Black ginger extract increases physical fitness performance and muscular endurance by improving inflammation and energy metabolism

Article (PDF Available)inHeliyon 2(5):e00115 · May 2016with 1,321 Reads 
How we measure 'reads'
A 'read' is counted each time someone views a publication summary (such as the title, abstract, and list of authors), clicks on a figure, or views or downloads the full-text. Learn more
DOI: 10.1016/j.heliyon.2016.e00115
Cite this publication
Abstract
We previously reported that polymethoxyflavones (PMFs) in black ginger (Kaempferia parviflora) extract (KPE) increased energy production by activating AMP-activated protein kinase (AMPK) in C2C12 myoblasts. We herein evaluated the effects of KPE on physical fitness performance and muscular endurance in mice. Male mice were orally administered KPE for 4 weeks, and then forced swimming test, open-field test, inclined plane test, and wire hanging test were performed. KPE significantly increased the swimming time, motility after swimming, and grip strength. IL-6 and TNF-α mRNA expression levels were decreased in the soleus muscle, whereas peroxisome proliferator-activated receptor γ coactivator (PGC)-1α and glycogen synthase mRNA expression levels, mitochondrial number, and glycogen content were increased. These results were in agreement with those obtained for KPE and PMFs in C2C12. Therefore, the activation of AMPK by PMFs may be one of the mechanisms by which KPE improves physical fitness performance and muscular endurance.
Figures - available via license: CC BY 4.0
Content may be subject to copyright.
Advertisement
Black ginger extract increases
physical fitness performance
and muscular endurance by
improving inflammation and
energy metabolism
Kazuya Toda, Shoketsu Hitoe, Shogo Takeda, Hiroshi Shimoda *
Research and Development Division, Oryza Oil and Fat Chemical Co., Ltd., 1 Numata, Kitagata-cho, Ichinomiya,
Aichi 493-8001, Japan
* Corresponding author.
E-mail address: kaihatsu@mri.biglobe.ne.jp (H. Shimoda).
Abstract
We previously reported that polymethoxyflavones (PMFs) in black ginger
(Kaempferia parviflora) extract (KPE) increased energy production by activating
AMP-activated protein kinase (AMPK) in C2C12 myoblasts. We herein evaluated
the effects of KPE on physical fitness performance and muscular endurance in
mice. Male mice were orally administered KPE for 4 weeks, and then forced
swimming test, open-field test, inclined plane test, and wire hanging test were
performed. KPE significantly increased the swimming time, motility after
swimming, and grip strength. IL-6 and TNF-αmRNA expression levels were
decreased in the soleus muscle, whereas peroxisome proliferator-activated receptor
γcoactivator (PGC)-1αandglycogensynthasemRNAexpressionlevels,
mitochondrial number, and glycogen content were increased. These results were
in agreement with those obtained for KPE and PMFs in C2C12. Therefore, the
activation of AMPK by PMFs may be one of the mechanisms by which KPE
improves physical fitness performance and muscular endurance.
Keywords: Biological sciences, Plant biology, Biochemistry
Received:
7 April 2016
Revised:
27 April 2016
Accepted:
13 May 2016
Heliyon 2 (2016) e00115
http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
1. Introduction
Black ginger, the rhizome of Kaempferia parviflora (Zingiberaceae), has
traditionally been used as food and a folk medicine for more than 1000 years in
Thailand. The dried rhizome is generally pulverized and used as tea bags, while the
fresh one is utilized to brew wine. The wine preparation is increasingly used in
Thailand as a tonic and as an aphrodisiac. As dietary supplements, it has been made
into various preparations such as medicinal liquor or liquor plus honey, pills
(powdered rhizome with honey), capsules and tablets. In Thai traditional medicine,
black ginger has been claimed to cure allergy, asthma, impotence, gout, diarrhea,
dysentery, peptic ulcer and diabetes. A large number of recent studies have
demonstrated the biological activities of black ginger extract (Kaempferia
parviflora extract: KPE) and polymethoxyflavones (PMFs) including anti-
oxidative activity, etc [1,2,3,4,5,6,7]. KPE has been shown to improve
physical fitness performance in clinical studies [6,7]. The anti-oxidative activity of
KPE has been implicated in its beneficial effects. We previously reported that
PMFs in KPE increased energy production through AMPK activation induced
improvements of metabolism in myocytes [8]. For the beneficial effects of black
ginger on health, we have developed a powdered black ginger extract as a healthy
food ingredient and put it on the market, which is known as Black Ginger Extract
that has been standardized to contain not less than 2.5% of 5,7-dimethoxyflavone
and 10% of total PMFs. The healthy function of black ginger has been continuously
being investigated.
Physical exhaustion decreases physical fitness performance and muscular
endurance. Fatigue was previously thought to decrease in intracellular pH
(acidosis) by the accumulation of lactic acid (LA) [9]. However, recent findings
suggest that the accumulation of LA is not a direct cause of fatigue, but rather a
fatigue-recovering factor [10,11,12,13]. Furthermore, various factors including
ATP metabolism, acidosis, and oxidative stress have been suggested to play a role
in the complex processes of fatigue [14,15,16,17,18,19,20,21].
AMP-activated protein kinase (AMPK) is known to be critically involved in the
regulation of energy homeostasis, [22,23,24] and its activation has been shown to
enhance the metabolism of glucose and lipids [25,26]. Therefore, AMPK has been
an attracting target for the discovery of anti-diabetic or anti-obesity treatments.
AMPK is linked to physical activity and muscular endurance. 5-Aminoimidazole-
4-carboxyamide ribonucleotide (AICAR), an agonist of AMPK, was previously
reported to increase running endurance by up to 44% and decrease body fat in mice
when orally administered for 4 weeks [27]. Consequently, the activation of AMPK
has been suggested to improve physical fitness performance, muscular endurance,
and fat metabolism. Therefore, we hypothesized that KPE may improve physical
Article No~e00115
2http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
fitness performance not only by its anti-oxidative activity, but also through other
mechanisms including the activation of AMPK.
The beneficial effects of black ginger on fatigue or muscular endurance have not
yet been investigated. Based on the findings described above, we herein evaluated
the effects of KPE on physical fitness performance and muscular endurance in
mice. In order to clarify the underlying mechanisms of action, the soleus muscle
and blood were collected from mice administered KPE, and various parameters
related to physical fitness performance, muscular endurance, inflammation,
metabolism in mitochondria, and the accumulation of glycogen were evaluated.
Furthermore, in an attempt to identify active compounds in KPE, PMFs were
evaluated in mouse myoblasts (C2C12).
2. Materials and methods
2.1. Animals and feeding
Animal experiments were performed in accordance with the Guidelines for the
Proper Conduct of Animal Experiments (Special Council of Japan, June 1, 2006).
Male ddY mice aged 10 weeks old (Japan SLC, Co., Ltd., Hamamatsu, Japan) were
kept at 23 ± 1 °C with a humidity of 60 ± 5% under a 12-h light/dark cycle. Mice
were freely fed a standard solid feed (CE-2, Oriental Yeast Co., Ltd., Tokyo,
Japan). They were divided into two groups with 15 mice in each group. The KPE
group was orally administered KPE (45 mg/kg/day) suspended in water for 4
weeks. The control group was orally administered the vehicle of KPE.
2.2. Regents
NucleoSpin
®
Tissue, the kit used to extract total DNA from the soleus muscle, was
purchased from Takara Bio Inc. (Kusatsu, Japan). Lipopolysaccharide (LPS) from
Escherichia coli 0127: B8 was purchased from Sigma-Aldrich Co. LLC (St. Louis,
MA, USA). LA was purchased from Wako Pure Chemical Industries, Ltd. (Osaka,
Japan). Lactate colorimetric assay kit 2 was purchased from BioVision (Milpitas,
CA, USA). Other reagents used in the in vitro test and various evaluations of mice
were prepared according to our previous study [8].
2.3. Preparation of KPE and PMFs
KPE was obtained from dried rhizomes of black ginger by extracting with aqueous
alcohol (yield 15.9%). KPE was mixed with modified starch at a ratio of 3:7 (KPE:
modified starch) and then powdered by spray drying. The KPE suspension for in
vivo experiment use was prepared by suspending 600 mg of powdered KPE in 40
mL water. Regarding the vehicle, 420 mg of modified starch was dissolved in 40
mL water. These solutions were ingested to mice. PMF standards including
Article No~e00115
3http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
5-hydroxy-3,7-dimethoxyflavone (1), 5-hydroxy-7-methoxyflavone (2), 5-hy-
droxy-3,7,4'-trimethoxyflavone (3), 5-hydroxy-3,7,3',4'-tetramethoxyflavone (4),
3,5,7,3',4'-pentamethoxyflavone (5), 5,7,4'-trimethoxyflavone (6), 3,5,7,4'-tetra-
methoxyflavone (7), and 5,7-dimethoxyflavone (8) were the same ones as used in
our previous study [8]. The contents of all PMFs in powdered KPE were
determined by reverse-phase HPLC using a Prominence HPLC system (Shimadzu,
Kyoto, Japan) equipped with a photodiode array detector (Model SPD-M20A) and
a Develosil RPAQUEOUS-AR-5 column (4.6 × 150 mm, 5 μm particle size,
Nomura Chemical Co., Ltd., Japan). The mobile phase was a binary gradient and
consisted of a mixture of acetonitrile, water and acetic acid (35:62.5:2.5, v/v) as
solvent A and a mixture of acetonitrile and acetic acid (97.5:2.5, v/v) as solvent B.
