Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Abstract

Bluetongue disease (BT) is a vector borne infectious but noncontagious disease of wild and domestic ruminants. The BTV isolate (7bp) of sheep origin was inoculated to 9-11 day old chicken embryo followed by BHK-21 cell culture. Upon appearance of 75% cytopathic effect in cell culture viral nucleic acid was extracted. The viral nucleic acid showed BTV specific migration pattern of 3:3:3:1 in RNA-PAGE.
The group specific ns1 gene RT-PCR confirmed the sample as BTV. The vp2 gene based serotype specific RT-PCR revealed the isolate as BTV16.The nucleic acid sequence of vp2 gene PCR products showed a high degree of identity (>99.0%) with other BTV16 isolates from different regions of India. It also showed maximum nucleotide identity of 99.7- 96.4% with several other eastern BTV16 viruses from India, Israel, Japan, Cyprus, Greece etc. Sequence identity study also revealed that 7bp isolate only showed 75.5% identity with western isolate of BTV16 from Nigeria. The phylogenetic study also showed a close relation between isolate in study and BTV16 isolates from India Japan, Israel and Greece which form a separate eastern cluster. Thus, molecular study showed that the isolate in study is of eastern origin and closer to BTV16 isolates from India, Greece, Japan, and Israel. Key words: Bluetongue Virus 16; Topotype; vp2 Gene; RT-PCR.

Full text

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
43
Journal of Microbiology and Related Research
Volume 2 Number 1, January - June 2016
DOI: http ://dx.doi.org/10.210 88/jmrr.23 95.6 623.2116.7 Original Article
Molecular Typing of Bluetongue Virus 16 From Karnataka State of India
Author Aff iliation
*Department of Animal
Biotechnology, LLR University of
Veterinary and Animal Sciences,
Hisa r, Haryana, 125004.
**Department of Veterinary
Physiology and Biochemistry, SVP
University of Agriculture and
Technology, Meerut, Uttar
Pradesh, 250110. *** SVP
University of Agriculture and
Technology, Meerut, Uttar
Pra desh, 250110.
Reprint Request
Minakshi Prasad, Professor
and Head, Department of Animal
Biotechnology, LLR University of
Veterinary and Animal Sciences,
Hisa r, Haryana, 125004.
E-mail:
minakshi.abt@gmail.com
© Red Flower Publication Pvt. Ltd.
Koushlesh Ranjan*, Minakshi Prasad**, Upendera Lambe**, Madhusudan Guray**, Gaya
Prasad***
Abstract
Bluetongue disease (BT) is a vector borne infectious but non-
contagious disease of wild and domestic ruminants. The BTV isolate
(7bp) of sheep origin was inoculated to 9-11 day old chicken embryo
followed by BHK-21 cell culture. Upon appearance of 75% cytopathic
effect in cell culture viral nucleic acid was extracted. The viral nucleic
acid showed BTV specific migration pattern of 3:3:3:1 in RNA-PAGE.
The group specific ns1 gene RT-PCR confirmed the sample as BTV. The
vp2 gene based serotype specific RT-PCR revealed the isolate as BTV16.
The nucleic acid sequence of vp2 gene PCR products showed a high
degree of identity (>99.0%) with other BTV16 isolates from different
regions of India. It also showed maximum nucleotide identity of 99.7-
96.4% with several other eastern BTV16 viruses from India, Israel, Japan,
Cyprus, Greece etc. Sequence identity study also revealed that 7bp isolate
only showed 75.5% identity with western isolate of BTV16 from Nigeria.
The phylogenetic study also showed a close relation between isolate in
study and BTV16 isolates from India Japan, Israel and Greece which
form a separate eastern cluster. Thus, molecular study showed that the
isolate in study is of eastern origin and closer to BTV16 isolates from
India, Greece, Japan, and Israel.
Key words: Bluetongue Virus 16; Topotype; vp2 Gene; RT-PCR.
Introduction
Bluetongue (BT) is non-contagious and
infectious viral disease of domestic and wild
ruminants in several parts of the world. BT is caused
by Bluetongue virus (BTV) of genus Orbivirus under
family Reoviridae. BT is a vector borne disease and
transmitted by Culicoides vector (MacLachlan, 1994).
