VitC are tested on the BMDMs and the inhibitory effect on NLRP3 inflammasome activation analyzed. Result show a decrease in IL-1β secretion in a dose-dependent manner, indicating that the NLRP3 inflammasome activation is inhibited by VitC [89]. ...
Article
Full-text available
Varicocele (VC) is the most common abnormality identified in men evaluated for hypofertility. Increased levels of reactive oxygen species (ROS) and reduced antioxidants concentrations are key contributors in varicocele-mediated hypofertility. Moreover, inflammation and alterations in testicular immunity negatively impact male fertility. In particular, NLRP3 inflammasome activation was hypothesized to lead to seminal inflammation, in which the levels of specific cytokines, such as IL-1β and IL-18, are overexpressed. In this review, we described the role played by oxidative stress (OS), inflammation, and NLRP3 inflammasome activation in VC disease. The consequences of ROS overproduction in testis, including inflammation, lipid peroxidation, mitochondrial dysfunction, chromatin damage, and sperm DNA fragmentation, leading to abnormal testicular function and failed spermatogenesis, were highlighted. Finally, we described some therapeutic antioxidant strategies, with recognized beneficial effects in counteracting OS and inflammation in testes, as possible therapeutic drugs against varicocele-mediated hypofertility.
... Vitamin C dampens the NLRP3 pathway indirectly by reducing oxidative stress and, thus, has the potential to mitigate tissue damage. [9] ...
... The initial immune response is important in eliminating the virus. [9] However, once the infection is established, further immune response leads to tissue damage. Antiviral drug (remdesivir), hydroxychloroquine and IFN therapy can be considered early in the disease, whereas immunomodulatory therapy should be considered in the hyper-inflammatory phase. ...
Article
Many countries in the world are affected by severe acute respiratory syndrome (SARS) coronavirus-2 (SARS-CoV-2) disease-2019 (COVID-19) pandemic. Approximately 80% of the cases are mild symptomatic, 15% are severe and approximately 5% are critically ill. The mortality among severe and critically ill patients ranges from 17% to 78%. Elderly and patients with comorbidities have higher chances of progression to severe disease and subsequent mortality. There are no proven antiviral agents available for the management of COVID-19. Besides the viral cytopathic effects, dysregulation in immunity also contributes substantially to the pathogenesis. Treatment with immunomodulatory agents such as interleukin-6 blockers, glucocorticoids and mesenchymal stem cell therapy has been observed to be potentially beneficial. In this review, the immune response in SARS-CoV-2, the mechanism of immune dysregulation as well as potential therapeutic targets for immunomodulatory therapies are discussed.
... AA is also a co-factor for the production of endogenous catecholamines and corticosteroid synthesis [57][58][59][60][61][62][63][64][65][66][67][68][69][70]. Given that humans, due to an evolutionary mutation, are almost unique among all mammals in their inability to synthesize AA, in states of stress plasma AA levels are rapidly and markedly decreased as opposed to other mammals such as goats that immediately begin to produce many grams of AA in stressed or infected states [57,71,72]. ...
Article
Full-text available
In December 2019, coronavirus disease 2019 (COVID-19), a severe respiratory illness caused by the new coronavirus severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) emerged in Wuhan, China. The greatest impact that COVID-19 had was on intensive care units (ICUs), given that approximately 20% of hospitalized cases developed acute respiratory failure (ARF) requiring ICU admission. Based on the assumption that COVID-19 represented a viral pneumonia and no anti-coronaviral therapy existed, nearly all national and international health care societies recommended "supportive care only" avoiding other therapies outside of randomized controlled trials, with a specific prohibition against the use of corticosteroids in treatment. However, early studies of COVID-19-associated ARF reported inexplicably high mortality rates, with frequent prolonged durations of mechanical ventilation (MV), even from centers expert in such supportive care strategies. These reports led the authors to form a clinical expert panel called the Front-Line COVID-19 Critical Care Alliance (www.flccc.net). The panel collaboratively reviewed the emerging clinical, radiographic, and pathological reports of COVID-19 while initiating multiple discussions among a wide clinical network of front-line clinical ICU experts from initial outbreak areas in China, Italy, and New York. Based on the shared early impressions of "what was working and what wasn't working", the increasing medical journal publications and the rapidly accumulating personal clinical experiences with COVID-19 patients, a treatment protocol was created for the hospitalized patients based on the core therapies of methylprednisolone, ascorbic acid, thiamine, heparin and non-antiviral co-interventions (MATH+). This manuscript reviews the scientific and clinical rationale behind MATH+ based on published in-vitro, pre-clinical, and clinical data in support of each medicine, with a special emphasis of studies supporting their use in the treatment of patients with viral syndromes and COVID-19 specifically.
