Quantification of protein Z expression in lung adenocarcinoma tissues and cells

Abstract

As a regulator of coagulation, abnormal Protein Z (PZ) expression may lead to the formation of blood clots in humans. While previous studies have shown that PZ protein is altered in several types of cancer, however, additional observations are needed to understand the complex biology involved. Herein, we investigated local alterations in PZ expression in lung adenocarcinomas by measuring gene and protein expression in both cancerous and normal lung tissues. Twenty-two (22) specimens of lung adenocarcinoma and 22 specimens of normal lung tissues from human patients were compared for the expression of PZ. In addition, A549 adenocarcinoma cells were compared to a normal epithelial cell line, 16-HBE, for in vitro PZ expression. In tissues and cells, PZ protein and gene expression were determined using western blot, immunohistochemistry and PCR. Lung adenocarcinoma tissues showed elevated expression of both PZ mRNA and protein compared with healthy tissue. Only protein expression was increased in cultured cell lines, which holds implications for the dominant source of PZ in tissues, as well as protein modifications necessary for PZ function. Protein Z appears to be associated with the presence of lung adenocarcinoma and may be a viable prognostic biomarker for lung cancer.

Full text

Wang et al. SpringerPlus (2016) 5:1046
DOI 10.1186/s40064-016-2610-x
RESEARCH
Quantication ofprotein Z expression
inlung adenocarcinoma tissues andcells
Hong Wang1, Fang Huang2, Xue‑Yi Pan1*, Ze‑Bin Guan1, Wen‑Bing Zeng1, Ming‑Jie Li1
and Rui‑Hao Zhang1
Abstract
As a regulator of coagulation, abnormal Protein Z (PZ) expression may lead to the formation of blood clots in humans.
While previous studies have shown that PZ protein is altered in several types of cancer, however, additional observa‑
tions are needed to understand the complex biology involved. Herein, we investigated local alterations in PZ expres‑
sion in lung adenocarcinomas by measuring gene and protein expression in both cancerous and normal lung tissues.
Twenty‑two (22) specimens of lung adenocarcinoma and 22 specimens of normal lung tissues from human patients
were compared for the expression of PZ. In addition, A549 adenocarcinoma cells were compared to a normal epithe‑
lial cell line, 16‑HBE, for in vitro PZ expression. In tissues and cells, PZ protein and gene expression were determined
using western blot, immunohistochemistry and PCR. Lung adenocarcinoma tissues showed elevated expression of
both PZ mRNA and protein compared with healthy tissue. Only protein expression was increased in cultured cell lines,
which holds implications for the dominant source of PZ in tissues, as well as protein modifications necessary for PZ
function. Protein Z appears to be associated with the presence of lung adenocarcinoma and may be a viable prog‑
nostic biomarker for lung cancer.
Keywords: Lung adenocarcinoma, Protein Z, A549, 16‑HBE, PZI
© 2016 The Author(s). This article is distributed under the terms of the Creative Commons Attribution 4.0 International License
(http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium,
provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license,
and indicate if changes were made.
Background
Protein Z (PZ) is a vitamin K-dependent (VKD) glycopro-
tein that acts as a potent cofactor for the enzyme protein
Z-dependent protease inhibitor (ZPI). Together, these
proteins mediate thrombin activation and blood coagu-
lation by strongly inhibiting the activation of Factor Xa
(FXa). PZ shares structural similarities with other VKD
factors such as coagulation factor VII, IX, X, protein C
and protein S, but holds no intrinsic enzymatic activity
(Broze and Miletich 1984). While the specific mecha-
nism of PZ’s actions in the anticoagulation cascade is not
established, several reports demonstrate the formation of
a PZ/ZPI complex that inactivates FX, thereby inhibiting
the coagulation cascade prior to formation of the pro-
thrombin complex. In fact, the presence of PZ enhances
the inhibition of FXa by ZPI by 1000-fold (Fujimaki etal.
1998). In this regard, the traditional role of PZ in mediat-
ing anticoagulation is to serve as a critical factor in ZPI
and FX signaling (Tabatabai etal. 2001), ultimately con-
trolling thrombus formation.
romboembolisms are one of the most common ail-
ments in cancer patients, as many hemostatic complica-
tions can arise due to malignancy (Wojtukiewicz etal.