BT is characterized by high morbidity, mortality, still
birth, foetal abnormality, abortion, weight loss, wool
break, reduced meat and milk yield which lead to
huge economic loss to farming community and
livestock industry. The clinical form of BT is
characterized by pyrexia, swelling of tongue and lips,
coronitis, cyanotic discoloration of tongue and
muzzle which may lead to death. However,
subclinical infection of BT may also cause reduced
milk yield, loss of condition and abortion leading to
infertility in animals (Osburn, 1994). Therefore, due
to severe economic losses mandatory disease
surveillance and trade barrier have been imposed on
movement of ruminant animals, their products and
germplasm from BT endemic countries to BT free
countries (Velthuis et al., 2009). The disease is seen in
more severe form in sheep and white-tailed deer
(Howerth et al., 1988; Darpel et al., 2007). Several other
domestic animals such as buffalo, cattle and goats

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
44
act as silent reservoirs and may remain viraemic for
several months post infection (Maclachlan et al.,
2009). BT may infect several species of domestic and
wild ruminanats. Therefore, it is listed as multi species
disease by Office International des Epizooties (OIE,
2013).
BTV is icosahedral virus having ten segmented
linear double-stranded RNA (dsRNA) genome. The
BT genome segments encode 7 structural (VP1 to
VP7) and 4 non-structural proteins (NS1, NS2, NS3/
NS3a and NS4). The structural proteins play
essential role in viral nucleic acid replication and
viral capsid assembly. However, non-structural
proteins have role in egression of viral particle from
infected cell (Mertens et al., 1989; Ratinier et al.,
2011). They are produced in infected host cells only.
The viral inner capsid is composed of two major
proteins (VP3 and VP7) and three minor proteins
(VP1, VP4, and VP6) (Roy, 1989). Similarly, outer
capsid is consists of major and minor serotype
specific VP2 and VP5 proteins for individual BTV
serotype (Ghiasi et al., 1987).
Because of segmented nature of BTV genome,
reassortment is a common phenomenon. BT viruses
exchange genome segments with other BT viruses
which lead to evolution of newer serotypes. There
are twenty seven distinct BTV serotypes (BTV1 to
BTV27) have been reported worldwide (Hofmann et
al., 2008; Maan et al., 2011; Jenckel et al., 2015). A
large number of BTV serotypes have also been
reported from India. The serum neutralization assay
and virus isolation in cell culture showed the
prevalence of 22 distinct BTV serotypes in different
geographical regions of India (Prasad et al., 2009;
Susmitha et al., 2012). Several serotypes of BTV have
been isolated from Karnataka state. In this study vp2
gene based molecular characterization of BTV isolate
of sheep origin from Karnataka state has been
reported.
Materials and Methods
Sample Preparation
The Blood sample was collected from a sheep
suspected for BTV infection from Karnataka state in
2009. The blood sample was designated as 7bp. The
sample was processed by ultrasonication followed
by filtration. The filtrate was inoculated to 9-11 day
old chicken embryo through intravenous route. On
7 day post inoculation, embryo showing
embryopathic effect was harvested. The embryonic
fluid was inoculated to one day old monolayer of
BHK-21 cell culture.
Viral Nucleic Acid Extraction and RNA-PAGE
BHK-21 cells were harvested after appearance of
about 75% cytopathic effect (CPE). The harvested
BHK-21 cells were centrifuged at 2000Xg for 10
minutes (Remi, India). The supernatant materials
were discarded and pellet was used for viral dsRNA
extraction using Guanidinium isothiocynate method
(Chomoczynski and Sacchi, 1987). The viral nucleic
acid was subjected to 8% RNA-poly acrylamide gel
electrophoresis (RNA-PAGE). The BTV specific
nucleic acid was visualized using silver staining
(Svensson et al., 1986).
cDNA Preparation and PCR
The viral nucleic acid was used for cDNA
preparation using moloney murine leukemia (Mo-
MuLV-RT) virus reverse transcriptase enzyme
(Sibzyme, Russia) and random decamer primer
(Ambion, USA) in thermal cycler (Biorad i-Cycler,
USA) as per manufacturer’s protocol. The cDNA was
allowed for group specific ns1 gene based PCR to
confirm the samples as BTV. The group specific PCR
was performed using primer pairs F:
5’GTTCTCTAGTTGGCAACCACC3’ and R: 5’
AAGCCAGACTGTTTCCCGAT3’ which produced
an amplicon of 274bp size in agarose gel
electrophoresis (Prasad et al., 1999).