The flow rate was fixed at 1.0 mL/min and column temperature was set at 35 °C.
The gradient condition was as follows: 020 min (solvent A: 991%). A UV
detection at 263 nm was used. The contents of the determined PMFs were 1
(0.66%), 2(0.52%), 3(0.81%), 4(0.30%), 5(2.94%), 6(3.14%), 7(1.75%) and 8
(2.5%), respectively (Fig. 1).
2.4. Test schedule in mice
In vivo tests were performed based on the schedule described in Fig. 2A. At
screening period, consecutive forced swimming test (CST) was performed on day
5 and 4. On day 3 and 2, physical fitness measurement tests (PT) were
[(Fig._1)TD$FIG]
Fig. 1. HPLC chromatogram of KPE for determination of PMFs. PMFs in KPE were separated on a
Develosil RPAQUEOUS-AR-5 column. The chromatographic mobile phase consisted of A
(acetonitrile: water: acetic acid = 35: 62.5: 2.5, v/v) and B (acetonitrile: acetic acid = 97.5: 2.5, v/
v). The gradient program was set as 020 min (solvent A: 991%). Use of 263 nm as a selective
wavelength allowed identification of the 8 known PMFs. Peak 1, 5-hydroxy-3,7-dimethoxyflavone; 2,
5-hydroxy-7-methoxyflavone; 3, 5-hydroxy-3,7,4'-trimethoxyflavone; 4, 5-hydroxy-3,7,3',4'-tetra-
methoxyflavone; 5, 3,5,7,3',4'-pentamethoxyflavone; 6, 5,7,4'-trimethoxyflavone; 7, 3,5,7,4'-tetra-
methoxyflavone; 8, 5,7-dimethoxyflavone.
Article No~e00115
4http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
performed and mice were divided into 2 groups according to the data obtained
from CST and PT to insure the total physical fitness performance of the two groups
to be almost same. After grouping (day 0), mice were orally administered KPE or
vehicle, and the same paired tests (CST and PT) conducted at 0 week were
performed at the 1-, 2-, and 4-week periods. After the test at the 4-week period, the
soleus muscle was collected from the right hind leg in order to investigate the
expression of various mRNAs, mitochondrial number, and glycogen content.
Blood was collected from the ventral aorta under anesthesia in order to determine
blood LA levels.
2.5. CST
In a round water pool (φ25 cm, 30 cm in depth filled with warmed water at 37 °C
to 40 °C), mice were bound by their tails to a weight that was approximately 10%
of their body weights and forced to swim. In order to exclude air on the surface of
the hair, measurements were started after the body had been submerged once below
[(Fig._2)TD$FIG]
Fig. 2. Protocol for in vivo test. The time schedule of the in vivo test (A). Each number shows the day
before and after the first oral administration of KPE or vehicle. The allow (), open triangle () and
closed triangle () mean grouping, consecutive forced swimming test (CST) and physical fitness
measurement tests (PT), respectively. Bold lines indicate the administration period of the vehicle (upper
line) for the control and KPE (lower line). The time schedules of the CST and PT are shown in B. Each
closed rectangle () means the forced swimming test (ST). The vertically lined rectangle (), open
rectangle (), and horizontally lined rectangle () mean the open-field test, inclined plate test, and
wire hanging test, respectively.
Article No~e00115
5http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
the water surface. The floating time was defined as the time until the mouse was
unable to float for 5 seconds [or 7 seconds in case of forced swimming (ST) in PT]
on the surface of the water. Moreover, in the CST, secondary ST was performed 30
min after the first ST under the same conditions. ST was subsequently performed a
total of 7 times at 0, 0.5, 1, 1.5, 2, 2.5 and 3 h (Fig. 2B).
2.6. PT
PT were performed using the following methods: ST, open-field test, inclined
plane test, and wire hanging test (Fig. 2C). ST was performed under almost the
same conditions as the CST. The other tests were performed twice (Fig. 2C),
before and after ST, as described below. Open-field test: A mouse was placed in a
square field (30 × 30 cm) divided into 9 areas. The number of times the mouse
moved to other areas was measured for 3 min. Inclined plate test: after the open-
field test, the mouse was placed on a wooden board covered with a canvas, which
was leaned gradually at a constant speed. The angle at which the mouse dropped
from the board was measured. Wire hanging test: after the inclined plane test, mice
were bound by their tails to a weight that was 15% of their body weight. They were
then placed on a square wire mesh (30 × 30 cm, mesh size 1 cm, wire diameter φ1
mm). The wire mesh with the mouse on was turned upside down and placed at a
height of 50 cm. The sides were shielded and the time until the mouse dropped off
was measured.
2.7. Measurement of mitochondrial DNA
Mitochondrial DNA was determined by the method of Henagan et al. [28] Total
DNA was extracted from 25 mg of the soleus muscle by NucleoSpin
®
Tissue. The
DNA obtained was used to determine the expression of mitochondrial DNA
(mtDNA) and genomic DNA (gDNA) by using real-time PCR. The specific
primers used for the nuclear gene of lipoprotein lipase were 5'-GGATGGACGG-
TAAGAGTGATTC-3' (forward) and 5'-ATCCAAGGGTAGCAGACAGGT-3'
(reverse). The specific primers used for the mitochondrial gene of NADH
dehydrogenase subunit I were 5'-CCCATTCGCGTTATTCTT-3' (forward) and 5'-
AAGTTGATCGTAACGGAAGC-3' (reverse). The ratio of mitochondrial num-
bers was calculated from the relative expression of the mitochondrial gene to the
nuclear gene using the ΔΔCt method.
2.8. Determination of glycogen content
Glycogen content was determined by the method of Lo et al. [29]. The soleus
muscle (20 mg) or C2C12 were soaked in 1 mL of 30% (w/v) KOH and incubated
at 100 °C for 15 min. After the incubation, the extract was added 2 mL of EtOH
and incubated at 4 °C for 5 min. Then, the extract was centrifuged (500 × g, 4 °C,
Article No~e00115
6http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
7 min) and the supernatant was removed. After sufficient drying of the pellets,
glycogen contents were measured using the phenol-sulfuric acid method and then
normalized by the weight of the soleus muscle or cell number.
2.9. Determination of blood LA level
After PT at the 4-week period, blood was collected and centrifuged (200 × g, room
temperature, 3 min). The supernatant obtained was used to measure blood LA
levels by lactate colorimetric assay kit 2.
2.10. Analysis of mRNA in the mouse soleus muscle and C2C12
Total RNA was extracted from the soleus muscle (25 mg) or C2C12 and relative
mRNA expression levels were evaluated using our previously described method
[8]. The specific primers used were as follows: IL-6, 5'- TCTATACCACTTCA-
CAAGTCGGA 3' (forward) and 5'- GAATTGCCATTGCACAACTCTTT 3'
(reverse), TNF-α, 5'- GACGTGGAAGTGGCAGAAGAG 3' (forward) and 5'-
TGCCACAAGCAGGAATGAGA 3' (reverse); peroxisome proliferator-activat-
ed receptor γcoactivator (PGC)-1α, 5'- TATGGAGTGACATAGAGTGTGCT 3'
(forward) and 5'- CCACTTCAATCCACCCAGAAAG 3' (reverse); peroxisome
proliferative activated receptor (PPAR)-γ1, 5'- GGAAGACCACTCGCATTCCTT
3' (forward) and 5'- GTAATCAGCAACCATTGGGTCA 3' (reverse); glycogen
synthase (Gsy) 1, 5'- TCCTGGCCCAGAACGAAGA 3' (forward) and 5'-
TGAGTGGTGAAGATGGTTGCC 3' (reverse); and glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), 5'- ACCTCAACTACATGGTCTAC 3' (forward) and
5'- TTGTCATTGAGAGCAATGCC 3' (reverse). mRNA expression levels were
evaluated by the relative expression ratio of the gene to GAPDH using the ΔΔCt
method.
