Pseudojuloides labyrinthus, a new labrid fish (Teleostei: Labridae) from the western Indian Ocean

Abstract

The new labrid fish species, Pseudojuloides labyrinthus n. sp., is described from three specimens obtained via the aquarium trade from Kenya, in the western Indian Ocean. The species is similar in appearance to other Indo-Pacific Pseudojuloides in the P. severnsi complex, distinguished mainly by the markings of the terminal-phase male, which includes a maze of lines on the head and three thicker blue stripes along the rear body. Despite the similarity in appearance, the new species is 9.66% divergent in the sequence of the mtDNA barcode marker COI (minimum interspecific divergence, pairwise; 10.54% K2P distance) from its nearest relative, P. edwardi, also found in Kenya. A neighbor-joining tree and genetic distance matrix is presented for 12 of the 14 known species in the genus Pseudojuloides.

Full text

58
Pseudojuloides labyrinthus, a new labrid sh (Teleostei: Labridae)
from the western Indian Ocean
BENJAMIN C. VICTOR
Ocean Science Foundation, 4051 Glenwood, Irvine, CA 92604, USA
and Guy Harvey Research Institute, Nova Southeastern University,
8000 North Ocean Drive, Dania Beach, FL 33004, USA
E-mail: ben@coralreefsh.com
JASON M.B. EDWARD
Greenwich Aquaria, 1064 E Putnam Ave, Riverside, CT 06878, USA
E-mail: jason@greenwichaquaria.com
Abstract
The new labrid sh species, Pseudojuloides labyrinthus n. sp., is described from three specimens obtained via
the aquarium trade from Kenya, in the western Indian Ocean. The species is similar in appearance to other Indo-
Pacic Pseudojuloides in the P. severnsi complex, distinguished mainly by the markings of the terminal-phase
male, which includes a maze of lines on the head and three thicker blue stripes along the rear body. Despite the
similarity in appearance, the new species is 9.66% divergent in the sequence of the mtDNA barcode marker COI
(minimum interspecic divergence, pairwise; 10.54% K2P distance) from its nearest relative, P. edwardi, also
found in Kenya. A neighbor-joining tree and genetic distance matrix is presented for 12 of the 14 known species
in the genus Pseudojuloides.
Key words: coral reef shes, ichthyology, new species, taxonomy, systematics, Kenya, Africa, DNA barcoding.
Citation: Victor, B.C. & Edward, J.M.B. (2016) Pseudojuloides labyrinthus, a new labrid sh (Teleostei: Labridae)
from the western Indian Ocean. Journal of the Ocean Science Foundation, 21, 58–70.
doi: http://dx.doi.org/10.5281/zenodo.55594
urn:lsid:zoobank.org:pub:B9C0D2C5-DBBD-42E9-BF57-3D7B52491C04
Date of publication of this version of record: 15 June, 2016
Introduction
The labrid genus Pseudojuloides Fowler was revised by Randall & Randall (1981), who recognized eight
species in the genus, ve of which were new. Since then, ve additional new species have been described from
various locations in the Indo-Pacic Ocean, including P. kaleidos by Kuiter & Randall (1995) from the Maldives
and Indonesia; P. severnsi by Bellwood & Randall (2000), from the Maldives to the W. Pacic; P. edwardi and
Journal of the Ocean Science Foundation, 21, 58–70 (2016)

