Phenotypic and genetic analysis support distinct species status of the Red-backed Woodpecker (Lesser Sri Lanka Flameback: Dinopium psarodes) of Sri Lanka

Abstract

Hybridization has challenged taxonomy, since hybridizing forms could be stable evolutionary entities or ephemeral forms that are blending together. The island of Sri Lanka has 2 subspecies of the flameback woodpecker D. benghalense: D. b. jaffnense in the north and D. b. psarodes in the south. Red plumage separates the endemic phenotype D. b. psarodes from other subspecies of D. benghalense. Despite these differences, intermediate phenotypes in north-central Sri Lanka discouraged the elevation of D. b. psarodes into a full species. The recent HBW and BirdLife International checklist, however, has elevated D. b. psarodes to a full species (D. psarodes), primarily based on its plumage. To objectively evaluate whether this taxonomic elevation is warranted, we examined the phenotypic and genetic affinities of D. psarodes within the D. benghalense cluster. In doing that we provide the first quantitative phenotypic and genetic analysis across a hybrid zone for an Old World woodpecker group. We sampled woodpeckers along a line transect across the island and measured body shape/size, plumage, and genetic variation in a mitochondrial gene (Cytb). Plumage color ranged from red in the south to yellow in the north, with varying proportions of orange in north-central Sri Lanka (an area of ~66 km). Morphology (body shape/ size) and plumage characters showed a clear separation. There are 2 mitochondrial haplotype groups, one in the north and one in the south. A mixture of north and south haplotypes were seen in north-central Sri Lanka. Width of the hybrid zone suggests that some form of selection limits the spread of hybrids into the range of parental forms. Morphological, plumage, and genetic traits are all indicative of limited hybridization in a narrow zone between the 2 taxa, supporting the treatment of D. psarodes as a distinct species. This study provides an illustrative example of extensive hybridization between stable taxonomic entities, discouraging the practice of merging hybridizing forms as single species.

Full text

Volume 133, 2016, pp. 497–511
DOI: 10.1642/AUK-15-233.1
RESEARCH ARTICLE
Phenotypic and genetic analysis support distinct species status of the
Red-backed Woodpecker (Lesser Sri Lanka Flameback: Dinopium
psarodes) of Sri Lanka
Saminda P. Fernando,
1
Darren E. Irwin,
2
and Sampath S. Seneviratne
1
*
1
Avian Evolution Node, Department of Zoology, University of Colombo, Colombo, Sri Lanka
2
Biodiversity Research Centre & Department of Zoology, University of British Columbia, Vancouver, British Columbia, Canada
* Corresponding author: sam@sci.cmb.ac.lk
Submitted December 20, 2015; Accepted March 23, 2016; Published June 22, 2016
ABSTRACT
Hybridization has challenged taxonomy, since hybridizing forms could be stable evolutionary entities or ephemeral
forms that are blending together. The island of Sri Lanka has 2 subspecies of the flameback woodpecker D.
benghalense:D. b. jaffnense in the north and D. b. psarodes in the south. Red plumage separates the endemic
phenotype D. b. psarodes from other subspecies of D. benghalense. Despite these differences, intermediate
phenotypes in north-central Sri Lanka discouraged the elevation of D. b. psarodes into a full species. The recent
HBW and BirdLife International checklist, however, has elevated D. b. psarodes to a full species (D. psarodes),
primarily based on its plumage. To objectively evaluate whether this taxonomic elevation is warranted, we
examined the phenotypic and genetic affinities of D. psarodes within the D. benghalense cluster. In doing that we
provide the first quantitative phenotypic and genetic analysis across a hybrid zone for an Old World woodpecker
group. We sampled woodpeckers along a line transect across the island and measured body shape/size, plumage,
and genetic variation in a mitochondrial gene (Cytb). Plumage color ranged from red in the south to yellow in the
north, with varying proportions of orange in north-central Sri Lanka (an area of ~66 km). Morphology (body shape/
size) and plumage characters showed a clear separation. There are 2 mitochondrial haplotype groups, one in the
north and one in the south. A mixture of north and south haplotypes were seen in north-central Sri Lanka. Width of
the hybrid zone suggests that some form of selection limits the spread of hybrids into the range of parental forms.
Morphological, plumage, and genetic traits are all indicative of limited hybridization in a narrow zone between the
2 taxa, supporting the treatment of D. psarodes as a distinct species. This study provides an illustrative example of
extensive hybridization between stable taxonomic entities, discouraging the practice of merging hybridizing forms
as single species.
Keywords: Dinopium benghalense, island endemicity, flameback woodpeckers, hybridization, hybrid zone,
speciation, Sri Lanka
Ana
´lisis fenot´
ıpicos y gen ´
eticos apoyan el estatus de especie de Dinopium psarodes en Sri Lanka
RESUMEN
La hibridaci ´
on es desafiante para la taxonom´
ıa puesto que las formas que hibridan pueden ser entidades
evolutivamente estables o formas ef´
ımeras que se esta
´n mezclando. La isla de Sri Lanka tiene dos subespecies de
Dinopium benghalense;D. b. jaffnense en el norte y D. b. psarodes en el sur. El plumaje rojo separa el fenotipo end ´
emico
de D. b. psarodes del de otras subespecies de D. benghalense. A pesar de estas diferencias, la existencia de fenotipos
intermedios en el centro-norte de Sri Lanka previno la elevaci ´
on de D. b. psarodes al estatus de especie. Sin embargo, la
lista ma
´s reciente del Handbook of Birds of the World y Birdlife International elev ´
oaD. b. psarodes al rango de especie
(D. psarodes) basa
´ndose principalmente en el plumaje. Para evaluar objetivamente si se justifica este cambio
taxon ´
omico, examinamos las afinidades gen´
eticas y fenot´
ıpicas de D. psarodes en el grupo de D. benghalense.Al
hacerlo, presentamos el primer ana
´lisis cuantitativo fenot´
ıpico y gen´
etico a trav´
es de una zona de hibridaci ´
on de un
carpintero del viejo mundo. Muestreamos carpinteros a lo largo de un transecto que atravesaba la isla y medimos el
tama ˜
no y la forma del cuerpo, el plumaje y la variaci ´
on gen´
etica en un gen mitocondrial (Cytb). El color del plumaje
vari ´
o de rojo en el sur a amarillo en el norte, con naranja en diferentes proporciones en el centro-norte de Sri Lanka (un
a
´rea de ~66 km). Los caracteres morfol ´
ogicos (tama ˜
no y forma del cuerpo) y del plumaje mostraron una separaci ´
on
clara. Existen dos grupos de haplotipos mitocondriales, uno en el norte y otro en el sur. Se vio una mezcla de
haplotipos del norte y del sur en el centro-norte de Sri Lanka. El ancho de la zona de hibridaci ´
on sugiere que alguna
forma de selecci ´
on limita la dispersi ´
on de los h´
ıbridos hacia la zona de distribuci ´
on de las formas parentales. Todos los
rasgos morfol ´
ogicos, gen´
eticos y del plumaje indican que existe hibridaci ´
on limitada entre los dos taxones en una
Q2016 American Ornithologists’ Union. ISSN 0004-8038, electronic ISSN 1938-4254
Direct all requests to reproduce journal content to the Central Ornithology Publication Office at aoucospubs@gmail.com