2.11. Inflammation in C2C12 induced by LPS
The experiment was performed as described previously [28,30]. Briefly, C2C12
were induced to differentiate with KPE (10 μg/mL) or PMFs (compound 18,10
μM) for one week. Cells were then cultured with 1 μg/mL LPS or LA for 1 h. Cells
were collected and total RNA was extracted. The relative mRNA expression levels
of total interleukin (IL)-6 and tumor necrosis factor (TNF)-αwere examined using
RT-PCR.
2.12. Statistical analysis
Data are presented as the mean ± S.E. A one-way analysis of variance (ANOVA)
followed by Welchst-test was performed for statistical comparisons of in vivo
experimental data. The significance of differences from the initial data (0 weeks)
was indicated as *: P <0.05, **: P <0.01, while that from the control was
Article No~e00115
7http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
indicated as :P<0.05, ††:P<0.01, respectively. The in vivo test was performed
on 15 mice in each group. However, one mouse treated with KPE drowned in ST at
week 4. Therefore, the statistical analysis was performed on 15 mice for the control
group and 14 mice for the KPE group. The same method as that described above
for in vivo experimental data was used for statistical comparisons of in vitro
experimental data.
3. Results
3.1. KPE suppressed decrease in muscular endurance induced
by fatigue in CST
KPE was orally administered to mice for 4 weeks and muscular endurance was
evaluated at 0-, 1-, 2-, and 4-week periods. In each week, no significant differences
between the control and KPE groups were observed in the initial values determined
(0 h) (Fig. 3). However, from the second and third measurements (0.5 or 1 h), the
[(Fig._3)TD$FIG]
Fig. 3. KPE enhanced muscular endurance in the consecutive forced swimming test (CST). The CST
was performed at the 0- (A), 1- (B), 2- (C), and 4- (D) week periods. According to Fig. 1B, ST was
repeated at 30-min intervals, and the swimming time was measured for a total of 7 times. Each point
represents the mean with the S.E. (control; n = 15, KPE; n = 14). Open circle () for the control group
and closed circle () for the KPE group. Asterisks denote significant differences from the initial value
(0 week) at *: P<0.05, **: P<0.01, respectively. Daggers denote significant differences from the
control at :P<0.05, ††:P<0.01, respectively.
Article No~e00115
8http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
decreases in the swimming time were smaller in the KPE group than in the control
group (Fig. 3B-D). This suppression was confirmed from the 1-week period and
became clearer in a time-dependent manner (Fig. 3B-D). In the 4-week period
determination, the swimming time duration for the last measurement (3 h)
shortened only 27% against the first measurement in the KPE group, while that
shortened 78% in the control group (Fig. 3D), indicating the enforcement of the
muscular endurance or the rapid recovery from swimming-induced fatigue in the
KPE group.
3.2. KPE enhanced physical fitness performance in PT
Physical fitness performance in PT was examined in order to evaluate the effects of
KPE 2 days after the CST. In ST, which induced sufficient fatigue in mice,
swimming times were slightly longer in the KPE group than in the control group
from the 1-week period (Fig. 4A). In the open-field test performed before ST
[(Fig._4)TD$FIG]
Fig. 4. KPE enhanced physical fitness performance with or without fatigue loading. Physical fitness
measurement tests (PT) consisting of forced swimming test (ST, A), open-field test (B and C), inclined
plate test (D) and wire hanging test (E) were performed. Columns represented open column (): control
group and closed column (): KPE group. Open-field test, inclined plate test, and wire hanging test were
performed twice: before and after ST. The values in the open-field test before (B) and after (C) ST were
indicated separately. Each column represents the mean with the S.E. (control; n = 15, KPE; n = 14).
Asterisks denote significant differences from the initial result (0 week) at *: P<0.05, **: P<0.01,
respectively. Daggers denote significant differences from the control at :P<0.05, ††:P<0.01,
respectively.
Article No~e00115
9http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
(Fig. 4B), the number of movements in control and KPE in 1-, 2- and 4-week
periods were significantly decreased compared to the values at 0-week period.
However, the number of movements after ST was significantly increased in the
KPE group, but not in the control group at the 1- and 2-week periods (Fig. 4C).
Furthermore, the number of movements after ST was significantly increased in the
KPE group at the 4-week period (Fig. 4C). In the inclined plate test, dropped
angles were significantly greater in the KPE group than in the control group at the
2-week period (Fig. 4D). The dropped angles in KPE group after ST were similar
to those before ST at the 2- and 4-week periods (Fig. 4D). In the wire hanging test,
similar results to those obtained in the inclined plate test were observed from the 1-
to 4-week periods. From the ratio calculated for the dropped time after and before
ST, the ratio in the KPE group (96%) was almost twice at the 4-week period
(Fig. 4E), indicating the enhancement of the grip strength in the KPE group.
3.3. KPE and PMFs suppressed muscular inflammation in vitro
and in vivo
In previous experiments (Fig. 3 and Fig. 4), KPE was shown to improve physical
fitness performance and muscular endurance in vivo. Therefore, we attempted to
clarify the mechanisms responsible for the effects of KPE. mRNA expression was
evaluated in relation to inflammation, namely, that of IL-6 and TNF-α, in the
soleus muscle. The results showed that IL-6 (Fig. 5A) and TNF-α(Fig. 5B) mRNA
expression levels tended to be lower in the KPE group than in the control group.
Therefore, the anti-inflammatory effects of KPE may contribute to improvements
in physical fitness performance and muscular endurance.
The anti-inflammatory effects of KPE and PMFs were investigated in vitro using a
previously reported method [30]. LPS and LA were used to induce muscular
inflammation. IL-6 and TNF-αmRNA expression levels were increased by LPS,
but not by LA (data not shown). The increases induced in mRNA expression levels
by LPS were slightly suppressed in the cells cultured with KPE. PMFs, compounds
18isolated from KPE, were examined by a similar procedure. KPE and
compounds 1,2, and 8significantly suppressed the increases induced by LPS in the
mRNA expression levels of IL-6 (Fig. 5C) and TNF-α(Fig. 5D). Compounds 3, 7
and 8suppressed the mRNA expression of TNF-α.
3.4. KPE increased mitochondrial number and decreased blood
LA level in vivo
In order to investigate the contribution of mechanisms other than anti-oxidative
activity to improvements in physical fitness performance and muscular endurance,
the effects of KPE on metabolism were evaluated in relation to mitochondrial
number, accumulation of glycogen, and blood LA level. Regarding mitochondrial
Article No~e00115
10 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
number, the expression ratio of mitochondrial DNA to genomic DNA was
measured. The results showed that KPE enhanced the number of mitochondria in
the soleus muscle (Fig. 6A). The mRNA expression of PGC-1α, which is related to
mitochondrial biosynthesis, tended to increase by KPE (Fig. 6B). The mRNA
expression of Gsy and accumulation of glycogen were similarly evaluated. The
results showed that KPE tended to enhance the mRNA expression of Gsy (Fig. 6C)
and increase glycogen content (Fig. 6D). Therefore, KPE was suggested to increase
mitochondrial numbers by enhancing the expression of PGC-1αand glycogen
content by enhancing the expression of Gsy. Moreover, KPE decreased blood LA
levels (Fig. 6E).
3.5. PMFs promoted the accumulation of glycogen in vitro
We previously reported that PMFs in KPE increased the mRNA expression of
glucose transporter type 4 (GLUT4) and PGC-1α. Therefore, we herein determined
whether PMFs affect the accumulation of glycogen. The mRNA expression of Gsy
was measured in C2C12 treated with KPE or PMFs. KPE and many of the PMFs
[(Fig._5)TD$FIG]
Fig. 5. KPE and PMFs suppressed muscular inflammation in vivo and in vitro.Total RNA was extracted
from mouse soleus muscles after physical fitness measurement tests had been completed. mRNA
expressions of IL-6 (A) and TNF-α(B) were evaluated using real-time PCR. C2C12 differentiated with
KPE (10 μg/mL) and compounds 18(10 μM) were cultured with LPS (final concentration: 1 μg/mL)
for 1 h. Total RNA was extracted from cells and the mRNA expression of IL-6 (C) and TNF-α(D) was
evaluated. Each column represents the mean with the S.E. (A and B: n = 14, C and D: n = 4). Asterisks
denote significant differences from the control (A and B) or the control only treated with LPS (C and D)
at *: p<0.05, **: p<0.01, respectively.
Article No~e00115
11 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
[(Fig._6)TD$FIG]
Fig. 6. Effect of KPE on mitochondria and glycogen in vitro and in vivo. Total DNA, mRNA, and
glycogen were extracted from the mouse soleus muscle and C2C12 treated with KPE (10 μg/mL) or
compounds 18(10 μM). In vivo (A-E), total DNA was evaluated for the expression of mitochondrial
DNA (mtDNA) using real-time PCR (A). mtDNA was normalized by the expression of genomic DNA
(gDNA). mRNA expressions of PGC-1α(B) and glycogen synthase (Gsy, C) were evaluated using real-
time PCR. Muscle glycogen was determined using the phenol-sulfuric acid method (D). The glycogen
content was normalized by the tissue weight. Blood lactic acid (LA) was measured using a kit (E).