59
P. polackorum from the southwest Indian Ocean (Victor & Randall 2014, Connell et al. 2015); and the deep-reef
species P. zeus from Micronesia (Victor & Edward 2015). The genus comprises a set of small fast-swimming
wrasses, typically found on deeper slopes and in habitats dominated by rubble rather than live coral. They are
distinguished morphologically by having chisel-like incisiform side teeth (unusual among the labrids) and
fusiform bodies with relatively large scales. Terminal-phase (TP) males are large, brightly colored individuals,
while smaller initial-phase (IP) sh, usually females, are reddish orange. We describe here a new species from
the African coast in the western Indian Ocean, the fourth species of the genus from that location, and compare its
barcode mtDNA COI sequence to 11 of the 13 described species in the genus (all except for P. argyreogaster and
P. erythrops).
Materials and Methods
Specimens have been examined from the Bernice P. Bishop Museum, Honolulu (BPBM). In addition, ethanol-
preserved specimens of comparison species were collected for DNA sequencing from Bali (Indonesia), Moorea
and the Marquesas Islands (French Polynesia), Cook Islands, New Caledonia, and Hawai‘i in the Pacic Ocean,
and South Africa in the Indian Ocean, as well as obtained via the aquarium trade from the Philippines, Indonesia,
Vanuatu, and Micronesia in the Pacic Ocean and Kenya and Mauritius in the Indian Ocean (Appendix 1).
DNA extractions were performed with the NucleoSpin96 (Machery-Nagel) kit according to manufacturer
specications under automation with a Biomek NX liquid-handling station (Beckman-Coulter) equipped with a
ltration manifold. A 652-bp segment was amplied from the 5′ region of the mitochondrial COI gene using a
variety of primers (Ivanova et al. 2007). PCR amplications were performed in 12.5 µl volume including 6.25 µl
of 10% trehalose, 2 µl of ultra pure water, 1.25 µl of 10× PCR buffer (10mM KCl, 10mM (NH4)2SO4, 20mM Tris-
HCl (pH8.8), 2mM MgSO4, 0.1% Triton X-100), 0.625 µl of MgCl2 (50mM), 0.125 µl of each primer (0.01mM),
0.0625 µl of each dNTP (10mM), 0.0625 µl of Taq DNA polymerase (New England Biolabs), and 2 µl of template
DNA. The PCR conditions consisted of 94°C for 2 min., 35 cycles of 94°C for 30 sec., 52°C for 40 sec., and 72°C
for 1 min., with a nal extension at 72°C for 10 min. Specimen information and barcode sequence data from this
study were compiled using the Barcode of Life Data Systems (Ratnasingham & Hebert 2007). The sequence data
is publicly accessible on BOLD and GenBank.
Sequence divergences were calculated using BOLD with the Kimura 2-parameter (K2P) model generating a
mid-point rooted neighbor-joining (NJ) phenogram to provide a graphic representation of the species’ sequence
divergence. Genetic distances were calculated by the BOLD algorithm, both as uncorrected p-distances and as
K2P distances.
The length of specimens is given as standard length (SL), measured from the median anterior end of the upper
lip to the base of the caudal n (posterior end of the hypural plate); body depth is the greatest depth from the base
of the dorsal-n spines to the ventral edge of the abdomen (correcting for any malformation of preservation); body
width is measured just posterior to the gill opening; head length from the front of the upper lip or anterior upper
teeth (whichever is most anterior) to the posterior end of the opercular ap; orbit diameter is the greatest eshy
diameter of the orbital rim, and interorbital width the least bony width; snout length is measured from the median
anterior point of the upper lip to the nearest eshy rim of the orbit; caudal-peduncle depth is the least depth, and
caudal-peduncle length the horizontal distance between verticals at the rear base of the anal n and the caudal-n
base; predorsal, prepelvic and preanal lengths are angular measurements; lengths of spines and rays are measured
to their extreme bases; caudal-n and pectoral-n lengths are the length of the longest ray; pelvic-n length is
measured from the base of the pelvic spine to the tip of the longest soft ray. Morphometric data are presented as
percentages of the standard length. Proportional measurements in the text are rounded to the nearest 0.05.
The upper rudimentary pectoral-n ray is included in the count. Lateral-line scale counts include the last
pored scale that overlaps the end of the hypural plate as +1; scales above the lateral line are counted in an oblique
row from the pored scales under the mid-spinous dorsal n, the much smaller scale abutting the base of the n is
counted as 0.5 scales. The count of gill rakers is made on the rst gill arch and includes all rudiments. The counts
and measurements for the larger paratype (>50 mm SL) is shown in parentheses following data for the holotype
(not listed if damaged). Proportional morphological measurements are presented in Table 1.

60
Figure 1. Pseudojuloides labyrinthus, BPBM 41257, TP male holotype, 65 mm SL, Kenya via aquarium trade (B.C. Victor).
Figure 2. Pseudojuloides labyrinthus, BPBM 41257, TP male holotype, 65 mm SL, Kenya via aquarium trade (M. Stern).
Pseudojuloides labyrinthus, n. sp.
Labyrinth Pencil Wrasse
urn:lsid:zoobank.org:act:A14ED652-FFF9-474D-9AA4-D4C281EDF3BC
Figures 1–6, Table 1.
Holotype. BPBM 41257, 65.0 mm SL, TP male, Mombasa region, Kenya, aquarium-trade, about April 9, 2015.
Paratypes. BPBM 41258, (2) 43.0 & 60.6 mm SL, IP females, same collection data, about May 8, 2014.

