Improved Aptamers for the Diagnosis and Potential Treatment of HER2-Positive Cancer

Abstract

Aptamers provide a potential source of alternative targeting molecules for existing antibody diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2 receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples. Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers with great potential for the diagnosis and possible treatment of HER2-positive cancer.

Full text

pharmaceuticals
Article
Improved Aptamers for the Diagnosis and Potential
Treatment of HER2-Positive Cancer
Marlies Gijs 1, 2, *, Gregory Penner 3, Garth B. Blackler 3, Nathalie R.E.N. Impens 1,
Sarah Baatout 1, André Luxen 2and An M. Aerts 1
1Radiobiology Unit, Belgian Nuclear Research Centre (SCK‚CEN), 2400 Mol, Belgium;
nimpens@sckcen.be (N.R.E.N.I.); sbaatout@sckcen.be (S.B.); aaerts@sckcen.be (A.M.A.)
2Cyclotron Research Centre, University of Liège, 4000 Liège, Belgium; aluxen@ulg.ac.be
3NeoVentures Biotechnology Inc., London, N6A 1A1 ON, Canada; gpenner@neoventures.ca (G.P.);
gblackler@neoventures.ca (G.B.B.)
*Correspondence: marlies_gijs@hotmail.com
Academic Editor: Alfredo Berzal-Herranz
Received: 20 February 2016; Accepted: 10 May 2016; Published: 19 May 2016
Abstract:
Aptamers provide a potential source of alternative targeting molecules for existing antibody
diagnostics and therapeutics. In this work, we selected novel DNA aptamers targeting the HER2
receptor by an adherent whole-cell SELEX approach. Individual aptamers were identified by next
generation sequencing and bioinformatics analysis. Two aptamers, HeA2_1 and HeA2_3, were shown
to bind the HER2 protein with affinities in the nanomolar range. In addition, both aptamers were able
to bind with high specificity to HER2-overexpressing cells and HER2-positive tumor tissue samples.
Furthermore, we demonstrated that aptamer HeA2_3 is being internalized into cancer cells and has
an inhibitory effect on cancer cell growth and viability. In the end, we selected novel DNA aptamers
with great potential for the diagnosis and possible treatment of HER2-positive cancer.
Keywords: aptamer; DNA; HER2; diagnosis; therapeutics; cancer
1. Introduction
One molecular target with high potential for targeted cancer therapy is the human epidermal
growth factor receptor 2 (HER2, also known as ErbB2). HER2 gene amplification and protein
overexpression is present in 15% to 20% of all breast cancers, and is associated with aggressive disease
and poor patient prognosis [
1
,
2
]. In addition, HER2 overexpression is associated with resistance to
certain chemotherapeutics [
3
], an increased risk for brain metastases [
4
] and higher recurrence of the
disease [
5
]. Trastuzumab (Herceptin
®
, Genentech), a humanized monoclonal antibody targeting HER2,
has been approved for the treatment of HER2 positive early-stage breast cancer, metastatic breast
cancer and metastatic cancer of the stomach or gastroesophageal junction [
6
]. However, only one
third of patients respond to trastuzumab therapy and most of the responders eventually relapse [
7
].
Moreover, resistance to trastuzumab is of major concern [
8
] and heart failure occurred in 1% to 4% of
patients treated with trastuzumab [9]. Hence, there is a need for novel therapeutic agents.
Aptamers provide a potential source of such alternative targeting molecules for existing antibody
therapeutics such as trastuzumab. Aptamers are short, non-coding, single-stranded oligonucleotides
(DNA or RNA) that mimic antibodies in their ability to bind to a specific target. Aptamers are promising
agents for therapeutic use as they are easily and inexpensively synthesised, poorly immunogenic
and non-toxic (as reviewed in [
10
,
11
]). Aptamers have numerous valuable applications in cancer
research, including biomarker discovery,
in vitro
and
in vivo
diagnostics (reviewed in [
12
]). In addition,
aptamers are being developed as therapeutics agents for the treatment of a wide range of cancers
via aptamer-mediated delivery of therapeutic payloads (such as drugs, siRNA and radionuclides
(reviewed in [13,14]) or via effects on target function (reviewed in [11,15–19]).
Pharmaceuticals 2016,9, 29; doi:10.3390/ph9020029 www.mdpi.com/journal/pharmaceuticals

Pharmaceuticals 2016,9, 29 2 of 21
Typically, aptamers are generated by an
in vitro
selection process known as systematic evolution of
ligands by exponential enrichment (SELEX) [
20
–
22
]. This process allows the identification of aptamers
from a large pool of random sequences or library. During the process, aptamers are subjected to
iterative rounds of selection, separation and amplification. As SELEX is an evolutionary affinity-driven
process, specific sequences (which bind in a specific way) will dominate non-specific sequences (which
bind at random). The most crucial step of the SELEX process is achieving the appropriate balance of
stringency in the separation of the bound and unbound sequences. Too much stringency introduces
the risk of losing the best aptamers, while too little stringency may lead to ineffective selection for
good aptamers.
Surface proteins, such as the HER2 receptor, are highly accessible drug targets and therefore
are central in targeted therapy. The majority of aptamers targeting HER2 reported so far have been
selected using the purified, soluble portion of the exo-cellular domain of the HER2 protein. However,
these domains alone may exhibit different conformations or lack post-translational modifications
thus altering their epitope potential. Hence, SELEX using living cells (called whole-cell SELEX) is
preferred. The use of adherent cells (as monolayers in cultured dishes) is favorable because it allows
easy separation of bound and unbound sequences during selection and easy removal of dead cells
(which generally have high affinity for nucleic acids) [
23
]. We describe herein a whole-cell SELEX
process using adherent SKBR3 breast cancer cells.
In order to avoid the drawbacks seen with long aptamers (higher production cost with lower
yields and purity) and RNA aptamers (increased susceptibility to nuclease degradation), we focused on
short DNA aptamers. For this, we used the Dubbles concept designed by NeoVentures Biotechnology
Inc. [24]. This concept involves the separation of the PCR-amplified double-stranded DNA amplicon
into single-strands by heating to 95
˝
C for 10 min and then “snap-cooling” the resulting single-strands
immediately for 15 min. First, this helps to stabilize the secondary and tertiary structures of the
single-stranded sequences in favour of double-stranded annealing. Second, re-annealing of the
single-stranded sequences is driven by the homology of the primer regions rather than complementary
strands. As a result, heteroduplexes (called Dubbles) are formed which allow interactions of the
single-stranded random regions with the target. This concept is advantageous because it avoids the
hybridization of primer sequences onto complementary parts of the internal random region (which
may make this region unavailable for binding to the target) [
25
], the involvement of primer sequences
in binding to the target [
26
,
27
], and the need for complex techniques to separate double-stranded to
single-stranded DNA after PCR amplification [
28
]. At the end, the internal random regions of the
selected aptamers are chemically synthesized without the primer regions, which results in short(er)
aptamers. Several aptamers have been selected using this strategy, for example aptamers targeting
aflatoxin [
29
] and ochratoxin A [
30
]. We have used a library containing a 40-mer random region and,
thanks to the Dubbles technology, generated aptamers of this length (average 12 kDa).
Lately, high throughput next generation sequencing (NGS) and bioinformatics are preferred over
traditional cloning and subsequent sequencing as it avoids the need for a high number of iterative
selection rounds while reducing time, PCR bias and artefacts [
25
,
31
–
34
]. We included NGS of every
selection round and subsequent identification of the best aptamer sequences from the selected aptamer
pools based on frequency of the individual aptamer sequences within the final selected aptamer
pool (abundance) and the rate at which these frequencies were increasing over multiple selection
rounds (enrichment).
Several aptamers targeting HER2 have been reported. Most of these aptamers are RNA
aptamers [
35
–
37
] and considerably longer (>71-mer) [
35
–
39
]. In addition, they were selected using
(a part of) the purified HER2 protein [
36
,
38
–
41
] or using a mouse cell line [
37
]. Moreover, the
majority of these studies did not utilize next generation sequencing to probe the selected libraries
deeply [
35
,
36
,
39
–
41
]. Finally, only few aptamers targeting HER2 were tested for their affinity
and specificity.

