Content uploaded by Michael H J Barfuss
Author content
All content in this area was uploaded by Michael H J Barfuss on Oct 10, 2016
Content may be subject to copyright.
A preview of the PDF is not available
Molecular studies in Bromeliaceae: Implications of plastid and nuclear DNA markers for phylogeny, biogeography, and character evolution with emphasis on a new classification of Tillandsioideae
Abstract and Figures
The monocot family Bromeliaceae comprises approximately 3,140 species distributed in tropical and subtropical regions of the New World from the southern United States to southern Argentina. The family is subdivided into eight subfamilies; the most species-rich are Tillandsioideae and Bromelioideae. Taxonomic concepts within Bromeliaceae are highly problematic, since discriminating morphological characters have been shown to be homoplastic or plesiomorphic. The present study aims to provide a robust phylogenetic framework for Bromeliaceae, especially for the most diverse and complicated subfamilies Bromelioideae and Tillandsioideae. Resulting phylogenies provide a basis to estimate the usefulness of morphological characters and to propose or strengthen hypotheses concerning evolutionary traits, biogeography, age and origins of bromeliads.
The main questions raised are:
(1) Do additional sequence data from the plastid genome and a wider sampling within Bromeliaceae provide a better resolved, robust phylogenetic framework? What are the reasons for the low DNA sequence divergence observed up to now?
(2) Can nuclear DNA sequences be successfully implemented for phylogenetic reconstruction? What are the challenges to optimize nuclear markers and do they perform better than plastid loci?
(3) Can the resulting phylogeny based on plastid and nuclear DNA sequences together with the re-evaluated morphological characters provide a reasonable, stable classification?
To provide a more robust phylogenetic hypothesis for the classification of Bromeliaceae, eight rapidly evolving plastid DNA markers (atpB-rbcL, matK, ndhF, psbA-trnH, rpl32-trnL, rps16, trnL intron, and trnL-trnF) and 90 bromeliad species were included in the current study and analysed using maximum-parsimony, maximum-likelihood, and Bayesian approaches. Results support the formerly proposed eight-subfamily classification based on the single plastid gene ndhF. Support values for five of the subfamilies increase, but that for Lindmanioideae, Puyoideae, and Bromelioideae decrease as a result of expanded taxon sampling, including several more divergent species. The initially proposed monophyletic origin of Puyoideae cannot be unambiguously confirmed. Calibration of the resulting phylogeny against time and biogeographic analysis reveals that Bromeliaceae originated in the Guayana Shield about 100 million years ago (Ma) and spread radially into adjacent areas ca. 16—13 Ma. Extant lineages arose between 20 and 5 Ma. Andean uplift facilitated diversification of core Tillandsioideae about 14.2 Ma and Bromelioideae 10.1 Ma, the latter having their greatest diversity in the Brazilian Shield due to dispersal from the Andes. The most species-rich genera did not appear before 8.7 My with a high diversification between 5 and 4 Ma, which is most likely the reason for the comparatively low sequence divergence.
To test the usefulness of nuclear regions for phylogenetic reconstruction in Bromelioideae, DNA sequences of part of the low-copy nuclear gene phosphoribulokinase (PRK) and five plastid loci (matK, 3'trnK intron, trnL intron, trnL-trnF, and atpB-rbcL) were investigated. Phylogenetic trees obtained from analyses of the PRK sequences do not contradict trees obtained from plastid markers. The PRK matrix shows a significantly higher number of potentially PICs (phylogenetically informative characters) than the plastid dataset (16.9% vs. 3.1%), which improves resolution and support in the resulting trees. Although PRK is not able to resolve relationships completely, the combined analysis with plastid markers yields good support for several uncertain relationships observed previously. The early diverging lineages can be identified (“basal bromelioids”) and the remainder of the subfamily clustered into a highly supported clade (“eu-bromelioids”). Results indicate that taxonomic circumscriptions within “core bromeliads” are still insufficient, and relationships complex and difficult to solve. Several genera appear polyphyletic, and Aechmea as well as Quesnelia remain the most complicated genera of the subfamily. Most-parsimonious character state reconstructions for two evolutionary traits (tank habit, sepal symmetry) indicate that both characters have undergone few transitions within the subfamily and thus are not as homoplasious as previously assumed. The comparative study of nuclear DNA sequences within Tillandsioideae shows that some nuclear markers are able to provide more information and a higher degree of resolution in phylogenetic trees than plastid markers. However, their utility does not depend only on sequence variability, but also on methodological challenges in using traditional Sanger-sequencing. The internal transcribed spacer of nuclear ribosomal DNA (ITS nrDNA) is not recommended as a suitable marker for phylogenetic investigations of Bromeliaceae due to the presence of strong secondary structures which create problems in amplification and sequencing as well as its low number of PICs for resolving deeper nodes. Amplified fragments of the genes malate synthase (MS) and RNA polymerase II, beta subunit (RPB2) are not helpful due to their small size and limited number of PICs. Glucose-6-phosphate isomerase (PGIC), nitrate reductase (NIA), and xanthine dehydrogenase (XDH) need to be further investigated. Phosphoribulokinase (PRK) and phytochrome C (PHYC) are useful nuclear markers and able to provide considerable resolution in phylogenetic trees, but some relationships are poorly supported.