The serotype of virus isolate was confirmed by vp2
gene based serotype specific RT-PCR using primers
specific to all the BTV serotypes. The cDNA was
allowed to PCR using individual serotype specific
primers in a 20 µl reaction mixture having 20 µM of
serotype specific primers, 2 µl cDNA, 3% DMSO, 0.4
µl of 10mM dNTPs mix (Finnzyme, Finland), 4 µl 5X
HF buffer and 0.4 U (2U/ µl) phusion high- fidelity
DNA polymerase (Finnzyme, Finland) in thermal
cycler (Biorad iCycler, USA). The PCR amplification
cycle was set as initial denaturation at 98°C for 2
minute, followed by 32 cycles of denaturation at 98°C
for 10 second, primer extension at 72°C for 20 second
and annealing for 20 second at 55°C. The final PCR
extension was allowed at 72°C for 10 minute. The
PCR products were visualized using gel
documentation system (Biovis, USA) in 1% agarose
gel (Sigma, USA) electrophoresis.
Nucleic Acid Sequencing and Sequence Data Analysis
The vp2 gene specific PCR products were purified
using QIA quick gel extraction kit (Qiagen, USA). The
purified PCR products were allowed for nucleic acid
sequencing using serotype specific forward and
reverse primers for final serotype confirmation. The
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
45
nucleic acid sequencing reaction was performed in
Genetic Analyser ABI PREISM TM 3130 XL machine
using BigDye® Terminator v3.1 Cycle Sequencing Kit
(Applied Biosystems, USA) as per the manufacturer’s
instruction in our departmental laboratory.
The nucleic acid sequence data obtained was
allowed for online available BLASTN+ 2.3.1 search
(Zhang et al., 2000) for serotype confirmation. The
forward and reverse sequences of virus were aligned
to generate contig sequences using Bioedit v7.2.5
software (Hall, 1999), which were used for further
analysis. The percent nucleotide identity with global
isolates of BTV16 was calculated using Bioedit v7.2.5
software (Hall, 1999). The phylogenetic analysis of
vp2 gene sequences of our isolate (7bp) along with
other global sequences were done using Mega 6
programme (Tamura et al., 2013).
Results and Discussion
India has several BTV serotypes reported from
different geographical regions. In the present study,
one of the BTV isolate (7bp) was isolated from sheep
in Karnataka state, adapted in BHK21 cell line and
used for vp2 gene based serotyping and molecular
characterization. The 7bp isolate adapted to BHK-21
cell line produced BTV specific CPE such as
vacuolation in cells, aggregation and rounding of
cells, floating of dead cells in medium within 36 hours
(Sekar et al. 2009) (Figure 1). The viral nucleic acid
was extracted using Guanidinium isothiocynate
method (Chomoczynski and Sacchi, 1987) from
pelleted cell culture materials and screened by RNA-
PAGE followed by silver staining. The RNA-PAGE
analysis showed characteristics BTV specific
migration pattern (3:3:3:1) of viral dsRNA (data not
shown). The viral nucleic acid was subjected to group
specific ns1 gene based RT-PCR. The ns1 gene PCR
amplicon showed 274bp product size on agarose gel
electrophoresis. This indicates the sample as BTV
(Figure 2). The characteristic CPE in BHK-21 cell
culture, specific migration pattern of viral nucleic acid
(3:3:3:1) in RNA-PAGE and 274 bp amplicon of
ns1gene group specific RT-PCR confirmed the
samples as BTV.