Pharmaceuticals 2016,9, 29 3 of 21
In this study, we isolated novel short (40-mer) HER2-specific DNA aptamers from whole-cell
SELEX using adherent human breast cancer cells (SKBR3). The selected aptamers were further
characterized in terms of binding properties and potential inhibitory effect on cell growth.
2. Results and Discussion
2.1. Whole-Cell SELEX on SKBR3 Breast Cancer Cells
To select aptamers against proteins associated with the cell surface in their natural state,
we performed whole-cell SELEX using the adherent SKBR3 breast cancer cell line (Figure 1A).
The major advantage of using adherent cells is the ability to easily wash the cells, thereby removing all
unbound sequences and those sequences that are (non-specifically) bound to dead or floating cells.
To isolate the bound sequences, a combination of treatments was performed, including incubation
with 5 mM EDTA for 15 min at 37
˝
C (to dissociate the cells from the coverslip), followed by
treatment with 6 M urea (to denature the cells) and heat treatment for 5 min at 95
˝
C (to dissociate the
aptamer-protein complexes).
Pharmaceuticals 2016, 9, 29 3 of 21
[35,36,39–41]. Finally, only few aptamers targeting HER2 were tested for their affinity and
specificity.
In this study, we isolated novel short (40-mer) HER2-specific DNA aptamers from whole-cell
SELEX using adherent human breast cancer cells (SKBR3). The selected aptamers were further
characterized in terms of binding properties and potential inhibitory effect on cell growth.
2. Results and Discussion
2.1. Whole-Cell SELEX on SKBR3 Breast Cancer Cells
To select aptamers against proteins associated with the cell surface in their natural state, we
performed whole-cell SELEX using the adherent SKBR3 breast cancer cell line (Figure 1A). The
major advantage of using adherent cells is the ability to easily wash the cells, thereby removing all
unbound sequences and those sequences that are (non-specifically) bound to dead or floating cells.
To isolate the bound sequences, a combination of treatments was performed, including incubation
with 5 mM EDTA for 15 min at 37 °C (to dissociate the cells from the coverslip), followed by
treatment with 6 M urea (to denature the cells) and heat treatment for 5 min at 95 °C (to dissociate
the aptamer-protein complexes).
(A)
Selection round Total Unique Total duplicates Duplicates
1 7,102,280 7,052,394 99,050 49,164
2 4,391,344 3,367,706 1,823,788 800,150
3 6,089,400 4,222,377 3,102,745 1,235,722
4 4,201,019 2,871,498 2,207,218 877,697
5 3,074,436 1,497,935 2,284,360 707,859
(B)
Figure 1. Cont.

Pharmaceuticals 2016,9, 29 4 of 21
Pharmaceuticals 2016, 9, 29 4 of 21
(C)
Name Sequence Abundance
(round 5)
Enrichment
(round 5)
p-value
HeA2_1 ATTAAGAACCATCACTCTTCCAAATGGATATACGACTGGG 0.000114 0.000101 <1 × 10−16
HeA2_3 TCTAAAAGGATTCTTCCCAAGGGGATCCAATTCAAACAGC 0.0000621 0.0000547 3.56 × 10−12
HeA2_4 CAAACAGAAAATTGCCTATTTAGCTGTCTCTGAGATTCGA 0.0000563 0.0000489 2.09 × 10−9
HeA2_5 AGTCAGTAGTTCGGCTTATGATTTTATACATCTTACCCCT 0.0000556 0.0000466 2.01 × 10−8
HeA2_6 TCGCATCAGTGTTTTAATAGTCAACCGGTAAATGTTTCCC 0.0000494 0.000039 1.23 × 10−5
HeA2_12 TAGATAAATTGGGTTGGAAGCGTAAAAGATATGAGCTGAC 0.00004 0.000033 0.000522
HeA2_13 AGAGCGTATGCTGGCGCCGAACGATTTAAAATCATATTCA 0.0000387 0.0000287 0.006136
HeA2_14 ACCTAAGCCATGACAGTGATTGATTATTTGAGCAGTTGGT 0.0000387 0.0000313 0.001632
HeA2_21 ACTTACTCTTTGCTATCATAGCTCTGGGAATTTAATCGAT 0.0000351 0.000028 0.008571
(D)
Figure 1. Aptamer selection. (A) Schematic overview of the adherent whole-cell SELEX approach;
Five selection rounds were performed to enrich DNA aptamer sequences that bind to adherent
SKBR3 cells on coverslips (B) Progress of the selection analysed by high throughput NGS; (C)
Abundance of the 1000 most abundant sequences in selection round 5 in selection rounds 3, 4 and 5;
(D) List of most promising DNA aptamer sequences after five rounds of selection in terms
abundance (at round 5), enrichment (from round 4 to 5) and p-value. The sequences of the 40-mer
random region are listed.
In total, five rounds of selection were performed. We sequenced the aptamer pools from each
selection round and conducted bioinformatics analysis on a total of 50 million sequences. The
progress of the selection was evaluated and the selection was found successful since the
heterogeneity of the aptamer pools decreased with the progress of the selection (Figure 1B).
In order to identify candidate aptamers, all individual sequences were analysed based on their
frequency within the final aptamer pool (abundance) and the rate at which these frequencies were
increasing over multiple selection rounds (enrichment). We believe that the abundance and
enrichment of individual sequences are a better predictor of valuable aptamers than conventional
motif frequency, as it would appear that selection occurs at the full sequence level rather than at the
motif level [42]. Figure 1C shows that the distribution of sequences abundance is not linearly
distributed. The top few sequences are present at much higher abundance than the rest of the
sequences. Figure 1C also demonstrates that the enrichment rate of the sequences in the final three
selection rounds is higher for the very few top sequences. We imposed a statistical filter whereby the
sequences must be within the top 1000 sequences in terms of abundance in selection round 5, and the
sequences must exhibit p-values that are less than 0.01 for enrichment based on comparison of
Figure 1.
Aptamer selection. (
A
) Schematic overview of the adherent whole-cell SELEX approach;
Five selection rounds were performed to enrich DNA aptamer sequences that bind to adherent SKBR3
cells on coverslips (
B
) Progress of the selection analysed by high throughput NGS; (
C
) Abundance of
the 1000 most abundant sequences in selection round 5 in selection rounds 3, 4 and 5; (
D
) List of most
promising DNA aptamer sequences after five rounds of selection in terms abundance (at round 5),
enrichment (from round 4 to 5) and p-value. The sequences of the 40-mer random region are listed.
In total, five rounds of selection were performed. We sequenced the aptamer pools from each
selection round and conducted bioinformatics analysis on a total of 50 million sequences. The progress
of the selection was evaluated and the selection was found successful since the heterogeneity of the
aptamer pools decreased with the progress of the selection (Figure 1B).

Pharmaceuticals 2016,9, 29 5 of 21
In order to identify candidate aptamers, all individual sequences were analysed based on their
frequency within the final aptamer pool (abundance) and the rate at which these frequencies were
increasing over multiple selection rounds (enrichment). We believe that the abundance and enrichment
of individual sequences are a better predictor of valuable aptamers than conventional motif frequency,
as it would appear that selection occurs at the full sequence level rather than at the motif level [
42
].
Figure 1C shows that the distribution of sequences abundance is not linearly distributed. The top
few sequences are present at much higher abundance than the rest of the sequences. Figure 1C also
demonstrates that the enrichment rate of the sequences in the final three selection rounds is higher
for the very few top sequences. We imposed a statistical filter whereby the sequences must be within
the top 1000 sequences in terms of abundance in selection round 5, and the sequences must exhibit
p-values that are less than 0.01 for enrichment based on comparison of enrichment rates within the
top 1000 sequences. This resulted in nine sequences (Figure 1D). The combined total frequency of
these nine selected top sequences in the final selection round was only 0.00049. If only 100 sequences
would have been analysed (by traditional cloning), the probability of capturing at least one of these
sequences would have been 4.9%. This means that there is a 95% probability that, if we had only
analysed 100 sequences, we would not have identified any of the sequences that exhibited the strongest
response to selection. These results illustrate the significance of NGS and bioinformatics analysis
during and after selection.
Since the aptamer structure is of great importance for its functionality, we evaluated the secondary
structures of the nine selected aptamers. One single structure was predicted for aptamers HeA2_1,
HeA2_3, HeA2_5 and HeA2_6. In contrast, five different structures could be predicted for aptamers
HeA2_14 and HeA2_21. The highest structure stability (expressed as Gibbs free energy) was predicted
for aptamer HeA2_3 (
´
9.27 kcal/mol). Amount of structures and structure stability are important
aspects for the formulation of therapeutics for reasons of stability and homogeneity.
Another important structure often observed within single-stranded DNA aptamers is the
G-quadruplex structure, formed by guanine-rich nucleic acid sequences. It has been demonstrated
that G-quadruplexes enhance structure stability, offer increased resistance against nuclease-mediated
degradation [
43
,
44
] and can be involved in the aptamers functionality [
45
,
46
]. We investigated the
nine selected aptamers for the presence of G-quadruplexes using QGRS Mapper [
47
]. However,
no G-quadruplexes could be identified.
In whole-cell SELEX, each of the cell surface molecules are a potential target. In our study, we chose
HER2 as target of interest. SKBR3 cells are known to overexpress the HER2 protein. The selected
aptamers were therefore tested for binding to the HER2 protein and other HER2 overexpressing
cell lines.
2.2. Aptamer Protein Binding and Binding Affinity
In order to determine aptamer protein binding and binding affinity, we evaluated the kinetic
parameters for aptamer-HER2 complex formation by surface-plasmon resonance imaging (SPRi).
The selected aptamers (100
µ
M) were spotted onto a gold chip. Subsequently, the chip was sequential
injected with 100 nM HER2 protein, 2
µ
M plasma protein and 50 nM HER2 protein. Figure 2shows
the response curves of aptamers HeA2_1 and HeA2_3. Both aptamers have a fast association phase,
followed by a slow disassociation phase (Figure 2). No binding was observed for plasma protein.
Based on these data, the binding affinity coefficient (Kd) was 28.9 nM for aptamer HeA2_1 and 6.2 nM
for aptamer HeA2_3. The calculated Kd values, as well as the Kon and Koff values, are in agreement
with the values of other aptamer-protein complexes [48].