Article No~e00115
12 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
(4,5,6,7, and 8) significantly increased the expression of Gsy (Fig. 6F). The
effects of KPE and compound 8on the glycogen content in C2C12 were then
evaluated. Compound 8was selected because it is known to activate AMPK [28].
KPE significantly enhanced the glycogen content (Fig. 6G), while compound 8
slightly enhanced its contents. These results suggest that PMFs in KPE promote the
accumulation of glycogen.
4. Discussion
The results of the present study indicate that KPE increases physical fitness
performance (Fig. 4) and muscular endurance (Fig. 3 and Fig. 4). In the inclined
plate test and wire hanging test after ST, endurance and performance were better in
the KPE group than in the control group. Anti-inflammation and enhanced energy
metabolism have been suggested as the mechanisms by which KPE improves
performance. Hence, enhancements in mRNA expression related to inflammation
and the accumulation of glycogen were evaluated. The results showed that KPE
tended to down-regulate the mRNA expression of IL-6 and TNF-αin the soleus
muscle (Fig. 5A, B) without significant differences being observed when compared
with control mice. In the in vitro test, KPE suppressed mRNA expression of
inflammatory factors induced by LPS. When PMFs (18) were examined using the
same method, 1,2, and 8were found to significantly suppress the mRNA
expression of IL-6 and TNF-α. KPE showed an inhibitory trend on the mRNA
expression of IL-6 and TNF-αin the in vivo research. In order to clarify this,
further study with more number of mice on the anti-inflammation effect of KPE in
muscle is needed. Regarding the up-regulation of GLUT4 and PGC-1α,2and 8
exerted similar strong effects [27]. Therefore, the 3- and 4-methoxy groups may
not be necessary for this activity.
We previously reported that PMFs including KPE activated AMPK [27]. AMPK
activators such as AICAR have been shown to increase physical fitness
performance and muscular endurance in vivo [27]. A chronic treatment with
AICAR was found to increase the accumulation of glycogen and enhance fatty acid
oxidation in skeletal muscles in insulin-deficient rats [31] while another activator,
C24 decreased blood glucose and fatty acid levels in diabetic db/db mice [32].
AMPK has also been reported to play an important role in improvements in
inflammation and insulin resistance [33]. These findings are consistent with the
present results and our previous findings on black ginger. KPE and PMFs,
particularly compound 8, promoted the uptake of glucose, accumulation of
In vitro (F, G), the mRNA expression of Gsy was evaluated using real-time PCR (F) and glycogen
contents were determined (G). The glycogen contents in these cells were normalized by the cell
numbers. Each column represents the mean with the S.E. (in vivo: control: n = 15, KPE: n = 14,
in vitro: n = 4). Asterisks denote significant differences from the control at *: P <0.05, **: P <0.01,
respectively.
Article No~e00115
13 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
glycogen, activation of mitochondria, and increases in mitochondrial number
(Fig. 6 and our previous findings [8]). Furthermore, KPE has been reported to
suppress increases in body weight, visceral fat accumulation, dysfunctional lipid
metabolism, hyperinsulinemia, insulin resistance, hypertension, and peripheral
neuropathy in TSOD mice [1]. Therefore, the activation of AMPK by KPE may
contribute to these activities including improvements in physical fitness
performance and endurance. The activation of AMPK by food ingredients differs
from that by medicines such as AICAR and C24. The application of black ginger as
a new approach to prevent diseases is promising because of its safety and historical
background as a food [34].
Clinical studies have been conducted on black ginger, with some reporting
improved physical fitness performance in the elderly and athletes, [6,7] and the
enhanced antioxidant enzyme activities (increased activities of superoxide
dismutase, glutathione peroxidase and catalase in serum) and decreased MDA
level had been suggested to be one of the mechanisms for physical improvement
effect of KPE [7]. The promotion of energy consumption through the activation of
metabolism in brown adipose tissue has also been reported [35]. Therefore, black
ginger may be a suitable ingredient for improving physical fitness performance,
muscular endurance, fatigue, and metabolism. On the other hand, mild exercise is
well-known to have similar effects as those of KPE on health [36,37,38,39,40].
We expect black ginger to become a useful ingredient in processed foods and
dietary supplements that will have exercise- and health-promoting effects.
Declarations
Author contribution statement
Kazuya Toda: Conceived and designed the experiments; Performed the experi-
ments; Analyzed and interpreted the data; Contributed reagents, materials, analysis
tools or data; Wrote the paper.
Shoketsu Hitoe: Performed the experiments; Analyzed and interpreted the data;
Wrote the paper.
Shogo Takeda: Performed the experiments.
Hiroshi Shimoda: Conceived and designed the experiments; Analyzed and
interpreted the data; Wrote the paper.
Funding statement
This research did not receive any specific grant from funding agencies in the
public, commercial, or not-for-profit sectors.
Article No~e00115
14 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
Competing interest statement
All authors related to this study are employees of Oryza Oil and Fat Chemical Co.,
Ltd. (Aichi, Japan). The authors declare no conflict of interest associated with this
manuscript.
Additional information
No additional information is available for this paper.
References
[1] T. Akase, T. Shimada, S. Terabayashi, Y. Ikeya, H. Sanada, M. Aburada,
Antiobesity effects of Kaempferia parviflora in spontaneously obese type II
diabetic mice, J. Nat. Med. 65 (2011) 7380.
[2] T. Shimada, T. Horikawa, Y. Ikeya, H. Matsuo, K. Kinoshita, T. Taguchi, K.
Ichinose, K. Takahashi, M. Aburada, Preventive effect of Kaempferia
parviflora ethyl acetate extract and its major components polymethoxy-
flavonoid on metabolic diseases, Fitoterapia 82 (2011) 12721278.
[3] C. Rujjanawate, D. Kanjanapothi, D. Amornlerdpison, S.J. Pojanagaroon,
Anti-gastric ulcer effect of Kaempferia parviflora, J. Ethnopharmacol. 102
(2005) 120122.
[4] W. Kusirisin, S. Srichairatanakool, P. Lerttrakarnnon, N. Lailerd, M. Suttajit,
C. Jaikang, C. Chaiyasut, Antioxidative activity: polyphenolic content and
anti-glycation effect of some Thai medicinal plants traditionally used in
diabetic patients, Med. Chem. 5 (2009) 139147.
[5] G. Chaturapanich, S. Chaiyakul, V. Verawatnapakul, T. Yimlamai, C.
Pholpramool, Enhancement of aphrodisiac activity in male rats by ethanol
extract of Kaempferia parviflora and exercise training, Andrologia 44 (2012)
323328.
[6] K. Promthep, W. Eungpinichpong, B. Sripanidkulchai, U. Chatchawan, Effect
of Kaempferia parviflora extract on physical fitness of soccer players: A
randomized double-blind placebo-controlled trial, Med. Sci. Monit. Basic
Res. 21 (2015) 100108.
[7] J. Wattanathorn, S. Muchimapura, T. Tong-Un, N. Saenghong, W. Thukhum-
Mee, B. Sripanidkulchai, Positive modulation effect of 8-week consumption
of Kaempferia parviflora on health-related physical fitness and oxidative
status in healthy elderly volunteers, Evid. Based Complement. Alternat. Med.
2012 (2012) 732816.
Article No~e00115
15 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
[8] K. Toda, S. Takeda, S. Hitoe, S. Nakamura, H. Matsuda, H. Shimoda,
Enhancement of energy production by black ginger extract containing
polymethoxy flavonoids in myocytes through improving glucose, lactic acid
and lipid metabolism, J. Nat. Med. 70 (2015) 163172.
[9] W.M. Fletcher, Lactic acid in amphibian muscle, J. Physiol. 35 (1907)
247309.
[10] H. Westerblad, J.D. Bruton, J. Lännergren, The effect of intracellular pH on
contractile function of intact: single fibres of mouse muscle declines with
increasing temperature, J. Physiol. 500 (1997) 193204.
[11] C.M. Stary, M.C. Hogan, Intracellular pH during sequential: fatiguing
contractile periods in isolated single Xenopus skeletal muscle fibers, J. Appl.
Physiol. 99 (2005) 308312.
[12] O.B. Nielsen, F. de Paoli, K. Overgaard, Protective effects of lactic acid on
force production in rat skeletal muscle, J. Physiol. 536 (2001) 161166.