61
Diagnosis. Dorsal-n rays IX,11; anal-n rays III,12; pectoral-n rays 13; lateral-line scales 27 (+1 on caudal-
n base); no scales on head; gill rakers 14; a single pair of large, projecting, and slightly recurved canine teeth
anteriorly in each jaw, the upper pair slightly out-aring, the lowers curving forward and tting between uppers
when mouth closed; a short irregular row of 3–7 chisel-like incisiform teeth on each side of upper and lower jaws,
no canine posteriorly at corner of mouth; elongate body, body depth 5.0–5.4 in SL; only slightly compressed,
body width 1.7 in depth; caudal n slightly rounded in initial phase, truncate in terminal-phase male; initial phase
reddish orange to pink, often with more yellow tint anteriorly and grading to white ventrally on the head and
abdomen, a band of bright reective white running from tip of upper jaw back to under posterior orbit; terminal-
phase male in life greenish yellow with three bright blue stripes along posterior half of body, head and anterior
body often abruptly darker, with maze of lines, thinner and ranging from bright blue to reddish on head, wider
(about one scale high) and bright blue on anterior body; dorsal and anal ns with broad yellow bands bordered
above and below with blue stripes, upper and lower margin of caudal n banded with yellow; iris red.
Description. Dorsal-n rays IX,11; anal-n rays III,12, all soft dorsal and anal-n segmented rays branched,
last split to base; pectoral-n rays 13, the rst rudimentary, the second unbranched; pelvic-n rays I,5; principal
caudal-n rays 14, the upper and lower unbranched; upper and lower procurrent caudal-n rays 6; pored lateral-
line scales 27 (+1 on caudal-n base); scales above lateral line to origin of dorsal n 4.5; scales below lateral line
to origin of anal n 8; median predorsal scales about 7–10; gill rakers 14.
Body elongate, the depth 5.0 (5.4) in SL, and only slightly compressed, the width 1.7 (1.7) in depth; head
length 3.1 (3.0) in SL; dorsal prole of head nearly straight on snout, forming low angle of about 20° to horizontal
axis of body, and slightly convex on nape; snout sharply pointed, its length 3.7 (3.8) in HL; orbit relatively small,
diameter 5.1 (4.7) in HL; interorbital space broadly convex, the least bony width 4.2 (4.8) in HL; caudal peduncle
short and narrow, the least depth 3.5 in HL, caudal-peduncle length 3.0 in HL.
Figure 4. Pseudojuloides labyrinthus, BPBM 41258, IP paratype, 60.6 mm SL, Kenya via aquarium trade (B.C. Victor).
Figure 3. Pseudojuloides labyrinthus, BPBM 41258, IP paratype, 43 mm SL, Kenya via aquarium trade (V. Altamirano).

62
TABLE 1
Proportional measurements of type specimens of Pseudojuloides labyrinthus, n. sp.
as percentages of the standard length
holotype paratypes
BPBM BPBM BPBM
41257 41258 41258
TP IP IP
Standard length (mm) 65.0 60.6 43.0
Body depth 19.8 18.5 19.5
Body width 11.8 11.1 11.9
Head length 32.0 33.2 33.7
Snout length 8.8 8.7 8.8
Orbit diameter 6.3 7.1 8.1
Interorbital width 7.7 6.9 7.0
Caudal-peduncle depth 9.2 - 10.0
Caudal-peduncle length 10.6 - 9.8
Predorsal length 29.4 29.9 33.0
Preanal length 56.6 58.4 58.1
Prepelvic length 35.5 36.0 35.6
Base of dorsal n 56.0 - 55.1
First dorsal-n spine 6.2 6.6 7.0
Ninth dorsal-n spine 8.6 - 9.8
Longest dorsal-n ray 11.1 - 12.8
Base of anal n 34.0 - 31.2
First anal-n spine 2.6 3.1 3.3
Second anal-n spine 5.7 6.9 4.9
Third anal-n spine 7.2 7.9 7.7
Longest anal-n ray 9.8 - 11.6
Caudal-n length 16.5 - 21.9
Pectoral-n length 15.4 15.8 18.1
Pelvic-spine length 9.4 10.1 11.2
Pelvic-n length 14.9 13.5 15.6