Pharmaceuticals 2016,9, 29 6 of 21
Pharmaceuticals 2016, 9, 29 5 of 21
enrichment rates within the top 1000 sequences. This resulted in nine sequences (Figure 1D). The
combined total frequency of these nine selected top sequences in the final selection round was only
0.00049. If only 100 sequences would have been analysed (by traditional cloning), the probability of
capturing at least one of these sequences would have been 4.9%. This means that there is a 95%
probability that, if we had only analysed 100 sequences, we would not have identified any of the
sequences that exhibited the strongest response to selection. These results illustrate the significance
of NGS and bioinformatics analysis during and after selection.
Since the aptamer structure is of great importance for its functionality, we evaluated the
secondary structures of the nine selected aptamers. One single structure was predicted for aptamers
HeA2_1, HeA2_3, HeA2_5 and HeA2_6. In contrast, five different structures could be predicted for
aptamers HeA2_14 and HeA2_21. The highest structure stability (expressed as Gibbs free energy)
was predicted for aptamer HeA2_3 (−9.27 kcal/mol). Amount of structures and structure stability are
important aspects for the formulation of therapeutics for reasons of stability and homogeneity.
Another important structure often observed within single-stranded DNA aptamers is the
G-quadruplex structure, formed by guanine-rich nucleic acid sequences. It has been demonstrated
that G-quadruplexes enhance structure stability, offer increased resistance against
nuclease-mediated degradation [43,44] and can be involved in the aptamers functionality [45,46]. We
investigated the nine selected aptamers for the presence of G-quadruplexes using QGRS Mapper
[47]. However, no G-quadruplexes could be identified.
In whole-cell SELEX, each of the cell surface molecules are a potential target. In our study, we
chose HER2 as target of interest. SKBR3 cells are known to overexpress the HER2 protein. The
selected aptamers were therefore tested for binding to the HER2 protein and other HER2
overexpressing cell lines.
2.2. Aptamer Protein Binding and Binding Affinity
In order to determine aptamer protein binding and binding affinity, we evaluated the kinetic
parameters for aptamer-HER2 complex formation by surface-plasmon resonance imaging (SPRi).
The selected aptamers (100 µM) were spotted onto a gold chip. Subsequently, the chip was
sequential injected with 100 nM HER2 protein, 2 µM plasma protein and 50 nM HER2 protein.
Figure 2 shows the response curves of aptamers HeA2_1 and HeA2_3. Both aptamers have a fast
association phase, followed by a slow disassociation phase (Figure 2). No binding was observed for
plasma protein. Based on these data, the binding affinity coefficient (Kd) was 28.9 nM for aptamer
HeA2_1 and 6.2 nM for aptamer HeA2_3. The calculated Kd values, as well as the Kon and Koff
values, are in agreement with the values of other aptamer-protein complexes [48].
Figure 2. Cont.
Pharmaceuticals 2016, 9, 29 6 of 21
(A)
(B)
Figure 2. (A) Protein binding assays by SPRi. Sensorgrams for aptamer HeA2_1 (top) and HeA2_3
(bottom). Injection of the protein started at 0 s and ended at 210 s. Data (mean reflexivity units) are
representative for 3 biological replicates. The dissociation (Koff) coefficient was calculated as
described in the experimental section; (B) Predicted aptamer secondary structures. The secondary
structure was investigated at conditions on selections (37 °C, 120 mM Na, 5 mM Mg). The secondary
structure and Gibbs free energy (ΔG, kcal/mole) were predicted using the Mfold software [49,50].
2.3. Aptamer Specificity for Different Cancer Cell Lines
To demonstrate the aptamer specificity, we used cell lines with different levels of HER2
receptors per cell. Since the literature is not consistent in the level of HER2 of these cell lines [51–60],
we investigated the HER2 expression level by flow cytometry using an anti-HER2 antibody (Figure
3A). A 2.3-fold higher HER2 expression could be observed for the SKOV3 cells vs. SKBR3 cells and a
40.1-fold difference for SKOV3 vs. MDA-MB-231. Moreover, to verify whether the observed aptamer
binding to HER2 overexpressing cells was related to HER2, we created SKOV3 cells with low HER2
expression (SKOV3_T) via lipid-based transfection of HER2-specific siRNAs. To confirm silencing,
HER2 mRNA and protein levels were determined using Q-PCR and flow cytometry, respectively
(Figure 3B,C). As shown in Figure 3B, the HER2 mRNA level was rapidly and significantly
decreased after treatment with HER2-specific siRNA and remained constant for the tested period. In
contrast, treatment with non-target siRNA showed a variable, but non-specific effect, similar to what
Figure 2.
(
A
) Protein binding assays by SPRi. Sensorgrams for aptamer HeA2_1 (
top
) and HeA2_3
(
bottom
). Injection of the protein started at 0 s and ended at 210 s. Data (mean reflexivity units) are
representative for 3 biological replicates. The dissociation (Koff) coefficient was calculated as described
in the experimental section; (
B
) Predicted aptamer secondary structures. The secondary structure was
investigated at conditions on selections (37
˝
C, 120 mM Na, 5 mM Mg). The secondary structure and
Gibbs free energy (∆G, kcal/mole) were predicted using the Mfold software [49,50].

Pharmaceuticals 2016,9, 29 7 of 21
2.3. Aptamer Specificity for Different Cancer Cell Lines
To demonstrate the aptamer specificity, we used cell lines with different levels of HER2 receptors
per cell. Since the literature is not consistent in the level of HER2 of these cell lines [
51
–
60
], we
investigated the HER2 expression level by flow cytometry using an anti-HER2 antibody (Figure 3A).
A 2.3-fold higher HER2 expression could be observed for the SKOV3 cells vs. SKBR3 cells and a
40.1-fold difference for SKOV3 vs. MDA-MB-231. Moreover, to verify whether the observed aptamer
binding to HER2 overexpressing cells was related to HER2, we created SKOV3 cells with low HER2
expression (SKOV3_T) via lipid-based transfection of HER2-specific siRNAs. To confirm silencing,
HER2 mRNA and protein levels were determined using Q-PCR and flow cytometry, respectively
(Figure 3B,C). As shown in Figure 3B, the HER2 mRNA level was rapidly and significantly decreased
after treatment with HER2-specific siRNA and remained constant for the tested period. In contrast,
treatment with non-target siRNA showed a variable, but non-specific effect, similar to what we
observed when treating cells with the transfecting reagents without siRNA (data not shown). The HER2
protein level was significantly decreased after treatment with HER2-specific siRNA in a gradual way,
due to remaining residual HER2 protein (Figure 3C). We observed that the introduction of a second
transfection, 72 h after the first transfection, was needed to further reduce the protein level. A maximal
reduction of 88.5% could be observed after 96 h. Remarkably, treatment with non-target siRNA also
led to a reduction in HER2 protein level with a maximal reduction of 59.1% after 72 h. Together, these
data show that the level of HER2 is maximally decreased at 96 h after transfection and that SKOV3_T
cells can be used for further HER2-specific assays.
Pharmaceuticals 2016, 9, 29 7 of 21
we observed when treating cells with the transfecting reagents without siRNA (data not shown). The
HER2 protein level was significantly decreased after treatment with HER2-specific siRNA in a
gradual way, due to remaining residual HER2 protein (Figure 3C). We observed that the
introduction of a second transfection, 72 h after the first transfection, was needed to further reduce
the protein level. A maximal reduction of 88.5% could be observed after 96 h. Remarkably, treatment
with non-target siRNA also led to a reduction in HER2 protein level with a maximal reduction of
59.1% after 72 h. Together, these data show that the level of HER2 is maximally decreased at 96 h
after transfection and that SKOV3_T cells can be used for further HER2-specific assays.
The specificity of aptamer HeA2_3 was evaluated by flow cytometry (Figure 4). Aptamer
HeA2_3 revealed a highly significant increase in binding to HER2-overexpressing cells (SKOV3 and
SKBR3) compared to cells with low HER2 expression level (MDA-MB-231) at 500 nM concentration
(Figure 4A). In contrast, incubation of these cells with a negative control aptamer did not result in a
difference in fluorescence between the three cell lines at all tested concentrations (Figure 4B).
Moreover, binding of aptamer HeA2_3 was significantly higher on SKOV3 and SKBR3 cells
compared to the negative control aptamer (Figure 4C). These results suggest that binding of aptamer
HeA2_3 was specific to HER2.
Figure 3. (A) HER2 expression level of different cell lines analysed by flow cytometry. Data are
expressed as mean ± SD, error bars are smaller than symbols (B) HER2 mRNA levels after silencing
of SKOV3 cells with HER2-specific siRNA or non-target siRNA. Data are expressed as fold change ±
SEM using the Pfaffl method, n = 3 biological replicates; (C) HER2 protein levels analysed by flow
cytometry using anti-HER2 antibody. Results are expressed as mean fluorescence ± SEM, n = 2
biological replicates. * p < 0.05; ** p < 0.01 and *** p < 0.001 vs. untreated cells, 2-way ANOVA with
Bonferroni post-test.
Figure 3.
(
A
) HER2 expression level of different cell lines analysed by flow cytometry. Data are
expressed as mean
˘
SD, error bars are smaller than symbols (
B
) HER2 mRNA levels after silencing
of SKOV3 cells with HER2-specific siRNA or non-target siRNA. Data are expressed as fold change
˘
SEM using the Pfaffl method, n= 3 biological replicates; (
C
) HER2 protein levels analysed by
flow cytometry using anti-HER2 antibody. Results are expressed as mean fluorescence
˘
SEM, n= 2
biological replicates. * p< 0.05; ** p< 0.01 and *** p< 0.001 vs. untreated cells, 2-way ANOVA with
Bonferroni post-test.