2001). An imbalance in pro- and anti-coagulation factors
may lead to blood coagulation abnormalities and vas-
cular disorders, which could further exacerbate cancer
progression, as well as attenuate immunologic defense
mechanisms and therapeutic efficacy of chemothera-
peutic drugs and other treatments (Sierko etal. 2012b;
Wojtukiewicz et al. 2007). e activation of FX has
been considered the most important step leading to the
formation of thrombin and fibrin in both normal and
pathologic conditions (Bick 1992; Falanga and Rickles
1999; Zacharski etal. 1992). However, it remains unclear
whether disruption of inhibition of FXa by PZ/ZPI spe-
cifically underlies the pathogenesis of thrombosis and
other blood coagulation disorders in cancer patients. Our
Open Access
*Correspondence: panxueyigyf@126.com
1 Department of Hematology, The First Affiliated Hospital of Guangdong
Pharmaceutical University, Guangzhou 510080, Guangdong,
People’s Republic of China
Full list of author information is available at the end of the article

Page 2 of 7
Wang et al. SpringerPlus (2016) 5:1046
previous studies have found that as malignant tumors
progress, plasma levels of PZ significantly decrease
(Shang etal. 2005), which indicates that PZ may be a fac-
tor contributing to poor prognosis in cancer patients. It
remains unclear, however, whether circulating concentra-
tions or local tissue PZ expression is primarily responsi-
ble for the downstream increase in thrombotic episodes
in patients. Abnormal tissue expression of PZ has been
observed in human cancers of the lung, breast, colon, and
stomach (Sierko etal. 2011, 2012a, b, 2014). Interestingly,
patients with these types of cancers are also more prone
to developing thrombosis.
Determining mechanisms by which local changes in
a tumor microenvironment lead to systemic changes in
an individual is an important aim in cancer research. In
the current study, we investigate PZ expression in lung
adenocarcinomas, which is highly metastatic and likely
to cause the development of thrombosis. We examined
the expression of PZ in cell cultures and in lung adeno-
carcinoma biopsies using Western blotting, immunohis-
tochemistry, and RT-PCR to observe any differences in
PZ in the local tumor environment compared to normal
tissue.
Subjects andmethods
Specimen collection
is study protocol adhered to the principles of Hel-
sinki and was confirmed by the ethics committee of the
First Affiliated Hospital of Guangdong Pharmaceuti-
cal University. A total of 22 specimens were collected
from pathologically-confirmed lung adenocarcinoma
patients who underwent surgery in the oracic
Department of the First Affiliated Hospital of Guang-
dong Pharmaceutical University between 2008 and
2011. Informed consent was obtained from all subjects
before the study. e average age of the patients was 59,
with 12 males and 10 females ranging from 27–80years
old. e cancerous tissue was collected from a primary
lesion, avoiding the necrotic and inflammatory sites,
while normal lung tissues were collected>5 cm, away
from the corresponding lesion. Upon surgical removal,
all specimens (0.5cm×0.5cm×0.2cm) were imme-
diately frozen in liquid nitrogen and stored at −80°C
until use.
Cell culture
Human bronchial epithelial 16-HBE cells and a lung
adenocarcinoma epithelial cell line, A549, were pro-
vided by the Experimental Medical Research Center at
the Guangzhou Medical University. Cells were grown in
DMEM supplemented with 10% FBS at 37°C in 5% CO2
and passaged twice. Cultures with a density of 5×105/ml
were used for all experiments.
Primer design
Primers were designed using Primer 6.0 software, synthe-
sized by Sangon Biotech (Shanghai, China), and ampli-
fied a 159bp product. Sequences are shown in Table1.
Tissue RNA extraction
Total RNA was extracted according to the manufacturer’s
instructions using TRIzol reagent, and precipitated RNA
was dissolved in 50μl DEPC-treated water. Agarose gel
electrophoresis showed three clear bands at 5, 18, and
28S. e absorbance of RNA samples at 260 and 280nm
was determined using UV spectroscopy and only samples
with A260/A280 ratio between 1.8 and 2.0 were used for
reverse transcription.
qRT‑PCR
cDNA was synthesized with 4μl total RNA using the Pri-
meScript TM RT Master Mix Kit (Takara) according to
the manufacturer’s instructions. Primer sets for PZ and
GAPDH are listed in Table1 (see “Primer design” sec-
tion). By using a real time PCR machine (MX3000P, Strat-
agene, USA), PCR reactions were performed in a total of
20μl reaction volume containing 10μl 2×Mix, 0.4μl
50×Rox, 3μl (F+R) primer (2μmol/L), 1μl cDNA, and
distilled water to make up to 20μl. e thermocycling
conditions were as follows: 30s at 95°C, followed by 40
cycles of 5s at 95°C, 30s at 56°C, and ended with 30s
at 72°C. e quantification of gene expression changes
were calculated as follows: (1) fold change=2−ΔΔCt;
(2) ΔΔCt = ΔCt treatment group − ΔCt control
group=(CT target gene−CT reference gene) treatment
group−(CT target gene−CT reference gene) control
group.