63
Mouth very small, terminal, the corner of gape with closed jaws well anterior to anterior nostril; end of maxilla
buried, even when jaws gape. Lips moderately thick, the upper puffed with striations on the underside, the lower
lip with prominent ventral-projecting ap along side of jaw. A pair of large, moderately projecting, and slightly
recurved canine teeth anteriorly in each jaw, the upper pair slightly out-aring, the lowers curving forward and
tting between uppers when mouth closed; a short row of 3–7 irregularly placed chisel-like incisiform teeth along
each side of upper and lower jaw; no canine tooth posteriorly on upper jaw. Upper preopercular margin free nearly
to level of lower edge of orbit; lower margin free anterior to a vertical through anterior nostril. Gill rakers short,
the longest on rst arch (at angle) about one-fth to one-tenth length of longest gill lament. Nostrils small, in
front of upper edge of orbit, the anterior in a short membranous tube elevated posteriorly, the posterior in advance
of a vertical through front of orbit by a distance slightly less than internarial space. Pores on lower half of head
comprise one over rear maxilla, then two anterior to orbit, followed by a curving suborbital series (counting up to
rear mid-eye level) numbering 5–7 in single series; preopercular pores in a curved series after start of free edge
near mandible, numbering 9 or 10 along free margin of preopercle, plus 1 or 2 more up to rear mid-eye level, in a
single series at distal tips of canals.
Scales thin and cycloid; scales on side of thorax less than half as high as largest scales on side of body, becoming
still smaller ventroanteriorly; head naked except for small partially embedded scales on nape in irregular rows;
median predorsal scales extending forward to slightly posterior to a vertical through upper free end of preopercular
margin; ns naked except for several progressively smaller scales on basal region of caudal n and mid-ventral
scale projecting posteriorly from base of pelvic ns. Lateral line continuous, nearly following contour of back
to 18th pored scale, below base of eighth dorsal soft ray, where deected sharply ventrally to straight peduncular
portion, single small pore per scale, last pored scale on caudal-n base. Origin of dorsal n above anterior edge of
second lateral-line scale; dorsal-n spines progressively longer, the rst 5.2 (5.0) and the ninth 3.7 in HL; longest
dorsal-n soft ray 2.9 in HL; origin of anal n below base of last dorsal-n spine; rst anal-n spine very short,
12.2 (10.6) in HL; second anal-n spine 5.6 (4.8) in HL; third anal-n spine 4.4 (4.2) in HL; longest anal-n soft
ray 3.3 in HL; caudal n with slightly extended upper and lower lobes in terminal-phase males, caudal-n length
1.9 in HL; third pectoral-n ray longest, 2.1 (2.1) in HL; pelvic ns short, 2.1 (2.5) in HL.
Color in life. Based on two TP male individuals (holotype and one living non-type)(Figs. 1,2 & 5 top), head
and body greenish yellow grading to white ventrally, one specimen with anterior body and head abruptly darker,
sparing ventral abdomen and thorax; head with reticulated pattern of thin lines, colored bright blue to red (in same
male holotype) to purplish; maze of lines on head continuing onto anterior body and partially breaking up into
spots, then transitioning at mid-body to form three distinct stripes ending near base of caudal n, body spots and
stripes bright blue and wider than head stripes, about one scale wide. Dorsal and anal ns with a broad yellow
band over a narrow blue stripe near base of n, n edged with a thin blue margin; caudal n with thick yellow
bands along the upper and lower margins also edged with a thin bluish line, central portion of n translucent;
pelvic and pectoral ns translucent. Iris reddish orange. IP individuals reddish to pinkish or orange (Figs. 3,4 &
6), lighter ventrally, white on lower half of head and thorax; a continuous band of brighter, reective, pearly white
from tip of upper jaw back to below rear orbital margin. Fins translucent. Iris orange to bright red.
The living holotype had a scattering of black pinpoint spots over the head and body; it is unclear if these are
pathological or parasitic. They do not persist on the preserved specimen.
Color in alcohol. TP male uniform grey brown dorsally grading to white ventrally, except for some residual
blue in stripes. Fins are translucent. IP sh are uniform yellowish with no markings.
Etymology. Named for the maze-like pattern of lines on the head and body. The specic epithet is a noun in
apposition.
Distribution. The new species is described from specimens from the coast of Kenya. A record of “P. erythrops”
from Seychelles (Randall & van Egmond 1994) is a 57-mm SL initial-phase specimen that is indistinguishable
from P. labyrinthus: given the distance of Seychelles from the type location of P. erythrops in Mauritius, the
record is more likely P. labyrinthus. Interestingly, the east African coast now has more sympatric species of
Pseudojuloides than any other location, i.e. four species: the new species plus P. edwardi, P. polackorum, and the
elusive P. argyreogaster.

64
Figure 5. TP male colors in aquaria– top: Pseudojuloides labyrinthus, non-type, Kenya (T.J. Engels); upper middle: P.
erythrops, Mauritius (J.E. Randall); lower middle: P. severnsi, Japan (K. Nishiyama); bottom: P. edwardi, Kenya (V. Altamirano).