Pharmaceuticals 2016,9, 29 8 of 21
The specificity of aptamer HeA2_3 was evaluated by flow cytometry (Figure 4). Aptamer HeA2_3
revealed a highly significant increase in binding to HER2-overexpressing cells (SKOV3 and SKBR3)
compared to cells with low HER2 expression level (MDA-MB-231) at 500 nM concentration (Figure 4A).
In contrast, incubation of these cells with a negative control aptamer did not result in a difference in
fluorescence between the three cell lines at all tested concentrations (Figure 4B). Moreover, binding of
aptamer HeA2_3 was significantly higher on SKOV3 and SKBR3 cells compared to the negative control
aptamer (Figure 4C). These results suggest that binding of aptamer HeA2_3 was specific to HER2.
Pharmaceuticals 2016, 9, 29 8 of 21
Figure 4. Flow cytometry analysis of aptamer specificity on cells with different HER2 expression
levels. Bar graphs represent mean fluorescence of the cells incubated with three different
concentrations (125, 250 and 500 nM) aptamer HeA2_3 (A) or negative control aptamer (B); (C) Bar
graphs represent mean fluorescence of the cells incubated with 500 nM aptamer HeA2_3 or negative
control aptamer. n ≥ 3 biological replicates, error bars represent SD, significance of differences was
tested using the 2-way ANOVA test with ** p < 0.01 and *** p < 0.005.
We further evaluated the specificity of aptamers HeA2_1 and HeA2_3 by fluorescence
microscopy (Figure 5). To avoid possible artefacts from fixation and permeabilization [61], aptamers
were incubated on live cells and cells were only fixed after the complete staining procedure (to
prevent dehydration during microscopic analysis). Antibody staining confirmed high HER2
expression of SKBR3 and SKOV3 cells and low HER2 expression of MDA-MB-231 cells and
transfected SKOV3 cells (SKOV3_T, 96 h). Increased fluorescence intensity of aptamers HeA2_1 and
HeA2_3 could be observed for SKBR3 and SKOV3 cells. In contrast, the negative control aptamer did
not show staining on the tested cell lines. These data confirm that the selected aptamers bind
specifically to HER2 overexpressing cells.
To note, the following experiments were performed with SKOV3 cells instead of SKBR3 cells,
because of the higher HER2 level (Figure 3A) and because SKBR3 cells were problematic to grow
tumors in mice (data not shown).
Figure 4.
Flow cytometry analysis of aptamer specificity on cells with different HER2 expression levels.
Bar graphs represent mean fluorescence of the cells incubated with three different concentrations
(125, 250 and 500 nM) aptamer HeA2_3 (
A
) or negative control aptamer (
B
); (
C
) Bar graphs represent
mean fluorescence of the cells incubated with 500 nM aptamer HeA2_3 or negative control aptamer.
n
ě
3 biological replicates, error bars represent SD, significance of differences was tested using the
2-way ANOVA test with ** p< 0.01 and *** p< 0.005.
We further evaluated the specificity of aptamers HeA2_1 and HeA2_3 by fluorescence microscopy
(Figure 5). To avoid possible artefacts from fixation and permeabilization [
61
], aptamers were incubated
on live cells and cells were only fixed after the complete staining procedure (to prevent dehydration
during microscopic analysis). Antibody staining confirmed high HER2 expression of SKBR3 and
SKOV3 cells and low HER2 expression of MDA-MB-231 cells and transfected SKOV3 cells (SKOV3_T,
96 h). Increased fluorescence intensity of aptamers HeA2_1 and HeA2_3 could be observed for SKBR3
and SKOV3 cells. In contrast, the negative control aptamer did not show staining on the tested cell
lines. These data confirm that the selected aptamers bind specifically to HER2 overexpressing cells.
To note, the following experiments were performed with SKOV3 cells instead of SKBR3 cells,
because of the higher HER2 level (Figure 3A) and because SKBR3 cells were problematic to grow
tumors in mice (data not shown).

Pharmaceuticals 2016,9, 29 9 of 21
Pharmaceuticals 2016, 9, 29 9 of 21
Figure 5. Fluorescence microscopy analysis of the aptamer binding specificity and epitope
competition. Cells were stained with both Hoechst (blue, left panels) and anti-HER2 antibody (red,
right panels) or aptamers HeA2_1 or HeA2_3 (green, right panels). Images were taken at a
magnification of 200×.
2.4. Competition for HER2 Binding
To evaluate aptamers HeA2_1 and HeA2_3 for competition for HER2 binding and to confirm
that binding of the aptamers was HER2-specific, SKOV3 cells were incubated with a 100-fold excess
of non-fluorescent aptamer HeA2_1 or HeA2_3 and subsequently stained with the fluorescent
anti-HER2 antibody, aptamer HeA2_1 or HeA2_3. As shown in Figure 6, both aptamers were found
to specifically bind HER2, since addition of an excess aptamer was able to block the binding of the
anti-HER2 antibody.
To evaluate whether the aptamers HeA2_1 and HeA2_3 compete with each other for HER2
binding, SKOV3 cells were incubated with a 100-fold excess of non-fluorescent aptamer HeA2_1 or
HeA2_3 and subsequently stained with the fluorescently labeled aptamers HeA2_1 or HeA2_3. We
observed less binding after addition of an excess aptamer, suggesting that both aptamers bind HER2
in a competitive manner. We therefore hypothesize that binding should involve the same epitope on
HER2 or that HER2 undergoes an allosteric shift as a result of binding, thus changing epitopes. On
the other side, it may be possible that the HER2 receptor was unavailable because of internalization
after binding.
Figure 5.
Fluorescence microscopy analysis of the aptamer binding specificity and epitope competition.
Cells were stained with both Hoechst (blue, left panels) and anti-HER2 antibody (red, right panels) or
aptamers HeA2_1 or HeA2_3 (green, right panels). Images were taken at a magnification of 200ˆ.
2.4. Competition for HER2 Binding
To evaluate aptamers HeA2_1 and HeA2_3 for competition for HER2 binding and to confirm that
binding of the aptamers was HER2-specific, SKOV3 cells were incubated with a 100-fold excess
of non-fluorescent aptamer HeA2_1 or HeA2_3 and subsequently stained with the fluorescent
anti-HER2 antibody, aptamer HeA2_1 or HeA2_3. As shown in Figure 6, both aptamers were found
to specifically bind HER2, since addition of an excess aptamer was able to block the binding of the
anti-HER2 antibody.
Pharmaceuticals 2016, 9, 29 10 of 21
Figure 6. Fluorescence microscopy analysis of the aptamer binding specificity and epitope
competition. Cells were stained with the anti-HER2 antibody (red) or aptamers HeA2_1 or HeA2_3
(green) in the absence ((left) panels) and presence ((right) panels) of an excess aptamer HeA2_1 or
HeA2_3. Images were taken at a magnification of 200×.
2.5. Internalization of Aptamer HeA2_3 into HER2 Overexpressing Cells
Aptamer-mediated transport of payloads such as toxins, drugs, siRNA or radionuclides, may
be more effective when delivered intracellularly. HER2 has no natural ligand but is known to
internalize after binding to specific molecules, such as antibodies [62–64], nanobodies [65] and
affibodies [66,67].
To assess whether aptamer HeA2_3 was internalized after HER2 binding, we compared the
cellular localization of aptamer HeA2_3 and the anti-HER2 antibody in SKOV3 cells. The antibody
displayed the characteristic localization of HER2 at the cell surface, whereas the fluorescent intensity
of aptamer HeA2_3 was mostly localized in the cytoplasm (Figure 7). Since the anionic character of
oligonucleotides does not favour spontaneous entry into live cells, the intracellular localization of
the aptamer suggests that entry into the cells occurred by receptor-mediated endocytosis. In
addition, a punctate pattern could be observed, which has also been observed with other
internalizing aptamers [40,68–72]. This pattern may indicate aptamer accumulation in the
endosomes, which support the hypothesis of receptor-mediated endocytosis as route of
internalization [73].
Anti-HER2
antibody-PE
HeA2_3
aptamer-FAM
SKOV3
Figure 7. Fluorescence microscopy analysis of internalization of aptamer HeA2_3 into SKOV3 cells.
Cultured SKOV3 cells were stained with anti-HER2 antibody (red) or HeA2_3 aptamer (green) and
internalization was evaluated by fluorescence microscopy. Images were taken at a magnification of
400×. All experiments were performed at 37 °C as lower temperatures may inhibit internalization.
Figure 6.
Fluorescence microscopy analysis of the aptamer binding specificity and epitope competition.
Cells were stained with the anti-HER2 antibody (red) or aptamers HeA2_1 or HeA2_3 (green) in the
absence ((
left
) panels) and presence ((
right
) panels) of an excess aptamer HeA2_1 or HeA2_3. Images
were taken at a magnification of 200ˆ.