zona estrecha, lo que apoya el estatus de especie de D. psarodes. Este estudio presenta un ejemplo ilustrativo de
hibridaci ´
on extensa entre entidades taxon ´
omicas estables, lo que desaconseja la pra
´ctica de unir formas que hibridan
en una sola especie.
Palabras clave: Dinopium benghalense,end
´
emicos de islas, especiaci ´
on, hibridaci ´
on, Sri Lanka, zona h´
ıbrida
INTRODUCTION
The woodpecker genus Dinopium has historically consist-
ed of 5 species from South and Southeast Asia, namely
Dinopium rattlesii,D. shorii,D. javanense,D. everetti,and
D. benghalense (Winkler et al. 1995, Winkler and Christie
2002, Clements et al. 2012). They are commonly called
flamebacks due to their golden-colored mantle, scapulars,
and folded wings. Among Dinopium, D. benghalense
consists of 6 subspecies or races, distributed across South
Asia (Gill and Donsker 2014), with 2 in Sri Lanka: D. b.
jaffnense (Golden-backed Woodpecker) in the north and
D. b. psarodes (Red-backed Woodpecker) in the south
(Rasmussen and Anderton 2012, Gorman 2014). Many
color variations have been observed within the Sri Lankan
forms (e.g., Legge 1880, Baker 1927, Wait 1931, Whister
1944, Philips 1953, Henry 1971, Rasmussen and Anderton
2012, Lamsfuss 2013, Gorman 2014, Fernando and
Seneviratne 2015, Freed et al. 2015).
The red-backed form of the Dinopium complex had
long been considered as endemic to Sri Lanka. Layard
(1853) classified the red-backed form as Brachypternus
ceylonus and the golden-backed form (D. b. jaffnense)asB.
aurantius. Legge (1880) reported the Red-backed Wood-
pecker B. ceylonus as an endemic species to Sri Lanka.
Both Legge (1880) and Wait (1931) commented on the
possible hybridization of the 2 island forms. Intermediate
phenotypes of Dinopium were reported as far back as
1868–1877 (Legge 1880). As a result, after Wait (1931), all
authors except del Hoyo et al. (2014) continued to adopt
the same taxonomic treatment of the 2 Sri Lankan forms
as members of D. benghalense (Baker 1927, Whistler 1944,
Ripley 1946, Ripley 1949, Philips 1953, Ali and Ripley 1983,
Ripley and Beehler 1990, Rasmussen and Anderton 2012).
The recent checklist of Birdlife International (del Hoyo
et al. 2014) elevated D. b. psarodes to a full species based
on a system proposed by Tobias et al. (2010). In this
system, a taxon is considered a separate species if an
overall differentiation score reaches 7. The overall score is
a sum of 2 elements: the quantification of differentiation in
3 main traits (morphology, voice, and biometrics) and 1
subsidiary trait (ecology and behavior), and the quantifi-
cation of geographical relationship (allopatry or parapatry
and the nature of the hybrid zone). In elevating the
subspecies D. b. psarodes into a full species, del Hoyo et al.
(2014) used the differences in its coloration (shining scarlet
on back shading to dull red on wings, lack of black in
carpal area), measurements (longer bill, wings, and tail)
and vocalization (louder and higher-pitched call) com-
pared to D. b. jaffnense.
Based on observations of plumage of Dinopium in the
wild, a recent paper (Freed et al. 2015) has described 8
intermediate plumage types, and assumed that these types
are of hybrid origin. Furthermore, Freed et al. (2015)
showed that these intermediate types are found in the
north-central part of the island. However, a quantitative
analysis of these different plumage patterns in the Dinopium
complex has not been attempted. Here we provide the first
comprehensive examination of phenotypic (body shape/size
and plumage) and genotypic variation across the 2 taxa of
the Dinopium benghalense complex in the island to
determine how well the criteria proposed by Tobias et al.
(2010) for avian taxonomy apply to this species complex
and to shed light on the complex biogeographic patterns
displayed in Dinopium in the South Asian region (de Silva et
al. 2014). We hypothesized that (1) D. psarodes is genetically
differentiated from the D. benghalense cluster in a way
corresponding to their phenotypic difference; (2) hybridiza-
tion occurs in the contact zone, resulting in hybrids that
have intermediate phenotypes and genotypes; and (3) partial
reproductive isolation is achieved through a narrow hybrid
zone maintained by selection against hybrids; if so, D.
psarodes is best treated as a separate species.
METHODS
Field Sampling
From April to December 2013, we captured flamebacks
using mist nets and dip nets along a 430 km transect
extending from the range of D. psarodes (Southern
Province; 06.048N, 79.558E) into the range of D. b.
jaffnense (Northern Province; 09.468N, 80.078E). Sites
were surveyed in intervals of ~50 km in allopatry and
~10 km in sympatry (i.e. across the transition zone
between the 2 forms) using optical and acoustic cues, and
playback of drumming calls. When a bird was located, call
playbacks and a decoy (a life-size replica made out of
plastic resembling a Dinopium male) were used to entice
the bird to fly to the mist net (Seneviratne et al. 2012).
From captured birds we measured morphology and
plumage, obtained a blood sample (~50 lL), a set of
photographs (to be maintained as a reference collection
for later phenotypic analysis), and determined the sex
(males have red crowns, females have white spots on the
forward part of their crowns). We geo-referenced the
capture site of each bird.
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
498 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

Museum Specimen Sampling
We examined 55 skins from different collections in the
National Museum of Sri Lanka (Appendix Table 6). Similar
to our treatment of live birds in the field, we measured
phenotypic characters (see below) and obtained a toe pad
for tissue sample (5 mg) and photographs from each skin.
A bench-mounted white light source was used to
illuminate specimens for photographs.
Morphology and Plumage Measurements
We measured 8 variables: culmen length, bill height and
bill width to calculate the bill breadth (sum of bill height
and width divided by 2); head length and head width to
calculate the size of the head (sum of head length and
width divided by 2); and flattened wing length, tail length,
length of hind reduced digit, first claw length, and tarsus
length (Baldwin et al. 1931, Seneviratne et al. 2012). A
single observer (S.F.) measured all the characters in both
field and museum specimens.
We evaluated 21 color-based characters: color of the
forehead, crown, mustache (malar) band, supercilium, face
region (between mustache and supercilium bands), chin,
breast, scapulars, back (mantle), rump, upper tail coverts,
tail, belly, primaries, secondaries, middle coverts, and
upper and lower wing coverts. Color analyses were based
on Munsell (1976) color charts. We measured 3 plumage
metric characters using a dial caliper (0.01 mm): mustache
width (measured ventral to the eye), width of the face
region, and width of the supercilium. A single observer
(S.F.) evaluated the intensity of carotenoid-based color
expression (black 0%, golden yellow 17%, yellow 33%,
orange 67%, red orange 83%, red 100%) in different
plumage patches. We also compared RGB (Red, Green,
Blue) and CMYK (Cyan, Magenta, Yellow, Black) values for
these above color patches and recorded percentages of
each color value (Fernando and Seneviratne 2015).
Amplification and Sequencing of Genes
We stored blood and toe pad samples in Queen’s lysis buffer
(Seutin et al. 1991) and extracted DNA using standard
phenol-chloroform DNA extraction. We followed the same
procedures that we used to amplify and sequence DNA
(Seneviratne et al. 2012) with several modifications. At least
4 samples per taxon were sequenced for all flameback taxa
presented in this study. Other sequences were obtained
from GenBank to construct a consensus sequence for each
species and identify species-diagnostic variation (Appendix
Table 7 and Appendix Table 8). To estimate genetic
relationships, we amplified and sequenced the cytochrome
b(Cytb) gene (see below) of the mitochondrial genome.
Mitochondrial Genome: Cytochrome b(Cytb; 481bp)
We amplified a 481 base pair (bp) region of Cytb, using the
primer combination Cyto_b_F and Cyto_b_R (Benz et al.
2006; Appendix Table 7). The PCR reaction mix was as
follows: 1X PCR buffer (Life Technologies, Carlsbad,
California, USA), 1.5 mM MgCl (Life Technologies), 0.2
mM dNTP mix (Promega, Madison, Wisconsin, USA), 0.5
mM Cyto_b_F and Cyto_b_R primers, 0.04 units/lLTaq
DNA polymerase (Life Technologies), and 2.5 ng/lL
template DNA, in a total volume of 10 lL. Thermal cycler
conditions for Cytb included an initial 3 min at 948C,
followed by 35 cycles of 20 s at 948C, 15 s at 538C, 60 s at
728C, followed by a 7 min final extension at 728C.
Sequence Alignment: Genotyping and Phylogenetic
Analysis
Sequences for other species of Dinopium and the outgroup
Picus from a neighboring biogeographic region were
downloaded from NCBI GenBank and all the sequences
were multiple aligned with clustalW (MBL-EBI, Wellcome
Trust Genome Campus, Cambridgeshire, UK) in Geneious
6.1.6 (Biomatters Limited, Auckland, New Zealand). Max-
imum-likelihood (ML) trees were generated using RaxML
(Exelixis Lab, Scientific Computing Group, Heidelberg
Institute for Theoretical Studies, Heidelberg, Germany),
using rapid bootstrap, for 1,000 replicates with the GTRþG
model using different outgroup species (Appendix Table 7).
Multiple sequences of Cytb of allopatric D. psarodes and
D. b. jaffnense were then aligned with the Zebra Finch
(Taeniopygia guttata) mitochondrial genome (Genebank
accession number NC_007897; our sequences aligning
within the range from 14246 to 14727 bp of the genome)
to identify nucleotide sites with differences between the 2
forms, such that those informative markers could be used
to genotype intermediate forms and estimate their
ancestry. A total of 16 haplotypes was identified, which
include 15 polymorphic sites. Analyses were done using
DnaSP program (http://www.ub.edu/dnasp). A taxonom-
ically informative G/A polymorphism was observed at
14391 bp, with allopatric D. b. jaffnense having nucleotide
G and allopatric D. psarodes having nucleotide A.
Cline Construction
We collapsed latitude and longitude data of sampled birds
to a single dimension by measuring the shortest geograph-
ic distance from the capture location of each bird to the
southeastern coast of mainland India (as shown in Figure
1A; we call this distance the ‘‘Geographic Distance’’). We
used the program CFit-7 (Gay et al. 2008, Lenormand and
Gay 2008) to estimate parameters for the best-fitting cline
for the Cytb marker (as in Seneviratne et al. 2012). The
cline was estimated as a simple sigmoidal curve across the
contact zone. We treated the genetic trait as a simple two-
allele system with each individual carrying a single Cytb
allele.
We also used CFit-7 (with the unimodal model) to fit
clines for PC1 scores of morphological and plumage
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 499