The combined analysis of nuclear DNA sequence data (PRK, PHYC) with the already existing plastid DNA sequence data (atpB-rbcL, matK, rbcL, partial rbcL-accD, rps16 intron, partial trnK intron, trnL intron and trnL-trnF) shows a significant increase of resolution within phylogenetic trees of Tillandsioideae. Nine accepted genera can be re-circumscribed and three new genera are described taxonomically based on morphology. For morphologically distinct species groups within Racinaea and Tillandsia, two new subgenera are erected. Viridantha has been downgraded to subgeneric rank. Poor sampling within the Cipuropsis-Mezobromelia clade and missing support for clades within Tillandsia prevent the recognition of further taxonomic groups.
Figures - uploaded by Michael H J Barfuss
Author content
All figure content in this area was uploaded by Michael H J Barfuss
Content may be subject to copyright.
... For each sample, we amplified and sequenced four plastid markers (matK, rpl32-trnL, rps16-trnK, and two fragments of the gene ycf1) and the nuclear DNA Phosphoribulokinase (PRK) gene. These molecular markers were previously used in molecular phylogenetic studies of Bromeliaceae and Hechtioideae, showing good potential for phylogenetic resolution (Barfuss, 2012;Barfuss et al., 2016;Castello et al., 2016;Ramírez-Morillo et al., 2018a). The nuclear PRK gene was chosen from other nuclear loci (ITS 1-5.8S-ITS 2, ETS, g3pdh, rpb2, phyC, and Agt1; Barfuss, 2012; Palma-Silva et al., 2016; Bratzel et al., 2020) used in molecular studies of Bromeliaceae, based on the higher number of phylogenetically informative characters that provide considerable resolution in phylogenetic trees, as has been reported in some bromeliad studies (Schulte et al., 2009;Barfuss, 2012;Ramírez-Morillo et al., 2018a). ...
... These molecular markers were previously used in molecular phylogenetic studies of Bromeliaceae and Hechtioideae, showing good potential for phylogenetic resolution (Barfuss, 2012;Barfuss et al., 2016;Castello et al., 2016;Ramírez-Morillo et al., 2018a). The nuclear PRK gene was chosen from other nuclear loci (ITS 1-5.8S-ITS 2, ETS, g3pdh, rpb2, phyC, and Agt1; Barfuss, 2012; Palma-Silva et al., 2016; Bratzel et al., 2020) used in molecular studies of Bromeliaceae, based on the higher number of phylogenetically informative characters that provide considerable resolution in phylogenetic trees, as has been reported in some bromeliad studies (Schulte et al., 2009;Barfuss, 2012;Ramírez-Morillo et al., 2018a). ...
... Herbarium abbreviations are according to Index Herbariorum (http://sweetgum.nybg.org/science/ih/). JBR: Cultivated at Jardín Botánico Regional Roger Orellana (2012) prk-890r GGGTATGAGCATGTCAATTTCCTCC Barfuss (2012) prk-1057r CTTCAGCATTTGTTGTGTCACCTC Barfuss (2012) checked the congruency between the plastid and nuclear trees by visually inspecting incongruent placements of individual accessions or whole clades and support values (Pirie, 2015). jModelTest 2.1.7 ...
