ArticlePDF Available

Quantification of protein Z expression in lung adenocarcinoma tissues and cells

Authors:

Abstract and Figures

As a regulator of coagulation, abnormal Protein Z (PZ) expression may lead to the formation of blood clots in humans. While previous studies have shown that PZ protein is altered in several types of cancer, however, additional observations are needed to understand the complex biology involved. Herein, we investigated local alterations in PZ expression in lung adenocarcinomas by measuring gene and protein expression in both cancerous and normal lung tissues. Twenty-two (22) specimens of lung adenocarcinoma and 22 specimens of normal lung tissues from human patients were compared for the expression of PZ. In addition, A549 adenocarcinoma cells were compared to a normal epithelial cell line, 16-HBE, for in vitro PZ expression. In tissues and cells, PZ protein and gene expression were determined using western blot, immunohistochemistry and PCR. Lung adenocarcinoma tissues showed elevated expression of both PZ mRNA and protein compared with healthy tissue. Only protein expression was increased in cultured cell lines, which holds implications for the dominant source of PZ in tissues, as well as protein modifications necessary for PZ function. Protein Z appears to be associated with the presence of lung adenocarcinoma and may be a viable prognostic biomarker for lung cancer.
Content may be subject to copyright.
Wang et al. SpringerPlus (2016) 5:1046
DOI 10.1186/s40064-016-2610-x
RESEARCH
Quantication ofprotein Z expression
inlung adenocarcinoma tissues andcells
Hong Wang1, Fang Huang2, Xue‑Yi Pan1*, Ze‑Bin Guan1, Wen‑Bing Zeng1, Ming‑Jie Li1
and Rui‑Hao Zhang1
Abstract
As a regulator of coagulation, abnormal Protein Z (PZ) expression may lead to the formation of blood clots in humans.
While previous studies have shown that PZ protein is altered in several types of cancer, however, additional observa‑
tions are needed to understand the complex biology involved. Herein, we investigated local alterations in PZ expres‑
sion in lung adenocarcinomas by measuring gene and protein expression in both cancerous and normal lung tissues.
Twenty‑two (22) specimens of lung adenocarcinoma and 22 specimens of normal lung tissues from human patients
were compared for the expression of PZ. In addition, A549 adenocarcinoma cells were compared to a normal epithe‑
lial cell line, 16‑HBE, for in vitro PZ expression. In tissues and cells, PZ protein and gene expression were determined
using western blot, immunohistochemistry and PCR. Lung adenocarcinoma tissues showed elevated expression of
both PZ mRNA and protein compared with healthy tissue. Only protein expression was increased in cultured cell lines,
which holds implications for the dominant source of PZ in tissues, as well as protein modifications necessary for PZ
function. Protein Z appears to be associated with the presence of lung adenocarcinoma and may be a viable prog‑
nostic biomarker for lung cancer.
Keywords: Lung adenocarcinoma, Protein Z, A549, 16‑HBE, PZI
© 2016 The Author(s). This article is distributed under the terms of the Creative Commons Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium,
provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license,
and indicate if changes were made.
Background
Protein Z (PZ) is a vitamin K-dependent (VKD) glycopro-
tein that acts as a potent cofactor for the enzyme protein
Z-dependent protease inhibitor (ZPI). Together, these
proteins mediate thrombin activation and blood coagu-
lation by strongly inhibiting the activation of Factor Xa
(FXa). PZ shares structural similarities with other VKD
factors such as coagulation factor VII, IX, X, protein C
and protein S, but holds no intrinsic enzymatic activity
(Broze and Miletich 1984). While the specific mecha-
nism of PZ’s actions in the anticoagulation cascade is not
established, several reports demonstrate the formation of
a PZ/ZPI complex that inactivates FX, thereby inhibiting
the coagulation cascade prior to formation of the pro-
thrombin complex. In fact, the presence of PZ enhances
the inhibition of FXa by ZPI by 1000-fold (Fujimaki etal.
1998). In this regard, the traditional role of PZ in mediat-
ing anticoagulation is to serve as a critical factor in ZPI
and FX signaling (Tabatabai etal. 2001), ultimately con-
trolling thrombus formation.
romboembolisms are one of the most common ail-
ments in cancer patients, as many hemostatic complica-
tions can arise due to malignancy (Wojtukiewicz etal.
2001). An imbalance in pro- and anti-coagulation factors
may lead to blood coagulation abnormalities and vas-
cular disorders, which could further exacerbate cancer
progression, as well as attenuate immunologic defense
mechanisms and therapeutic efficacy of chemothera-
peutic drugs and other treatments (Sierko etal. 2012b;
Wojtukiewicz et al. 2007). e activation of FX has
been considered the most important step leading to the
formation of thrombin and fibrin in both normal and
pathologic conditions (Bick 1992; Falanga and Rickles
1999; Zacharski etal. 1992). However, it remains unclear
whether disruption of inhibition of FXa by PZ/ZPI spe-
cifically underlies the pathogenesis of thrombosis and
other blood coagulation disorders in cancer patients. Our
Open Access
*Correspondence: panxueyigyf@126.com
1 Department of Hematology, The First Affiliated Hospital of Guangdong
Pharmaceutical University, Guangzhou 510080, Guangdong,
People’s Republic of China
Full list of author information is available at the end of the article
Page 2 of 7
Wang et al. SpringerPlus (2016) 5:1046
previous studies have found that as malignant tumors
progress, plasma levels of PZ significantly decrease
(Shang etal. 2005), which indicates that PZ may be a fac-
tor contributing to poor prognosis in cancer patients. It
remains unclear, however, whether circulating concentra-
tions or local tissue PZ expression is primarily responsi-
ble for the downstream increase in thrombotic episodes
in patients. Abnormal tissue expression of PZ has been
observed in human cancers of the lung, breast, colon, and
stomach (Sierko etal. 2011, 2012a, b, 2014). Interestingly,
patients with these types of cancers are also more prone
to developing thrombosis.