characters. However, to better visualize the clinal variation of
those phenotypic traits, we also fit cubic splines in program
R (R Development Core Team 2010). We used CFit-7 to test
whether the plumage, morphology, and genetic clines are
coincident (i.e. have the same location) and concordant (i.e.
have the same width); differences in location and width can
be due to different patterns of selection, dispersal, inheri-
tance, and associations between genes on these traits (Barton
and Hewitt 1985). We compared each of the 4 combinations
(unconstrained, centers constrained, slopes constrained, and
both center and slope constrained) of the 3 phenotypic and
genetic clines. The likelihood-ratio test and Akaike infor-
mation criterion (Akaike 1974) were used to determine the
best model with varying sets of constraints on cline centers
and slopes.
Testing Whether Selection Maintains the Hybrid Zone
To test whether selection maintains the zone width, we
compared the width obtained through cline analysis of
field samples across the hybrid zone with the expected
width of a neutrally expanding cline: w¼1.68rffiffiffiffi
T
p(Endler
1977, Brelsford and Irwin 2009), where wis the width of
the neutral cline, ris the root mean square dispersal per
generation (distance between parent and offspring breed-
ing sites), and Tis the time in generations since secondary
contact (Endler 1977). A narrow hybrid zone compared to
neutral expectations would suggest that some form of
selection maintains the zone (Barton and Hewitt 1989,
Jiggins and Mallet 2000).
No estimates of dispersal distance are available for
Dinopium or other Asian woodpeckers. Therefore we used
estimates of generation time and dispersal of a New World
woodpecker, the Northern Flicker (Colaptes auratus). Root
mean square dispersal (r) was estimated as 100 km per
generation (estimates for C. auratus; Moore and Buchanan
1985). Generation time was estimated as 1.9 years,
calculated as in Mila
´et al. (2007) based on the annual
survival rate (0.41–0.53; Wiebe 2006), geometric popula-
tion growth (assuming the population is in demographic
equilibrium k¼1; Mila
´et al. 2007), and the age of first
breeding (1 year; Walters et al. 2002a, 2002b). We
alternatively used a highly conservative estimate of root
mean square dispersal (r) based on North American
songbirds (10 km per generation; Paradis et al. 1998).
We considered 2 levels of time since secondary contact
of the parental taxa: 10,000 years and 160 years. The
climate and other biogeographic characteristics of Sri
Lanka remained more or less stable since the Miocene
period (Bossuyet et al. 2004). Therefore we assume the
secondary contact of D. psarodes and D. b. jaffnense took
FIGURE 1. Allopatric distribution of D. b. jaffnense and D. psarodes and the existence of a hybrid zone between the 2 forms as seen
from the capture locations of Dinopium flamebacks, frequency distribution of mitochondrial haplotype (Cytb), and the frequency
distribution of plumage color in Sri Lanka. (A) Capture locations of field and museum specimens. The lines indicate the distance from
the southeastern coast (Dhanushkodi) of mainland India. Squares denote field capture locations and triangles denote the locations
of museum specimens: green ¼D. b. jaffnense, orange ¼Dinopium intermediate, red ¼D. psarodes.(B) Frequency distribution of
mitochondrial haplotype (Cytb): green ¼northern haplotype, red ¼southern haplotype. (C) Frequency distribution of plumage color:
green ¼D. b. jaffnense, yellow/ red and yellow ¼Dinopium intermediate in the hybrid zone, red ¼D. psarodes. The 2 lines indicate the
northern and southern borders of the hybrid zone. The province boundaries are also shown.
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
500 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