Bakerantha is one of three genera of subfamily Hechtioideae (Bromeliaceae). This genus was reestablished recently, and currently contains four species (B. caerulea, B. lundelliorum, B. purpusii, and B. tillandsioides), which are distributed throughout the central region of Mexico. Bakerantha tillandsioides has the widest geographical distribution of the four species, and some populations currently referred to it do not match the species description. In this study, we used an extensive sampling (81 accessions) of four plastid regions (matK, rpl32‐trnL, rps16‐trnK, and ycf1) and the nuclear PRK gene to reconstruct the phylogenetic relationships and delimit the species boundaries in Bakerantha. Our results confirm the monophyly of Bakerantha, and the species delimitation analysis supports five evolutionary lineages within Bakerantha, showing that B. tillandsioides is non‐monophyletic as currently circumscribed. Diagnostic characters and coherent geographical distributions support the five lineages. Based on our results, we describe and illustrate B. hidalguense as a new species and provide evidence that B. caerulea is morphologically and ecologically different from B. tillandsioides with which it has been confused in the past. Additionally, we provide a morphological key to the Bakerantha species.
This article is protected by copyright. All rights reserved.
... As the Agt1 maximum likelihood tree shown in Fig. 3 depicts, T. virescens, T. recurvata and T. landbeckii that have been assigned to the Tillandsia subg. Diaphoranthema in previous studies [39,40,43], can be clearly separated from the Tillandsia purpurea complex members T. purpurea and T. marconae. The different T. marconae Agt1 alleles are clearly assigned either to the T. landbeckii or the T. purpurea genepool (identical alleles and/or high bootstrap support). ...
... Accordingly, we interpret T. marconae as a putative hybrid with T. purpurea and T. landbeckii from subg. Diaphoranthema as parents as suggested earlier [42,43]. ...
... Given the fact that among the included taxa only Tillandsia landbeckii shares the habitat with Tillandsia marconae and Tillandsia purpurea [54], we consider it likely that Tillandsia marconae arose through hybridization of Tillandsia landbeckii and Tillandsia purpurea. These findings are in support of an earlier study that used other low-copy nuclear markers to address the same question [43]. Although these hypothesis needs to be further underlined with other taxonomically relevant data and with a more comprehensive dataset, we consider it noteworthy to find that the Agt1 sequence resolution is high enough to be also used for studies on the population level in order to reconstruct reticulate evolutionary processes. ...
Background
The angiosperm family Bromeliaceae comprises over 3.500 species characterized by exceptionally high morphological and ecological diversity, but a very low genetic variation. In many genera, plants are vegetatively very similar which makes determination of non flowering bromeliads difficult. This is particularly problematic with living collections where plants are often cultivated over decades without flowering. DNA barcoding is therefore a very promising approach to provide reliable and convenient assistance in species determination. However, the observed low genetic variation of canonical barcoding markers in bromeliads causes problems.
Result
In this study the low-copy nuclear gene Agt1 is identified as a novel DNA barcoding marker suitable for molecular identification of closely related bromeliad species. Combining a comparatively slowly evolving exon sequence with an adjacent, genetically highly variable intron, correctly matching MegaBLAST based species identification rate was found to be approximately double the highest rate yet reported for bromeliads using other barcode markers.
Conclusion
In the present work, we characterize Agt1 as a novel plant DNA barcoding marker to be used for barcoding of bromeliads, a plant group with low genetic variation. Moreover, we provide a comprehensive marker sequence dataset for further use in the bromeliad research community.
... Total genomic DNA was extracted using the DNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) according to the manufacturer's protocol. The plastid rps16 intron and the nuclear ribosomal ITS (internal transcribed spacer) regions were amplified and sequenced using the primers rpsF and rpsR2 (Oxelman et al., 1997), and ITS18Sfa (ITS18Scsf, 5′-GAA TGG TCC GGT GAA GTG TTC G-3′) and ITS26Sra (ITS26Scsr, 5′-GGA CGC TTC TCC AGA CTA CAA TTC G-3′; Barfuss, 2012), respectively. For ITS, two additional sequencing reactions were performed using the internal primers ITS5.8Sfa (ITS5.8Scf, ...