Determining mechanisms by which local changes in
a tumor microenvironment lead to systemic changes in
an individual is an important aim in cancer research. In
the current study, we investigate PZ expression in lung
adenocarcinomas, which is highly metastatic and likely
to cause the development of thrombosis. We examined
the expression of PZ in cell cultures and in lung adeno-
carcinoma biopsies using Western blotting, immunohis-
tochemistry, and RT-PCR to observe any differences in
PZ in the local tumor environment compared to normal
tissue.
Subjects andmethods
Specimen collection
is study protocol adhered to the principles of Hel-
sinki and was confirmed by the ethics committee of the
First Affiliated Hospital of Guangdong Pharmaceuti-
cal University. A total of 22 specimens were collected
from pathologically-confirmed lung adenocarcinoma
patients who underwent surgery in the oracic
Department of the First Affiliated Hospital of Guang-
dong Pharmaceutical University between 2008 and
2011. Informed consent was obtained from all subjects
before the study. e average age of the patients was 59,
with 12 males and 10 females ranging from 27–80years
old. e cancerous tissue was collected from a primary
lesion, avoiding the necrotic and inflammatory sites,
while normal lung tissues were collected>5 cm, away
from the corresponding lesion. Upon surgical removal,
all specimens (0.5cm×0.5cm×0.2cm) were imme-
diately frozen in liquid nitrogen and stored at 80°C
until use.
Cell culture
Human bronchial epithelial 16-HBE cells and a lung
adenocarcinoma epithelial cell line, A549, were pro-
vided by the Experimental Medical Research Center at
the Guangzhou Medical University. Cells were grown in
DMEM supplemented with 10% FBS at 37°C in 5% CO2
and passaged twice. Cultures with a density of 5×105/ml
were used for all experiments.
Primer design
Primers were designed using Primer 6.0 software, synthe-
sized by Sangon Biotech (Shanghai, China), and ampli-
fied a 159bp product. Sequences are shown in Table1.
Tissue RNA extraction
Total RNA was extracted according to the manufacturer’s
instructions using TRIzol reagent, and precipitated RNA
was dissolved in 50μl DEPC-treated water. Agarose gel
electrophoresis showed three clear bands at 5, 18, and
28S. e absorbance of RNA samples at 260 and 280nm
was determined using UV spectroscopy and only samples
with A260/A280 ratio between 1.8 and 2.0 were used for
reverse transcription.
qRT‑PCR
cDNA was synthesized with 4μl total RNA using the Pri-
meScript TM RT Master Mix Kit (Takara) according to
the manufacturer’s instructions. Primer sets for PZ and
GAPDH are listed in Table1 (see “Primer design” sec-
tion). By using a real time PCR machine (MX3000P, Strat-
agene, USA), PCR reactions were performed in a total of
20μl reaction volume containing 10μl 2×Mix, 0.4μl
50×Rox, 3μl (F+R) primer (2μmol/L), 1μl cDNA, and
distilled water to make up to 20μl. e thermocycling
conditions were as follows: 30s at 95°C, followed by 40
cycles of 5s at 95°C, 30s at 56°C, and ended with 30s
at 72°C. e quantification of gene expression changes
were calculated as follows: (1) fold change=2ΔΔCt;
(2) ΔΔCt = ΔCt treatment group ΔCt control
group=(CT target geneCT reference gene) treatment
group(CT target geneCT reference gene) control
group.
Immunohistochemistry
Immunohistochemical analysis was performed using
the Histostain-SP IHC Kit (Life Technologies) accord-
ing to the manufacture’s protocol. Briefly, tissue samples
were fixed in 10 % formalin, dehydrated, and paraffin-
embedded. Paraffin blocks were cut for 4μm-thick serial
sections, and antigen retrieval was performed by micro-
waving in a pH 8.0 sodium citrate solution. Monoclonal
mouse anti-human PZ antibody (Abcam, UK) (1:1600)
was used as primary antibody, followed by incubation
with ALP-conjugated goat anti-mouse IgG (1:5000), and
DAB was used as the chromogen. PZ-positive cells were
Table 1 Real time PCR primer Sequence (5–3)
PZ Forward: 5‑GCCCTCCATCGTGTGGAGCC‑3
Reverse: 5‑TAAGCTTTCCTGGACGCCTGTGC‑3
GAPDH Forward: 5‑AAGAGAGGCATCCTCACCCT‑3
Reverse: 5‑TACATGGCTGGGGTGTTGAA‑3
Page 3 of 7
Wang et al. SpringerPlus (2016) 5:1046
defined as cells with brown precipitates in the plasma.
Cells without staining were marked as negative (); cells
stained light brown were marked as weakly positive (+);
cells stained dark brown were marked as strongly positive
(+++); and cells stained between weakly and strongly
positive were marked as moderately positive (++).