place during the last complete exposure of the Adams
Bridge (the land bridge that connects Sri Lanka to the
mainland India) due to the drop of sea level ~10,000 years
ago (Ripley 1949, Hopkins 1967). However the secondary
contact may be more recent (de Silva et al. 2014). We used
160 years as our most conservative estimate of secondary
contact based on the time where the species was first
described to science in 1853 by the British ornithologist E.
L. Layard (note that intermediate phenotypes of Dinopium
were common in northern Sri Lanka even in 1868–1877;
Legge 1880).
Analysis of the Phenotype
To summarize patterns of variation between plumage and
size, we carried out separate principal components
analyses (PCA) using correlation matrices, first for the 8
morphological characters and second for the 21 plumage
characters. The principal axis method was used to extract
the components without rotation. The majority of
variation was captured by the first component (PC1) in
both analyses (morphometric and plumage) and only the
first 2 components displayed eigenvalues greater than 1.
Therefore we used the first 2 principal components for the
rest of the analysis. To examine the relationship between
the parental genotypes with parental phenotypes, we used
one-way ANOVA with Tukey’s family error post hoc test
(Sokal and Rohlf 1995). Since the residuals were not
normally distributed we performed a rank-based normal-
ization with Tukey’s formula. Shapiro–Wilk’s test was
executed to confirm normalization (P.0.05; Sokal and
Rohlf 1995). Significance level was set at P,0.05. All
statistical analyses were performed with SPSS 20.0 (IBM
Corporation, Armonk, New York, USA).
Evaluation of del Hoyo et al. (2014) Criteria of
Splitting D. benghalense
We compared our dataset with the data used by del
Hoyo et al. (2014) to split D. psarodes as a full species
following the criteria proposed by Tobias et al. (2010;
Table 1). Tobias et al. (2010) used the strength of
differentiation in various characters according to effect
sizes computed from the means and standard deviations.
Effect sizes are most commonly presented as the Cohen’s
dstatistic [d¼X
1
–X
2
/S
pooled ,
where X¼mean of
species 1 and 2, S¼standard deviation, and S
pooled
¼
ffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
f½ðn11ÞS2
1þðn21ÞS2
2=ðn1þn2Þg
pwhere n¼
number of individuals sampled in species 1 and 2], which
expresses the difference in means in terms of the amount of
within-group variation (Tobias et al. 2010). On the basis of
the distribution of effect sizes produced by empirical tests of
divergence in undisputed species, they have scored
character differences with an effect size of 0.2–2 as minor,
2–5 as medium, 5–10 as major, and .10 as exceptional.
RESULTS
We sampled 70 individuals across the island along a 430 km
transect; based on plumage these were identified as 41 D.
psarodes,17D. b. jaffnense, and 12 intermediate forms of
varied levels of orange plumage. These birds included 32
males and 38 females (sex was determined using plumage;
see Methods). We did not observe any sexual differences in
TABLE 1. Comparison of del Hoyo et al. (2014) analysis for splitting Dinopium psarodes as a full species with present data shows a
similar conclusion. ‘‘Scores’’ ¼introduced by del Hoyo et al. (2014).
Taxonomic
characters
del Hoyo et al. (2014) Our study
Minor characters Scores
Minor characters
(D. psarodes vs. D. b. jaffnense) Scores
Biometrics Longer billed
Longer winged
Longer tailed
Effective size ¼2.92
2 Longer billed (34.1 mm vs. 32.5 mm)
Longer winged (138.5 mm vs. 133.6 mm)
Longer tailed (94.7 mm vs. 86.9 mm)
Effective size ¼4.21
2
Acoustics Screechy call (louder and higher-pitched
call)
1 Not quantitatively analyzed (louder and
higher-pitched call)
1
Plumage and
bare parts
Scarlet central upper parts shading to dull
red on wings vs. golden yellow shading
to dull yellow
Lack of black on carpal
Effect size not reported
3
1
Contrasting difference in color
Red vs. golden yellow
Lack of black on carpal
Effective size ¼6.73
3
1
Ecology and
behavior
Non-overlapping differences in foraging/
breeding habitat
1 Non-overlapping differences in foraging/
breeding habitat
1
Geographical
relationship
Narrow hybrid zone 2 Narrow hybrid zone (hybridization between
D. psarodes and D. b. jaffnense occurs
over a range ,200 km at its maximum
point
2
Total scores 10 10
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 501

morphological traits in either species (one-way ANOVA, F
¼0.40, df ¼1 and 70, P¼0.53), other than the slight color
difference in forehead plumage. From the national collec-
tion we sampled 25 D. psarodes,8D. b. jaffnense,and22
intermediate types (Figure 2G). Since museum and field
data originated from different sampling locations (Figure
1A), we analyzed them separately.
Plumage color of the back ranges from red to yellow,
with many intermediate colors (Figure 2) as suggested by
previous authors (e.g., Fernando and Seneviratne 2015,
Freed et al. 2015). A clinal change of plumage characters
was observed along the line transect from Jaffna (northern
tip of the island: 9.468N, 80.078E) to Matara (southern tip
of the island: 6.048N, 80.388E; Figures 1C, 3C). All
individuals captured from Jaffna peninsula had yellow
backs (Figure 1A). All individuals captured from the core
of the wet zone (southern parts of the island) had crimson-
red backs (Figure 1A). The intermediate plumage colors
(orange) were found in varying proportions in the north-
central dry zone, from the southern border of Wilpathu
National Park (08.378N, 80.078E) up to Kilinochchi
(9.228N, 80.258E).
A clinal change of genetic characters (in Cytb) was
observed in the line transect across north-central Sri Lanka
(Table 2; Figures 1B, 3A). Allopatric D. b. jaffnense has a G
nucleotide and allopatric D. psarodes has an A at the
diagnostic polymorphic site in Cytb gene. In the sympatric
area a mixture of these Cytb types was found among the
intermediate phenotypes.
Our Cfit analysis positioned cline centers 83–149 km
(mean center ¼115 km) from the southeastern coast of
mainland India (Table 3). The Cytb-based genetic cline and
the center- and slope-constrained cline based on all traits
positioned the cline center at 115–117 km from the coast of
FIGURE 2. Color variation of Dinopium flamebacks in Sri Lanka: (A) crimson-red plumage (D. psarodes) (image courtesy of V.
Weeratunge), (B) reddish-orange form, (C) orange form, (D) orange-yellow form, (E) orange/reddish mantle, (F) golden-yellow
plumage (D. b. jaffnense) (image courtesy of V. Weeratunge), and (G) variation of back color in Dinopium flamebacks in the national
collection (image courtesy of the Department of National Museums, Sri Lanka).
TABLE 2. A composition of genotypes of flameback woodpeck-
ers at Cytb gene along the transect line showing a mixture of
genotypes among the intermediate phenotypes in the sympat-
ric area.
Phenotype Individuals
Cytb gene
Northern
allele
Southern
allele
Northern allopatric area
D. b. jaffnense 10 10
Sympatric area
D. b. jaffnense 642
D. psarodes 13 10 3
Dinopium intermediates 8 4 4
Southern allopatric area
D. psarodes 31 31
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
502 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

India (Table 3; Figure 3A). The widths of these clines range
from 18 to 142 km among different traits. The constrained
clines, which Akaike Information Criterion (AIC) values
indicate should be taken as the best model, gave the center
as 117 km and width as 118 km (Table 3). Cubic splines of
both morphological and plumage traits showed clinal
variation in the same area that of Cytb: ~117 km from
the southeast coast of India (line north of Putlum to
Vavunia; Figures 1C & 3). These 3 measured traits are
generally concordant in their centers and widths (Figure 3).
When we compare the empirical clines with hypothetical
neutral clines unaffected by selection, the empirical clines
were always narrower than the neutral clines. Assuming
that the secondary contact of D. psarodes and D. b. jaffnense
took place during the last complete exposure of the Adams
Bridge due to the drop of sea level (~10,000 years ago:
Ripley 1949, Hopkins 1967), and given the dispersal rate and
generation time of C. auratus, a neutral cline would have
now reached a width of ~1,700 km. A highly conservative
(i.e. minimal) estimate of time since recent contact between
taxa (160 years, based on Layard’s [1853] original descrip-
tion of the red form and dispersal rate of songbirds) would
give a width of 213 km. Just 15 years after this first
description came the documentation of intermediate
phenotypes between D. psarodes and D. b. jaffnense (Legge
1880). Assuming 1868 as the time of secondary contact
would give a cline width of 192 km—still a much wider cline
compared to the observed clines (112 km). The narrowness
of the empirical clines suggests some form of selection
constrains the width of the cline; such selection can be
considered a form of partial reproductive isolation that
hinders the blending of the 2 forms and stabilizes them as
distinct entities (Barton and Hewitt 1985, 1989).
Dinopium flamebacks in Sri Lanka all have red crowns,
and plain black napes and upper mantles (Figure 2A–F).
However, their backs have 2 predominant color types
(Figure 2A–F), crimson-red and olive-yellow, correspond-
ing to the 2 forms. The intermediate color forms range
from golden yellow (Figure 2F) to orange (Figure 2C). The
orange color is sometimes confined to the mantle, and
sometimes extends more prominently into the wings.
Secondaries and coverts show olive-yellow, golden yellow,
orange, and crimson red (Figure 2A–F). D. psarodes in the
extreme south has crimson-red shading in the primaries
and in the otherwise black rump as well (Figure 2A).
Similarly, the amount of black and white plumes on the
facial region and upper wing coverts shows slight variation
along the north–south transect. The northern (dry-zone)
birds of all color types have broader white supercilium and
malar stripes (mustache). Birds in the south (wet-zone)
have narrower white facial stripes (hence darker faces;
Figure 2A). Upper wing coverts are dotted with 2 rows of
white spots in northern birds (Figure 2E, 2F); these spots
are less prominent in the southern birds (Figure 2A). In all
TABLE 3. Comparison of genetic, plumage, and morphometric clines based on maximum log-likelihood estimates obtained from Cfit-7. Cline centers are in kilometers from
the nearest coast of mainland India. Likelihood ratio tests and Akaike Information Criterion (AIC) indicate that a single cline (Model 4) best represents variation in all of these
traits. *Asterisks indicate similar centers or widths due to constrained models.
Model
Allele (Cytb) Plumage Morphometric
Log-likelihood AIC
Comparison
115/112 v
2
PCenter (km) Width (km) Center (km) Width (km) Center (km) Width (km)
1. No constraint 115 142 149 82 83 18 188.36 408.72
2. Center constrained 73 250 * 138 * 4 190.56 417.84 1 and 2 4.4 0.89
3. Slope constrained 116 114 117 * 63 * 191.63 411.26 1 and 3 6.54 0.96
4. Center and slope constrained 117 118 * * * * 191.85 407.7 1 and 4 6.98 0.86
2 and 4 2.58 0.73
3 and 4 0.44 0.20
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 503