... 5′-GAC TCT CGG CAA CGG ATA TCT CG-3′) and ITS5.8Sra (ITS5.8Scsr, 5′-GAT GCG TGA CGC CCA GGC AG-3′), which are located in the 5.8S region (Barfuss, 2012). Wet lab procedures principally follow the protocol by Ehrendorfer et al. (2018), but amplification was done with 2× Phusion Green Hot Start II High-Fidelity PCR Master Mix (Thermo Scientific, Vienna, Austria) using a standard protocol with optimized annealing temperatures (rps16: 68°C; ITS: 70°C) and the addition of 3% DMSO (Sigma-Aldrich) for ITS. ...
Although mountain ranges are often recognized as global biodiversity hotspots with a high level of endemism, diversity and biogeographic connections of isolated and weakly explored mountains remain poorly understood. This is also the case for Shirkuh Mts. in central Iran. Here, Yazdana shirkuhensis gen. & spec. nov. (Caryophylleae, Caryophyllaceae) is described and illustrated from the high alpine zone of this mountain. Molecular phylogenetic analyses of nuclear and plastid DNA sequence data show that Yazdana shirkuhensis is related to Cyathophylla and Heterochroa (tribe Caryophylleae). The herein newly described genus and species accentuate the Shirkuh Mts. as a center of endemism, which harbors a high number of narrowly distributed species, mostly in high elevations reaching alpine habitats. As this area is currently not protected, high elevations of Shirkuh Mts. have conservation priority. This article is protected by copyright. All rights reserved.
... The sulcate type predominates in the family but is less frequent in Bromelioideae, in which biporate or polyporate pollen prevails (Halbritter & Till 1998). Although there are overlaps between sulcus types, there are often conspicuous correlations with taxonomic groups at least in Bromelioideae and Tillandsioideae (Barfuss 2012, Barfuss et al. 2016. ...
A new species of Krenakanthus, a member of the bromelioid “Cryptanthoid complex”, is described based on plants discovered through collaborative citizen science. Krenakanthus ribeiranus and its only congener K. roseolilacinus are endemic to the “João Pinto Center of Biodiversity”, a still poorly explored region with Campos Rupestres and associated vegetation in the Rio Doce Valley, in eastern Minas Gerais state, Brazil. The unusual combination of morphological characters of K. ribeiranus, highlighted by plant delicacy and almost all leaf and flower parts covered by uniseriate, hair-like trichomes, is illustrated and discussed in comparison with K. roseolilacinus, including leaf and seed anatomy, as well as pollen morphology. This micro-endemic species is assessed as Critically Endangered, reinforcing the need for strategy to protect the biodiversity of the region. The morphology of the new species validates and strengthens the diagnostic flower characters used in the circumscription of Krenakanthus, suggesting as secondary diagnostic characters the habit, stature, and leaf conformation.
... Approximately 650 bp of cytochrome c oxidase subunit I (COI), 400 bp of 16S, 1 700 bp of 18S, 1 000 bp of 28S, and 900 bp of ITS (ITS1-5.8S-ITS2) genes were amplifi ed using the following primers: LoboF1 and LoboR1 for COI (Lobo et al., 2013); Ann16SF and Ann16SR for 16S (Sjölin et al., 2005); 18SA and 18SB for 18S (Medlin et al., 1998;Nygren and Sundberg, 2003), 28S D1_F and D3 for 28S (Brown et al., 1999;Vonnemann et al., 2005); ITS18SFPOLY and POLY_28R for ITS (Barfuss, 2012). The 25-μL reaction contained 12-μL 2X Es TaqMasterMix (CWBio Co., Ltd., Beijing, China), 1 μL of each primer (10 mmol/L), 2 μL of template DNA (50 ng/μL), and 9-μL dH 2 O. Thermal cycling protocols followed Wu et al. (2019) ...