Staining was scored using a 13-point scoring system
(Sierko etal. 2014) based on the percentage of stained
cells (no cells stained = 0, <10 % = 1, 10–50 % = 2,
51–80%=3,>80%=4) and the intensity of the stain-
ing (negative staining=0, weak staining=1, moderate
staining=2, strong staining= 3). e final score was
determined by multiplying the percentage of positively
stained cell score with the intensity score (see Table2 for
a summary). All results were analyzed by two observers
that were blinded to the condition of the patients.
Western blotting
Total protein was extracted from the frozen tissue sam-
ples using ultrasound homogenization with SDS lysis
buffer (Beyotime Biotechnology, China). Lysates were
cleared by centrifugation at 4 °C. e collected super-
natants were measured for protein concentration using
a BCA protein assay before being separated on 10 %
SDS-PAGE gels and transferred to PVDF membranes.
e membranes were incubated overnight at 4°C with
anti-PZ antibody (Abnova Taiwan, 1:2500) in PBS with
1%BSA. e next day, membranes were washed and then
incubated for 2h at room temperature with ALP-con-
jugated secondary antibody (1:20,000). Protein signals
were detected using NBT/BCIP (Beyotime Institute of
Biotechnology) and analyzed with IPP software. e PZ/
actin ratio was used for statistical analysis.
Statistical analysis
All data are expressed as mean±standard deviation. Sta-
tistical analysis was performed using SPSS 19.0 by T test,
and p value<0.05 was considered statistically significant.
Results
mRNA expression ofPZ gene incells
We used SYBR-based quantitative fluorescence PCR to
detect the expression of PZ gene in the A549 lung ade-
nocarcinoma cell line and 16-HBE normal epithelial line,
using GADPH to normalize the samples. e dissociation
curves for both genes showed a single peak, suggesting
that no off-target products, such as primer dimers, were
formed. A549 adenocarcinoma cells exhibited a 1.06-fold
increase in PZ mRNA expression over 16-HBE cells, but
this increase was not statistically significant (Fig.1).
mRNA expression ofPZ inhuman lung adenocarcinoma
tissue samples
Similarly, we used SYBR-based quantitative fluorescence
PCR to detect the genetic expression of PZ in 22 lung
adenocarcinoma and 22 normal tissues. A single peak
was again observed, indicating that no off-target prod-
ucts such as primer dimers were formed. Compared with
normal tissue, PZ mRNA expression was 1.77-fold higher
in lung adenocarcinoma samples, which was statistically
significant (Fig.2).
Immunohistochemical analysis ofPZ inhuman lung
adenocarcinoma tissue samples
e expression of PZ in cancerous lung tissue was
increased, as indicated by intense brown staining in
Fig.3a. In contrast, healthy lung tissues showed minimal
expression of PZ (Fig.3c). Overall, PZ protein appears to
be expressed in macrophages and endothelial cells in the
newly formed vessels, which is in line with previous find-
ings (Sierko etal. 2012b).
Protein expression ofPZ inA549 and16‑HBE cells
As shown in Fig.4, western blot analysis shows a signifi-
cant 1.84-fold higher expression of PZ protein in A549
cells than 16-HBE epithelial cells. is suggests that the
expression level of PZ protein may be associated with
Table 2 Immunohistochemical results ofPZ inlung adeno-
carcinoma andhealthy lung tissue
Adenocarcinoma
tissue Healthy lung
tissue
Proportion of positive cells (%) >75 <25
Staining scores 58 9
Staining results 22/22 (100 %) 7/22 (31 %)
Fig. 1 PZ mRNA in cell cultures. In comparison with normal cells,
A549 adenocarcinoma cells exhibited a 1.06‑fold increase in PZ mRNA
expression. (P = 0.086)
Page 4 of 7
Wang et al. SpringerPlus (2016) 5:1046
cancerous cells. Furthermore, this change is likely to be
mediated by post-transcriptional or post-translational
modifications, as total PZ mRNA expression was mini-
mally altered (Fig.4).
Protein expression ofPZ inlung adenocarcinomas
andhealthy lung tissues
We next examined the expression of PZ protein in 22
lung adenocarcinoma and 22 healthy lung tissues via
western blotting. Representative images of the mem-
branes shown in Fig.5 illustrate that PZ expression is sig-
nificantly increased in cancerous tissues compared with
normal lung tissue.
Discussion
In order to examine whether protein Z (PZ) is altered
in primary cancer tissues, we studied PZ expression in
human lung adenocarcinomas, one of the most meta-
static and thrombosis-prone lung cancers. Using Western
blotting, immunohistochemical staining and real-time
PCR techniques, we examined the expression levels of
PZ in lung adenocarcinoma versus normal lung tissue.