65
Barcode DNA sequence. A 652-nucleotide sequence of the segment of the mitochondrial COI gene used
for barcoding by the BOLD informatics database (Ratnasingham & Hebert 2007) was obtained for the holotype.
Following the database management recommendation of the BOLD, the sequence of the holotype (GenBank
accession number KT352046) is presented here as well:
CCTCTATCTAGTATTCGGTGCCTGAGCTGGGATGGTGGGCACAGCCCTAAGCCTGCTCATTCGGGCT
GAACTTAGCCAGCCCGGTGCTCTCCTCGGAGACGACCAAATTTATAACGTAATCGTTACGGCCCAC
GCCTTCGTAATAATCTTTTTTATAGTAATGCCAATTATGATTGGCGGGTTCGGAAACTGACTAATTCC
TCTGATGATTGGGGCCCCTGATATGGCCTTCCCTCGAATGAACAACATGAGCTTCTGACTCCCATCT
TTCCTTCTCCTCCTTGCCTCATCTGGTGTAGAAGCGGGAGCTGGAACTGGCTGAACAGTCTACCCC
CCTCTGGCTGGCAACCTCGCCCACGCAGGGGCCTCTGTAGACTTAACTATCTTCTCCCTCCACTTAG
CCGGCATCTCATCGATCCTAGGGGCAATCAACTTTATTACAACTATTGTAAATATGAAGCCCCCTGCT
ATTTC TCAATACCAAACACCTCTCTTTGTTTGAGCCGTCTTAATTACAGCAGTCCTACTTCTTCTCTC
ACTACCCGTGCTTGCTGCGGGCATCACAATGCTGCTAACTGATCGTAACCTCAATACCACCTTCTTT
GACCCTGCAGGGGGAGGAGATCCCATCCTTTACCAACACCTC
Comparisons. Among the Pseudojuloides, P. labyrinthus most closely resembles the P. severnsi species
complex in basic marking patterns on the TP male, i.e. an abruptly darker head and anterior body, reticulated
lines on the head, and blue stripes along the body (Fig. 5). The new species differs by having a third blue stripe
along the posterior half of the body (vs. two), the third running well below the lateral midline. The TP male of P.
erythrops also differs from P. labyrinthus in having the light ventrum ending abruptly at mid-abdomen, blue spots
and reticulations against a dark background on the anterior abdomen, and only a single stripe across the upper
head (vs. a maze). TP males of both P. edwardi and P. severnsi are missing the maze of lines on the upper head
and upper anterior body. The initial-phase specimens of the entire genus are very similar and mostly non-descript
and reddish orange; however, IP P. labyrinthus have the prominent reective white stripe below the eye extending
in a complete wide band from the tip of the upper jaw to past the orbit, while those of the other species have the
reective white more limited to the maxilla, or maxilla and separately under the eye, not forming a continuous
streak (Fig. 6; and see Victor & Edward 2015).
Figure 6. Pseudojuloides edwardi vs. labyrinthus, initial phase, (identications by DNA barcode): P. edwardi at left, P.
labyrinthus paratype, 43 mm SL, at right; Kenya via aquarium trade (J.M.B. Edward).

66
Morphometrics (>50 mm SL) are similar to other congeners, although the new species is more elongate than
most, with body depth 18.5–19.8% SL, less than the P. cerasinus complex and P. atavai (23 to 25% SL; Randall
& Randall 1981, Connell et al. 2015) and P. edwardi and P. severnsi (19% to 23% SL; Victor & Randall 2014);
about the same as P. erythrops (18.6% to 19.6% SL; Randall & Randall 1981); and slightly wider than P. zeus and
P. mesostigma (less than 18% from Victor & Edward [2015]).
DNA Comparisons. The neighbor-joining phenetic tree based on the COI mtDNA sequences of 12 of the 14
known Pseudojuloides species, following the Kimura two-parameter model (K2P) generated by BOLD (Barcode
of Life Database), shows deep divergences between species and relatively small differences within species, except
for the P. edwardi and P. severnsi sequences, which are very close (Fig. 7). As a broad generality, among most reef
TABLE 2
K2P distances for mtDNA COI sequences of 12 species of Pseudojuloides
Minimum Interspecic and Maximum Intraspecic Distances (%)
ata cer edw elo kal lab mes pol pyr sev xan zeu
P. atavai 0
P. cerasinus 19.32 0.18
P. edwardi 17.97 16.06 0.31
P. elongatus 17.78 18.8 15.81 0.62
P. kaleidos 16.61 10.4 15.9 19.6 NA
P. labyrinthus 20.19 16.63 10.54 17.54 15.9 0.31
P. mesostigma 6.89 17.64 9.07 17.5 16.49 11.78 0.93
P. polackorum 14.83 9.47 14.58 18.69 8.42 16.37 14.83 0.31
P. pyrius 18.57 3.5 15.27 20.38 10.71 16.89 16.76 9.47 NA
P. severnsi 17.76 16.34 0.46 16.14 15.83 10.75 9.3 14.34 15.61 0.93
P. xanthomos 16.22 11.34 15.51 19.16 4.48 16.52 15.08 7.5 11.23 15.45 NA
P. zeus 18.2 17.49 9.29 17.94 17.51 12.0 5.31 17.09 17.23 8.61 16.28 NA
P-distances (uncorrected pairwise) for mtDNA COI sequences
of 12 species of Pseudojuloides
Minimum Interspecic and Maximum Intraspecic Distances (%)
ata cer edw elo kal lab mes pol pyr sev xan zeu
P. atavai 0
P. cerasinus 16.5 0.18
P. edwardi 15.67 14.12 0.31
P. elongatus 15.67 16.41 14.17 0.61
P. kaleidos 14.59 9.55 14.02 17.05 NA
P. labyrinthus 17.36 14.68 9.66 15.51 14.13
P. mesostigma 14.9 15.37 8.41 15.51 14.44 10.75 0.92
P. polackorum 13.21 8.74 12.93 16.28 7.83 14.44 13.21 0.31
P. pyrius 15.98 3.4 13.55 17.51 9.83 14.9 14.75 8.76 NA
P. severnsi 15.51 14.34 0.46 14.44 13.98 9.83 8.6 12.75 13.82 0.92
P. xanthomos 14.29 10.36 13.71 16.74 4.3 14.59 13.36 7.07 10.29 13.67 NA
P. zeus 15.82 15.2 8.57 15.82 15.21 10.91 5.07 14.9 15.05 7.99 14.29 NA