Pharmaceuticals 2016,9, 29 10 of 21
To evaluate whether the aptamers HeA2_1 and HeA2_3 compete with each other for HER2
binding, SKOV3 cells were incubated with a 100-fold excess of non-fluorescent aptamer HeA2_1 or
HeA2_3 and subsequently stained with the fluorescently labeled aptamers HeA2_1 or HeA2_3. We
observed less binding after addition of an excess aptamer, suggesting that both aptamers bind HER2
in a competitive manner. We therefore hypothesize that binding should involve the same epitope
on HER2 or that HER2 undergoes an allosteric shift as a result of binding, thus changing epitopes.
On the other side, it may be possible that the HER2 receptor was unavailable because of internalization
after binding.
2.5. Internalization of Aptamer HeA2_3 into HER2 Overexpressing Cells
Aptamer-mediated transport of payloads such as toxins, drugs, siRNA or radionuclides, may be
more effective when delivered intracellularly. HER2 has no natural ligand but is known to internalize
after binding to specific molecules, such as antibodies [62–64], nanobodies [65] and affibodies [66,67].
To assess whether aptamer HeA2_3 was internalized after HER2 binding, we compared the
cellular localization of aptamer HeA2_3 and the anti-HER2 antibody in SKOV3 cells. The antibody
displayed the characteristic localization of HER2 at the cell surface, whereas the fluorescent intensity
of aptamer HeA2_3 was mostly localized in the cytoplasm (Figure 7). Since the anionic character of
oligonucleotides does not favour spontaneous entry into live cells, the intracellular localization of the
aptamer suggests that entry into the cells occurred by receptor-mediated endocytosis. In addition,
a punctate pattern could be observed, which has also been observed with other internalizing
aptamers [
40
,
68
–
72
]. This pattern may indicate aptamer accumulation in the endosomes, which
support the hypothesis of receptor-mediated endocytosis as route of internalization [73].
Pharmaceuticals 2016, 9, 29 10 of 21
Figure 6. Fluorescence microscopy analysis of the aptamer binding specificity and epitope
competition. Cells were stained with the anti-HER2 antibody (red) or aptamers HeA2_1 or HeA2_3
(green) in the absence ((left) panels) and presence ((right) panels) of an excess aptamer HeA2_1 or
HeA2_3. Images were taken at a magnification of 200×.
2.5. Internalization of Aptamer HeA2_3 into HER2 Overexpressing Cells
Aptamer-mediated transport of payloads such as toxins, drugs, siRNA or radionuclides, may
be more effective when delivered intracellularly. HER2 has no natural ligand but is known to
internalize after binding to specific molecules, such as antibodies [62–64], nanobodies [65] and
affibodies [66,67].
To assess whether aptamer HeA2_3 was internalized after HER2 binding, we compared the
cellular localization of aptamer HeA2_3 and the anti-HER2 antibody in SKOV3 cells. The antibody
displayed the characteristic localization of HER2 at the cell surface, whereas the fluorescent intensity
of aptamer HeA2_3 was mostly localized in the cytoplasm (Figure 7). Since the anionic character of
oligonucleotides does not favour spontaneous entry into live cells, the intracellular localization of
the aptamer suggests that entry into the cells occurred by receptor-mediated endocytosis. In
addition, a punctate pattern could be observed, which has also been observed with other
internalizing aptamers [40,68–72]. This pattern may indicate aptamer accumulation in the
endosomes, which support the hypothesis of receptor-mediated endocytosis as route of
internalization [73].
Anti-HER2
antibody-PE
HeA2_3
aptamer-FAM
SKOV3
Figure 7. Fluorescence microscopy analysis of internalization of aptamer HeA2_3 into SKOV3 cells.
Cultured SKOV3 cells were stained with anti-HER2 antibody (red) or HeA2_3 aptamer (green) and
internalization was evaluated by fluorescence microscopy. Images were taken at a magnification of
400×. All experiments were performed at 37 °C as lower temperatures may inhibit internalization.
Figure 7.
Fluorescence microscopy analysis of internalization of aptamer HeA2_3 into SKOV3 cells.
Cultured SKOV3 cells were stained with anti-HER2 antibody (
red
) or HeA2_3 aptamer (
green
) and
internalization was evaluated by fluorescence microscopy. Images were taken at a magnification of
400ˆ. All experiments were performed at 37 ˝C as lower temperatures may inhibit internalization.
2.6. Ex Vivo Tumor Tissue Staining
Aptamer binding was further evaluated on tumor tissue sections by fluorescence microscopy.
For this, immunodeficient mice were inoculated with SKOV3 or MDA-MB-231 cells and tumors were
dissected 9 weeks after inoculation. Tumor tissue sections were stained with hematoxylin and eosin
for morphology confirmation. A highly dense, poorly differentiated cell mass could be observed
(Figure 8). Next, antibody staining confirmed that the HER2 expression of the cell lines was maintained
in the xenografts. A bright fluorescent staining could be observed for aptamers HeA2_3 and Hea2_1,
although less pronounced for aptamer HeA2_1. No staining was observed for all aptamers on the
MDA-MB-231 tumor tissue sections and for the negative control aptamer on both tumor tissue sections.
These results confirm specific binding of the aptamers to HER2. In addition, it demonstrates the
potential use of aptamers to replace antibodies in immunostaining protocols.

Pharmaceuticals 2016,9, 29 11 of 21
Pharmaceuticals 2016, 9, 29 11 of 21
2.6. Ex Vivo Tumor Tissue Staining
Aptamer binding was further evaluated on tumor tissue sections by fluorescence microscopy.
For this, immunodeficient mice were inoculated with SKOV3 or MDA-MB-231 cells and tumors
were dissected 9 weeks after inoculation. Tumor tissue sections were stained with hematoxylin and
eosin for morphology confirmation. A highly dense, poorly differentiated cell mass could be
observed (Figure 8). Next, antibody staining confirmed that the HER2 expression of the cell lines
was maintained in the xenografts. A bright fluorescent staining could be observed for aptamers
HeA2_3 and Hea2_1, although less pronounced for aptamer HeA2_1. No staining was observed for
all aptamers on the MDA-MB-231 tumor tissue sections and for the negative control aptamer on both
tumor tissue sections. These results confirm specific binding of the aptamers to HER2. In addition, it
demonstrates the potential use of aptamers to replace antibodies in immunostaining protocols.
Figure 8. Fluorescence microscopy analysis of aptamer binding to tumor xenografts. Sections of
tumor xenografts were stained with hematoxylin and eosin (top), Hoechst (blue) and the anti-HER2
antibody (red) or aptamer HeA2_1, HeA2_3 or the negative control aptamer (green). Images were
taken at a magnification of 200×.
Figure 8.
Fluorescence microscopy analysis of aptamer binding to tumor xenografts. Sections of tumor
xenografts were stained with hematoxylin and eosin (top), Hoechst (blue) and the anti-HER2 antibody
(red) or aptamer HeA2_1, HeA2_3 or the negative control aptamer (green). Images were taken at a
magnification of 200ˆ.
2.7. Targeted Inhibition of Cell Growth
The HER2 receptor plays an important role in cell growth and proliferation. Several molecules
targeting the HER2 receptor, such as the antibody trastuzumab, showed that binding to HER2 leads to
a decrease in cell growth of HER2 overexpressing cells [
74
,
75
]. Aptamers have also shown to be able to
sterically hinder the active site or interaction surfaces of other protein targets, thereby affecting the
function of the targeted protein (reviewed in [76,77]).
We investigated the potential inhibitory effect of aptamers HeA2_1 and HeA2_3 on cell
proliferation of SKOV3 and MDA-MB-231 cells. Cells were treated daily with 0.1
µ
M aptamer and
counted daily up till 5 days after initiation. All cells were analysed in their exponential growth
phase. Both HER2 aptamers significantly inhibited the proliferation of SKOV3 cells. As expected, the
inhibitory effect was time- and dose-dependent as the largest effect in cell number could be observed