Our results show increased expression of PZ in lung
adenocarcinoma tissues and higher expression in A549
than 16-HBE, which correlates with previous experimen-
tal results that provide a role for local PZ expression in
the biology of several types of cancer (Sierko etal. 2011,
2012a, b, 2014). Although additional studies are needed,
these results indicate that altered PZ expression plays a
role in the local pathobiology of lung cancer, possibly dis-
tinct from its global role as an anti-coagulant.
romboembolisms are commonly associated with
cancer malignancy, as global hemostatic changes are
observed in response to tumor formation and growth.
rombin and fibrin are largely known for their essen-
tial roles as coagulants in the blood. However, these and
other related pro-coagulants, such as tissue factor and
Factor X, have strong effects on cell biology aside from
blood clot formation. rombin, for example, stimu-
lates cancer cell proliferation and migration (Bick 1992;
Zacharski et al. 1992), and acts on endothelial cells to
stimulate angiogenesis and vascular permeability (Woj-
tukiewicz et al. 2001). Fibrin can act as a scaffold for
balancing mechanical tension during tumor growth, or
to bind growth factors that guide cell behavior or are
released upon fibrin degradation (Zacharski etal. 1992).
Often, an increase in the expression of coagulation fac-
tors naturally leads to an increase in the expression of
their inhibitors, which includes PZ (Sierko etal. 2012b).
While evidence of direct effects of PZ on different cell
types is minimal, studies have demonstrated a role for PZ
in normal angiogenesis (Butschkau etal. 2014), accumu-
lation of PZ around vascular lesions (Greten etal. 1998)
and increased PZ expression surrounding blood vessels
in breast cancer tissue (Sierko etal. 2011), all of which
indicate a more direct involvement of PZ in endothelial
and mural cell biology. Maintaining a balance between
pro- and anti-coagulant factors is, therefore, not only
critical for blood clot formation and degradation, but also
for proper cellular activation and homeostasis within tis-
sues themselves.
A relationship between PZ and cancer has been
observed, but experimental results are conflicting and
generally inconclusive. In liver cancer, it was found that
PZ might serve as a tumor suppressor (Neumann et al.
2012). In acute leukemia, reduced plasma PZ levels
were shown to increase the risk of bleeding in patients
(Galar etal. 2012). Another recent study reported a sig-
nificant drop of plasma PZ level in young acute lympho-
blastic leukemia (ALL) patients undergoing induction
therapy; however, this decrease did not correlate with
bleeding or thrombosis (Cankal et al. 2013), indicat-
ing non-traditional roles for PZ in cancer cell biology.
Sierko etal. recently showed an overexpression of PZ in
breast, lung, colon, and stomach cancer tissues (Sierko
Fig. 2 PZ mRNA in normal vs. cancerous tissue biopsies. Compared
to normal tissue, PZ mRNA expression was 1.77‑fold higher in lung
adenocarcinoma tissue, which was statistically significant (P = 0.023).
The altered PZ expression in adenocarcinoma patient samples, com‑
pared with normal tissues, suggests its involvement in the pathology
of lung adenocarcinoma
Page 5 of 7
Wang et al. SpringerPlus (2016) 5:1046
et al. 2011, 2012a, b, 2014). Additionally, they detected
elevated PZ expression in tissue-associated macrophages
and endothelial cells in cancer microenvironments, and
examined the expression and interactions of PZ, ZPI,
prothrombin fragments (F1+2), and fibrin in non-small-
cell lung carcinoma and colon cancer (Sierko etal. 2011,
2012a, b). eir findings suggest that PZ, through its
anticoagulation properties, affects tumor angiogenesis,
invasion and metastasis. On the other hand, our previ-
ous clinical studies have found that as a malignant tumor
progresses, circulating levels of PZ significantly decrease
(Broze and Miletich 1984). While this may seem conflict-
ing to the data presented here and by others (Sierko etal.
2011, 2012a, b, 2014), it could simply mean that certain
components of tumor (and tissue) microenvironments
may not be properly represented in the circulation, and
care should be taken during the establishment of truly
representative novel circulating biomarkers.
Conclusions
e current study confirms that PZ is locally present
in lung adenocarcinomas. Given what is known about
the biology of PZ, it may play a critical role in the
tumor microenvironment, or in the systemic response
to maintain homeostasis. We provide evidence that
PZ should be studied to determine its distinct roles in
tumor initiation, progression, angiogenesis and meta-
static potential. It is possible that PZ may serve as an
important target for treatments of lung adenocarcino-
mas and other tumors, and more experiments will help
Fig. 3 Representative images from immunohistochemical staining. In lung adenocarcinoma tissue (a), an increase in PZ staining (brown) is
observed. The black arrow indicates the cytoplasmic expression of PZ, while the red arrow and yellow arrow indicates the presence of PZ protein in
macrophages and endothelial cells, respectively. Scale bar 50 μm. b PZ protein was not expressed in the cytoplasm of cells in healthy lung tissue.
The positively stained cells are macrophages (red arrow) and endothelial cells (yellow arrow). Scale bar 50 μm
Page 6 of 7
Wang et al. SpringerPlus (2016) 5:1046
to determine the precise role of PZ in disease pathogen-
esis and progression.
Authors’ contributions
Conceived and designed the experiments: XYP. Performed the experiments:
HW, FH, ZBG, WBZ.Analyzed the data: HW, MJL, RHZ. Wrote the paper: HW, FH.
All authors read and approved the final manuscript.
Author details
1 Department of Hematology, The First Affiliated Hospital of Guangdong
Pharmaceutical University, Guangzhou 510080, Guangdong, People’s Republic
of China. 2 Department of Hematology, The Sixth Affiliated Hospital of Guang‑
zhou Medical University, Qingyuan People’s Hospital, Qingyuan 511518,
Guangdong, People’s Republic of China.