forms along the transect the throat is black, bill blackish
grey, iris chestnut, breast and belly have dark chevrons and
streaks, and legs are gray.
Bill length (i.e. total culmen), wing length, and tail
length are smaller in D. b. jaffnense than in D. psarodes and
intermediates (Table 4). In the morphology-based PCA,
PC1 explained 64.6% of the variation and described size
differences between the species (Table 5, Figure 4A). In the
morphological PCA, many traits contributed heavily to
PC1 (Table 5) and there was a clear separation of D.
psarodes and D. b. jaffnense in PC1 (ANOVA; P,0.001).
In the plumage PCA, PC1 captured 66.2% of the variation,
correlating well with all characters that tend to differ
between D. psarodes and D. b. jaffnense (ANOVA; P,
0.001; Table 5 and Figure 4B).
Both Sri Lankan and Indian yellow forms of D.
benghalense are clustered together, and form a sister group
to Sri Lankan red form (D. psarodes) at Cytb (Figure 5).
Our analysis of biometrics following Tobias et al. (2010)
and del Hoyo et al. (2014) is consistent with the latter
analysis (which resulted in splitting the D. psarodes into a
full species) but with a greater effect size (4.21 rather than
2.92). Likewise, the quantitative analysis of plumage and
bare parts (effect size 6.73), ecology, behavior, and
geographical relationship too are in accordance with del
Hoyo et al. (2014) (Table 1).
DISCUSSION
We examined phenotypic and genotypic relationships
within 2 distinct forms of Dinopium flamebacks in Sri
Lanka to test the validity of the newly elevated species D.
psarodes, the Red-backed Woodpecker or the Lesser Sri
Lanka Flameback (del Hoyo et al. 2014), a distinct form
endemic to the island of Sri Lanka. We documented clear
phenotypic and genetic evidence for a hybrid zone, and
find that this hybrid zone is narrower (112 km in width)
than that expected for a neutrally expanding zone. The
narrow hybrid zone suggests some form of selection acts
against hybrids; such selection is considered a form of
partial reproductive isolation (Barton and Hewitt 1985,
1989, AOU 1998, Brelsford and Irwin 2009).
Is D. psarodes a good species under the biological
species concept? We argue that despite extensive hybrid-
ization in sympatry, there are several key factors suggesting
that D. psarodes is best considered a distinct species. It is
phenotypically (Figures 2 and 4) and genetically (Figures
3A and 5) a distinct entity. Except for hybrids in this
narrow contact zone (Table 3), it does not show
intermediate phenotypes in the rest of its range, and
breeding areas of D. psarodes and D. b. jaffnense remain
largely separated from each other. When our data is
evaluated under the species-delimiting criteria used in
Tobias et al. (2010), we find strong support for the species
status of D. psarodes.
Phylogenetic affinities based on Cytb support D.
psarodes’s separation from D. benghalense cluster (Figure
5). A much broader phylogenetic analysis on this group
using very large amount of genomic sequence (152,311bp)
generated by Restriction Site Associated DNA (RAD)
sequencing also revealed a similar pattern (de Silva et al.
2014), where D. b. jaffnense cluster with the Indian forms
TABLE 4. Morphological and plumage traits measured in Dinopium flamebacks showing that beak, wing, and tail length of D.
psarodes are longer and supercilium and mustache width are narrower in D. psarodes than in D. b. jaffnense (mean 6SE, with data
range in parentheses).
Field sample (n¼70)
D. psarodes (n¼41) D. b. jaffnense (n¼17) Intermediate (n¼12)
Morphometric traits (mm)
Head length 29.66 61.93 (21.90–32.30) 30.52 60.97 (29.30–32.20) 30.42 61.67 (27.30–32.00)
Head width 21.82 60.76 (19.51–23.60) 21.26 60.55 (20.21–22.20) 21.28 60.90 (19.00–22.30)
Beak length 34.15 61.63* (30.61–36.70) 33.50 62.07 (30.60–37.22) 32.61 62.50 (29.80–36.90)
Bill height 8.96 61.00 (8.22–10.50) 8.91 60.54 (7.90–10.30) 8.76 60.85 (7.60–9.80)
Bill width 9.11 60.81 (7.42–11.00) 8.36 60.81 (6.72–9.55) 9.16 60.70 (7.90–10.10)
Flat-wing length 138.59 66.22* (130.52–142.20) 133.60 62.82 (129.00–138.00) 131.64 62.34 (129.00–135.00)
Tarsus length 27.50 61.99 (22.45–30.94) 24.14 61.01 (23.00–26.90) 25.90 62.03 (22.80–28.70)
Tail length 94.70 61.48* (76.00–139.00) 82.92 63.10 (79.00–91.00) 86.80 60.83 (74.00–98.00)
1st claw length 8.94 60.25 (8.30–9.65) 8.96 60.33 (8.40–9.50) 8.97 60.54 (8.10–9.80)
Length of the
reduced hind digit 4.40 60.98 (2.50–6.60) 4.16 60.66 (2.80–5.42) 4.68 60.94 (3.30–6.30)
Plumage traits**
Supercilium width 2.69 60.69* (1.30–4.32) 3.37 60.98 (1.50–6.12) 3.00 60.89 (1.80–4.20)
Face width 7.33 61.11 (4.55–9.20) 7.00 60.50 (6.32–8.00) 6.99 61.18 (5.20–8.54)
Mustache width 3.17 61.18* (1.40–8.92) 3.68 60.80 (2.00–5.00) 3.24 60.66 (2.40–4.40)
*P,0.05 compared to D. b. jaffnense (ANOVA with Tukey’s family error post hoc test).
** Length or width measured in millimeters (mm).
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
504 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