Further, the cDNA of 7bp isolate was allowed for
serotype specific RT-PCR using vp2 gene specific
primers for all the BTV serotypes. The PCR amplicon
showed 768bp amplification product on agarose gel
electrophoresis, which is specific for BTV16 serotype
(Figure 3). The remaining serotype specific primers
did not show any amplification. Thus the 7bp isolate
was serotyped as BTV16. For final confirmation of
serotype of 7bp the vp2 gene PCR product was
allowed for direct nucleic acid sequencing. The
BLASTN+ 2.3.1 search of nucleotide sequence of vp2
gene of 7bp isolate showed the maximum identity
only with several isolates of BTV16 from different
regions of the world. Thus, vp2 gene specific RT-PCR
followed by nucleotide sequencing confirmed the 7bp
isolate as BTV16. The nucleotide sequence of 7bp
isolate was deposited to GenBank database and
accession number GU931316 was assigned. The
contig sequence of 7bp isolate was generated and
percent nucleotide sequence identity of 7bp isolate
with several other BTV16 isolates from India and
different regions of the world were calculated using
Bioedit v7.2.5 (Hall, 1999) programme (Table 1).
The nucleotide sequence identity analysis showed
that 7bp isolate (accession number GU931316)
possessed 99.7% nucleotide identity with IND2010/
cattle/16 (accession no JX007924), Sheep/2010/Ind/
Hisar (accession no JQ904061) and IND/Goat/2010/
16/HSR (Minakshi et al., 2012) isolate of BTV16 from
India. However, 7bp isolate also showed nucleotide
identity of 99.4-98.0% with several Indian BTV16
isolates such as G53/ABT/HSR, CU-NAU/IND/
2010 (accession no JQ478482), INDAPMBNAP04/
10 (accession no KC751423), G4/IND/2011
(Dadawala et al., 2013), VJW66/IND (Minakshi et
al., 2015), GNT-27/IND (Minakshi et al., 2015), G53/
IND/2011 (Dadawala et al., 2013) and MBN48/IND
(Minakshi et al., 2015).
The 7bp isolate also showed nucleotide identity of
97.7-94.6% with several isolates from Israel (ISR2008/
03, BTV16/ISR-2404/08 and BTV16/ISR-2228/08)
(Nomikou et al., 2015), Greece (GRE2008/10, BTV-
16/Gree1999/13(S-2) and GRE1999/13) (Nomikou
et al., 2015), Cyprus (CYP2006/01) (Nomikou et al.,
2015), Japan (MZ-1/C/01) (Shirafuji et al., 2012) and
South Africa (RSArrrr/16) (Maan et al., 2004) (Table 1).
The BTV nucleotide sequence analysis from
different geographical regions of globe broadly
categorised BTV in to ‘eastern’ or ‘western’ topotypes
(Maan et al., 2010). The sequence analysis of 7bp
isolate showed an overall nucleotide identity of 99.7-
94.6% identity with several eastern BTV16 viruses
from India, Israel, Japan, South Africa, Greece and
Cyprus. However, 7bp isolate showed only 75.5%
nucleotide identity with Western isolate (NIG1982/
10) of BTV16 from Nigeria (Mertens et al., 2013). Thus,
it confirmed the eastern origin of 7bp isolate.
The phylogenetic study of BTV16 nucleotide
sequences using Mega 6 software programme formed
two separate major, western and eastern clusters. The
isolate in study (7bp) formed a separate close cluster
with several other Indian BTV16 viruses (IND2010/
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
46
cattle/16, Sheep/2010/Ind/Hisar, IND/Goat/2010/
16/HSR, Cattle/2010/Ind/Hisar and
INDAPMBNAP04/10) under eastern cluster. They
were also found slightly distantly related to other
eastern BTV16 isolates from India, Japan, Greece,
Israel, South Africa and Cyprus. The BTV16 from
Nigeria (Isolate NIG1982/10) was placed in western
cluster (Mertens et al., 2013). Thus phylogenetic and
sequence identity study revealed that 7bp isolate was
found much closer to BTV16 isolates from Indian,
Japanese, Israel or Greece.