Acknowledgements
The authors would like to thank Dr. Qian‑Chen Yong for language editing of
this article. The authors declare no conflicts of interest related to this study.
Competing interests
All authors declare that they have no competing interests.
Funding
Xue‑Yi Pan has supported by Science and Technology Planning Project of
Guangdong Province, China (2014A020212415).
Received: 25 March 2016 Accepted: 17 June 2016
References
Bick RL (1992) Coagulation abnormalities in malignancy: a review. Semin
Thromb Hemost 18(4):353–372
Broze GJ, Miletich JP (1984) Human protein Z. J Clin Invest 73(4):933–938
Butschkau A, Wagner NM, Genz B, Vollmar B (2014) Protein z exerts pro‑angio‑
genic effects and upregulates CXCR4. PLoS ONE 9(12):e113554
Cankal A, Tufekci O, Gozmen S, Yuksel F, Vergin C, Irken G, Ören H (2013)
The evaluation of protein Z levels of children with acute lymphoblas‑
tic leukaemia during induction therapy. Blood Coagul Fibrinolysis
24(4):375–380
Falanga A, Rickles FR (1999) Pathophysiology of the thrombophilic state in the
cancer patient. Semin Thromb Hemost 25(2):173–182
Fujimaki K, Yamazaki T, Taniwaki M, Ichinose A (1998) The gene for human pro‑
tein Z is localized to chromosome 13 at band q34 and is coded by eight
regular exons and one alternative exon. Biochemistry 37(19):6838–6846
Galar M, Piszcz J, Bolkun L, Szumowska A, Kloczko J (2012) Protein Z con‑
centrations in patients with acute leukemia. Clin Appl Thromb Hemost
18(5):542–545
Greten J, Kreis I, Liliensiek B, Allenberg J, Amiral J, Ziegler R, Nawroth PP (1998)
Localisation of protein Z in vascular lesions of patients with atherosclero‑
sis. Vasa 27(3):144–148
Neumann O, Kesselmeier M, Geffers R, Pellegrino R, Radlwimmer B, Hoffmann
K, Ehemann V, Schemmer P, Schirmacher P, Lorenzo Bermejo J et al (2012)
Methylome analysis and integrative profiling of human HCCs identify
novel protumorigenic factors. Hepatology 56(5):1817–1827
Shang Y, Pan XY, Ding CP, Yang XM, Cai XY, Ding Y, Zhang RL (2005) Clinical
significance of protein Z detection in patients with malignant tumors.
Chin J Cancer 24(9):1144–1147
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Kisiel W (2011) Protein Z is
present in human breast cancer tissue. Int J Hematol 93(5):681–683
Sierko E, Wojtukiewicz MZ, Zimnoch L, Ostrowska‑Cichocka K, Tokajuk P,
Ramlau R, Kisiel W (2012a) Protein Z/protein Z‑dependent protease
inhibitor system in human non‑small‑cell lung cancer tissue. Thromb Res
129(4):e92–e96
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Ostrowska‑Cichocka K, Kisiel
W (2012b) Co‑localization of protein Z, protein Z‑Dependent protease
inhibitor and coagulation factor X in human colon cancer tissue:
Fig. 4 PZ protein expression is increased in adenocarcinoma cells.
Representative images illustrate that Western blotting of isolated
cells revealed a significant increase in PZ protein in A549 (adeno‑
carcinoma) cells compared to normal cells (16‑HBE). Samples were
normalized to actin and quantitated (*P = 0.017)
Fig. 5 PZ protein expression is upregulated in cancerous tissue
biopsies. Representative Western blots show that PZ expression is
highly upregulated in lung adenocarcinoma (LA) tissue compared
with normal lung tissue (NLT). Samples were normalized to actin and
quantitated (*P = 0.014)
Page 7 of 7
Wang et al. SpringerPlus (2016) 5:1046
implications for coagulation regulation on tumor cells. Thromb Res
129(4):e112–e118
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Ostrowska‑Cichocka K, Kisiel
W (2014) Protein Z/protein Z‑dependent protease inhibitor system in
loco in human gastric cancer. Ann Hematol 93(5):779–784
Tabatabai A, Fiehler R, Broze GJ (2001) Protein Z circulates in plasma in a
complex with protein Z‑dependent protease inhibitor. Thromb Haemost
85(4):655–660
Wojtukiewicz MZ, Sierko E, Klement P, Rak J (2001) The hemostatic system and
angiogenesis in malignancy. Neoplasia 3(5):371–384
Wojtukiewicz MZ, Sierko E, Kisiel W (2007) The role of hemostatic system
inhibitors in malignancy. Semin Thromb Hemost 33(7):621–642
Zacharski LR, Wojtukiewicz MZ, Costantini V, Ornstein DL, Memoli VA (1992)
Pathways of coagulation/fibrinolysis activation in malignancy. Semin
Thromb Hemost 18(1):104–116
... 25,26 Additionally, the mRNA and protein expression levels of PROZ were elevated in lung adenocarcinoma cells compared to normal healthy lung tissues and might serve as a prognostic biomarker for lung cancer. 27 However, PROZ was found to be decreased in HCC tissues compared with control tissues and was significantly associated with overall survival in HCC. 28 This was consistent with the results of this study. ...