Immunohistochemistry
Immunohistochemical analysis was performed using
the Histostain-SP IHC Kit (Life Technologies) accord-
ing to the manufacture’s protocol. Briefly, tissue samples
were fixed in 10 % formalin, dehydrated, and paraffin-
embedded. Paraffin blocks were cut for 4μm-thick serial
sections, and antigen retrieval was performed by micro-
waving in a pH 8.0 sodium citrate solution. Monoclonal
mouse anti-human PZ antibody (Abcam, UK) (1:1600)
was used as primary antibody, followed by incubation
with ALP-conjugated goat anti-mouse IgG (1:5000), and
DAB was used as the chromogen. PZ-positive cells were
Table 1 Real time PCR primer Sequence (5′–3′)
PZ Forward: 5′‑GCCCTCCATCGTGTGGAGCC‑3′
Reverse: 5′‑TAAGCTTTCCTGGACGCCTGTGC‑3′
GAPDH Forward: 5′‑AAGAGAGGCATCCTCACCCT‑3′
Reverse: 5′‑TACATGGCTGGGGTGTTGAA‑3′

Page 3 of 7
Wang et al. SpringerPlus (2016) 5:1046
defined as cells with brown precipitates in the plasma.
Cells without staining were marked as negative (−); cells
stained light brown were marked as weakly positive (+);
cells stained dark brown were marked as strongly positive
(+++); and cells stained between weakly and strongly
positive were marked as moderately positive (++).
Staining was scored using a 13-point scoring system
(Sierko etal. 2014) based on the percentage of stained
cells (no cells stained = 0, <10 % = 1, 10–50 % = 2,
51–80%=3,>80%=4) and the intensity of the stain-
ing (negative staining=0, weak staining=1, moderate
staining=2, strong staining= 3). e final score was
determined by multiplying the percentage of positively
stained cell score with the intensity score (see Table2 for
a summary). All results were analyzed by two observers
that were blinded to the condition of the patients.
Western blotting
Total protein was extracted from the frozen tissue sam-
ples using ultrasound homogenization with SDS lysis
buffer (Beyotime Biotechnology, China). Lysates were
cleared by centrifugation at 4 °C. e collected super-
natants were measured for protein concentration using
a BCA protein assay before being separated on 10 %
SDS-PAGE gels and transferred to PVDF membranes.
e membranes were incubated overnight at 4°C with
anti-PZ antibody (Abnova Taiwan, 1:2500) in PBS with
1%BSA. e next day, membranes were washed and then
incubated for 2h at room temperature with ALP-con-
jugated secondary antibody (1:20,000). Protein signals
were detected using NBT/BCIP (Beyotime Institute of
Biotechnology) and analyzed with IPP software. e PZ/
actin ratio was used for statistical analysis.
Statistical analysis
All data are expressed as mean±standard deviation. Sta-
tistical analysis was performed using SPSS 19.0 by T test,
and p value<0.05 was considered statistically significant.
Results
mRNA expression ofPZ gene incells
We used SYBR-based quantitative fluorescence PCR to
detect the expression of PZ gene in the A549 lung ade-
nocarcinoma cell line and 16-HBE normal epithelial line,
using GADPH to normalize the samples. e dissociation
curves for both genes showed a single peak, suggesting
that no off-target products, such as primer dimers, were
formed. A549 adenocarcinoma cells exhibited a 1.06-fold
increase in PZ mRNA expression over 16-HBE cells, but
this increase was not statistically significant (Fig.1).
mRNA expression ofPZ inhuman lung adenocarcinoma
tissue samples
Similarly, we used SYBR-based quantitative fluorescence
PCR to detect the genetic expression of PZ in 22 lung
adenocarcinoma and 22 normal tissues. A single peak
was again observed, indicating that no off-target prod-
ucts such as primer dimers were formed. Compared with
normal tissue, PZ mRNA expression was 1.77-fold higher
in lung adenocarcinoma samples, which was statistically
significant (Fig.2).