[13] T.H. Pedersen, O.B. Nielsen, G.D. Lamb, D.G. Stephenson, Intracellular
acidosis enhances the excitability of working muscle, Science 305 (2004)
11441147.
[14] T.G. Favero, Sarcoplasmic reticulum Ca
2+
release and muscle fatigue, J.
Appl. Physiol. 87 (1999) 471483.
[15] O.B. Nielsen, T. Clausen, The Na
+
/K
+
-pump protects muscle excitability and
contractility during exercise, Exerc. Sport Sci. Rev. 28 (2000) 159164.
[16] D.G. Allen, A.A. Kabbara, Hk. Westerblad, Muscle fatigue: the role of
intracellular calcium stores, Can. J. Appl. Physiol. 27 (2002) 8396.
[17] R. Vandenboom, The myofibrillar complex and fatigue: a review, Can. J.
Appl. Physiol. 29 (2004) 330356.
[18] S.K. Powers, L.L. Ji, A.N. Kavazis, M.J. Jackson, Reactive oxygen species:
impact on skeletal muscle, Compr. Physiol. 1 (2011) 941969.
[19] H.R. Gosker, A.M. Schols, Fatigued muscles in COPD but no finishing line in
sight, Eur. Respir. J. 31 (2008) 693694.
[20] J. Finsterer, Biomarkers of peripheral muscle fatigue during exercise, BMC
Musculoskelet. Disord. 13 (2012) 218.
[21] X. Liu, G. Wu, D. Shi, R. Zhu, H. Zeng, B. Cao, M. Huang, H. Liao, Effects
of nitric oxide on notexin-induced muscle inflammatory responses, Int. J.
Biol. Sci. 11 (2015) 156167.
Article No~e00115
16 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
[22] B.B. Kahn, T. Alquier, D. Carling, D.G. Hardie, AMP-activated protein
kinase: ancient energy gauge provides clues to modern understanding of
metabolism, Cell Metab. 1 (2005) 1525.
[23] D.G. Hardie, B.E. Schaffer, A. Brunet, AMPK: an energy-sensing pathway
with multiple inputs and outputs, Trends Cell Biol. 26 (2016) 190201.
[24] I.V. Astratenkova, V.A. Rogozkin, Participation AMPK in the regulation of
skeletal muscles metabolism, Ross Fiziol Zh Im I M Sechenova 99 (2013)
657673.
[25] H. Nasri, M. Rafieian-Kopaei, Metformin: Current knowledge, J. Res. Med.
Sci. 19 (2014) 658664.
[26] S.K. Malin, S.R. Kashyap, Effects of metformin on weight loss: potential
mechanisms, Curr. Opin. Endocrinol. Diabetes Obes. 21 (2014) 323329.
[27] V.A. Narkar, M. Downes, R.T. Yu, E. Embler, Y.X. Wang, E. Banayo, M.M.
Mihaylova, M.C. Nelson, Y. Zou, H. Juguilon, H. Kang, R.J. Shaw, R.M.
Evans, AMPK and PPARδagonists are exercise mimetics, Cell 134 (2008)
405415.
[28] T.M. Henagan, W.T. Cefalu, D.M. Ribnicky, R.C. Noland, K. Dunville, W.
W. Campbell, L.K. Stewart, L.A. Forney, T.W. Gettys, J.S. Chang, C.D.
Morrison, In vivo effects of dietary quercetin and quercetin-rich red onion
extract on skeletal muscle mitochondria, metabolism, and insulin sensitivity,
Genes Nutr. 10 (2015) 2.
[29] S. Lo, J.C. Russell, A.W. Taylor, Determination of glycogen in small tissue
samples, J. Appl. Physiol. 28 (1970) 234236.
[30] R.A. Frost, G.J. Nystrom, C.H. Lang, Lipopolysaccharide and proinflamma-
tory cytokines stimulate interleukin-6 expression in C2C12 myoblasts: role of
the Jun NH
2
-terminal kinase, Am. J. Physiol. Regul. Integr. Comp. Physiol.
285 (2003) R11531164.
[31] K.F. Vitzel, G. Bikopoulos, S. Hung, K.E. Pistor, J.D. Patterson, R. Curi, R.B.
Ceddia, Chronic treatment with the AMP-kinase activator AICAR increases
glycogen storage and fatty acid oxidation in skeletal muscles but does not
reduce hyperglucagonemia and hyperglycemia in insulin deficient rats, PLoS
One 8 (2013) e62190.
[32] Y.Y. Li, L.F. Yu, L.N. Zhang, B.Y. Qiu, M.B. Su, F. Wu, D.K. Chen, T.
Pang, M. Gu, W. Zhang, W.P. Ma, H.W. Jiang, J.Y. Li, F.J. Nan, J. Li, Novel
small-molecule AMPK activator orally exerts beneficial effects on diabetic
db/db mice, Toxicol. Appl. Pharmacol. 273 (2013) 325334.
Article No~e00115
17 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
[33] S. Liong, M. Lappas, Activation of AMPK improves inflammation and
insulin resistance in adipose tissue and skeletal muscle from pregnant women,
J. Physiol. Biochem. 71 (2015) 703717.
[34] P. Sudwan, K. Saenphet, S. Saenphet, S. Suwansirikul, Effect of Kaempferia
parviflora Wall. ex: Baker on sexual activity of male rats and its toxicity,
Southeast Asian J. Trop. Med. Public Health 37 (2006) 210215.
[35] M. Matsushita, T. Yoneshiro, S. Aita, T. Kamiya, N. Kusaba, K. Yamaguchi,
K. Takagaki, T. Kameya, H. Sugie, M. Saito, Kaempferia parviflora extract
increases whole-body energy expenditure in humans: roles of brown adipose
tissue, J. Nutr. Sci. Vitaminol. (Tokyo) 61 (2015) 7983.
[36] A. Pingitore, G.P. Lima, F. Mastorci, A. Quinones, G. Iervasi, C. Vassalle,
Exercise and oxidative stress: potential effects of antioxidant dietary
strategies in sports, Nutrition 31 (2015) 916922.
[37] J.F. Horowitz, S. Klein, Lipid metabolism during endurance exercise, Am. J.
Clin. Nutr. 72 (2000) 558S563S.
[38] N.A. Johnson, S.R. Stannard, M.W. Thompson, Muscle triglyceride and
glycogen in endurance exercise: implications for performance, Sports Med.
34 (2004) 151164.
[39] F.B. Stephens, S.D. Galloway, Carnitine and fat oxidation, Nestlé Nutr. Inst.
Workshop Ser. 76 (2013) 1323.
[40] B.K. Pedersen, B. Saltin, Exercise as medicine evidence for prescribing
exercise as therapy in 26 different chronic diseases, Scand. J. Med. Sci. Sports
25 (Suppl. 3) (2015) 172.
Article No~e00115
18 http://dx.doi.org/10.1016/j.heliyon.2016.e00115
2405-8440/© 2016 The Authors. Published by Elsevier Ltd. This is an open access article under the CC BY-NC-ND license
(http://creativecommons.org/licenses/by-nc-nd/4.0/).
  • ... Kaempferia parviflora (KP) or Krachaidam, which belongs to the family Zingiberaceae, is originally found in the North and Northeast of Thailand. The rhizomes of KP, also known as black ginger, are popular as health-promoting herbs and traditionally used as a folk medicine for managing a variety of diseases, including inflammation, ulcers, gout, colic disorder, abscesses, allergy, and osteoarthritis [1,2]. A number of pharmacological researches on KP have claimed the valuable benefits for a variety of diseases. ...
    ... But administration with 1.35g of KP daily does not produce any adverse effects [1]. In addition, the powder of KP extract has been developed as a food ingredient on the market, which is standardized for containing not less than 2.5% of 5,7-dimethoxyflavone (Compound-6) and 10% of total methoxyflavones [2]. Acute and chronic toxicity study has been proved that oral administration of KP does not induce any abnormal changes in body weight and histology in various visceral organs [14,15]. ...
    ... Consequently, the extract of KP significantly improves physical fitness performance and muscular endurance through upregulation of PGC-1 and glucose synthase (GS) expression in C2C12 cells. Meanwhile, the inflammatory cytokines IL-6 and TNF expression are also attenuated in C2C12 cells by the KP extract [2]. ...
    Article
    Full-text available
    Kaempferia parviflora (KP), a health-promoting herb, has been traditionally used for treating a variety of diseases. Pharmacological studies have claimed the various benefits from KP and its main effective methoxyflavones, including cellular metabolism-regulating activity, anticancer activity, vascular relaxation and cardioprotective activity, sexual enhancing activity, neuroprotective activity, antiallergic, anti-inflammatory, and antioxidative activity, antiosteoarthritis activity, antimicroorganism activity, and transdermal permeable activity. These might be associated with increased mitochondrial functions and activated cGMP-NO signaling pathway. However, the underlying molecular mechanisms of KP and its methoxyflavones are still under investigation. The clinical applications of KP and its methoxyflavones may be limited due to their low bioavailability. But promising strategies are on the way. This review will comprehensively discuss the biological activities of KP and its methoxyflavones.