67
P. severnsi
}
New Caledonia
Indonesia
Philippines
}
P. edwardi
Kenya
New Caledonia
P. elongatus
}
Hawai‘i
P. cerasinus
Marquesas Islands P. pyrius
P. xanthomos
Mauritius
Bali, Indonesia Leptojulis cyanopleura
Kenya
Kenya
Kenya
Philippines
Philippines
New Caledonia
New Caledonia
Vanuatu
Vanuatu P. mesostigma
}
P. kaleidos
South Africa
South Africa
South Africa
Kenya
Kenya
P. polackorum
aqua
Hawai‘i
Hawai‘i
Hawai‘i
}
New Caledonia
New Caledonia
Cook Islands
Fr. Polynesia
Fr. Polynesia
Fr. Polynesia
P. atavai
Micronesia P. zeus
}
P. labyrinthus, n. sp.
Kenya
Kenya
Kenya
}
0.02
}
Figure 7. The neighbor-joining phenetic tree of Pseudojuloides following the Kimura two-parameter model (K2P) generated
by BOLD (Barcode of Life Database). The scale bar at left represents a 2% sequence difference. Collection locations for
specimens are indicated, and Leptojulis cyanopleura is used as an outgroup. The “aqua” label indicates an aquarium-trade
specimen of unknown provenance. GenBank accession numbers and collection data for the sequences in the tree are listed
in Appendix 1.