Immunohistochemical analysis ofPZ inhuman lung
adenocarcinoma tissue samples
e expression of PZ in cancerous lung tissue was
increased, as indicated by intense brown staining in
Fig.3a. In contrast, healthy lung tissues showed minimal
expression of PZ (Fig.3c). Overall, PZ protein appears to
be expressed in macrophages and endothelial cells in the
newly formed vessels, which is in line with previous find-
ings (Sierko etal. 2012b).
Protein expression ofPZ inA549 and16‑HBE cells
As shown in Fig.4, western blot analysis shows a signifi-
cant 1.84-fold higher expression of PZ protein in A549
cells than 16-HBE epithelial cells. is suggests that the
expression level of PZ protein may be associated with
Table 2 Immunohistochemical results ofPZ inlung adeno-
carcinoma andhealthy lung tissue
Adenocarcinoma
tissue Healthy lung
tissue
Proportion of positive cells (%) >75 <25
Staining scores 58 9
Staining results 22/22 (100 %) 7/22 (31 %)
Fig. 1 PZ mRNA in cell cultures. In comparison with normal cells,
A549 adenocarcinoma cells exhibited a 1.06‑fold increase in PZ mRNA
expression. (P = 0.086)

Page 4 of 7
Wang et al. SpringerPlus (2016) 5:1046
cancerous cells. Furthermore, this change is likely to be
mediated by post-transcriptional or post-translational
modifications, as total PZ mRNA expression was mini-
mally altered (Fig.4).
Protein expression ofPZ inlung adenocarcinomas
andhealthy lung tissues
We next examined the expression of PZ protein in 22
lung adenocarcinoma and 22 healthy lung tissues via
western blotting. Representative images of the mem-
branes shown in Fig.5 illustrate that PZ expression is sig-
nificantly increased in cancerous tissues compared with
normal lung tissue.
Discussion
In order to examine whether protein Z (PZ) is altered
in primary cancer tissues, we studied PZ expression in
human lung adenocarcinomas, one of the most meta-
static and thrombosis-prone lung cancers. Using Western
blotting, immunohistochemical staining and real-time
PCR techniques, we examined the expression levels of
PZ in lung adenocarcinoma versus normal lung tissue.
Our results show increased expression of PZ in lung
adenocarcinoma tissues and higher expression in A549
than 16-HBE, which correlates with previous experimen-
tal results that provide a role for local PZ expression in
the biology of several types of cancer (Sierko etal. 2011,
2012a, b, 2014). Although additional studies are needed,
these results indicate that altered PZ expression plays a
role in the local pathobiology of lung cancer, possibly dis-
tinct from its global role as an anti-coagulant.
romboembolisms are commonly associated with
cancer malignancy, as global hemostatic changes are
observed in response to tumor formation and growth.
rombin and fibrin are largely known for their essen-
tial roles as coagulants in the blood. However, these and
other related pro-coagulants, such as tissue factor and
Factor X, have strong effects on cell biology aside from
blood clot formation. rombin, for example, stimu-
lates cancer cell proliferation and migration (Bick 1992;
Zacharski et al. 1992), and acts on endothelial cells to
stimulate angiogenesis and vascular permeability (Woj-
tukiewicz et al. 2001). Fibrin can act as a scaffold for
balancing mechanical tension during tumor growth, or
to bind growth factors that guide cell behavior or are
released upon fibrin degradation (Zacharski etal. 1992).
Often, an increase in the expression of coagulation fac-
tors naturally leads to an increase in the expression of
their inhibitors, which includes PZ (Sierko etal. 2012b).
While evidence of direct effects of PZ on different cell
types is minimal, studies have demonstrated a role for PZ
in normal angiogenesis (Butschkau etal. 2014), accumu-
lation of PZ around vascular lesions (Greten etal. 1998)
and increased PZ expression surrounding blood vessels
in breast cancer tissue (Sierko etal. 2011), all of which
indicate a more direct involvement of PZ in endothelial
and mural cell biology. Maintaining a balance between
pro- and anti-coagulant factors is, therefore, not only
critical for blood clot formation and degradation, but also
for proper cellular activation and homeostasis within tis-
sues themselves.
A relationship between PZ and cancer has been
observed, but experimental results are conflicting and
generally inconclusive. In liver cancer, it was found that
PZ might serve as a tumor suppressor (Neumann et al.