Pharmaceuticals 2016,9, 29 12 of 21
at the end of the experiment, which is 5 days after daily treatment, after having received 5 doses of
0.1
µ
M aptamer. The mean SKOV3 cell number after 5 days of treatment was reduced to 82.2%
˘
3.8%
and 80.0%
˘
8.5%, for aptamers HeA2_1 and HeA2_3 respectively compared to untreated cells
(p< 0.01) (Figure 9A). In addition, the mean SKOV3 cell number was significantly reduced for aptamer
HeA2_3 compared to the negative control aptamer (p< 0.05), suggesting that inhibitory effect was
related to the aptamer’s specificity for HER2.
Pharmaceuticals 2016, 9, 29 12 of 21
2.7. Targeted Inhibition of Cell Growth
The HER2 receptor plays an important role in cell growth and proliferation. Several molecules
targeting the HER2 receptor, such as the antibody trastuzumab, showed that binding to HER2 leads
to a decrease in cell growth of HER2 overexpressing cells [74,75]. Aptamers have also shown to be
able to sterically hinder the active site or interaction surfaces of other protein targets, thereby
affecting the function of the targeted protein (reviewed in [76,77]).
We investigated the potential inhibitory effect of aptamers HeA2_1 and HeA2_3 on cell
proliferation of SKOV3 and MDA-MB-231 cells. Cells were treated daily with 0.1 µM aptamer and
counted daily up till 5 days after initiation. All cells were analysed in their exponential growth
phase. Both HER2 aptamers significantly inhibited the proliferation of SKOV3 cells. As expected, the
inhibitory effect was time- and dose-dependent as the largest effect in cell number could be observed
at the end of the experiment, which is 5 days after daily treatment, after having received 5 doses of
0.1 µM aptamer. The mean SKOV3 cell number after 5 days of treatment was reduced to 82.2% ±
3.8% and 80.0% ± 8.5%, for aptamers HeA2_1 and HeA2_3 respectively compared to untreated cells
(p < 0.01) (Figure 9A). In addition, the mean SKOV3 cell number was significantly reduced for
aptamer HeA2_3 compared to the negative control aptamer (p < 0.05), suggesting that inhibitory
effect was related to the aptamer’s specificity for HER2.
Figure 9. Targeted inhibition of cell growth by selected aptamers. (A) Bar graphs represent % cell
number after 5 days of daily treatment with or without 0.1 µM aptamer. n ≥ 3 biological replicates,
error bars represent SD, significance of differences between treated vs. untreated cells was tested
using the 2-way ANOVA test with ** p < 0.01 (B) Bar graphs represent overall population doubling
time (h) after daily treatment with or without 0.1 µM aptamer. n ≥ 3 biological replicates, error bars
represent SD, significance of differences between treated vs. untreated cells was tested using the
2-way ANOVA test with * p < 0.05.
The overall population doubling time of SKOV3 cells was significantly increased with 1.26-fold
for aptamer HeA2_1 and 1.30-fold for aptamer HeA2_3 compared to untreated cells (p < 0.05) (Figure
9B). In case of the MDA-MB-231 cells, treatment with the HER2 aptamers showed no significant
effects on cell number, suggesting that the inhibitory effect may be related to the action of HER2.
Moreover, no effect on cell proliferation was observed in the presence of the negative control
aptamer for both cell lines, suggesting that the tested dose (0.1 µM) was not toxic in a non-specific
manner.
Figure 9.
Targeted inhibition of cell growth by selected aptamers. (
A
) Bar graphs represent % cell
number after 5 days of daily treatment with or without 0.1
µ
M aptamer. n
ě
3 biological replicates,
error bars represent SD, significance of differences between treated vs. untreated cells was tested using
the 2-way ANOVA test with ** p< 0.01 (
B
) Bar graphs represent overall population doubling time (h)
after daily treatment with or without 0.1 µM aptamer. ně3 biological replicates, error bars represent
SD, significance of differences between treated vs. untreated cells was tested using the 2-way ANOVA
test with * p< 0.05.
The overall population doubling time of SKOV3 cells was significantly increased with 1.26-fold for
aptamer HeA2_1 and 1.30-fold for aptamer HeA2_3 compared to untreated cells (p< 0.05) (Figure 9B).
In case of the MDA-MB-231 cells, treatment with the HER2 aptamers showed no significant effects
on cell number, suggesting that the inhibitory effect may be related to the action of HER2. Moreover,
no effect on cell proliferation was observed in the presence of the negative control aptamer for both
cell lines, suggesting that the tested dose (0.1 µM) was not toxic in a non-specific manner.
3. Materials and Methods
3.1. Cell Lines and Cell Culture
Human adherent cell lines SKBR3 (breast adenocarcinoma), MDA-MB-231 (breast adenocarcinoma),
SKOV3 (ovarian adenocarcinoma) were purchased from American Type Cell Culture (ATCC,
Manassas, VA, USA). SKBR3 and SKOV3 cells were maintained in McCoy’s 5A culture medium
(ATCC) supplemented with 20% (v/v) fetal bovin serum (FBS, Gibco, ThermoFisher Scientific, Gent,
Belgium). Both cell lines were cultured in a humidified incubator at 37
˝
C in the presence of 5% CO
2
in
air. MDA-MB-231 cells were maintained in Leibovitz’s L-15 culture medium (ATCC) supplemented

Pharmaceuticals 2016,9, 29 13 of 21
with 10% (v/v) FBS (Gibco) and 100 Units/mL penicillin and 100
µ
g/mL streptomycin (Gibco).
MDA-MB-231 cells were cultured in a humidified incubator at 37
˝
C in 100% air. All cell lines were
dissociated using 5 mM ethylenediaminetetraacetic acid (EDTA, Sigma-Aldrich, St. Louis, MO, USA).
3.2. Transfection
Ten thousand SKOV3 cells were plated in a 24-well plate in antibiotic free medium one day prior
transfection. Cells were transfected with 50 or 100 nM ON-TARGETplus SMARTpool Human ERBB2
siRNA (Dharmacon, Lafayette, CO, USA) with 1.5
µ
L Lipofectamine RNAiMAX reagent (Invitrogen,
Carlsbad, CA, USA) in Opti-MEM I Reduced Serum Medium, GlutaMAX (Invitrogen). Complete
growth medium was added 4 hours after incubation with the transfection mixture. Cells treated with
the transfection reagent alone were used as a reference. In addition, a negative control using 50 or
100 nM ON-TARGET plus non-targeting pool (Dharmacon) was included. Cells were analysed by
Q-PCR and flow cytometry for HER2 expression.
3.3. HER2 Expression Analysis by Q-PCR (mRNA Level)
RNA isolation (AllPrep DNA/RNA/Protein Mini, Qiagen, Hilden, Germany) and reverse
transcription (Taqman Reverse transcription reagens, Applied Biosystems, Foster City, CA, USA)
were performed according to manufacturer’s recommendations. Expression levels were evaluated
using the TaqMan Gene Expression Assay (Applied Biosystems) following manufacturer’s instructions.
Ct values were normalised using GAPDH as endogenous control. Fold changes were calculated using
the Pfaffl method. Significance was tested with the two-way ANOVA test.
3.4. HER2 Expression Analysis by Flow Cytometry (Protein Level)
Cells were harvested by 5 mM EDTA and stained with the fluorescent anti-human
ErbB2-Phycoerythin (PE) monoclonal antibody (R & D Systems, Minneapolis, MN, USA) according to
manufacturer’s protocol. As a negative control, cells were stained with a PE-conjugated isotype control
antibody (R & D Systems). Cells were analysed using the C6 flow cytometer (Accuri, Ann Arbor, MI,
USA). It should be noted that only extracellular HER2 is stained using the PE-conjugated antibody.
3.5. Oligonucleotides
The DNA library for selection was composed of a 40-mer random region flanked by two constant
regions for primer hybridisation: 5
1
-TAG GGA AGA GAA GGA CAT ATG AT-(N40)-TTG ACT AGT
ACA TGA CCA CTT GA-31(Trilink Biotechnologies, San Diego, CA, USA).
During selection, the eluted sequences were PCR amplified using 1X PCR amplification buffer
(New England Biolabs, Ipswich, MA, USA), 2
µ
M primers and 5 Units/
µ
L Taq polymerase (50
µ
L total
volume). Amplifications were carried out in a MJ Mini Thermal Cycler (BioRad, Hercules, CA, USA)
at 94
˝
C for 10 s, 55
˝
C for 15 s and 72
˝
C for 30 s. The appropriate number of PCR cycles was visually
determined by 10% acrylamide gel electrophoresis.
After selection, aptamer sequences without primers (40-mer) were chemically synthesized by
Sigma Genosys (Oakville, ON, Canada) or Integrated DNA Technologies (IDT, Leuven, Belgium).
For fluorescent-based assays, the aptamer sequences were extended with a 25-mer region (5
1
-TTT TTC
CAC AAC GAT GCG TAG TTC CG-3
1
) complementary to a 20-mer fluorescent probe (5
1
-FAM-CGG
AAC TAC GCA TCG TGT GG-3
1
). Prior to use, both sequences were combined at an equimolar
concentration, heated for 10 min at 95 ˝C and cooled down to room temperature.
3.6. Aptamer Selection
The selection was performed using 20,000 adherent SKBR3 cells which were plated on glass
coverslips in a 24-well plate. Once a good lawn of adherent cells was established, the growth medium
was removed and replaced by 1 mL of pre-warmed selection buffer (10 mM HEPES, 120 mM NaCl,