  • ... The 5,7-dimethoxyflavone (DMF, Figure 1) is a major bioactive in Kaempferia parviflora, which has been used as food [23] and folk medicine to treat digestive disorders, gastric ulcer, and oral diseases [24]. DMF possesses a wide spectrum of pharmacological and biological activities, such as anti-obesity [25] and melanogenesis [26] functions. ...
    ... DMF possesses a wide spectrum of pharmacological and biological activities, such as anti-obesity [25] and melanogenesis [26] functions. Previously, DMF has been shown not only to enhance energy metabolism by upregulating PGC-1α but also to increase glycogen contents and mRNA expression of glycogen synthase in the C2C12 myocytes [23,27]. In addition, the antiinflammatory property of DMF has been well researched in various models [23,24,28]. ...
    ... Previously, DMF has been shown not only to enhance energy metabolism by upregulating PGC-1α but also to increase glycogen contents and mRNA expression of glycogen synthase in the C2C12 myocytes [23,27]. In addition, the antiinflammatory property of DMF has been well researched in various models [23,24,28]. These led us to the hypothesis that DMF potentially has anti-sarcopenic property. ...
    Article
    Full-text available
    Sarcopenia is a muscle disease featured by the loss of muscle mass and dysfunction with advancing age. The 5,7-dimethoxyflavone (DMF), a major flavone found in Kaempferia parviflora, has biological activities, including anti-diabetes, anti-obesity, and anti-inflammation. However, its anti-sarcopenic effect remains to be elucidated. This current study investigated the inhibitory activity of DMF on sarcopenia. Eighteen-month-old mice were orally administered DMF at the dose of 25 mg·kg−1·day−1 or 50 mg·kg−1·day−1 for 8 weeks. DMF not only stimulated grip strength and exercise endurance but also increased muscle mass and volume. Besides, DMF stimulated the phosphatidylinositol 3-kinase-Akt pathway, consequently activating the mammalian target of rapamycin-eukaryotic initiation factor 4E-binding protein 1-70-kDa ribosomal protein S6 kinase pathway for protein synthesis. DMF reduced the mRNA expression of E3 ubiquitin ligase- and autophagy-lysosomal-related genes involved in proteolysis via the phosphorylation of Forkhead box O3. DMF upregulated peroxisome proliferator-activated receptor-gamma coactivator 1 alpha, nuclear respiratory factor 1, and mitochondrial transcription factor A along with the increase of relative mitochondrial DNA content. DMF alleviated inflammatory responses by reducing the tumor necrosis factor-alpha and interleukin-6 serum and mRNA levels. Collectively, DMF can be used as a natural agent to inhibit sarcopenia via improving protein turnover and mitochondria function.
  • ... Among them, we found that the administration of 5,7dimethoxyflavone (DMF), which is a major constituent of K. parviflora, attenuates obesity in high-fat-diet-induced 2 Evidence-Based Complementary and Alternative Medicine C57BL/6J mice by downregulating adipogenesis [18,19]. In addition, K. parviflora has been reported to improve physical fitness performance and muscular endurance in normal ddY mice [20]. Based on these considerations, we hypothesized that the ethanol extract of K. parviflora (KPE) might reduce obesity by preventing fat accumulation and improving muscle function in ob/ob mice. ...
    ... Previously, KPE has been reported to improve physical fitness performance in normal mice [20]. In this study, we used a treadmill and grip strength meter to observe whether KPE enhances muscle function in ob/ob mice. ...
    ... Furthermore, KPE upregulated the mRNA level of mitochondrial biogenesis-related biomarkers, such as PGC-1 , nuclear respiratory factor 1 (NRF1), mitochondrial transcription factor A (TFAM), and estrogen-related receptor (ERR ) in soleus muscle (Figure 6(e)). Previous studies have reported that KPE increased the amount of mitochondrial DNA and glycogen in vivo and promotes energy production by upregulating ATP production and AMPK in C2C12 myocytes [20,37]. Therefore, KPE may enhance running endurance by improving the function and quality of type I fibers, not just through its hypertrophy in size. ...
    Article
    Full-text available
    Obesity, a metabolic disorder caused by an imbalance between energy intake and energy expenditure, is accompanied with fat accumulation and skeletal muscle atrophy. Kaempferia parviflora Wall. ex Baker, also called black ginger, is known to increase physical fitness performance and improve energy metabolism. In this study, we investigated whether Kaempferia parviflora extract (KPE) alleviates both obesity and muscle atrophy using ob/ob mice. Wild-type C57BL/6J and ob/ob mice were provided with a normal diet ad libitum, and ob/ob mice were orally given KPE at a dose of 100 mg/kg/day or 200 mg/kg/day for eight weeks. KPE significantly decreased body weight, fat volume, and fat weight without affecting appetite. It inhibited the expression of adipogenic transcription factors and lipogenic enzymes by upregulating AMP-activated protein kinase (AMPK) in epididymal fat. In contrast, it markedly increased the muscle fiber size, muscle volume, and muscle mass, resulting in the enhancement of muscle function, such as exercise endurance and grip strength. On the molecular level, it activated the phosphatidylinositol 3 kinase (PI3K)/Akt pathway, a key regulator in protein synthesis in skeletal muscle. KPE could be a promising material to alleviate obesity by inhibiting adipogenesis, lipogenesis, and muscle atrophy.
  • ... [10] Another study in male mice showed that K. parviflora improved physical fitness performance and muscular endurance. [11] It also acts as modulator of multidrug resistance in cancer cells. [12] Adaptogenic activities of K. parviflora has been reported in mice. ...
  • ... As dietary supplements, it has been made into various preparations such as medicinal liquor or liquor plus honey, pills, capsules and tablets. It has been claimed that black ginger is appropriate to cure allergy, asthma, impotence, gout, diarrhoea, dysentery, peptic ulcer and diabetes (Toda et al., 2016). Other notable member of this family (Zingiberacea) is turmeric otherwise called red ginger (Curcuma longa) (Akinyemi et al., 2015). ...
    Article
    Full-text available
    Goji berry has long played important roles in Traditional Chinese Medicine (TCM), where they are believed to enhance immune system function, improve eyesight, protect liver, boost sperm production and improve circulation, among other effects. Ginger has been used in traditional medicine as an anti-edema drug and is used for the treatment of various diseases including nausea, gastrointestinal disorders, respiratory disorders, athero-sclerosis, migraine, depression, gastric ulcer, cholesterol; and other benefits of giner are reducing pain, rheumatoid arthritis, anti-inflammatory, and antioxidant effects. Ginseng contains an abundance of diversified chemical elements hardly found in other medicinal herbs. Red Ginseng is known to possess various biological activities including boosting the immune system, improving the blood circulation, enhancing memory, antifatigue effects, antioxidant effects and positive effects on menopausal disorder; white ginseng is used to promote the production fluids of body fluids as well as enhance physical fitness. In TCM, Astragalus considers to use in the treatment of diabetes, mellitus, nephritis, leukemia, uterine cancer, besides its tonic agent and diuretic effects. The usage of non-toxic and organic plant products having TCM Crops, development of modern drugs from Goji Berry, Ginger, Ginseng and Astragalus should be emphasized for the control of various diseases.
  • ... As dietary supplements, it has been made into various preparations such as medicinal liquor or liquor plus honey, pills, capsules and tablets. It has been claimed that black ginger is appropriate to cure allergy, asthma, impotence, gout, diarrhoea, dysentery, peptic ulcer and diabetes (Toda et al., 2016). Other notable member of this family (Zingiberacea) is turmeric otherwise called red ginger (Curcuma longa) (Akinyemi et al., 2015). ...