2012). In acute leukemia, reduced plasma PZ levels
were shown to increase the risk of bleeding in patients
(Galar etal. 2012). Another recent study reported a sig-
nificant drop of plasma PZ level in young acute lympho-
blastic leukemia (ALL) patients undergoing induction
therapy; however, this decrease did not correlate with
bleeding or thrombosis (Cankal et al. 2013), indicat-
ing non-traditional roles for PZ in cancer cell biology.
Sierko etal. recently showed an overexpression of PZ in
breast, lung, colon, and stomach cancer tissues (Sierko
Fig. 2 PZ mRNA in normal vs. cancerous tissue biopsies. Compared
to normal tissue, PZ mRNA expression was 1.77‑fold higher in lung
adenocarcinoma tissue, which was statistically significant (P = 0.023).
The altered PZ expression in adenocarcinoma patient samples, com‑
pared with normal tissues, suggests its involvement in the pathology
of lung adenocarcinoma

Page 5 of 7
Wang et al. SpringerPlus (2016) 5:1046
et al. 2011, 2012a, b, 2014). Additionally, they detected
elevated PZ expression in tissue-associated macrophages
and endothelial cells in cancer microenvironments, and
examined the expression and interactions of PZ, ZPI,
prothrombin fragments (F1+2), and fibrin in non-small-
cell lung carcinoma and colon cancer (Sierko etal. 2011,
2012a, b). eir findings suggest that PZ, through its
anticoagulation properties, affects tumor angiogenesis,
invasion and metastasis. On the other hand, our previ-
ous clinical studies have found that as a malignant tumor
progresses, circulating levels of PZ significantly decrease
(Broze and Miletich 1984). While this may seem conflict-
ing to the data presented here and by others (Sierko etal.
2011, 2012a, b, 2014), it could simply mean that certain
components of tumor (and tissue) microenvironments
may not be properly represented in the circulation, and
care should be taken during the establishment of truly
representative novel circulating biomarkers.
Conclusions
e current study confirms that PZ is locally present
in lung adenocarcinomas. Given what is known about
the biology of PZ, it may play a critical role in the
tumor microenvironment, or in the systemic response
to maintain homeostasis. We provide evidence that
PZ should be studied to determine its distinct roles in
tumor initiation, progression, angiogenesis and meta-
static potential. It is possible that PZ may serve as an
important target for treatments of lung adenocarcino-
mas and other tumors, and more experiments will help
Fig. 3 Representative images from immunohistochemical staining. In lung adenocarcinoma tissue (a), an increase in PZ staining (brown) is
observed. The black arrow indicates the cytoplasmic expression of PZ, while the red arrow and yellow arrow indicates the presence of PZ protein in
macrophages and endothelial cells, respectively. Scale bar 50 μm. b PZ protein was not expressed in the cytoplasm of cells in healthy lung tissue.
The positively stained cells are macrophages (red arrow) and endothelial cells (yellow arrow). Scale bar 50 μm

Page 6 of 7
Wang et al. SpringerPlus (2016) 5:1046
to determine the precise role of PZ in disease pathogen-
esis and progression.
Authors’ contributions
Conceived and designed the experiments: XYP. Performed the experiments:
HW, FH, ZBG, WBZ.Analyzed the data: HW, MJL, RHZ. Wrote the paper: HW, FH.
All authors read and approved the final manuscript.
Author details
1 Department of Hematology, The First Affiliated Hospital of Guangdong
Pharmaceutical University, Guangzhou 510080, Guangdong, People’s Republic
of China. 2 Department of Hematology, The Sixth Affiliated Hospital of Guang‑
zhou Medical University, Qingyuan People’s Hospital, Qingyuan 511518,
Guangdong, People’s Republic of China.
Acknowledgements
The authors would like to thank Dr. Qian‑Chen Yong for language editing of
this article. The authors declare no conflicts of interest related to this study.
Competing interests
All authors declare that they have no competing interests.
Funding
Xue‑Yi Pan has supported by Science and Technology Planning Project of
Guangdong Province, China (2014A020212415).