... However, the aberrant activation of the NLRP3 inflammasome leads to pathological inflammatory disorders, including AD, PD, atherosclerosis, arthritis, and cancer [3,4,33]. Recently, the existence of inflammasomes in non-mammalian species including zebrafish have been identified [34]. Previous studies of Li et al. [35] suggested that the overall structural architecture of NLRP3 inflammasome in zebrafish is shared with mammalian NLRP3s, which enables the activation of classical inflammasome complex assembly to cleave the IL-1β through caspase-1 activation. ...
Article
Full-text available
Fisetin has numerous therapeutic properties, such as anti-inflammatory, antioxidative, and anticancer effects. However, the mechanism by which fisetin inhibits NLRP3 inflammasome remains unclear. In this study, we observed that fisetin bound to TLR4 and occluded the hydrophobic pocket of MD2, which in turn inhibited the binding of LPS to the TLR4/MD2 complex. This prevented the initiation of scaffold formation by the inhibition of MyD88/IRAK4 and subsequently downregulated the NF-κB signaling pathway. The result also demonstrated that fisetin downregu-lated the activation of the NLRP3 inflammasome induced by LPS and ATP (LPS/ATP) and the subsequent maturation of IL-1β. Fisetin also activated mitophagy and prevented the accumulation of damaged mitochondria and the excessive production of mitochondrial reactive oxygen species. The transient knockdown of p62 reversed the inhibitory activity of fisetin on the LPS/ATP-induced formation of the NLRP3 inflammasome. This indicated that fisetin induces p62-mediated mitophagy for eliminating damaged mitochondria. Recently, the existence of inflammasomes in non-mammalian species including zebrafish have been identified. Treatment of an LPS/ATP-stimulated zebrafish model with fisetin aided the recovery of the impaired heart rate, decreased the recruitment of macrophage to the brain, and gradually downregulated the expression of inflammasome-related genes. These results indicated that fisetin inhibited the TLR4/MD2-mediated activation of NLRP3 inflammasome by eliminating damaged mitochondria in a p62-dependent manner.
... Resveratrol and omega-3 fatty acids are known to inhibit NF-κB translocation to the nucleus and diminish inflammasome activation due to the prevention of its priming [32,48]. On the other hand, resveratrol and vitamin C have been shown to reduce ROS production and NLRP3 inflammasome activity in mouse lung tissue and macrophages, respectively [32,49]. The absence of copper has been shown to suppress NLRP3 inflammasome activation in macrophages [50]. ...
Article
Full-text available
Age-related macular degeneration (AMD) is an eye disease in which retinal pigment epithelium (RPE) cells play a crucial role in maintaining retinal homeostasis and photoreceptors’ functionality. During disease progression, there is increased inflammation with nucleotide-binding domain, leucine-rich repeat, and Pyrin domain 3 (NLRP3) inflammasome activation, oxidative stress, and impaired autophagy in RPE cells. Previously, we have shown that the dietary supplement Resvega reduces reactive oxygen species (ROS) production and induces autophagy in RPE cells. Here, we investigated the ability of Resvega to prevent NLRP3 inflammasome activation with impaired protein clearance in human RPE cells. Cell viability was measured using the lactate dehydrogenase (LDH) and the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays. Enzyme-linked immunosorbent assays (ELISA) were utilized to determine the secretion of cytokines, NLRP3, and vascular endothelial growth factor (VEGF). Caspase-1 activity was measured with a fluorescent labeled inhibitor of caspase-1 (FLICA; FAM-YVAD-FMK) and detected microscopically. Resvega improved the cell membrane integrity, which was evident as reduced LDH leakage from cells. In addition, the caspase-1 activity and NLRP3 release were reduced, as was the secretion of two inflammatory cytokines, interleukin (IL)-1β and IL-8, in IL-1α-primed ARPE-19 cells. According to our results, Resvega can potentially reduce NLRP3 inflammasome-mediated inflammation in RPE cells with impaired protein clearance.