68
shes the minimum interspecic distance between close congeners is often up to an order of magnitude greater
than the maximum intraspecic distance, which is precisely what makes the barcode database particularly useful.
It appears that the majority of reef sh species (with many exceptions) differ by more than 2% from their nearest
relatives (Steinke et al. 2009, Ward et al. 2009, Victor 2015). Our genetic results show that P. labyrinthus falls in
a broad clade made up of P. severnsi/edwardi and P. zeus and P. mesostigma. The nearest-neighbor sequence to
P. labyrinthus is P. edwardi, which differs by 9.66% in COI sequence (uncorrected pairwise distance; 10.54% by
K2P). The divergence is on a similar scale to that from the remaining species in the complex, i.e. P. severnsi, P.
zeus, and P. mesostigma. It is somewhat unexpected that P. labyrinthus is more distant from P. severnsi than are P.
zeus and P. mesostigma, since the TP males of P. labyrinthus share the basic marking patterns of P. severnsi and
P. edwardi and appear quite different from P. zeus and P. mesostigma. Interestingly, in this case, the initial-phase
marking differences (although slight) may be more reective of the genetic relationship than the TP male pattern.
Genetic divergences within the genus Pseudojuloides vary widely (Table 2). For all but one pair, minimum
interspecic distances range from 3.4% to 17.51% (uncorrected pairwise; 3.5% to 20.38% by K2P). The maximum
intraspecic distances range from 0 to 0.92% (uncorrected pairwise; 0 to 0.93% by K2P), showing a clear “barcode
gap” between species. The exception is the species pair of P. edwardi and P. severnsi, which diverge by only 0.46%
(three nucleotides of the 652-bp barcode segment), and may be an example of phenotypic differences outpacing
the rate of neutral substitutions in the mitochondrial COI DNA sequence early in the process of speciation (Victor
& Randall 2014, Allen et al. 2015).
Acknowledgments
We thank Loreen R. O’Hara and Arnold Suzumoto of the Bishop Museum for curatorial assistance, and Vincent
Altamirano, T.J. Engels, Kazuhiko Nishiyama (Kazu), and Michael Stern for graciously providing photographs.
Comparison sequences on the Barcode of Life Database (BOLD) were provided by Serge Planes of the Centre
National de la Recherche Scientique and Jeff Williams of the U.S. National Museum of Natural History, via
CRIOBE (Centre de Recherches Insulaires et Observatoire de l’Environnement CNRS-EPHE), BIOCODE (Moore
Foundation), CORALSPOT (MEDDE, ANR, Polynésie), and the LABEX “CORAIL”; as well as by David Carlon
of the Bowdoin Marine Laboratory, Brunswick, Maine and the University of Hawaiʻi and Anuschka Faucci of the
University of Hawaiʻi. The assistance of Michael Stern of NY Aquatics is appreciated. Comparison specimens/
tissues were provided by David Bellwood, Alonso Gonzalez Cabello, the late Allan Connell, Arie deJong of De
Jong Marinelife of the Netherlands, and Antoine Teitelbaum. George Walsh and Walsh Paper Distribution, Inc. of
Westminster, CA sponsored preparation and publication of the project. The DNA barcoding was performed at the
Biodiversity Institute of Ontario with the support of Robert Hanner and the team at BOLD. DNA barcoding was
supported by the International Barcode of Life Project (iBOL.org) with funding from the Government of Canada
via the Canadian Centre for DNA Barcoding, as well as from the Ontario Genomics Institute (2008-OGI-ICI-03),
Genome Canada, the Ontario Ministry of Economic Development and Innovation, and the Natural Sciences and
Engineering Research Council of Canada. The manuscript was reviewed by John E. Randall and Helen A. Randall.
References
Allen, G.R., Erdmann, M.V. & Dailami, M. (2015) Cirrhilabrus marinda, a new species of wrasse (Pisces:
Labridae) from eastern Indonesia, Papua New Guinea, and Vanuatu. Journal of the Ocean Science Foundation,
15, 1–13.
Bellwood, D.R. & Randall, J.E. (2000) Pseudojuloides severnsi, a new species of wrasse from Indonesia and Sri
Lanka (Perciformes: Labridae). Journal of South Asian Natural History, 5(1), 1–5.
Connell, A.D., Victor, B.C. & Randall, J.E. (2015) A new species of Pseudojuloides (Perciformes: Labridae) from
the south-western Indian Ocean. Journal of the Ocean Science Foundation, 14, 49–56.
Ivanova, N.V., Zemlak, T.S., Hanner, R.H. & Hebert, P.D.N. (2007) Universal primer cocktails for sh DNA
barcoding. Molecular Ecology Notes, 7, 544–548.

69
Kuiter, R.H. & Randall, J.E. (1995) Four new Indo-Pacic wrasses (Perciformes: Labridae). Revue française
d’Aquariologie Herpétologie, 21, 107–118.
Randall, J.E. & Randall, H.A. (1981) A revision of the labrid sh genus Pseudojuloides, with descriptions of ve
new species. Pacic Science, 35, 51–74.
Randall, J.E. & van Egmond, J. (1994) Marine shes from the Seychelles: 108 new records. Zoologische
Verhandelingen, 297, 43–83.
Ratnasingham, S. & Hebert, P.D.N. (2007) BOLD: The Barcode of Life Data System (www.barcodinglife.org).
Molecular Ecology Notes, 7(3), 355–364.
Steinke, D., Zemlak, T.S., & Hebert, P.D.N. (2009) Barcoding Nemo: DNA-Based Identications for the
Ornamental Fish Trade. PLoS ONE 4(7) e6300. http://dx.doi.org/10.1371/journal.pone.0006300
Victor, B.C. (2015) How many coral reef sh species are there? Cryptic diversity and the new molecular
taxonomy. In: Mora, C. (Ed.) Ecology of Fishes on Coral Reefs. Cambridge University Press, Cambridge,
United Kingdom, pp. 76–87.
Victor, B.C. & Randall, J.E. (2014) Pseudojuloides edwardi, n. sp. (Perciformes: Labridae): an example of
evolution of male-display phenotype outpacing divergence in mitochondrial genotype. Journal of the Ocean
Science Foundation, 11, 1–12.
Victor, B.C. & Edward, J.M.B. (2015) Pseudojuloides zeus, a new deep-reef wrasse (Perciformes: Labridae) from
Micronesia in the western Pacic Ocean. Journal of the Ocean Science Foundation, 15, 41–52.
Ward, R.D., Hanner, R. & Hebert, P.D.N. (2009) The campaign to DNA barcode all shes, FISH-BOL. Journal
of Fish Biology, 74, 329–356.