Pharmaceuticals 2016,9, 29 14 of 21
5 mM MgCl
2
, 5 mM KCl) containing the random DNA library (10
15
sequences, corresponding to
1.66
µ
M). Prior to incubation, the library was heated to 95
˝
C for 10 min and “snap-cooled” on ice
for 15 min. Following an incubation of 30 min at 37
˝
C, the selection buffer, along with all unbound
aptamers and dead cells, was removed and the cells were washed with 1 mL of fresh selection buffer.
Next, 500
µ
L of 5 mM EDTA was applied to the cells and incubated for 15 min at 37
˝
C to lift the
cells from the coverslip. The supernatant containing the cells and the bound aptamers was then
added to a urea solution (6 M final concentration) to lyse the cells. In addition, heat treatment was
performed (95
˝
C for 5 min) to dissociate aptamer-protein complexes. The cellular debris was removed
by centrifugation at 13,300 rpm for 1 min. The bound aptamers were recovered from the cell lysate
using a MinElute PCR Purification Kit (Qiagen). PCR amplification (forward primer 5
1
-TAG GGA
AGA GAA GGA CAT ATG AT-3
1
, reverse primer 5
1
-TCA AGT GGT CAT GTA CTA GTC AA-3
1
) was
used to amplify a fraction of the recovered aptamers (10
µ
L out of 400
µ
L) for the next round of
selection. The PCR products were purified away from the primers with the use of a MinElute PCR
Purification Kit (Qiagen). The purified PCR products (400
µ
L) were diluted with 600
µ
L selection
buffer, heated at 95
˝
C for 10 min and “snap-cooled” for 15 min, and added to the cells for the next
round of selection. In total, 5 rounds of positive selection were performed. A fraction of the eluted
aptamer pools from each selection round was sequenced by NGS (Illumina HiSeq 2500, Hospital for
Sick Children, Toronto, ON, Canada). For each sequence, a copy number was observed in the NGS
data. This copy number was normalized to a frequency (or abundance) by dividing it by the total
number of sequences observed for that selection round. Enrichment refers to the increase in frequency
from one selection round to another. We determined Z-values (observed value—mean value)/standard
deviation. Next, we determined p-values for these Z-values using the Excel function 1-NORMSDIST
(Z-value). The secondary structures of the selected sequences were predicted using mfold software
at the conditions of selection (37
˝
C, 120 mM Na
+
and 5 mM Mg
2+
) [
49
,
50
]. In addition, the selected
sequences were analysed for potential quadruplex forming G-rich sequences by QGRS Mapper [
47
,
78
].
3.7. Protein Binding by Surface Plasmon Resonance Imaging (SPRi)
Two aptamers were chosen for further investigation: HeA2_3: 5
1
-TCT AAA AGG ATT CTT CCC
AAG GGG ATC CAA TTC AAA CAG C-3
1
and HeA2_1: 5
1
-ATT AAG AAC CAT CAC TCT TCC AAA
TGG ATA TAC GAC TGG G-3
1
. A negative control aptamer of the same sequence length was also used
(51-CCC TTT TAC ACA ACC ATC GAC ATA ACT AAA ACC ACC ACT G-31).
The aptamers were synthesized with hexyl-disulfide group on the 5
1
end and spotted (10 nL,
100
µ
M) in triplicate on a gold sensor chip. The chip was blocked with a coating of bovine serum
albumin (Fischer, Ried im Innkreis, Austria). The chip was loaded on top of a prism in an OpenPlex
SPRi instrument (Horiba Scientific, Edison, NJ, USA). HER2 protein (50 or 100 nM final concentration)
(monomer, extracellular domain, Met1-Thr652, Sino Biological Inc., North Wales, PA, USA) and plasma
protein (2 µM final concentration) were diluted in selection buffer and injected at a volume of 200 µL
and a flow rate of 50
µ
L/min into the instrument. Bound protein was removed with 1 M NaCl (4 min).
The chip was calibrated using 3 mg/mL sucrose (Sigma Aldrich).
Resonance (R) was measured using the optical sensor of the instrument. An increase in resonance
observed when the protein flows over the chip, is a function of the protein binding to the aptamers.
Data was analysed by subtracting the resonance values observed as the protein flows over the negative
aptamer spots from the resonance values observed as the protein passes over the HeA2_1 and HeA2_3
aptamer spots.
Data were analysed in R using the ‘Neo-Bind’ program (NeoVentures Biotechnology Inc.).
The coefficient of disassociation (Koff) was determined by the following formula: dR/dt = – Koff
ˆ
Rt (dR/dt = the first derivative of the resonance values, and Rt = the resonance value for each time
point evaluated). The following formula was used to determine the coefficient of association (Kon):
dR/dt = – Kon
ˆ
c
ˆ
Rmax – (Konn
ˆ
c+Koff )
ˆ
Rt (c= protein concentration in the flow, Rmax = the

Pharmaceuticals 2016,9, 29 15 of 21
maximal observed resonance). The binding affinity coefficient (Kd) was calculated by dividing Koff
by Kon.
3.8. Flow Cytometry
Cells were detached from the culture flask using non-enzymatic dissociation buffer (5 mM
EDTA in PBS) at 37
˝
C for 10 min. Dissociated cells (100,000) were washed in selection buffer and
incubated with varying concentrations (125, 250 and 500 nM) of aptamer HeA2_3 or negative control
aptamer in selection buffer at 37
˝
C for 60 min. After incubation, unbound aptamers were removed
by centrifugation and the cells were washed with PBS. Cells were kept on ice prior to flow cytometry
analysis on an Accuri C6 flow cytometer (BD Bioscience, San Jose, CA, USA). The resulting mean
fluorescence was subtracted with the mean (auto)fluorescence of untreated cells.
3.9. Fluorescent Microscopy—Cellular Staining
Cells (20,000 cells in 500
µ
L culture medium) were seeded in LabTek II 4-well chamber slides
(Nunc, Sigma Aldrich, St. Louis, MO, USA) and cultured for 4 to 5 days. The cells were carefully
washed with PBS and then incubated with the aptamers at a final concentration of 250 nM in selection
buffer. After incubation (30 min at 37 ˝C), cells were washed with PBS to remove unbound aptamers.
For antibody staining, cells were blocked with human IgG (R & D Systems) for 15 min at room
temperature. Afterwards, 10
µ
L of monoclonal anti-HER2 antibody (R & D Systems) was added
and incubated for 30 min at 37
˝
C. Hoechst staining was performed by incubating the cells with
0.1 mg/mL Hoechst final concentration (Sigma Aldrich) for 10 min at room temperature. Finally,
cells were fixed using 4% sucrose in 4% paraformaldehyde (PFA) for 10 min at room temperature.
Images were acquired with a 40
ˆ
objective on a Eclipse Ti automated inverted fluorescence microscope
(Nikon Instruments Inc., Melville, NY, USA) equipped with bandpass filters for Hoechst (excitation
387/11, emission 452/45), FAM (excitation 485/20, emission 536/40) and PE (excitation 556/20,
emission 593/40). Differential interference contrast (DIC) images are bright field. All images were
taken with the same exposure time. For competition studies, a 100-fold of non-fluorescent aptamer
HeA2_1 or HeA2_3 was added to SKOV3 cells for 30 min at 37
˝
C. Next, unbound excess aptamer
was removed and fluorescent antibody or aptamer was added to the cells and incubated for 30 min
at 37
˝
C. Cells were counterstained with Hoechst as mentioned above. Fluorescent images were not
always merged with DIC or Hoechst for reasons of clarity.
3.10. Fluorescent Microscopy—Tumor Tissue Staining
3.10.1. Animals
Hairless non-obese diabetic severe combined immunodeficient (NOD.Cg-Prkdc
scid
Hr
hr
/NCrHsd)
mice were purchased from Harlan Laboratories/Envigo (Indianapolis, IN, USA). Mice were housed
together (3–4 mice per cage) in individual ventilated cages and were kept under controlled conditions
of 12:12 h light:dark cycle, 22
˘
2
˝
C and 50%
˘
5% relative humidity. The mice were fed ad libitum
with irradiated rodent food (Teklad, Harlan Laboratories) and autoclaved water. The animals were
housed at the animal facility of SCK
‚
CEN in accordance with the Ethical Committee Animal Studies
of Medanex Clinic (EC_MxCl_2014_034). All animal experiments were done in compliance with the
NIH Guides for the Care and Use of Laboratory Animals and were approved by the Ethical Committee
of the University of Liège. Mice were inoculated subcutaneously in the hind leg with a 100
µ
L cell
suspension composed of 50
µ
L cells (3
ˆ
10
6
MDA-MB-231 or 1.5
ˆ
10
6
SKOV3) and 50
µ
L Matrigel
basement membrane matrix high concentration (Corning, Corning, NY, USA).
3.10.2. Ex Vivo Tumor Tissue Staining
Xenografted tumors were harvested, washed with PBS and incubated overnight in 4% PFA at 4
˝
C.
The tumors were subsequently washed three times with PBS (5 min) and incubated in 10% sucrose