... Moreover, vitamin C has an anti-inflammatory effect and thus has a therapeutic role in sepsis, a systemic inflammatory syndrome mediated by inflammasome-dependent pyroptosis and pro-inflammatory cytokines such as IL-1β [28]. This may give additional benefits to protect against viral infection. ...
Article
Full-text available
Introduction COVID-19 disease progresses through a number of distinct phases. The management of each phase is unique and specific. The pulmonary phase of COVID-19 is characterized by an organizing pneumonia with profound immune dysregulation, activation of clotting, and a severe microvascular injury culminating in severe hypoxemia. The core treatment strategy to manage the pulmonary phase includes the combination of methylprednisolone, ascorbic acid, thiamine, and heparin (MATH+ protocol). The rationale for the MATH+ protocol is reviewed in this paper. Areas covered We provide an overview on the pathophysiological changes occurring in patients with COVID-19 respiratory failure and a treatment strategy to reverse these changes thereby preventing progressive lung injury and death. Expert opinion While there is no single ‘Silver Bullet’ to cure COVID-19, we believe that the severely disturbed pathological processes leading to respiratory failure in patients with COVID-19 organizing pneumonia will respond to the combination of Methylprednisone, Ascorbic acid, Thiamine, and full anticoagulation with Heparin (MATH+ protocol).We believe that it is no longer ethically acceptable to limit management to ‘supportive care’ alone, in the face of effective, safe, and inexpensive medications that can effectively treat this disease and thereby reduce the risk of complications and death.
Article
Antioxidant metabolites contribute to alleviating oxidative stress caused by reactive oxygen species (ROS) in microorganisms. We utilized oxidative stressors such as hydrogen peroxide supplementation to increase the yield of the bioactive secondary metabolite antioxidant antrodin C in submerged fermentations of the medicinal mushroom Antrodia cinnamomea. Changes in the superoxide dismutase and catalase activities of the cells indicate that ROS are critical to promote antrodin C biosynthesis, while the ROS production inhibitor diphenyleneiodonium cancels the productivity-enhancing effects of H2O2. Transcriptomic analysis suggests that key enzymes in the mitochondrial electron transport chain are repressed during oxidative stress, leading to ROS accumulation and triggering the biosynthesis of antioxidants such as antrodin C. Accordingly, rotenone, an inhibitor of the electron transport chain complex I, mimics the antrodin C productivity-enhancing effects of H2O2. Delineating the steps connecting oxidative stress with increased antrodin C biosynthesis will facilitate the fine-tuning of strategies for rational fermentation process improvement.
Article
Full-text available
Cryptococcus neoformans is an opportunistic fungal pathogen that causes cryptococccosis in immunocompromised patients as well as immunocompetent individuals. Host cell surface receptors that recognize C. neoformans have been widely studied. However, intracellular sensing of this pathogen is still poorly understood. Our previous studies have demonstrated that both biofilm and acapsular mutant of C. neoformans are able to activate the NOD-like receptor family, pyrin domain-containing 3 (NLRP3) inflammasome. In the current study, it was found that opsonization-mediated internalization of encapsulated C. neoformans also activated the canonical NLRP3-apoptosis-associated speck-like protein containing a CARD (ASC)-caspase-1 inflammasome. In addition, the internalized C. neoformans activated the noncanonical NLRP3-ASC-caspase-8 inflammasome as well, which resulted in robust IL-1β secretion and cell death from caspase-1-deficient primary dendritic cells. Interestingly, we found that caspase-1 was inhibitory for the activation of caspase-8 in dendritic cells upon C. neorformans challenge. Further mechanistic studies showed that both phagolysosome membrane permeabilization and potassium efflux were responsible for C. neoformans-induced activation of either the canonical NLRP3-ASC-caspase-1 inflammasome or the noncanonical NLRP3-ASC-caspase-8 inflammasome. Moreover, challenge with zymosan also led to the activation of the noncanonical NLRP3-ASC-caspase-8 inflammasome in cells absent for caspase-1. Collectively, these findings uncover a number of novel signaling pathways for the innate immune response of host cells to C. neoformans infection and suggest that manipulating NLRP3 signaling may help to control fungal challenge.