India is a rainy tropical country which provides
suitable environment for Culicoides vector growth and
multiplication. Out of more than 1400 different
Culicoides species globally reported, about 63 are
identified from different geographical regions of India
(Reddy et al., 2008; Halder et al., 2013; Archana et al.,
2014). Thus, persistence of large numbers of Culicoides
vectors explains the prevalence of 22 different BTV
serotypes in India. The serological study revealed the
presence of antibodies against BTV in several species
of wild and domestic ruminants in India (Prasad et
al., 1998).
Karnataka state is one of the major hubs of BT
infection in India. Based on virus isolation and serum
neutralization several BTV serotypes such as 1, 2, 4,
12, 16, 17, 18, 20 and 23 have been reported from
Karnataka state (Prasad et al., 2009). Moreover, BTV16
was also reported from sheep population in adjoining
states such as Tamil Nadu (isolate IND/Goat/2010/
16/HSR) (Minakshi et al., 2012) and Andhra Pradesh
(isolate, VJW66/IND, GNT-27/IND and MBN48/
IND) (Minakshi et al., 2015).
The 7bp isolate showed a high degree of identity
(99.7-98.0%) with several isolates of BTV16 from Tamil
Nadu and Andhra Pradesh. Since Tamil Nadu and
Andhra Pradesh states are neighbouring states to
Karnataka and are also endemic for a known BTV
vector (Culicoides oxystoma) in India (Minakshi, 2010).
Thus, it may be assumed that BTV16 might be
transmitted from neighbouring states to Karnataka
either through vectors or migrating sheep population
or through wind velocity. Moreover, due to serious
BTV16 outbreaks in some states of India such as
Andhra Pradesh, Karnataka, Gujarat and Tamil
Nadu, it is included in inactivated Pentavalent
vaccine formulation along with other serotypes such
as 1, 2, 10 and 23 (Reddy et al., 2010). However, the
knowledge about the molecular epidemiology of all
the BTV serotypes is essential for a successful BTV
control programme. The conventional serotyping
methods along with molecular tests such as RT-PCR
based typing and nucleic acid sequencing can be used
for BTV surveillance in a particular geographical
area. The surveillance information can be used for
proper BT vaccine formulation.
Table 1: Percent nucleotide identity of vp2 gene of 7bp isolate with other bluetongue virus 16 from
different regions of the world
S.
N
.
BTV16 vp2 gene sequences
7bp.GU931316.India
Percent nucleotide identity
1
7bp.GU931316.India
100
2 IND2010/cattle/16.JX007924.India 99.7
3
Sheep/2010/Ind/Hisar.JQ904061.India
99.7
4
IND/Goat/2010/16/HSR.JQ924821.India
99.7
5 G53/ABT/HSR.KF664134.India 99.4
6
Cattle/2010/Ind/Hisar.JQ904063.
India
99.2
7 Goat/2010/Ind/Hisar.JQ904062.India 98.9
8
CU
-
NAU/IND/2010.JQ478482.India
99.2
9 INDAPMBNAP04/10.KC751423.India 98.9
10
G4/IND/2011.JQ478483.India
98.6
11
VJW66/IND.JN106022.India
98.6
12 GNT-27/IND.JN106018.India 98.6
13
G53/IND/2011.JQ
478486.India
98.0
14 MBN48/IND.JN106020.India 98.0
15
ISR2008/03.KP820992.Israel
97.9
16 CYP2006/01.KP820986.Cyprus 97.9
17 BTV16/ISR-2404/08.KP306785.Israel 97.9
18
BTV16/ISR
-
2228/08.KP306782.Isreal
97.9
19
GRE2008/10.KP820990.Greece
97.7
20 MZ-1/C/01.AB686220.Japan 97.6
21
GRE1999/13.KP820989.Greece
97.4
22 BTV-16/Gree1999/13(S-2).AM773709.Greece 97.4
23
GRE1999/13.AM773702.Greece
97.4
24
RSArrrr/16.AJ585137.South Africa
96.4
25 NIG1982/10.AJ585150.Nigeria 75.5
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
47
Fig. 1: Bluetongue virus isolation in BHK-21 cell line. (1a): Normal uninfected BHK-21 cell monolayer (48hours); (1b): BTV
infected BHK-21 cells (48 hours) showing cytopathic effect characterized by degeneration and rounding of infected cells
Fig. 2: 1% agarose gel electrophoresis of ns1 gene RT-PCR of
Indi an BTV16 isolate . La ne L: Ladde r 100 bp, 1: 7bp, 2:
BHK21 cell control, 3: Nuclese free water control. The left
side numbers indicate DNA marker and right side indicated
size of PCR product.