Laetmonice Kinberg, 1856 is a remarkable genus characterized by having harpoon notochaetae in the polychaete family Aphroditidae. We describe a new species of Laetmonice, Laetmonice iocasica sp. nov., found from seamounts on the Caroline Ridge in the tropical Western Pacific. The new species is readily distinguished from congeners, particularly those distributed in the Indo-Pacific Ocean by possessing 45 segments with 18 pairs of elytra, and the tuberculated harpoon notochaetae in the elytrigerous segments, which are replaced by tuberculated notochaetae without recurved fangs on segments 4 and 5. Laetmonice iocasica sp. nov. is closely related to L. producta Grube, 1877, but differs in both morphology and the genetic distance of the mitochondrial cytochrome oxidase subunit I (COI) sequences. Laetmonice producta Grube, 1877 contained five varieties reported in various marine areas, which have been raised to species level. However, the records of L. producta from the Sagami Bay and Suruga Bay in Japan and in the south-eastern Australia remain obscure and probably represent a different species. The data indicate that L. producta, which was originally described from Kerguelen Islands in the Southern Ocean and later commonly found on the Antarctic shelf, is probably distributed only at high latitudes of the Southern Hemisphere.
... However, the systematic value of pollen morphology within Bromeliaceae has been demonstrated in many studies. Sulcate pollen prevails in the family Bromeliaceae while as in the subfamily Bromelioideae porate pollen grains predominate (Halbritter, 1992;Halbritter and Till, 1998;Schulte and Zizka, 2008;Barfuss, 2012;Heller et al., 2015b). Nevertheless, sulcate pollen is regarded as plesiomorphic for the subfamily Bromelioideae and evolved secondarily in some clades of the core Bromelioideae, as well as inaperturate pollen (e.g. ...
Phylogenetic trouble unleashed
The first part of my thesis deals with a comprehensive phylogeny of the Bromelioideae subfamily. The family Bromeliaceae is subdivided into eight subfamilies, one of them is the Bromelioideae. Phylogenetic relationships among the Bromelioideae are still poorly understood and many of the extant genera are suspected to be not monophyletic. Especially Aechmea, the largest and most polymorphic genus constitutes many questions and the genus was used as a depot for taxonomically problematic species. The phylogenetic study presented here is the most comprehensive one so far, covering about half of the known species (434 of 965, Table 1) of Bromelioideae. The phylogeny was generated using plastid (atpB-rbcL, matK, rps16, ycf1_1, ycf1_6) and nuclear (AGT1_exon, ETS, G3PDH, PHYC, RPB2) genetic markers. The markers were analysed individually as well as combined using maximum likelihood and Bayesian analysis. The comparison of plastid vs. nuclear data revealed significant differences which were discussed in detail and hypothesised to indicate hybridisation in certain lineages. Nevertheless, the combination of both datasets increased the overall resolution of the phylogeny and was used to discuss the results in the light of previous studies. The entire phylogeny was divided into 32 groups for discussion. These groups represent potential genera or starting points for further studies in order to reorganise the polyphyletic genera of Bromelioideae into monophyletic lineages. Many extant genera of the eu-Bromelioideae were found to be not monophyletic. Monophyly was observed for the genera Acanthostachys, Billbergia, Cryptanthus, Disteganthus, Hoplocrypanthus, Lapanthus, Orthocryptanthus, Orthophytum, Rokautskyia, Ronnbergia, Sincoraea, Wittmackia and the monotypic ones (Deinacanthon, Eduandrea, Fascicularia, Hohenbergiopsis, Pseudananas). The genus concept proposed by Smith and Downs (1979) is therefore rejected, as well as the taxonomic utility of petal appendages, which were mainly used to delimit genera. In summary, this study and recent studies highlighted other morphological characters (e.g. pollen morphology, stigma type) as much more informative. However, no single character should be used to delimit genera and combinations of relevant characters are required. Even the petal appendages can pose a taxonomical important character at certain taxonomic level.
The combination of biogeography and phylogeny revealed that species of some groups which co- occur in a biome or region are also phylogenetically closely related. These groups were not recognised before because the misinterpretation of homoplastic characters led to wrong taxonomical conclusion. For example, the recent re-organisation of the Cryptanthoid group and the re-establishment of Wittmackia with the former Hohenbergia subgen. Wittmackiopsis species highlighted, among other characters, the importance of biogeography. Another case is the subgenus Neoregelia subgen. Hylaeaicum which is geographically and phylogenetically separated from the Nidularioid group and therefore has to be excluded.