70
Genus species Collection site Voucher GenBank # Collector/Source
Pseudojuloides labyrinthus, n. sp. Mombasa, Kenya BPBM 41258 (43.0) KP975975 J. Edward/aq. trade
Pseudojuloides labyrinthus, n. sp. Mombasa, Kenya BPBM 41257 KT352046 J. Edward/aq. trade
Pseudojuloides labyrinthus, n. sp. Mombasa, Kenya BPBM 41258 (60.6) KT352050 J. Edward/aq. trade
Pseudojuloides zeus Majuro, Marshall Islands BPBM 41215 KJ591656 J. Edward/aq. trade
Pseudojuloides mesostigma Vanuatu BPBM 41216 60.6 KP975989 J. Edward/aq. trade
Pseudojuloides mesostigma Vanuatu BPBM 41216 60.9 KP975968 J. Edward/aq. trade
Pseudojuloides edwardi Mombasa, Kenya BPBM 41172 KJ591643 J. Edward/aq. trade
Pseudojuloides edwardi Mombasa, Kenya je14pe1 KP975964 J. Edward/aq. trade
Pseudojuloides edwardi Mombasa, Kenya BPBM 41173 63.4 KJ591642 A. DeJong/aq. trade
Pseudojuloides edwardi Mombasa, Kenya BPBM 41173 70.6 KJ591644 J. Edward/aq. trade
Pseudojuloides severnsi Philippines BPBM 41174 72.3 KJ591652 J. Edward/aq. trade
Pseudojuloides severnsi New Caledonia BPBM 41175 55.4 KJ591651 A. Teitelbaum
Pseudojuloides severnsi Philippines M1496 JQ839573 D. Bellwood, JCU
Pseudojuloides severnsi New Caledonia BPBM 41175 70.1 KJ591655 A. Teitelbaum
Pseudojuloides severnsi Indonesia je13ps KJ591653 J. Edward/aq. trade
Pseudojuloides severnsi New Caledonia qm14ps2 KJ591654 A. Teitelbaum
Pseudojuloides severnsi Philippines BPBM 41174 79.8 JQ839574 J. Edward/aq. trade
Pseudojuloides kaleidos aquarium trade je14pk610 KP975974 J. Edward/aq. trade
Pseudojuloides xanthomos Mauritius dej13px360 KJ591657 A. DeJong/aq. trade
Pseudojuloides polackorum South Africa DSFSG592-11 KF489719 A. Connell/ SAIAB
Pseudojuloides polackorum South Africa DSFSG925-13 KP975998 A. Connell/ SAIAB
Pseudojuloides polackorum Kenya BPBM 41207 KP975967 J. Edward/aq. trade
Pseudojuloides polackorum Kenya BPBM 41208 KP975996 J. Edward/aq. trade
Pseudojuloides polackorum South Africa ac13pc KP975978 A. Connell/ SAIAB
Pseudojuloides pyrius Marquesas Islands MARQ-424 KJ591650 J. Williams/S. Planes
Pseudojuloides cerasinus Hawai‘i FLHI398-09 KJ591646 D. Carlon/A. Faucci
Pseudojuloides cerasinus Hawai‘i h83pc370 JQ839570 B. Victor
Pseudojuloides cerasinus Hawai‘i FLHI318-09 KJ591645 D. Carlon/A. Faucci
Pseudojuloides cerasinus Hawai‘i h83pc260 JQ839571 B. Victor
Pseudojuloides elongatus New Caledonia jr14pe3 KJ591647 A. Teitelbaum
Pseudojuloides elongatus New Caledonia jr14pe2 KJ591649 A. Teitelbaum
Pseudojuloides elongatus New Caledonia jr14pe1 KJ591648 A. Teitelbaum
Pseudojuloides atavai Rarotonga, Cook Islands ck98425pa210 JQ839568 B. Victor
Pseudojuloides atavai Moorea, French Polynesia MBIO1549 JF435150 S. Planes/J. Williams
Pseudojuloides atavai Moorea, French Polynesia M106 JQ839569 D. Bellwood, JCU
Pseudojuloides atavai Moorea, French Polynesia MBIO1289 JF435151 S. Planes/J. Williams
Leptojulis cyanopleura Bali, Indonesia bal11700px124 JQ839546 B. Victor
Appendix 1. Specimen data and GenBank accession numbers for the mtDNA COI barcode sequences used to generate the
phenogram in Fig. 7, following the order in the tree. Holotype in bold.