Fig. 3: 1% agarose gel electrophoresis of vp2 gene RT-PCR of
Indi an BTV16 isolate . La ne L: Ladde r 100 bp, 1: 7bp, 2:
BHK21 cell control, 3: Nuclease free water control. The left
side numbers indicate DNA marker and right side indicated
size of PCR product.
Fig. 4: Phylogenetic analysis of vp2 gene of Indian BTV16
isol ate. Tree was constructed using nei ghbour joining
method with 1000 bootstrap values in Mega6 software
programme (Tamura et al., 2013). Ï%= Isolate selected in
this study.
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
48
Conclusion
BT is mostly a disease of sheep in India. However,
several reports of BT outbreak in other ruminants such
goat and cattle has also been reported from country.
The BTV isolate (7bp) of sheep origin from Karnataka
state was used for vp2 gene based serotyping and
molecular characterization. The 7bp isolate was
confirmed as BTV16 serotype based on RT-PCR,
nucleic acid sequencing and vp2 gene sequence
similarity search in GenBank data base. The
nucleotide sequence identity and phylogenetic
analysis revealed that 7bp isolate is much closer to
other BTV16 isolates from India, Japan, Israel, Cyprus
and Greece. Therefore, to control BT in India the close
surveillance regarding import of live animal and its
products should be initiated.
Competing Interest
All authors declare that they have no conflict of
interest.
Acknowledgements
Authors are thankful to ICAR, New Delhi for
providing financial support under ‘All India network
programme on Bluetongue’ and Department of
Animal Biotechnology, Lala Lajpat Rai University of
Veterinary and Animal Sciences, Hisar, Haryana for
providing infrastructural facility.
Reference
1. Archana M, D’Souza PE, Prasad RC, Byregowda SM
(2014). Seasonal prevalence of different Culicoides
species of in Bangalore rural and urban districts of
South India. Vet world. 7(7): 517 - 521.
2. Chomoczynski P and Sacchi N (1987). Single step
method of RNA isolation by acid Guanidinium
isothiocyanate - phenol - chloroform extraction.
Analit. Biochem. 162: 156 - 159.
3. Dadawala AI, Kher HS, Chandel BS, Bhagat AG,
Chauhan HC, Ranjan K, Minakshi P (2013). Isolation
and molecular characterization of bluetongue virus
16 of goat origin from India. Adv. Anim. Vet. Sci. 1
(4S): 24 - 29.
4. Darpel KE, Batten CA, Veronesi E, Shaw AE, Anthony
S, Bachanek-Bankowska K, Kgosana L, bin-Tarif A,
Carpenter S, Müller-Doblies UU, Takamatsu HH,
Mellor PS, Mertens PP, Oura CA. (2007). Clinical
signs and pathology shown by British sheep and
cattle infected with bluetongue virus serotype 8
derived from the 2006 outbreak in northern Europe.
Vet. Rec. 161:253 - 261.
5. Ghiasi H, Fukusho A, Eshita Y and Roy P (1987).
Identification and characterization of conserved and
variable regions in the neutralization VP2 gene of
bluetongue virus. Virol. 160: 100 - 109.
6. Halder A, Joardar SN, Parui P, Banerjee D, Kumar
V, Samanta I, Lodh C (2013). Prevalence of midges;
potent vectors for bluetongue virus infection in
West Bengal, India. Adv. Anim. Vet. Sci. 1(4S):
45 - 50.
7. Hall TA (1999). BioEdit: a user-friendly biological
sequence alignment editor and analysis program
for Windows 95/98/NT. Nucl. Acids. Symp. Ser.
41:95 - 98.