5
The large phylogeny presented here gives evidence for multiple invasions of the Brazilian biomes (Amazon Forest, Atlantic Forest, Cerrado, Caatinga) as well as of Central America and the Greater Antilles. It is important to note that the phylogeny is lacking resolution in the deeper nodes. Confident assumptions are therefore hindered and the historical biogeography of Bromelioideae remains cryptic. Anyway, the Atlantic Forest is nowadays the diversity hotspot of the core Bromelioideae and critically endangered. Extensive conservation efforts are required to protect the diverse flora, including the bromeliads.
The genetic markers used so far in bromeliad phylogenies provided only limited variation resulting in often unresolved complexes. The search for additional suitable genetic markers in bromelioid phylogenies yielded the nuclear marker AGT1. The amplified fragment consists of one well conserved exon region as well as a highly variable intron. The intron was too variable for aligning it across the entire bromelioid set. On the other hand, the intron provides relevant information for inferring phylogenies of closely related species groups (e.g. in Ananas, Cryptanthoid group). Furthermore, AGT1 is proposed as a genetic barcode in Bromelioideae because it poses much more information then the commonly used ones (e.g. matK).
Does size matter?
The second part of this thesis deals with the genome size evolution within the family Bromeliaceae. Samples from seven subfamilies were screened with the emphasis on the subfamily Bromelioideae. The data were combined with data from literature and the observed patterns were discussed in relation to known phenomena (e.g. correlations to environment and life form). In the second sub-chapter I have chosen the species Tillandsia usneoides to study the intraspecific genome size variation in combination with morphology and biogeography. Genome size and base composition were measured using the flow cytometry technique.
Bromeliaceae comprises mostly diploid species with predominantly 50 small chromosomes (2n), small genome sizes (0.59-4.11 pg) and normal GC content (36.46-42.21 %) compared to other families. Polyploidy was observed so far in the subfamilies Bromelioideae, Tillandsioideae and Pitcairnioideae. Triploids, tetraploids and potential hexaploids were identified. The genera show significant differences in holoploid genome size and base composition throughout the entire family. GC content is weakly positively correlated with genome size. Significant intraspecific genome size variation has been observed, including polyploidization, but no endopolyploidy and no variation in dioecious species. Within the subfamily Bromelioideae, the observed genome size between the early diverging lineages and the core Bromelioideae supports this division. The differences are due to a higher proportion of polyploids in the early diverging lineages and a significant higher
6
GC content in the core Bromelioideae. Both groups differ in their life strategies and occupy principally different habitats with corresponding morphological adaptations. Hence, the early diverging lineages are predominantly terrestrial and xeromorphic. In contrast, the prevailing epiphytic core Bromelioideae are characterised by a tank habit and mostly adapted to more humid environments. Across the family and the subfamily Bromelioideae in particular, significant genome size differences between the different life forms have been observed, but no correlation to biomes within Brazil.
Tillandsia usneoides is the most widely distributed species of the family Bromeliaceae. It ranges from the southeastern United States to Argentina and Chile. Tillandsia usneoides grows epiphytic and is dispersed by seeds as well as by fragments of the plant. Within the species striking morphological differences can be observed as far as size characters are concerned. Morphotypes have shown to be stable in cultivation while growing under the same conditions. In order to investigate possible reasons for the variation the relative genome size of 75 specimens covering the whole distribution range was measured and combined with morphological, distribution and climatic data. Significant variation in the relative genome size corresponded to the morphological differences and reflected the north-south distribution gradient. Genome size and morphotypes showed a positive correlation, as well as with the mean temperature of the driest and coldest quarter and the minimal temperature of the coldest month.
Full-text view-only version of this paper: https://rdcu.be/c3phg. The green phyllodocids Eulalia clavigera and E. viridis are a known European pseudo-cryptic complex, but questions about its distribution and evidence of additional lineages in previous studies call for an investigation of the real diversity within the complex.