    Article
    Full-text available
    Ginger (Zingiber officinale) has been used as a spice and a medicine for over 200 years in traditional Chinese medicine. Ginger is an important plant with several medicinal and nutritional values used in Asian and Chinese tradition medicine. Ginger and its general compounds such as Fe, Mg, Ca, vitamin C, flavonoids, phenolic compounds (gingerdiol, gingerol, gingerdione and shogaols), sesquiterpenes, paradols has long been used as an herbal medicine to treat various symptoms including vomiting, pain, cold symptoms and it has been shown to have anti-inflammatory, anti-apoptotic, anti-tumor activities, anti-pyretic, anti-platelet, anti-tumourigenic, anti-hyperglycaemic, antioxidant anti-diabetic, anti-clotting and analgesic properties, cardiotonic, cytotoxic. It has been widely used for arthritis, cramps, sprains, sore throats, rheumatism, muscular aches, pains, vomiting, constipation, indigestion, hypertension, dementia, fever and infectious diseases. Ginger leaves have also been used for food flavouring and Asian traditional medicine especially in China. Ginger oil also used as food flavouring agent in soft drink, as spices in bakery products, in confectionary items, pickles, sauces and as a preservatives. Ginger is available in three forms, namely fresh root ginger, preserved ginger and dried ginger. The pharmacological activities of ginger were mainly attributed to its active phytocompounds 6-gingerol, 6-shogaol, zingerone beside other phenolics and flavonoids. Gingerol and shogaol in particular, is known to have anti-oxidant and anti-inflammatory properties. In both traditional Chinese medicine, and modern China, Ginger is used in about half of all herbal prescriptions. Traditional medicinal plants are often cheaper, locally available and easily consumable raw and as simple medicinal preparations. The obtained findings suggest potential of ginger extract as an additive in the food and pharmaceutical industries.
  • ... As dietary supplements, it has been made into various preparations such as medicinal liquor or liquor plus honey, pills, capsules and tablets. It has been claimed that black ginger is appropriate to cure allergy, asthma, impotence, gout, diarrhoea, dysentery, peptic ulcer and diabetes (Toda et al. 2016). Other notable member of this family (Zingiberacea) is turmeric otherwise called red ginger (Curcuma longa) (Akinyemi et al. 2015). ...
    Article
    Full-text available
    Ginger (Zingiber officinale) has been used as a spice and medicine for over 200 years in Traditional Chinese Medicine. It is an important plant with several medicinal, and nutritional values used in Asian and Chinese Tradition medicine. Ginger and its general compounds such as Fe, Mg, Ca, vitamin C, flavonoids, phenolic compounds (gingerdiol, gingerol, gingerdione and shogaols), sesquiterpenes, paradols has long been used as an herbal medicine to treat various symptoms including vomiting, pain, cold symptoms and it has been shown to have anti-inflammatory, anti-apoptotic, anti-tumour activities, anti-pyretic, anti-platelet, anti-tumourigenic, anti-hyperglycaemic, antioxidant anti-diabetic, anti-clotting and analgesic properties, cardiotonic, cytotoxic. It has been widely used for arthritis,
  • ... It has been traditionally used as a health-promoting alternative medicine with anti-inflammatory, anti-allergic, anticholinesterase, adaptogenic, and antiobesity effects [10]. K. parviflora contains several flavonoids, including 5,7-dimethoxyflavone, 5hydroxy-3,7,4′-trimethoxyflavone, and 5-hydroxy-3,7-dimethoxyflavone [11]. The extracts of this plant have shown efficacies against several disorders, including metabolic, sexual, and cognitive disorders, as well as cancer [12]. ...
    Article
    Full-text available
    Kaempferia parviflora, referred to as black ginger, has traditionally been used as a health-promoting alternative medicine. In this study, we examined the anti-inflammatory, sebostatic, and anti-Propionibacterium acnes activities of K. parviflora extract. The extract significantly down-regulated the expression of inducible NO synthase (iNOS) and cyclooxygenase-2 (COX-2), and pro-inflammatory cytokine tumor necrosis factor alpha (TNF-α) level. Moreover, the phosphorylation of IĸBα and nuclear factor-kappa B (NF-κB), and the enhanced nuclear translocation of NF-κB p65 in lipopolysaccharide-stimulated murine macrophage-like cell line (RAW 264.7) cells were markedly decreased by the extract. Notably, the main component of K. parviflora, 5,7-dimethoxyflavone, also modulated the expression of iNOS and NF-κB signal molecules in P. acnes-stimulated human keratinocyte (HaCaT) cells. Additionally, K. parviflora extract inhibited the lipogenesis of sebocytes, as evidenced by a reduced level of triglyceride and lipid accumulation in the sebocytes. The sebostatic effect was also confirmed by a reduced expression of peroxisome proliferation-activating receptors (PPAR-γ) and oil-red O staining in sebocytes. Taken together, this study suggests for the first time that K. parviflora extract could be developed as a potential natural anti-acne agent with anti-inflammatory, sebostatic, and anti-P. acnes activity.
  • Article
    Skeletal muscle wasting is highly correlated with not only the reduced quality of life but also higher morbidity and mortality. Although increasing patients are suffering from various kinds of muscle atrophy and weakness, there’s still no effective therapy available, and skeletal muscle is considered as an under-medicated organ. Food provided not only essential macronutrients but functional substances involved in modulation of physiological systems of our body. Natural constituents from commonly-consumed dietary plants, either extracts or compounds, have attracted more and more attention to be developed as agents for preventing and treating muscle wasting due to their safety and effectiveness, as well as structural diversity. This review provides an overview of the mechanistic aspects of muscle wasting, and summarizes the extracts and compounds from food sources as potential therapies against muscle wasting.
  • Article
    Full-text available
    This review provides the reader with the up-to-date evidence-based basis for prescribing exercise as medicine in the treatment of 26 different diseases: psychiatric diseases (depression, anxiety, stress, schizophrenia); neurological diseases (dementia, Parkinson's disease, multiple sclerosis); metabolic diseases (obesity, hyperlipidemia, metabolic syndrome, polycystic ovarian syndrome, type 2 diabetes, type 1 diabetes); cardiovascular diseases (hypertension, coronary heart disease, heart failure, cerebral apoplexy, and claudication intermittent); pulmonary diseases (chronic obstructive pulmonary disease, asthma, cystic fibrosis); musculo-skeletal disorders (osteoarthritis, osteoporosis, back pain, rheumatoid arthritis); and cancer. The effect of exercise therapy on disease pathogenesis and symptoms are given and the possible mechanisms of action are discussed. We have interpreted the scientific literature and for each disease, we provide the reader with our best advice regarding the optimal type and dose for prescription of exercise.
  • Article
    Full-text available
    AMP-activated protein kinase (AMPK) is a key regulator of energy balance expressed ubiquitously in eukaryotic cells. Here we review the canonical adenine nucleotide-dependent mechanism that activates AMPK when cellular energy status is compromised, as well as other, noncanonical activation mechanisms. Once activated, AMPK acts to restore energy homeostasis by promoting catabolic pathways, resulting in ATP generation, and inhibiting anabolic pathways that consume ATP. We also review the various hypothesis-driven and unbiased approaches that have been used to identify AMPK substrates and have revealed substrates involved in both metabolic and non-metabolic processes. We particularly focus on methods for identifying the AMPK target recognition motif and how it can be used to predict new substrates.
  • Article
    Enhancement of muscular energy production is thought to improve locomotive functions and prevent metabolic syndromes including diabetes and lipidemia. Black ginger (Kaempferia parviflora) has been cultivated for traditional medicine in Thailand. Recent studies have shown that black ginger extract (KPE) activated brown adipocytes and lipolysis in white adipose tissue, which may cure obesity-related dysfunction of lipid metabolism. However, the effect of KPE on glucose and lipid utilization in muscle cells has not been examined yet. Hence, we evaluated the effect of KPE and its constituents on energy metabolism in pre-differentiated (p) and differentiated (d) C2C12 myoblasts. KPE (0.1-10 μg/ml) was added to pC2C12 cells in the differentiation process for a week or used to treat dC2C12 cells for 24 h. After culturing, parameters of glucose and lipid metabolism and mitochondrial biogenesis were assessed. In terms of the results, KPE enhanced the uptake of 2-deoxyglucose and lactic acid as well as the mRNA expression of glucose transporter (GLUT) 4 and monocarboxylate transporter (MCT) 1 in both types of cells. The expression of peroxisome proliferator-activated receptor γ coactivator (PGC)-1α was enhanced in pC2C12 cells. In addition, KPE enhanced the production of ATP and mitochondrial biogenesis. Polymethoxy flavonoids in KPE including 5-hydroxy-7-methoxyflavone, 5-hydroxy-3,7,4'-trimethoxyflavone and 5,7-dimethoxyflavone enhanced the expression of GLUT4 and PGC-1α. Moreover, KPE and 5,7-dimethoxyflavone enhanced the phosphorylation of 5'AMP-activated protein kinase (AMPK). In conclusion, KPE and its polymethoxy flavonoids were found to enhance energy metabolism in myocytes. KPE may improve the dysfunction of muscle metabolism that leads to metabolic syndrome and locomotive dysfunction.