8. Hofmann MA, Renzullo S, Mader M, Chaignat V,
Worwa G a nd Thuer B (2008). Genetic
Characterization of Toggenburg Orbivirus, a New
Bluetongue Virus, from Goats, Switzerland. Emerg.
Infect. Dis. 14 (12): 1855 - 1861.
9. Howerth EW, Greene CE and Prestwood AK (1988).
Experimentally induced bluetongue virus infection
in white tailed deer: coagulation, clinical pathologic
and gross pathologic changes. Am. J. Vet. Res.
49:1906 - 1913.
10. Jenckel M, Bréard E2, Schulz C, Sailleau C, Viarouge
C, Hoffmann B, Höper D, Beer M, Zientara S (2015).
Complete coding genome sequence of putative
novel bluetongue virus serotype 27. Genome
Announc. 3(2). pii: e00016-15.
11. Maan S, Maan NS, Nomikou K, Eva V, Bankowska
KB, Manjunatha BN, Houssam A and Mertens PPC
(2011). Complete Genome Characterisation of a
Novel 26th Bluetongue Virus Serotype from
Kuwait. PLoS One, 6 (10): 1-11.
12. Maan S, Maan NS, Samuel AR, O’Hara R, Meyer AJ,
Rao S, Mertens PP (2004). Completion of the
sequence analysis and comparisons of genome
segment 2 (encoding outer capsid protein VP2) from
representative isolates of the 24 bluetongue virus
serotypes. Vet Ital. 40(4):484-488.
13. Maan S, Maan NS, van Rijn PA, van Gennip RG,
Sanders A, Wright IM, Batten C, Hoffmann B,
Eschbaumer M, Oura CA, Potgieter AC, Nomikou
K, Mertens PP (2010). Full genome characterisation
of bluetongue virus serotype 6 from the Netherlands
2008 and comparison to other field and vaccine
strains . PLoS One. 5(4):e10323. doi: 10.1371/
journal.pone.0010323.
14. MacLachlan NJ (1994). The pathogenesis and
immunology of bluetongue virus infection of
ruminants. Comp. Immunol. Microbiol. Infect.
17:197 - 206.
15. Maclachlan NJ, Drew CP, Darpel KE and Worwa G
(2009). The Pathology and Pathogen esis of
Bluetongue. J. Comp. Path.141: 1 - 16.
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India

Journal of Microbiology and Related Research / Volume 2 Number 1 / January - June 2016
49
16. Mertens PP, Pedley S, Cowley J, Burroughs JN,
Corteyn AH, Jeggo MH, Jennings DM, Gorman BM
(1989). Analysis of the roles of bluetongue virus
outer capsid proteins VP2 and VP5 in determination
of virus serotype. Virol. 170:561- 565.
17. Mertens PPC, Maan NS, Belaganahalli MN, Singh
KP, Nomikou K, Maan S (2013). Full genome
sequence of a western reference strain of bluetongue
virus serotype 16 from Nigeria. Genome Announc.
1(5):e00684-13.
18. Minakshi P (2010). Annual report of All India
Network Programme on Bluetongue. ICAR, New
Delhi.
19. Minakshi P, Singh R, Ranjan K, Kumar P, Joshi CG,
Reddy YKM, Prasad G (2012). Complete Genome
Sequence of Bluetongue Virus Serotype 16 of Goat
Origin from India. J Virol 86(15):8337.
20. Nomikou K, Hughes J, Wash R, Kellam P, Breard E,
Zientara S, Palmarini M, Biek R, Mertens P (2015).
Widespread Reassortment Shapes the Evolution and
Epidemiology of Bluetongue Virus following
European Invasion. PLoS Pathog. 11(8):e1005056.
21. OIE (2013). OIE-Listed diseases, infections and
infestations in force in 2013. http://www.oie.int/
animal-health-in-the-world/oie-listed-diseases-
2013/.
22. Osburn BI (1994). Bluetongue virus. Vet Clin North
Am Food Anim Pract. 10:547 - 560.
23. Prasad G, Malik P, Malik PK and Minakshi (1998).
Serological survey of Bluetongue virus antibodies
in domestic and wild ruminants in and around Sariska
tiger reserve, Rajasthan. Indian J. Virol. 14:51 - 53.