Received: 25 March 2016 Accepted: 17 June 2016
References
Bick RL (1992) Coagulation abnormalities in malignancy: a review. Semin
Thromb Hemost 18(4):353–372
Broze GJ, Miletich JP (1984) Human protein Z. J Clin Invest 73(4):933–938
Butschkau A, Wagner NM, Genz B, Vollmar B (2014) Protein z exerts pro‑angio‑
genic effects and upregulates CXCR4. PLoS ONE 9(12):e113554
Cankal A, Tufekci O, Gozmen S, Yuksel F, Vergin C, Irken G, Ören H (2013)
The evaluation of protein Z levels of children with acute lymphoblas‑
tic leukaemia during induction therapy. Blood Coagul Fibrinolysis
24(4):375–380
Falanga A, Rickles FR (1999) Pathophysiology of the thrombophilic state in the
cancer patient. Semin Thromb Hemost 25(2):173–182
Fujimaki K, Yamazaki T, Taniwaki M, Ichinose A (1998) The gene for human pro‑
tein Z is localized to chromosome 13 at band q34 and is coded by eight
regular exons and one alternative exon. Biochemistry 37(19):6838–6846
Galar M, Piszcz J, Bolkun L, Szumowska A, Kloczko J (2012) Protein Z con‑
centrations in patients with acute leukemia. Clin Appl Thromb Hemost
18(5):542–545
Greten J, Kreis I, Liliensiek B, Allenberg J, Amiral J, Ziegler R, Nawroth PP (1998)
Localisation of protein Z in vascular lesions of patients with atherosclero‑
sis. Vasa 27(3):144–148
Neumann O, Kesselmeier M, Geffers R, Pellegrino R, Radlwimmer B, Hoffmann
K, Ehemann V, Schemmer P, Schirmacher P, Lorenzo Bermejo J et al (2012)
Methylome analysis and integrative profiling of human HCCs identify
novel protumorigenic factors. Hepatology 56(5):1817–1827
Shang Y, Pan XY, Ding CP, Yang XM, Cai XY, Ding Y, Zhang RL (2005) Clinical
significance of protein Z detection in patients with malignant tumors.
Chin J Cancer 24(9):1144–1147
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Kisiel W (2011) Protein Z is
present in human breast cancer tissue. Int J Hematol 93(5):681–683
Sierko E, Wojtukiewicz MZ, Zimnoch L, Ostrowska‑Cichocka K, Tokajuk P,
Ramlau R, Kisiel W (2012a) Protein Z/protein Z‑dependent protease
inhibitor system in human non‑small‑cell lung cancer tissue. Thromb Res
129(4):e92–e96
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Ostrowska‑Cichocka K, Kisiel
W (2012b) Co‑localization of protein Z, protein Z‑Dependent protease
inhibitor and coagulation factor X in human colon cancer tissue:
Fig. 4 PZ protein expression is increased in adenocarcinoma cells.
Representative images illustrate that Western blotting of isolated
cells revealed a significant increase in PZ protein in A549 (adeno‑
carcinoma) cells compared to normal cells (16‑HBE). Samples were
normalized to actin and quantitated (*P = 0.017)
Fig. 5 PZ protein expression is upregulated in cancerous tissue
biopsies. Representative Western blots show that PZ expression is
highly upregulated in lung adenocarcinoma (LA) tissue compared
with normal lung tissue (NLT). Samples were normalized to actin and
quantitated (*P = 0.014)

Page 7 of 7
Wang et al. SpringerPlus (2016) 5:1046
implications for coagulation regulation on tumor cells. Thromb Res
129(4):e112–e118
Sierko E, Wojtukiewicz MZ, Zimnoch L, Tokajuk P, Ostrowska‑Cichocka K, Kisiel
W (2014) Protein Z/protein Z‑dependent protease inhibitor system in
loco in human gastric cancer. Ann Hematol 93(5):779–784
Tabatabai A, Fiehler R, Broze GJ (2001) Protein Z circulates in plasma in a
complex with protein Z‑dependent protease inhibitor. Thromb Haemost
85(4):655–660
Wojtukiewicz MZ, Sierko E, Klement P, Rak J (2001) The hemostatic system and
angiogenesis in malignancy. Neoplasia 3(5):371–384
Wojtukiewicz MZ, Sierko E, Kisiel W (2007) The role of hemostatic system
inhibitors in malignancy. Semin Thromb Hemost 33(7):621–642
Zacharski LR, Wojtukiewicz MZ, Costantini V, Ornstein DL, Memoli VA (1992)
Pathways of coagulation/fibrinolysis activation in malignancy. Semin
Thromb Hemost 18(1):104–116