Article
Full-text available
Reactive oxygen species (ROS) are integral components of multiple cellular pathways even though excessive or inappropriately localized ROS damage cells. ROS function as anti-microbial effector molecules and as signaling molecules that regulate such processes as NF-kB transcriptional activity, the production of DNA-based neutrophil extracellular traps (NETs), and autophagy. The main sources of cellular ROS are mitochondria and NADPH oxidases (NOXs). In contrast to NOX-generated ROS, ROS produced in the mitochondria (mtROS) were initially considered to be unwanted by-products of oxidative metabolism. Increasing evidence indicates that mtROS have been incorporated into signaling pathways including those regulating immune responses and autophagy. As metabolic hubs, mitochondria facilitate crosstalk between the metabolic state of the cell with these pathways. Mitochondria and ROS are thus a nexus of multiple pathways that determine the response of cells to disruptions in cellular homeostasis such as infection, sterile damage, and metabolic imbalance. In this review, we discuss the roles of mitochondria in the generation of ROS-derived anti-microbial effectors, the interplay of mitochondria and ROS with autophagy and the formation of DNA extracellular traps, and activation of the NLRP3 inflammasome by ROS and mitochondria.
Article
Full-text available
Inflammatory caspases (caspase-1, -4, -5 and -11) are critical for innate defences. Caspase-1 is activated by ligands of various canonical inflammasomes, and caspase-4, -5 and -11 directly recognize bacterial lipopolysaccharide, both of which trigger pyroptosis. Despite the crucial role in immunity and endotoxic shock, the mechanism for pyroptosis induction by inflammatory caspases is unknown. Here we identify gasdermin D (Gsdmd) by genome-wide clustered regularly interspaced palindromic repeat (CRISPR)-Cas9 nuclease screens of caspase-11- and caspase-1-mediated pyroptosis in mouse bone marrow macrophages. GSDMD-deficient cells resisted the induction of pyroptosis by cytosolic lipopolysaccharide and known canonical inflammasome ligands. Interleukin-1β release was also diminished in Gsdmd(-/-) cells, despite intact processing by caspase-1. Caspase-1 and caspase-4/5/11 specifically cleaved the linker between the amino-terminal gasdermin-N and carboxy-terminal gasdermin-C domains in GSDMD, which was required and sufficient for pyroptosis. The cleavage released the intramolecular inhibition on the gasdermin-N domain that showed intrinsic pyroptosis-inducing activity. Other gasdermin family members were not cleaved by inflammatory caspases but shared the autoinhibition; gain-of-function mutations in Gsdma3 that cause alopecia and skin defects disrupted the autoinhibition, allowing its gasdermin-N domain to trigger pyroptosis. These findings offer insight into inflammasome-mediated immunity/diseases and also change our understanding of pyroptosis and programmed necrosis.
Article
Full-text available
Intracellular lipopolysaccharide from Gram-negative bacteria including Escherichia coli, Salmonella typhimurium, Shigella flexneri and Burkholderia thailandensis activates mouse caspase-11, causing pyroptotic cell death, interleukin-1β processing, and lethal septic shock. How caspase-11 executes these downstream signalling events is largely unknown. Here we show that gasdermin D is essential for caspase-11-dependent pyroptosis and interleukin-1β maturation. A forward genetic screen with ethyl-N-nitrosourea-mutagenized mice links Gsdmd to the intracellular lipopolysaccharide response. Macrophages from Gsdmd(-/-) mice generated by gene targeting also exhibit defective pyroptosis and interleukin-1β secretion induced by cytoplasmic lipopolysaccharide or Gram-negative bacteria. In addition, Gsdmd(-/-) mice are protected from a lethal dose of lipopolysaccharide. Mechanistically, caspase-11 cleaves gasdermin D, and the resulting amino-terminal fragment promotes both pyroptosis and NLRP3-dependent activation of caspase-1 in a cell-intrinsic manner. Our data identify gasdermin D as a critical target of caspase-11 and a key mediator of the host response against Gram-negative bacteria.