and the D. psarodes separates out as the sister group with
posterior probability of close to 1 (de Silva et al. 2014).
Our multivariate analysis further showed that D.
psarodes is a distinct phenotypic entity diagnosed by
crimson back, black rump and upper tail coverts, and
slightly longer tail and tarsus. Intermediate phenotypes
were clustered between the 2 parental phenotypes (Figures
3 and 4). The intermediates were found in the contact area
between the parental groups, in a narrow band north of
Puttalum to Killinochi in the north-central and north-
western parts of Sri Lanka (Figure 1). The center of the
hybrid zone lies roughly in the middle of this band (~112
km from the mainland; Figure 3). We found crimson-red,
red, orange-red, orange, golden yellow, and olive-yellow
phenotypes of Dinopium in this area (Figure 2). Legge
(1880) and several others over the past century have made
similar observations (see Introduction). We encountered
heterospecific pairs at the center of the hybrid zone as well.
For example, in Wilpattu National Park in northwestern
Sri Lanka (08.378N, 80.088E), we observed a nest with
nestlings where the parent male was a D. psarodes and the
female was a D. b. jaffnense. A previous observer also has
noted similar heterospecific pairs in this same region
(Freed et al. 2015).
Despite the plumage differences, these woodpeckers are
vocally very similar (Rasmussen and Anderton 2012). We
observed only subtle differences in the frequency in their
calls (S. Seneviratne personal observation). In fact both
species and their hybrids respond to each other’s playback
calls.
Sri Lanka has 2 main climatic zones. The southern one-
third of the island is the wet zone with over 2,500 mm
annual rainfall. The rest of the island, including the
TABLE 5. Variance explained and factor loading of the first 2
principal components (PC) produced in principal components
analyses (PCAs) of phenotypic traits: A) morphological traits and
B) plumage traits.In the morphological PCA, PC1 explained 64.6%
of the variation and described size differences between the
species, with each standardized morphological variable being
roughly equally correlated with PC1 (Figure 4). PC1 scores of
morphological traits separate the 2 species. The PC1 of plumage
captured 66.2% of the variation. PC2 of both morphological and
plumage traits captured minor amounts of variation.
Field samples (n¼70)
PC1 PC2
(A) Morphometric traits
Eigenvalue 2.67 0.80
Variance explained 64.6% 10.5%
Factor loadings
Tail length 0.53 0.30
Tarsus 0.34 0.49
Head width 0.54 0.23
1st claw length 0.43 0.30
Exposed culmen 0.64 0.11
Hind reduced digit 0.04 0.55
Flat-wing length 0.44 0.14
Head size 0.38 0.64
Head length 0.15 0.63
Bill height (mm) 0.34 0.050
Bill breadth 0.29 0.07
Bill width (mm) 0.11 0.04
(B) Plumage traits
Eigenvalue 3.82 1.17
Variance explained 66.2% 20.7%
Factor loadings
Back color 0.67 0.19
Rump color 0.86 0.15
Secondary coverts color 0.67 0.16
Supercilium width 0.43 0.66
Face width 0.23 0.59
Mustache width 0.26 0.74
TABLE 4. Extended.
Museum skins (n¼55)
D. psarodes (n¼25) D. b. jaffnense (n¼8) Intermediate (n¼22)
29.87 62.69 (25.60–35.90) 28.8 63.78 (25.80–36.20) 29.85 62.38 (24.80–36.20)
22.63 61.14 (20.00–25.00) 21.51 62.04 (20.00–25.40) 22.04 61.98 (18.20–25.40)
32.05 63.25 (21.80–37.80) 30.76 61.39 (29.10–33.10) 30.83 63.17 (29.10–31.30)
9.07 60.61 (8.00–10.80) 8.65 60.58 (8.10–9.70) 8.56 60.69 (8.10–9.70)
8.07 60.64 (6.90–9.40) 7.40 60.48 (6.82–8.11) 7.61 60.70 (6.80–8.10)
129.33 62.56 (108.00–142.00) 130.83 65.27 (125.00–138.00) 127.71 67.87 (125.00–138.00)
24.15 61.77 (21.50–28.20) 22.48 61.01 (21.50–24.00) 22.10 61.86 (21.50–24.00)
97.25 65.14 (89.00–111.00) 97.17 63.37 (92.00–102.00) 97.72 61.95 (92.00–102.00)
9.72 61.28 (7.00–12.00) 9.30 60.98 (7.60–10.40) 9.14 60.84 (7.70–10.40)
–––
2.47 60.58 (1.40–3.90) 3.00 60.62 (2.10–3.80) 2.90 60.55 (1.80–3.80)
6.54 61.10 (5.00–9.20) 6.10 61.30 (4.50–8.30) 6.49 61.02 (4.80–8.30)
3.05 60.59 (2.00–4.90) 3.71 60.51 (2.80–4.10) 3.55 60.84 (2.10–4.10)
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 505

northern parts near mainland India, is the dry-zone with
seasonal rainfall averaging ~1,500 mm (Ashton et al.
1997). The Sri Lankan endemic D. psarodes is bigger, and
has longer bill breadth and length, than D. b. jaffnense.A
possible reason is that the trees in the wet zone forests are
much bigger, such that the bigger bill of D. psarodes can
better excavate the thick bark. The supercilium and
mustache width of D. psarodes are narrower than that of
D. b. jaffnense (Table 4). The darker plumage coloration
and the longer beak are general patterns shown by the
birds in the wet zone of Sri Lanka compared to their dry-
zone and Indian counterparts (Ripley 1946, 1949, Ripley
and Bheeler 1990). This fits the general pattern of higher
humidity being associated with darker and bigger individ-
uals (Prum et al. 2012, Fernando and Seneviratne 2015).
Mainland India and northern Sri Lanka are similar in
humidity, and a similar plumage can likewise be found in
both the mainland and the island (Fernando and
Seneviratne 2015). D. psarodes is found in the dry zone
of Sri Lanka as well, but there they are found closer to
water bodies such as lakes and rivers, which are abundant
in the dry zone. This may indicate that D. psarodes prefers
humid habitats compared to its dry-zone counterpart.
Here we have provided the first comprehensive analysis
incorporating both phenotypic and genetic variation across
a hybrid zone for an Old World woodpecker group. We
FIGURE 3. Clinal variation of allele frequency, morphology, and plumage of Dinopium along an axis representing distance from the
southeastern coast of mainland India showing the allopatric distribution of D. b. jaffnense and D. psarodes and the presence of the
hybrid zone. Zero kilometers represents the nearest southeastern coastal line of India (Figure 1A). Points represent mitochondrial
haplotype frequency (red indicates southern Cytb haplotype and green indicates northern haplotype) in groups of local individuals
(A) or PC1 scores (morphological and plumage characters) of individuals (B–C: red dots indicate red forms, orange triangles indicate
intermediate forms, and green dots indicate yellow forms). The lines represent the best-fitting clines generated by CFit-7. Dark gray
area indicates the width of the genetic cline. (A) Cytb gene, (B) Morphology, (C) Plumage.
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
506 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

conclude that D. psarodes of Sri Lanka is both genetically
and phenotypically a distinct entity that warrants full
species status. Our study provides an example in which the
phenotype-based criteria proposed by Tobias et al. (2010)
for avian taxonomy are consistent with conclusions arrived
at through genetic and cline-based analyses. Hence the
conclusion of del Hoyo et al. (2014) to elevate D. psarodes
to a distinct species. Detailed studies on the amount of
introgression in the context of hybridization, the stability
of the hybrid zone and the fate of its hybrids, and the
ecology of the new species (D. psarodes) would shed more
light into this charismatic group of poorly known Asian
woodpeckers.
ACKNOWLEDGMENTS
Prof. Gaya Ranawaka of the Open University of Sri Lanka,
Prof. Sarath Kotagama and Prof. Preethi Udagama of
University of Colombo provided assistance in various stages.
We thank Kelum Manupriya and numerous other field
assistants for their assistance in the field. We thank Janaka
Perera, Indrika Kaggodaarachchi, Nelum Wickramasighe, and
Manori Goonathilaka for their assistance both in the field and
at the National Museum. Three anonymous reviewers and
Kristen Ruegg gave valuable comments to early versions of the
manuscript. The Department of National Museums provided
the needed permission to sample the national collection. The
Department of Wildlife Conservation (permit nos. WL/3/2/
FIGURE 4. Variation of morphological (A) and plumage (B) characters in adult D. b. jaffnense and D. psarodes showing clear
separation of D. psarodes only in plumage. Red ¼D. psarodes, orange ¼intermediate, green ¼D. b. jaffnense.
FIGURE 5. Molecular phylogenetic analysis by maximum-likelihood method for Cytb gene.
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 507