We analyze DNA sequences (mtCOI-5P, ITS, and 28S rRNA) of different populations of E. clavigera from intertidal and subtidal marine waters along the North East Atlantic, Mediterranean Sea, the Azores and Webbnesia (Madeira, Savage islands and Canaries), and populations of E. viridis from the Scandinavia. This provided compelling evidence for the existence of six additional divergent evolutionary lineages, three of the most abundant being described here as new species: Eulalia feliciae sp. nov., intertidal and unique to the Western Mediterranean, Eulalia madeirensis sp. nov., subtidal and unique to the Madeira Island (Portugal), and Eulalia xanthomucosa sp. nov., mostly subtidal and occurring in the British Isles and southern France. Complementary morphometric analyses showed that E. feliciae sp. nov. and E. madeirensis sp. nov. formed two independent morphometric clusters, while E. xanthomucosa sp. nov. often overlapped with E. clavigera sensu stricto (s. s.), although being unique in showing a yellow coloration and parapodial cirri on median segments larger in relation to its body size.
Recent biotechnological findings based on “E. clavigera” specimens highlight the importance of formally describing cryptic complexes, since each lineage chemistry might be unique and may have a range of distinct effects and applications.
The genus Stigmatodon occurs in vertical and bare granite slopes, typical of the inselbergs of the Brazilian Atlantic Forest. Here, we present the first broad phylogenetic analysis focused on Stigmatodon , sampling a total of 83 terminals, including 16 of the 20 species of the genus and the morphologically similar species of Vriesea . We conducted a phylogenetic analysis using two plastid markers ( matK and rps16-trnK ) and the nuclear gene PHYC to infer phylogenetic relationships and reconstruct ancestral states for ecological and morphological characters. Our results suggest the monophyly of Stigmatodon as originally circumscribed is only possible with the inclusion of morphologically and ecologically similar Vriesea species. In addition, the morphological and anatomical traits led us to propose a new circumscription for the genus, combining eight species of Vriesea to Stigmatodon as S. andaraiensis , S. freicanecanus , S. lancifolius , S. limae , S. oliganthus , S. pseudoliganthus , S. vellozicolus , and S. zonatus . The stomata positioned above the ordinary epidermal cells, the adaxial water-storage parenchyma with axially elongated cells, the stamens positioned in two groups of three on each side of the corolla, and the tubo-laciniate stigma are exclusive to Stigmatodon in its new circumscription. These new morphological and phylogenetic results constitute a relevant contribution to the taxonomy and evolution of Bromeliaceae, one of the most diverse and ecologically important families of flowering plants of the Neotropics.
DOI for the Supplemental Material: https://doi.org/10.6084/m9.figshare.18858224.v1.
Eumida sanguinea is a recognized polychaete species complex which, in previous studies, has been reported to have additional undescribed diversity. We detected nine additional lineages by analysing DNA sequence data (mitochondrial: COI, 16S rRNA and nuclear loci: ITS region and 28S rRNA) of E. sanguinea morphotype populations from a broader sampling effort in European marine waters. Traditional morphological features failed to provide consistent differences or unique characters that could be used to distinguish these Eumida species. However, by complementing DNA data with morphometrics, geographic range, colour and pigmentation patterns, we revealed five new species. Two of these undescribed species derived from the previously signalled Eumida lineages S21 and GB22, which are here named as E. schanderi sp. nov. and E. fenwicki sp. nov., respectively. Three other species are based on newly discovered lineages, namely E. fauchaldi sp. nov., E. langenecki sp. nov. and E. pleijeli sp. nov. From the six new lineages remaining, three are represented by fewer than two well-preserved specimens, which prevented further comprehensive analysis. The last three lineages were only distinct when using mitochondrial markers. Integrative taxonomy is essential to elucidate evolutionary phenomena and eventually allow informed use of species complexes, exhibiting stasis in biomonitoring or other ecological studies.