Article
Full-text available
Objective: The occurrence and development of hepatocellular carcinoma (HCC) remain unclear. This study aimed to investigate potential diagnostic or prognostic markers for early HCC by applying bioinformatic analysis. Methods: The gene expression profiles of early HCC and normal tissues from a TCGA dataset were used to identify differentially expressed genes (DEGs) and then analysed by weighted gene coexpression network analysis. The integrated genes were selected to construct the protein-protein interaction (PPI) network and determine the hub genes. The prognostic impact of the hub genes was then analysed. Results: A total of 508 integrated genes were selected from the 615 DEGs and 8956 genes in the turquoise module. A PPI network was constructed, and the top 20 hub genes, including apolipoprotein A-IV (APOA4), fibrinogen gamma chain (FGG), vitamin K-dependent protein Z (PROZ), secreted phosphoprotein 24 (SPP2) and fetuin-B (FETUB), were identified. Only PROZ was significantly associated with the prognosis of early HCC. Conclusion: In this study, we demonstrated that the expression of PROZ was decreased in early HCC compared with normal liver controls, and low PROZ expression might result in poor overall survival of early HCC.
Article
Full-text available
Background/aim: Hemostatic system components contribute to cancer progression independently from their roles in hemostasis. It has been shown that protein Z (PZ)/protein Z-dependent protease inhibitor (ZPI) inhibit coagulation factor X (FX). The aim of the study was to analyze the expression of PZ/ZPI in relation to the main coagulation factor - FX in human endometrial cancer tissue. Materials and methods: Immunohistochemical analysis was performed on 21 endometrial cancer specimens employing antibodies against ZPI, PZ and FX. Results: Endometrial cancer cells showed a strong expression of ZPI and PZ and medium expression of FX. Normal endometrial tissue showed no expression of ZPI, PZ or FX. Conclusion: Strong expression of PZ and ZPI in endometrial cancer cells suggests a role of these proteins in endometrial cancer.
Article
Full-text available
Protein Z (PZ) is a vitamin K-dependent coagulation factor without catalytic activity. Evidence points towards PZ as an independent risk factor for the occurrence of human peripheral arterial disease. However, the role of PZ in ischemia-driven angiogenesis and vascular healing processes has not been elucidated so far. Angiogenic potency of PZ was assessed in established in vitro assays using endothelial cells. PZ-deficient (PZ-/-) mice and their wild-type littermates (PZ+/+) were subjected to hindlimb ischemia. Furthermore, PZ-/- mice were exposed to PZ expressing adenovirus (AdV-PZ) or control adenovirus (AdV-GFP). In an additional set of animals, PZ-/- mice were exposed to AdV-PZ and AdV-GFP, each in combination with the CXCR4 antagonist AMD3100. In vitro, PZ stimulated migratory activity and capillary-like tube formation of endothelial cells comparable to SDF-1. PZ-/- mice exhibited diminished hypoxia-driven neovascularization and reperfusion in post-ischemic hindlimbs, which was restored by adenoviral gene transfer up to levels seen in PZ+/+ mice. The stimulatory impact of PZ on endothelial cells in vitro was abolished by siRNA targeting against PZ and PZ was not able to restore reduced migration after knock-down of CXCR4. The increased surface expression of CXCR4 on PZ-stimulated endothelial cells and the abrogated restoration of PZ-/- mice via AdV-PZ after concomitant treatment with the CXCR4 antagonist AMD3100 supports the idea that PZ mediates angiogenesis via a G-protein coupled pathway and involves the SDF-1/CXCR4 axis. This is underlined by the fact that addition of the G-protein inhibitor PTX to PZ-stimulated endothelial cells abolished the effect of PZ on capillary-like tube formation. The results of the current study reveal a role of PZ in ischemia-induced angiogenesis, which involves a G-protein coupled pathway and a raised surface expression of CXCR4. Our findings thereby extend the involvement of PZ from the coagulation cascade to a beneficial modulation of vascular homeostasis.
Article
Full-text available
In gastric cancer, hemostatic system components contribute to cancer progression, as activation of factor X (FX) was observed. The protein Z (PZ)/protein Z-dependent protease inhibitor (ZPI) complex inhibits factor Xa proteolytic activity. The purpose of this study was to determine the distribution of ZPI and PZ in relation to FX, and prothrombin fragment (F1 + 2), a standard marker for blood coagulation activation, in human gastric cancer tissue. ABC procedures and a double staining method employed polyclonal antibodies against PZ, FX, and F1 + 2 and a monoclonal antibody against ZPI. In situ hybridization (ISH) methods employed biotin-labeled 25-nucleotide single-stranded DNA probes directed to either PZ or ZPI mRNAs. FX and components of PZ/ZPI coagulation inhibitory system were observed in cancer cells. F1 + 2 was observed in gastric cancer cells as well. Double staining studies revealed FX/PZ, FX/ZPI, and PZ/ZPI co-localization on gastric cancer cells. ISH studies demonstrated the presence of PZ mRNA and ZPI mRNA in gastric cancer cells indicating induced synthesis of these proteins. The co-localization of PZ/ZPI and FX in gastric cancer cells indicates in loco that these proteins may play a role in anticoagulant events at the tumor tissue.