24. Prasad G, Minakshi, Malik Y and Maan S (1999). RT
PCR and its detection limit for cell culture grown
bluetongue virus1 using NSI gene specific primers.
Indian J. Exp. Biol. 37: 1255-1258.
25. Prasad G, Sreenivasulu D, Singh KP, Mertens PPC,
Maan S (2009 ). Bluetongue in the Indian
subcontinent. In: Bluetongue. (Eds. Mellor P, Baylis
M and Merten P C). Elsevier Ltd., London. 167 - 195.
26. Ranjan K, Prasad G, Kumar P and Minakshi P (2013).
Vp5 gene based molecular characterization of
bluetongue virus 9 from South India. Adv. Anim.
Vet. Sci. 1 (4S): 30 - 36.
27. Ratinier M, Caporale M, Golder M, Franzoni G,
Allan K, Armezzani A, Bayoumy A, Rixon F, Shaw
A, Palmarini M (2011). Identification and
Characterization of a Novel Non–Structural Protein
of Bluetongue Virus. PLoS Pathog. 7: e1002477.
doi:10.1371/journal.ppat.1002477.
28. Reddy CVS, Hafeez M (2008). Studies on certain
aspects of prevalence of Culicoides species. Indian J.
Anim. Sci.78 (2): 138 - 142.
29. Reddy YKM, Manohar BM, Pandey AB, Reddy YN,
Prasad G, Chauhan RS (2010). Development and
evaluation of inactivated pentavalent adjuvanted
vaccine for Bluetongue. Indian Vet. J. 87:434 - 436.
30. Reddy YV, Krishnajyothi Y, Susmitha B, Devi BV,
Brundavanam Y, Gollapalli SR, Karunasri N, Sonali
B, Kavitha K, Patil SR, Sunitha G, Putty K, Reddy
GH, Reddy YN, Hegde NR, Rao PP (2015). Molecular
Typing of Bluetongue Viruses Isolated Over a
Decade in South India. Transbound Emerg Dis. doi:
10.1111/tbed.12320.
31. Roy P (1989). Bluetongue virus genetics and genome
structures. Virus Res. 13:179 - 206.
32. Sekar P, Ponmurugan K and Gurusubramanian G
(2009). Comparative Susceptibility of BHK 21 and
Vero Cell Lines to Bluetongue Virus (BTV) Isolate
Pathogenic for Sheep. Internet. J. Microbiol., 7 (1):1
- 5.
33. Shirafuji H, Yanase T, Kato T and Yamakawa M
(2012). Genetic and phylogenetic characterization
of genome segments 2 and 6 of bluetongue virus
isolates in Japan from 1985 to 2008. J Gen Virol 93:
1465 - 1473.
34. Susmitha B, Sudheer D, Rao PP, Uma M, Prasad G,
Minakshi P, Hegde NR, Reddy YN (2012). Evidence
of bluetongue virus ser otype 21 (BTV-21)
divergence. Virus Genes. 44(3): 466-469.
35. Svensson L, Uhnoo I, Grandien M and Wadeli G
(1986). Molecula r epidemiolog y of rotavirus
infections in Upsala. Sweden. 1981; disappearance
of a predominant electropherotype. J. Med. Virol.
18:101 - 111.
36. Tamura K, Stecher G, Peterson D, Filipski A, and
Kumar S (2013). MEGA6: Molecular Evolutionary
Genetics Analysis Version 6.0. Molecular Biology
and Evolution 30: 2725 - 2729.
37. Velthuis AG, Saatkamp HW, Mourits MC, de Koeijer
AA, Elbers AR (2009). Financial consequences of the
Dutch bluetongue serotype 8 epidemics of 2006 and
2007. Prev. Vet. Med. 93:294 - 304.
38. Zhang Z, Schwartz S, Wagner L and Miller W (2000).
A greedy algorithm for aligning DNA sequences. J.
Comput. Biol. 7(1-2):203 - 214.
Koushlesh Ranjan et. al. / Molecular Typing of Bluetongue Virus 16 From Karnataka State of India