Article
Full-text available
Introduction: Macrophage reprogramming is vital for resolution of acute inflammation. Parenteral vitamin C (VitC) attenuates proinflammatory states in murine and human sepsis. However information about the mechanism by which VitC regulates resolution of inflammation is limited. Methods: To examine whether physiological levels of VitC modulate resolution of inflammation, we used transgenic mice lacking L-gulono-γ-lactone oxidase. VitC sufficient/deficient mice were subjected to a thioglycollate-elicited peritonitis model of sterile inflammation. Some VitC deficient mice received daily parenteral VitC (200 mg/kg) for 3 or 5 days following thioglycollate infusion. Peritoneal macrophages harvested on day 3 or day 5 were examined for intracellular VitC levels, pro- and anti-inflammatory protein and lipid mediators, mitochondrial function, and response to lipopolysaccharide (LPS). The THP-1 cell line was used to determine the modulatory activities of VitC in activated human macrophages. Results: VitC deficiency significantly delayed resolution of inflammation and generated an exaggerated proinflammatory response to in vitro LPS stimulation. VitC sufficiency and in vivo VitC supplementation restored macrophage phenotype and function in VitC deficient mice. VitC loading of THP-1 macrophages attenuated LPS-induced proinflammatory responses. Conclusion: VitC sufficiency favorably modulates macrophage function. In vivo or in vitro VitC supplementation restores macrophage phenotype and function leading to timely resolution of inflammation.
Article
Full-text available
In response to acute insults to the central nervous system, such as pathogen invasion or neuronal injuries, glial cells become activated and secrete inflammatory mediators such as nitric oxide (NO), cytokines, and chemokines. This neuroinflammation plays a crucial role in the pathophysiology of chronic neurodegenerative diseases. Endogenous ascorbate levels are significantly decreased among patients with septic encephalopathy. Using the bacterial endotoxin lipopolysaccharide (LPS) to induce neuroinflammation in primary neuron/glia cocultures, we investigated how L-ascorbate (vitamin C; Vit. C) affected neuroinflammation. LPS (100 ng/ml) induced the expression of inducible NO synthase (iNOS) and the production of NO, interleukin (IL)-6, and macrophage inflammatory protein-2 (MIP-2/CXCL2) in a time-dependent manner; however, cotreatment with Vit. C (5 or 10 mM) attenuated the LPS-induced iNOS expression and production of NO, IL-6, and MIP-2 production. The morphological features revealed after immunocytochemical staining confirmed that Vit. C suppressed LPS-induced astrocytic and microglial activation. Because Vit. C can be transported into neurons and glia via the sodium-dependent Vit. C transporter-2, we examined how Vit. C affected LPS-activated intracellular signaling in neuron/glia cocultures. The results indicated the increased activation (caused by phosphorylation) of mitogen-activated protein kinases (MAPKs), such as p38 at 30 min and extracellular signal-regulated kinases (ERKs) at 180 min after LPS treatment. The inhibition of p38 and ERK MAPK suppressed the LPS-induced production of inflammatory mediators. Vit. C also inhibited the LPS-induced activation of p38 and ERK. Combined treatments of Vit. C and the inhibitors of p38 and ERK yielded no additional inhibition compared with using the inhibitors alone, suggesting that Vit. C functions through the same signaling pathway (i.e., MAPK) as these inhibitors. Vit. C also reduced LPS-induced IκB-α degradation and NF-κB translocation. Thus, Vit. C suppressed the LPS-stimulated production of inflammatory mediators in neuron/glia cocultures by inhibiting the MAPK and NF-κB signaling pathways.
Article
Inflammasomes are multiprotein complexes that trigger the activation of caspase-1 and the maturation of IL-1β, which are critical for inflammation and control of pathogen infection. Although the function of inflammasomes in immune response and disease development is well studied, the molecular mechanism by which inflammasomes are activated and assembled remains largely unknown. In this study, we found that β-arrestin1, a key regulator of the G protein-coupled receptor signaling pathway, was required for nucleotide-binding domain and leucine-rich repeat containing (NLR) family pyrin domain-containing 3 (NLRP3) and NLR family CARD domain-containing protein 4 (NLRC4) inflammasome-mediated IL-1β production and caspase-1 activation, but it had no effect on absent in melanoma 2 (AIM2) inflammasome activation. Moreover, apoptosis-associated speck-like protein containing a CARD (ASC) pyroptosome, which is ASC aggregation mediating caspase-1 activation, was also impaired in β-arrestin1-deficient macrophages upon NLRP3 or NLRC4, but not AIM2 inflammasome activation. Mechanistic study revealed that β-arrestin1 specifically interacted with NLRP3 and NLRC4 and promoted their self-oligomerization. In vivo, in a monosodium urate crystal (MSU)-induced NLRP3-dependent peritonitis model, MSU-induced IL-1β production and neutrophil flux were significantly reduced in β-arrestin1 knockout mice. Additionally, β-arrestin1 deficiency rescued the weight loss of mice upon log-phase Salmonella typhimurium infection, with less IL-1β production. Taken together, our results indicate that β-arrestin1 plays a critical role in the assembly and activation of two major canonical inflammasomes, and it may provide a new therapeutic target for inflammatory diseases. Copyright © 2015 by The American Association of Immunologists, Inc.