19/13 and WL/3/2/41/14) and Forest Department (permit no.
RE/RES/NFSRC/13) provided the permits to carry out the
study in the field.
Funding statement: A Collaborative Research Grant of the
University of Colombo to S.S.S. (AP/3/2012/CG/30) funded
this study. Our funder had no influence on the content of the
submitted or published manuscript and our funder did not
require approval of the final manuscript to be published.
Ethics statement: This study has been approved by the
Research Committees of the Department of Wildlife Conser-
vation of Sri Lanka (permit nos. WL/3/2/19/13 and WL/3/2/
41/14), the Forest Department of Sri Lanka (permit no. RE/
RES/NFSRC/13), and the Higher Degrees Committee of the
Faculty of Science, University of Colombo.
Author contributions: S.P.F. designed and conducted field-
work and laboratory experiments, performed the analysis, and
wrote the paper. D.E.I. assisted with formulating the research
question and writing the paper. S.S.S. conceived the idea,
formulated the research question, designed field and labora-
tory experiments, provided funding, and wrote the paper.
LITERATURE CITED
Ali, S., and S. D. Ripley (1983). Handbook of Birds of India and
Pakistan, Together with Those of Bangladesh, Nepal, Bhutan
and Sri Lanka. Oxford University Press, London, UK.
Akaike, H. (1974). A new look at the Statistical Model
Identification. IRRR Transactions on Automatic Control 19:
716–723.
American Ornithologists’ Union (1998). Checklist of North
American Birds, 7th edition. Available at http://www.
americanornithology.org/
Ashton, M. S., S. Gunatilaka, N. de Zoysa, M. D. Dassanayake, N.
Gunatilake, and S. Wijesundara (1997). A Field Guide to the
Common Trees and Shrubs of Sri Lanka. WHT Publications,
Colombo, Sri Lanka.
Baker, E. C. S. (1927). The Fauna of British India Including Ceylon
and Burma. Birds, Volume 4, 2nd edition. Taylor and Francis
Press, London, UK.
Baldwin, S. P., H. C. Oberholser, and L. G. Worley (1931).
Measurements of birds. Scientific Publications of the
Cleveland Museum of Natural History 2:1–165.
Barton, N. H., and G. M. Hewitt (1985). Analysis of hybrid zones.
Annual Review of Ecology and Systematics 16:113–148.
Barton, N. H., and G. M. Hewitt (1989). Adaptation, speciation
and hybrid zones. Nature 341:497–503.
Benz, B. W., M. B. Robbins, and A. T. Peterson (2006).
Evolutionary history of woodpeckers and allies (Aves:
Picidae): Placing key taxa on the phylogenetic tree. Molecular
Phylogenetic and Evolution 40:389–399.
Bossuyt, F., M. Meegaskumbura, N. Beenaerts, D. J. Gower, R.
Pethiyagoda, K. Roelants, A. Mannaert, M. Wilkinson, M. M.
Bahir, K. Manamendra-Arachchi, P. K. Ng, et al. (2004) Local
endemism within the Western Ghats–Sri Lanka biodiversity
hotspot. Science 306:479–481.
Brelsford, A., and D. E. Irwin (2009). Incipient speciation despite
little assortative mating: The Yellow-rumped Warbler hybrid
zone. Evolution 63:3050–3060.
Clements, J. F., T. S. Schulenberg, M. J. Iliff, B. L. Sullivan, C. L.
Wood, and D. Roberson (2012). The Clements Checklist of
Birds of the World, Version 6.7. Available at http://www.birds.
cornell.edu/clementschecklist/
de Silva, K. M., P. S. Dodangoda, and S. S. Seneviratne (2014). A
peculiar biogeographic history for a flame-back woodpecker
revealed through high throughput sequencing. 51st Meeting
of the Association of Tropical Biology and Conservation,
Cairns, Queensland, Australia.
del Hoyo, J., N. J. Collar, D. A. Christie, A. Elliott, and L. D. C.
Fishpool (2014). HBW and BirdLife International Illustrated
Checklist of the Birds of the World. Lynx Edicions, Barcelona,
Spain.
Endler, J. A. (1977). Geographic variation, speciation and clines.
Systematic Zoology 10:482–483.
Fernando, S. P., and S. S. Seneviratne (2015). Quantitative
analysis of the variation of plumage colouration in Dinopium
flame-back complex of Sri Lanka. Wildlanka 3:1–7.
Freed, L. A., D. Warakadoda, R. L. Cann, U. Sirivardana, and U.
Hettige (2015). A hybrid swarm of Dinopium woodpeckers in
Sri Lanka. Wilson Journal of Ornithology 127:13–20.
Gay, L., P. A., Crochet, D. A. Bell, and T. Lenormand (2008).
Comparing clines on molecular and phenotypic traits in
hybrid zones: A window on tension zone models. Evolution
62:2789–2806.
Gill, F., and D. Donsker (2014). IOC World Bird List (Version 4.4).
doi: 10.14344/IOC.ML.4.4
Gorman, G. (2014). Woodpeckers of the World: The Complete
Guide. Christopher Helm, London, UK.
Henry, G. M. (1971). A Guide to the Birds of Ceylon, 2nd edition.
Oxford University Press, London, UK.
Hopkins, D. M. (1967). The CenozoicHistory of Beringia: A Synthesis.
In The Bering Land Bridge (D. M. Hopkins, Editor). Stanford
University Press, Stanford, California, USA. pp. 451–484.
Jiggins, C. D., and J. Mallet (2000). Bimodal hybrid zones and
speciation. Trends in Ecology & Evolution 15:250–255.
Lamsfuss, G. (2013). Some comments on the Ceylon golden-back
and red backed woodpeckers, Ceylon Birds Club Notes May
2013:106–116.
Layard, E. L. (1853). Notes on the ornithology of Ceylon,
collected during an eight years’ residence on the island.
The Annals and Magazine of Natural History 12:165–176.
Lenormand, T., and L. Gay (2008). C-Fit: A very short overview.
Available for download with CFit-7 package from http://
www.cefe.cnrs.fr/fr/recherche/ee/gee/1038-desc/204-cfit
Legge, W. V. (1880). A History of the Birds of Ceylon. Tisara
Prakasakayo, Dehiwala, Sri Lanka.
Mila
´,B.,T.B.Smith,andR.K.Wayne(2007).Speciationand
rapid phenotypic differentiation in the Yellow-rumped
Warbler (Dendroica coronata) complex. Molecular Ecology
16:59–173.
Moore, W. S., and D. B. Buchanan (1985). Stability of the
Northern Flicker hybrid zone in historical times: Implications
for adaptive speciation theory. Evolution 39:135–151.
Munsell Color Company (1976). Munsell Book of Color.
Baltimore, Maryland, USA.
Paradis, E., S. R. Baille, W. J. Sutherland, and R. D. Gregory (1998).
Pattern of natal and breeding dispersal in birds. Journal of
Animal Ecology 67:518–536.
Philips, W. W. A. (1953). Nests and eggs of Ceylon birds (Picidae
and Capitonidae). Ceylon Journal of Science 25:35–45.
Prum, R. O., A. M. LaFountain, J. Berro, M. C. Stoddard, and H. A.
Frank (2012). Molecular diversity, metabolic transformation,
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
508 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