Plectranthus hadiensis is an important medicinal plant in Sri Lanka. It was considered a separate species, P. zeylanicus, endemic to the island until its inclusion, as P. hadiensis var. tomentosus, together with morphs from southern Africa in the revised species concept of P. hadiensis. However, there are morphological, chemical, and therapeutic differences between the African and Sri Lankan morphs. We used eight molecular markers in a phylogenetic study to clarify the species concept of P. hadiensis and to investigate whether it should include the Sri Lankan morph. We examined the position of the two P. hadiensis morphs in relation to eight other Plectranthus species. The maximum likelihood tree revealed three clades: a weakly supported clade including P. calycinus, P. glabratus, P. fruticosus, and P. malabaricus; a highly supported clade including P. amboinicus and African and Sri Lankan specimens of P. hadiensis; and a highly supported clade formed by P. barbatus, P. caninus, and P. hadiensis var. tomentosus. The African P. hadiensis specimens form a highly supported subclade sister to a subclade containing the Sri Lankan P. hadiensis, suggesting that the subclades correspond to either two sister species or two subspecies. We propose that they are more likely to be sister species given the differences in morphology, chemistry, and chromosome number.
The development of universal markers that can be assayed across taxa, but which are polymorphic within taxa, can facilitate both comparative map-based studies and phylogenetic analyses. Here we describe the development of such markers for use in the Asteraceae, which includes the crops lettuce, sunflower, and safflower as well as dozens of locally important crop and weed species. Using alignments of a conserved orthologous set (COS) of ESTs from lettuce and sunflower and genomic sequences of Arabidopsis, we designed a suite of primer pairs that are conserved across species, but which are predicted to flank introns. We then tested 192 such primer pairs in 8 species from across the family. Of these, 163 produced an amplicon in at least 1 taxon, and 125 amplified in at least half of the taxa surveyed. Thirty-nine amplified in all 8 species. Comparisons amongst sequences within the lettuce and sunflower EST databases indicate that the vast majority of these loci will be polymorphic. As a direct test of the utility of these markers outside the lettuce and sunflower subfamilies, we sequenced a subset of ten loci from a panel of cultivated safflower individuals. All 10 loci proved to be single-locus, and nine of the 10 loci were polymorphic with an average of 12.8 SNPs per kb. Taken together, these loci will provide an initial backbone for comparative genetic analyses within the Asteraceae. Moreover, our results indicate that these loci are phylogenetically informative, and hence can be used to resolve evolutionary relationships between taxa within the family as well as within species.
The pantropical orchid genus Polystachya is the subject of ongoing taxonomic work. We inferred phylogenetic relationships in the genus using 5.3 kb of plastid DNA, for 83 out of ca. 240 species and 12 out of 15 sections, as well as five outgroup species. We also collected ploidy data using chromosome counts and genome size estimates. Bayesian and parsimony trees were congruent with each other and well resolved. Polystachya appears monophyletic based on current sampling, provided that the name P. neobenthamia is used instead of Neobenthamia gracilis for that species. The current sectional classification does not define monophyletic groups, but the present study can be used as the basis for a future sectional classification. Areas postulated as Pleistocene refugia for wet tropical forests in Africa also form centres of diversity for the genus. Biogeographical analyses using DIVA and Lagrange show an early radiation in eastern Africa, followed by separate radiations in eastern and western Africa. Subsequent dispersal from western to eastern Africa has occurred at a much higher rate than from east to west. Dispersal to the Neotropics occurred more than once, and one lineage has spread recently and rapidly throughout the tropics. Polyploidy has occurred several times during the diversification of the genus, most notably in association with the recent pantropical dispersal.
Eighty-three chromosome counts are reported for 72 taxa of the Bromeliaceae. Fifty-eight of these counts are the first known chromosome number reports for their respective taxa. A model of chromosomal evolution in the Bromeliaceae (n = 25) is presented. The model is parsimonious and consistent with existing data on meiotic chromosome numbers within the family and in the closely related Velloziaceae (n = 9). Two hypothesized paleodiploids (n = 8 and n = 9) hybridized to form a tetraploid that in turn hybridized with the n = 8 lineage. The resultant n = 25 is the extant base number for the family. Two alternative hypotheses could explain the unique extant base number (n = 17) for Cryptanthus: 1) Cryptanthus represents the paleotetraploid level, i.e., prior to the second round of hybridization, or 2) the lower number represents the result of a more recent series of aneuploid reductions from n = 25. Given the existence of intergeneric hybrids involving Cryptanthus, aneuploid reduction is the more likely interpretation.