Article
Vitamin C is not only an essential nutrient involved in many anabolic pathways, but also an important player of the endogenous antioxidant defense. Low plasma levels are very common in critical care patients and may reflect severe deficiency states. Vitamin C scavenges reactive oxygen species such as superoxide and peroxynitrite in plasma and cells (preventing damage to proteins, lipids and DNA), prevents occludin dephosphorylation and loosening of the tight junctions. Ascorbate improves microcirculatory flow impairment by inhibiting tumor-necrosis-factor-induced intracellular adhesion molecule expression, which triggers leukocyte stickiness and slugging. Clinical trials in sepsis, trauma and major burns testing high-dose vitamin C show clinical benefit. Restoration of normal plasma levels in inflammatory patients requires the administration of 3 g/day for several days, which is 30 times the daily recommended dose. The recent research on the modulation of oxidative stress and endothelial protection offer interesting therapeutic perspectives, based on the biochemical evidence, with limited or even absent side-effects.
Article
Sepsis, a clinical syndrome occurring in patients following infection or injury, is a leading cause of morbidity and mortality worldwide. Current immunological mechanisms do not explain the basis of cellular dysfunction and organ failure, the ultimate cause of death. Here we review current dogma and argue that it is time to delineate novel immunometabolic and neurophysiological mechanisms underlying the altered cellular bioenergetics and failure of epithelial and endothelial barriers that produce organ dysfunction and death. These mechanisms might hold the key to future therapeutic strategies.
Article
Inflammasomes elicit host defense inside cells by activating caspase-1 for cytokine maturation and cell death. AIM2 and NLRP3 are representative sensor proteins in two major families of inflammasomes. The adaptor protein ASC bridges the sensor proteins and caspase-1 to form ternary inflammasome complexes, achieved through pyrin domain (PYD) interactions between sensors and ASC and through caspase activation and recruitment domain (CARD) interactions between ASC and caspase-1. We found that PYD and CARD both form filaments. Activated AIM2 and NLRP3 nucleate PYD filaments of ASC, which, in turn, cluster the CARD of ASC. ASC thus nucleates CARD filaments of caspase-1, leading to proximity-induced activation. Endogenous NLRP3 inflammasome is also filamentous. The cryoelectron microscopy structure of ASCPYD filament at near-atomic resolution provides a template for homo- and hetero-PYD/PYD associations, as confirmed by structure-guided mutagenesis. We propose that ASC-dependent inflammasomes in both families share a unified assembly mechanism that involves two successive steps of nucleation-induced polymerization. PaperFlick eyJraWQiOiI4ZjUxYWNhY2IzYjhiNjNlNzFlYmIzYWFmYTU5NmZmYyIsImFsZyI6IlJTMjU2In0.eyJzdWIiOiIxYjAyNDc5OThlNDg4YzhkNzA5NmI5NGEwNjQwM2Q3NCIsImtpZCI6IjhmNTFhY2FjYjNiOGI2M2U3MWViYjNhYWZhNTk2ZmZjIiwiZXhwIjoxNjAwMDE1ODMzfQ.JW7xo4xIdKRFKPsRviCvMa57fRivXcffGOfVk7ruf9s6UfmrjJN-DHTq9JYaRfYdYzc5J_M9fNPW-MRc2pH3-dL071ivVcN7mbSNnkP-eTB2Rgz86kRTeHYv3Vljw2txNzoJBI_pkmTUO9YaOxlb5zJD4FYjVhPJlR3zrLz7miHzntPHYMx2ve5GD6-Eys5NSQN96F4suK8OzZPn9mxCi17cHE2W9LNcW0n4FM7wdza8cK36xYPbvwvNTSkBqkmkNQyezHutpXUSzYNsmc0hza-vfpOoq8uoGSryVUGUS3z5wZdAh2mKJNV2J-aq4wQ54radQ6C--cfPI-F05u-BiQ (mp4, (14.73 MB) Download video