and evolution of carotenoid feather pigments in cotingas
(Aves: Cotingidae). Journal of Comparative Physiology and
Biology 182:1095–1116.
R Development Core Team (2010). R: A Language and
Environment for Statistical Computing. R Foundation for
Statistical Computing, Vienna, Austria. https://www.r-project.
org/
Rasmussen, P. C., and J. C. Anderton (2012). Birds of South Asia:
The Ripley Guide, volumes1 & 2. Smithsonian Institution,
Washington, D.C., USA, and Lynx Edicions, Barcelona, Spain.
Ripley, S. D. (1946). Comments on Ceylon Birds. Spolia Zeylanica
24:197–241
Ripley, S. D. (1949). Avian relics and double invasions in
peninsular India and Ceylon. Evolution 3:150–159.
Ripley, S. D., and B. M. Beehler (1990). Patterns of speciation in
Indian birds. Journal of Biogeography 17:639–648.
Seneviratne, S. S., D. P. L. Toews, A. Brelsford, and D. E. Irwin
(2012). Concordance of genetic and phenotypic characters
across a sapsucker hybrid zone. Journal of Avian Biology 43:
1–12.
Seutin, G., B. N. White, and P. T. Boag (1991). Preservation of
avian blood and tissue samples for DNA analyses. Canadian
Journal of Zoology 69:82–90.
Sokal, R. R., and F. J. Rohlf (1995). Biometry: The Principles and
Practice of Statistics in Biological Research. W. H. Freeman
and Company, New York, NY, USA.
Tobias, J. A., N. Seddon, C. N. Spottiswoode, J. D. Pilgrim, L. D. C.
Fishpool, and N. J. Collar (2010). Quantitative criteria for
species delimitation. Ibis 152:724–746.
Wait, W. E. (1931). Manual of the Birds of Ceylon, 2nd edition.
Dulau & Co. Ltd. London, UK.
Walters, E. L., E. H. Miller, and P. E. Lowther (2002a). Yellow-
bellied Sapsucker (Sphyrapicus varius). The Birds of North
America, no. 662 (A. Poole, Editor). Cornell Lab of Ornithol-
ogy, Ithaca, NY, USA. doi:10.2173/bna.662
Walters, E. L., E. H. Miller, and P. E. Lowther. (2002b). Red-
breasted Sapsucker (Sphyrapicus ruber) and Red-naped
Sapsucker (Sphyrapicus nuchalis). The Birds of North America,
no. 663 (A. Poole and F. Gill, Editors). The Birds of North
America, Inc., Philadelphia, PA, USA.
Whister, H. (1944). The avifaunal survey of Ceylon conducted
jointly by the British and Colombo Museums. Spolia
Zeylanica 23:1–27.
Wiebe, K. (2006). A review of adult survival rates in woodpeckers.
Annual Zoology Fennici 43:112–117.
Winker, H., and D. A. Christie (2002). Family Picidae (Woodpeckers).
In Handbook of the Birds of the World, Volume 7: Jacamars to
Woodpeckers (J. del Hoyo, A. Elliott, and Sargatal, J. Editors).
Lynx Edicions, Barcelona, Spain. pp. 296–432.
Winkler, H., D. A. Christie, and D. Nurney (1995). Woodpeckers:
An Identification Guide to the Woodpeckers of the World.
Houghton Mifflin Company, New York, USA.
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 509

APPENDIX
APPENDIX TABLE 6. Summary of the sampled specimens at the
National Collection, National Museum, Colombo, Sri Lanka.
Museum
number Collected date Species Sex
127-2 March 23, 1969 D. psarodes Male
127-V March 3, 1934 D. psarodes Female
127-I August 14, 1913 D. psarodes Male
127-Q November 7, 1923 D. psarodes Female
127-B August 21, 1905 D. psarodes Female
127 August 22, 1905 D. psarodes Male
127-R November 27, 1933 D. psarodes Male
127-T March 3, 1934 D. psarodes Male
127-Z May 16, 1961 D. psarodes Female
127-P May 22, 1932 D. psarodes Male
129-Z January 31, 1940 D. psarodes Male
129-X January 17, 1940 D. psarodes Male
129-T June 30, 1951 D. psarodes Female
127-E February 9, 1913 D. psarodes Male
127-X July 31, 1958 D. psarodes Male
127-1 September 13, 1961 D. psarodes Female
127-Y March 31, 1961 D. psarodes Female
127-A February 15, 1906 D. psarodes female
127-L November 8, 1923 D. psarodes female
127-K August 12, 1913 D. psarodes male
127-M December 2, 1920 D. psarodes female
127-N November 20, 1924 D. psarodes male
127-O November 7, 1923 D. psarodes female
127-D August 6, 1913 D. psarodes-HYB female
127-H August 23, 1905 D. psarodes male
126-Z May 30, 1947 D. b. jaffnense-HYB male
126-1 May 8, 1947 D. b. jaffnense male
126-i March 14, 1933 D. b. jaffnense-HYB female
126-Y February 17, 1959 D. b. jaffnense-HYB male
126-F September 10, 1919 D. b. jaffnense-HYB female
126-P July 1, 1951 D. b. jaffnense-HYB male
126-T November 17, 1953 D. b. jaffnense-HYB female
126-D August 13, 1913 D. b. jaffnense-HYB male
126-W May 28, 1958 D. b. jaffnense-HYB male
126-O June 29, 1951 D. b. jaffnense-HYB female
126-Q June 30, 1951 D. b. jaffnense-HYB male
126 February 15, 1954 D. b. jaffnense-HYB female
126-X February 15, 1952 D. b. jaffnense-HYB female
126-K March 21, 1933 D. b. jaffnense-HYB female
126-M July 23, 1945 D. b. jaffnense-HYB male
126-N July 1, 1945 D. b. jaffnense-HYB female
126-E January 23, 1911 D. b. jaffnense-HYB female
126 UNKNOWN D. b. jaffnense female
126-A April 15, 1904 D. b. jaffnense male
126-B April 15, 1904 D. b. jaffnense-HYB male
126-H March 14, 1933 D. b. jaffnense-HYB male
126-U February 9, 1956 D. b. jaffnense female
126-F September 10, 1919 D. b. jaffnense-HYB male
126-L July 22, 1945 D. b. jaffnense male
126-V February 14, 1956 D. b. jaffnense female
APPENDIX TABLE 7. List of primers used in the genetic analysis.
Gene Primer Sequence (50-30) Reference
Cytochrome b DINO_Cyto_b_F CGATTCTTCGCTTTACACTTCCTCC Benz et al. 2006
DINO_Cyto_b_R ATGAAGGGATGTTCTACTGGTTG
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
510 Phenotypic and genotypic analysis of Dinopium psarodes S. P. Fernando, D. E. Irwin, and S. S. Seneviratne

APPENDIX TABLE 8. Summary of the samples included in the molecular analysis. Voucher number indicates the catalog numbers of
Avian Evolution Node or NCBI Genbank.
Taxon
Country
of origin
Voucher
number
Accession number
Cytb LDH
In group
Dinopium shorii Myanmar B3291 DQ479273.1 NS
D. javanense India NRM20026532 KF765961.1 NS
D. benghalense India – KC439266.1 KJ455248.1
D. psarodes Sri Lanka MD18SS03 This study This study
MK13SF01
MK13SF02
MK13SF04
D. b. jaffnense Sri Lanka MG28SF01 This study This study
MI10SS01
MI10SS02
MI10SS03
D. psarodes/
D. b. jaffnense
Intermediate
Sri Lanka MF11SS01 NS NS
MF11SS02
MH29SF01
MH29SF02
Out group
Piculus chrysochloros – – NS NS
Picus viridis – – EU556833.1 NS
Picus flavinucha India NRM:20056713 NS KJ455282
NS ¼No sequence obtained
The Auk: Ornithological Advances 133:497–511, Q2016 American Ornithologists’ Union
S. P. Fernando, D. E. Irwin, and S. S. Seneviratne Phenotypic and genotypic analysis of Dinopium psarodes 511