Article
The objective of this study was to evaluate the protein Z levels of children with acute lymphoblastic leukaemia (ALL) during induction therapy. Although several studies investigated the association between steroid and L-asparaginase (L-ASP) administration and levels of coagulation proteins such as protein C, protein S and antithrombin in children with ALL, protein Z levels have not been examined in any study yet. Peripheral blood was drawn from the study group before chemotherapy (PZ0) at diagnosis, at 12th day (PZ1), 15th day (PZ2), 18th day (PZ3) and 21st day (PZ4) of treatment wherein L-ASP treatment is given along with steroid administration according to ALL BFM-1995 chemotherapy protocol. Plasma protein Z levels were measured by enzyme immunoassay method. Mean protein Z level at PZ0 was 1.628 ± 0.485 μg/ml in the study group and 1.672 ± 0.662 μg/ml in the control group. No statistical difference was observed. In the study group, there was a slight increase in protein Z levels between the PZ0 and PZ1 periods in which only steroid therapy was administered. Statistically significant decrease was observed between protein Z levels in PZ0-PZ4, PZ1-PZ2, PZ1-PZ3, PZ1-PZ4 and PZ3-PZ4 periods. During the induction treatment, symptomatic haemorrhage or thrombosis was not followed up in any patients. We demonstrated that children with ALL have similar protein Z values to those of the control group at diagnosis. A significant decrease occurs at the end of the induction treatment with steroid and L-ASP administration. However, this deficiency does not result in development of symptomatic thrombosis or bleeding in these patients.
Article
Unlabelled: To identify new tumor-suppressor gene candidates relevant for human hepatocarcinogenesis, we performed genome-wide methylation profiling and vertical integration with array-based comparative genomic hybridization (aCGH), as well as expression data from a cohort of well-characterized human hepatocellular carcinomas (HCCs). Bisulfite-converted DNAs from 63 HCCs and 10 healthy control livers were analyzed for the methylation status of more than 14,000 genes. After defining the differentially methylated genes in HCCs, we integrated their DNA copy-number alterations as determined by aCGH data and correlated them with gene expression to identify genes potentially silenced by promoter hypermethylation. Aberrant methylation of candidates was further confirmed by pyrosequencing, and methylation dependency of silencing was determined by 5-aza-2'-deoxycytidine (5-aza-dC) treatment. Methylation profiling revealed 2,226 CpG sites that showed methylation differences between healthy control livers and HCCs. Of these, 537 CpG sites were hypermethylated in the tumor DNA, whereas 1,689 sites showed promoter hypomethylation. The hypermethylated set was enriched for genes known to be inactivated by the polycomb repressive complex 2, whereas the group of hypomethylated genes was enriched for imprinted genes. We identified three genes matching all of our selection criteria for a tumor-suppressor gene (period homolog 3 [PER3], insulin-like growth-factor-binding protein, acid labile subunit [IGFALS], and protein Z). PER3 was down-regulated in human HCCs, compared to peritumorous and healthy liver tissues. 5-aza-dC treatment restored PER3 expression in HCC cell lines, indicating that promoter hypermethylation was indeed responsible for gene silencing. Additionally, functional analysis supported a tumor-suppressive function for PER3 and IGFALS in vitro. Conclusion: The present study illustrates that vertical integration of methylation data with high-resolution genomic and transcriptomic data facilitates the identification of new tumor-suppressor gene candidates in human HCC.
Article
Protein Z (PZ) deficiency may induce bleeding as well as thrombosis. The aim of our study was to estimate the concentration of PZ in patients with acute leukemia. Plasma levels of PZ were determined in 76 patients with newly diagnosed acute leukemia ([AML], n = 50; acute lymphoblastic leukemia [ALL], n = 26) and 62 healthy participants. In the patients, mean plasma concentrations of PZ were statistically lower than in healthy individuals: AML (1.24 ± 0.11 μg/mL vs 1.58 ± 0.05 μg/mL P = .01) and ALL (1.19 ± 0.16 μg/mL vs 1.58 ± 0.05 μg/mL P = .01). Levels of PZ below the fifth percentile (0.873 μg/mL) of normal value distribution in control participants were found in 30% of patients with AML and ALL and in 3% of controls (P < .0001). In this AML subgroup, we found statistically significant correlation between episodes of bleeding and PZ level (P = .01). There was no such correlation in ALL group. The results suggest that PZ can be a cofactor associated with an increased bleeding tendency in patients with AML.
Article
Several hemostatic system components, including factor X (FX), contribute to cancer progression. The Protein Z (PZ)/protein Z-dependent protease inhibitor (ZPI) complex directly inhibits factor Xa proteolytic activity. The aim of this study was to determine the antigenic distribution of ZPI and PZ, in relation to FX, as well as indicators of blood coagulation activation (F1+2 and fibrin) in human colon cancer tissue. Studies were performed on human colon cancer fragments. Immunohistochemical (IHC) ABC procedures and double staining method employed polyclonal antibodies against PZ, FX, F1+2 and monoclonal antibodies against ZPI and fibrin. In-situ hybridization (ISH) methods employed biotin-labeled 25-nucleotide single-stranded DNA probes directed to either FX, PZ or ZPI mRNAs. Expression of FX, PZ and ZPI in association with colon cancer cells was observed by IHC. Moreover, the presence of both F1+2 and fibrin in association with colon cancer cells was found, which indicates that blood coagulation activation proceeds extravascularly at the tumor site. Furthermore, expression of FX and PZ was visualized in association with endothelial cells. In turn, colon cancer-associated macrophages were characterized by FX , PZ and ZPI presence. The double staining studies revealed strong FX/PZ, FX/ZPI, as well as PZ/ZPI co-localization on colon cancer cells. ISH studies revealed the presence of FX mRNA, PZ mRNA and ZPI mRNA in colon cancer cells indicating induced synthesis of these proteins. The localization of PZ/ZPI and FX in colon cancer cells indicates that PZ/ZPI may contribute to anticoagulant events at the tumor site. Strong co-localization of PZ/ZPI and FX in cancer cells, and the presence of the mRNAs encoding the proteins, suggests their role in the tumor's biology. However, the presence of F1+2 and fibrin at the colon cancer site also suggests that the regulation of FXa by the PZ/ZPI complex at this site is incomplete.