  • Article
    Gestational diabetes mellitus (GDM) is characterised by maternal peripheral insulin resistance and inflammation. Sterile inflammation and bacterial infection are key mediators of this enhanced inflammatory response. Adenosine monophosphate (AMP)-activated kinase (AMPK), which is decreased in insulin resistant states, possesses potent pro-inflammatory actions. There are, however, no studies on the role of AMPK in pregnancies complicated by GDM. Thus, the aims of this study were (i) to compare the expression of AMPK in adipose tissue and skeletal muscle from women with GDM and normal glucose-tolerant (NGT) pregnant women; and (ii) to investigate the effect of AMPK activation on inflammation and insulin resistance induced by the bacterial endotoxin lipopolysaccharide (LPS) and the pro-inflammatory cytokine IL-1β. When compared to NGT pregnant women, AMPKα activity was significantly lower in women with GDM as evidenced by a decrease in threonine phosphorylation of AMPKα. Activation of AMPK, using two pharmacologically distinct compounds, AICAR or phenformin, significantly suppressed LPS- or IL-1β-induced gene expression and secretion of pro-inflammatory cytokine IL-6, the chemokines IL-8 and MCP-1, and COX-2 and subsequent prostaglandin release from adipose tissue and skeletal muscle. In addition, activators of AMPK decreased skeletal muscle insulin resistance induced by LPS or IL-1β as evidenced by increased insulin-stimulated phosphorylation of IRS-1, GLUT-4 expression and glucose uptake. These findings suggest that AMPK may play an important role in inflammation and insulin resistance.
  • Article
    Kaempferia parviflora extract (KP) has been reported to have a preventive effect on obesity in mice, probably by increasing energy expenditure (EE). The aims of the current study were to examine the acute effects of KP ingestion on whole-body EE in humans and to analyze its relation to the activity of brown adipose tissue (BAT), a site of non-shivering thermogenesis. After an oral ingestion of an ethanol extract of KP, EE increased significantly, showing a maximal increase of 229±69 kJ/d at 60 min, while it did not change after placebo ingestion. To evaluate BAT activity, the subjects underwent fluorodeoxyglucose-positron emission tomography, and divided into two groups with high- and low-BAT activities. A similar and greater response of EE to KP ingestion was observed in the high-BAT group (351±50 kJ/d at 60 min), but not in the low activity group. Placebo ingestion did not cause any significant EE change in either group. These results indicate that a single oral ingestion of the KP extract can potentially increase whole-body EE probably through the activation of BAT in healthy men, and may be useful as an anti-obesity regimen.
  • Article
    Full-text available
    Background: Physical fitness is a fundamental prerequisite for soccer players. Kaempferia parviflora is an herbal plant that has been used in some Asian athletes with the belief that it might prevent fatigue and improve physical fitness. This study aimed to determine the effects of Kaempferia parviflora on the physical fitness of soccer players. Material and methods: Sixty soccer players who routinely trained at a sports school participated in a double-blind placebo-controlled trial and were randomly allocated to the treatment group or the placebo group. The participants in both groups were given either 180 mg of Kaempferia parviflora extract in capsules or a placebo once daily for 12 weeks. Baseline data were collected using the following 6 tests of physical performance: a sit-and-reach test, a hand grip strength test, a back-and-leg strength test, a 40-yard technical test, a 50-metre sprint test, and a cardiorespiratory fitness test. All of the tests were performed every 4 weeks throughout the 12-week study period. Results: The study showed that after treatment with Kaempferia parviflora, the right-hand grip strength was significantly increased at weeks 4, 8, and 12. The left-hand grip strength was significantly increased at week 8. However, the back-and-leg strength, the 40-yard technical test, the sit-and-reach test, the 50-metre sprint test, and the cardiorespiratory fitness test results of the treatment group were not significantly different from those of the placebo group. Conclusions: Taking Kaempferia parviflora supplements for 12 weeks may significantly enhance some physical fitness components in soccer players.
  • Article
    Free radicals are produced during aerobic cellular metabolism, and have key roles as regulatory mediators in signaling processes. Oxidative stress reflects an imbalance between production of reactive oxygen species and an adequate antioxidant defense. This adverse condition may lead to cellular and tissue damage of components, and is involved in different physiopathological states, including aging, exercise, inflammatory, cardiovascular and neurodegenerative diseases, and cancer. In particular, the relationship between exercise and oxidative stress is extremely complex, depending on the mode, intensity, and duration of exercise. Regular moderate training appears beneficial for oxidative stress and health. Conversely, acute exercise leads to increased oxidative stress, although this same stimulus is necessary to allow for an upregulation in endogenous antioxidant defenses (hormesis).
  • Article
    Excessive inflammatory response may delay the regeneration and damage the normal muscle fibers upon myoinjury. It would be important to be able to attenuate the inflammatory response and decrease inflammatory cells infiltration in order to improve muscle regeneration formation, resulting in better muscle functional recovery after myoinjury. This study was undertaken to explore the role of Nitric oxide (NO) during skeletal muscle inflammatory process, using a mouse model of Notexin induced myoinjury. Intramuscular injection (tibialis anterior, TA) of Notexin was performed for preparing mice myoinjury. NO synthase inhibitor (L-NAME) or NO donor (SNP) was intraperitoneally injected into model mice. On day 4 and 7 post-injury, expression of muscle-autoantigens and toll-like receptors (TLRs) was evaluated from muscle tissue by qRT-PCR and Western Blot; the intramuscular infiltration of monocytes/macrophage (CD11b(+) or F4/80(+) cells), CD8(+) T cell (CD3ε(+)CD8α(+)), apoptotic cell (CD11b(+)caspase3(+)), and MHC-I molecule H-2K(b)-expressing myofibers in damaged muscle were assessed by imunoflourecence analysis; the mRNAs expression of cytokines and chemokines associated with the preferential biological role during the muscle damage-induced inflammation response, were assessed by qRT-PCR. We detected the reduced monocytes/macrophages infiltration, and increased apoptotic cells in the damaged muscle treated with SNP comparing to untreatment. As well, SNP treatment down-regulated mRNA and protein levels of muscle autoantigens, TLR3, and mRNA levels of TNF-α, IL-6, MCP-1, MCP-3, and MIP-1α in damaged muscle. On the contrary, L-NAME induced more severe intramuscular infiltration of inflammatory cells, and mRNA level elevation of the above inflammatory mediators. Notably, we observed an increased number of MHC-I (H2-K(b)) positive new myofibers, and of the infiltrated CD8(+) T cells in damaged muscle at the day 7 after L-NAME treatment. The result herein shows that, NO can act as an endogenous anti-inflammatory molecule during the ongoing muscle inflammation. Our finding may provide new insight to optimize NO-based therapies for improving muscle regeneration after myoinjury.
  • Article
    Red onions and low doses of the flavonoid, quercetin, increase insulin sensitivity and improve glucose tolerance. We hypothesized that dietary supplementation with red onion extract (RO) would attenuate high fat diet (HFD)-induced obesity and insulin resistance similar to quercetin supplementation by increasing energy expenditure through a mechanism involving skeletal muscle mitochondrial adaptations. To test this hypothesis, C57BL/6J mice were randomized into four groups and fed either a low fat diet (LF), HFD (HF), HFD + quercetin (HF + Q), or HFD + RO (HF + RO) for 9 weeks. Food consumption and body weight and composition were measured weekly. Insulin sensitivity was assessed by insulin and glucose tolerance tests. Energy expenditure and physical activity were measured by indirect calorimetry. Skeletal muscle incomplete beta oxidation, mitochondrial number, and mtDNA-encoded gene expression were measured. Quercetin and RO supplementation decreased HFD-induced fat mass accumulation and insulin resistance (measured by insulin tolerance test) and increased energy expenditure; however, only HF + Q showed an increase in physical activity levels. Although quercetin and RO similarly increased skeletal muscle mitochondrial number and decreased incomplete beta oxidation, establishing mitochondrial function similar to that seen in LF, only HF + Q exhibited consistently lower mRNA levels of mtDNA-encoded genes necessary for complexes IV and V compared to LF. Quercetin- and RO-induced improvements in adiposity, insulin resistance, and energy expenditure occur through differential mechanisms, with quercetin-but not RO-induced energy expenditure being related to increases in physical activity. While both treatments improved skeletal muscle mitochondrial number and function, mtDNA-encoded transcript levels suggest that the antiobesogenic, insulin-sensitizing effects of purified quercetin aglycone, and RO may occur through differential mechanisms.
  • Article
    Diabetes mellitus is a group of metabolic disorders in which the blood glucose is higher than normal levels, due to insufficiency of insulin release or improper response of cells to insulin, resulting in high blood pressure. The resultant hyperglycemia produces sever complications. Metformin drug has been shown to prevent diabetes in people who are at high risk and decrease most of the diabetic complications. Recent reports on metformin, not only indicate some implications such as renoprotective properties have been suggested for metformin, but some reports indicate its adverse effects as well that are negligible when its benefits are brought into account. We aimed here to review the new implications of metformin and discuss about the concerns in the use of metformin, referring to the recently published papers.