Article
NSCLC progression is often associated with VTE. Activation of factor X is an important step in blood coagulation activation in cancer patients. PZ)/ZPI contribute to direct factor Xa inhibition, and ZPI - attenuates factors IXa and XIa activity. The role of the PZ/ZPI in NSCLC is obscure. The aim of the study was to localize ZPI and PZ in NSCLC tissue in relation to factors X, IX and XI, as well as indicators of blood coagulation activation: prothrombin fragment F1+2 (F1+2) and fibrin. Immunohistochemical studies were performed on surgical NSCLC specimens employing antibodies against ZPI, PZ, coagulation factors X, IX, XI, as well as fibrinogen, F1+2 and fibrin. A semiquantitative analysis (acc. to immunoreactive score-IRS) was conducted. Medium expression of ZPI(IRS=6.5), together with weak expression of PZ(IRS=4), was observed in cancer cells. Strong or medium staining for factors IX, X, and XI(IRS=8-9) was revealed in cancer cells. Fibrinogen(IRS=10) and fibrin(IRS=8) were demonstrated in tumor stroma and cancer cells. F1+2(IRS=10) was localized in NSCLC cells. Endothelial cells (ECs) and tumor infiltrating macrophages (TAMs) were characterized by a positive staining for ZPI and PZ. ZPI and PZ expression in NSCLC cells, ECs and TAMs may suggest a role for PZ/ZPI in the anticoagulant mechanisms at the tumor site. The presence of F1+2 and fibrin, along with a disproportional expression of ZPI and PZ, might point to impaired function of the coagulation inhibitory system in NSCLC tissue.
Article
As outlined in this review, patients with cancer may harbor many alterations of hemostasis. These are multifaceted and must be taken into account when trying to control hemorrhage or thrombosis in cancer patients. Often, hemorrhage or thrombosis is the final fatal event in many patients with metastatic solid tumor or hematologic malignancies. Patients with malignancy present a major clinical challenge in this new era of oncologic awareness and more aggressive care, which has led to prolonged survival for patients and a longer time frame during which these complications may develop. Therefore, these complications are occurring more commonly. It is important to realize that these alterations of hemostasis exist and must be approached in a sequential and logical manner with respect to diagnosis; only in this way can responsible, efficacious, and rational therapy be delivered to patients. By far the most common alteration of hemostasis in malignancy is that of hemorrhage associated with thrombocytopenia, either drug-induced, radiation-induced, or from bone marrow invasion. However, hemorrhage resulting from DIC is also quite common and may present as hemorrhage, thrombosis, thromboembolus, or any combination thereof. Many antineoplastic drugs and radiation therapy may lead to or significantly enhance hemorrhage in patients with malignancy. Thrombosis, also commonly seen in patients with malignancy, is often a manifestation of low-grade DIC, conspicuous as an intravascular thrombotic or thromboembolic event instead of an intravascular proteolytic (hemorrhagic) event. When suspecting this, confirmatory laboratory evidence must be sought and the patient treated appropriately. When approaching the patient with malignancy and either hemorrhage or thrombosis, all the potential defects in hemostasis must be taken into account, defined from the laboratory standpoint, and treated in as precise and logical manner as possible.
Article
Recent progress in elucidating the complex and heterogeneous interactions between malignancy and coagulation or fibrinolysis reactions in humans has clarified the pathogenesis of disseminated intravascular coagulation that occurs with malignancy and has revealed evidence for two distinct pathways of growth regulation based on production by tumor cells of initiators of thrombin formation versus plasminogen activators. We have proposed a preliminary classification of tumors (see Table 2) based on these interactions. Type I tumors are those in which the tumor cells are associated with an intact coagulation pathway that leads to thrombin formation at the tumor periphery but in which the tumor cells lack u-PA. Examples of tumors in this category include SCCL, malignant melanoma, and renal cell carcinoma. Type II tumors are those in which the tumor cells express u-PA but lack an associated coagulation pathway leading to thrombin formation. Examples of type II tumors include prostate cancer, colon cancer, breast cancer, and N-SCLC. Type III tumors are those that express neither of these pathways, or exhibit some other pattern of interaction. Obviously, this formulation must be regarded as hypothetical. However, this concept fits with the limited data available to date from clinical trials. More importantly, this hypothesis can be tested further by means of intervention aimed at interrupting pathways relevant to specific tumor types. Characterization of additional tumor types by the methods described should permit amplification of this classification of tumors and other patterns of interaction may be defined. Exploration of the coagulation-cancer interaction holds considerable promise for gaining new understanding of both the coagulation mechanism and tumor biology. Most intriguing is the prospect that imaginative approaches to cancer treatment may be devised that are not only relatively nontoxic and low cost, but also effective.