Pharmaceuticals 2016,9, 29 16 of 21
(2 h), 20% sucrose (2 h) and 30% sucrose (overnight) at 4
˝
C. Next, the tumors were placed in liquid
optimal-cutting-temperature medium Tissuetek (Sakura, AJ Alphen aan den Rijn, the Netherlands)
and flash-frozen for storage at
´
20
˝
C. Frozen tumor tissue sections were cut (10
µ
m thick) with a
CryoStar
™
NX50 Cryostat (Thermo Scientific, Waltham, MA, USA). Hematoxylin and eosin staining
was performed for morphological confirmation following routine laboratory protocol. For antibody
staining, the tumor tissue sections were blocked with human IgG (R & D Systems) for 15 min at
room temperature. Afterwards, 10
µ
L of monoclonal anti-HER2 antibody (R & D Systems) was
added and incubated for 30 min at 37
˝
C. Hoechst staining was performed by incubating the tumor
tissue sections with 0.1 mg/mL Hoechst final concentration (Sigma Aldrich) for 10 min at room
temperature. For aptamer staining, the tumor tissue sections were washed with PBS and incubated
with the aptamer at a final concentration of 250 nM in selection buffer. After incubation (30 min at
37
˝
C), the tumor tissue sections were washed with PBS to remove unbound aptamers. Images were
acquired as described above.
3.11. Cell Proliferation Assay
Cells were seeded in a T25 culture flask (100,000 cells in 3 mL culture medium) and cultured.
After 24 h, cells were treated daily with 0.1
µ
M aptamer (HeA2_1, HeA2_3 or negative control).
Fresh culture medium was added on day 2, 4 and 6. At various time points, cells were dissociated
with 5 mM EDTA and counted using the MOXI Z mini automated cell counter (curve fit count mode,
VWR). Population doubling time (h) was extrapolated from modelling the data with the exponential
growth equation y = y
0(k*x)
with y = cell number at time x, y
0
= initial cell number, k = rate constant)
(GraphPad). All samples were determined in triplicate.
4. Conclusions
In this study, we selected novel DNA aptamers targeting the HER2 receptor, an important protein
in cancer development and progression and thus an attractive target for cancer therapy. In contrast
to the previously selected HER2 aptamers, the aptamers selected in this study are relatively short
(40-mer). This short length avoids the need for laborious truncation experiments and facilitates a
more efficient synthesis, as it is known that the synthesis efficiency decreases by 3% per nucleotide.
Moreover, the synthesis can be more inexpensive, which is important when translating aptamers to
diagnostic and therapeutic applications.
These aptamers were selected using an adherent whole-cell SELEX approach using the cells in their
most natural state. Over the last decade, several aptamers have been developed using the whole-cell
SELEX approach on living cells, such as bacteria, immune cells and cancer cells (reviewed in [
79
–
82
]).
However, most of these approaches are complex, laborious and time-consuming. We designed a
protocol including high throughput NGS and bioinformatics analysis instead of traditional cloning and
subsequent sequencing. This approach allowed us to reduce the number of iterative selection rounds,
to only select high affinity sequences and to minimize the introduction of related sequences from PCR
artefacts [
25
,
32
,
33
,
83
]. This idea was supported by the report of Schütze et al. who demonstrated
that most clones that occur after round 5 are derivatives of strongly enriched clones, which can be
attributed to either mutation or sequencing artefacts [31,83].
Affinity and specificity of binding are two of the most important characteristics for aptamers in
oncology. High affinity is crucial for aptamers for efficient targeting and long tumor residence time.
The aptamers selected in this study have affinities in the low nanomolar range. However, high affinity
(<10 nM) is not always needed as it was demonstrated that a too high affinity restricts efficient tumor
penetration (so-called binding side barrier hypothesis) [
63
,
84
–
87
]. It should also be mentioned that the
affinity was estimated based on the kinetics of the aptamer-protein complex formation by SPRi, which
may not reflect the
in vivo
(cellular) situation. In particular, because we showed that aptamer HeA2_3
was internalized (and probably subsequently degraded in the endosomes), the dissociation constant

Pharmaceuticals 2016,9, 29 17 of 21
(Koff ) becomes pointless. Moreover, Kd values highly depend on the experimental method used and
must therefore be interpreted with caution [48].
Specificity may be of more value than affinity, as the specificity will drive both the potency of
the aptamer and its side effect profile. Therefore, we focused on demonstrating the specificity of
the aptamers selected in this study. To accomplish this, we set up binding assays using a variety of
cell lines, a transfected cell line and tumor tissue sections with different expression levels of HER2.
One of the best ways to actually visualize aptamer binding is by fluorescent microscopy. Our major
findings showed that the selected aptamers bind HER2-overexpressing cells in a highly specific and
competitive manner. These results show that both aptamers possess excellent targeting properties and
are therefore good candidates as tools for
in vitro
diagnostics. In addition, they can also be used for
in vivo
diagnostic applications, after coupling to a detectable moiety, such as diagnostic radionuclides
or contrast agents.
Interestingly, aptamer HeA2_3 was able to be internalized into HER2-overexpressing cancer
cells, which may be useful for the aptamer-mediated delivery of toxic payloads, such as drugs,
siRNA and radionuclides. Moreover, we showed that aptamers HeA2_1 and HeA2_3 possessed an
extra desirable feature for therapeutic applications because it retarded cell growth. We hypothesize
that the internalization of HER2 after aptamer binding may be involved in this growth retardation,
because internalization of receptors results in both short and long term loss of receptor activity and
because HER2-overexpressing cancer cells are highly dependent on HER2 signaling for survival and
proliferation [88–91].
In conclusion, our findings open up new possibilities for the development of a novel promising
therapeutic aptamer. In a next step, the
in vivo
therapeutic potential of this aptamer should be
investigated. Finally, its ability to replace (or complement) the existing HER2-targeting therapeutics,
by overcoming their drawbacks such as treatment resistance and cardiotoxicity, will need to be
demonstrated. In the end, this will provide new opportunities in personalized medicine, in particular
in the area of targeted cancer therapy.
Acknowledgments: Marlies Gijs was granted a SCK-CEN/ULg Ph.D. scholarship.
Author Contributions:
M.G. and G.P. conceived and designed the experiments with input from N.R.E.N.I, S.B.,
A.L. and A.M.A. Experiments were performed by M.G., G.P. and G.B.B. The manuscript was jointly written by
M.G. and G.P. Review and editing of the manuscript were conducted by all authors: M.G., G.P., G.B.B., N.R.E.N.I.,
S.B., A.L. and A.M.A.
Conflicts of Interest: The authors declare no conflict of interest.
References
1.
Slamon, D.J.; Clark, G.M.; Wong, S.G.; Levin, W.J.; Ullrich, A.; McGuire, W.L. Human breast cancer:
Correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science
1987
,235,
177–182. [CrossRef] [PubMed]
2.
Slamon, D.J.; Godolphin, W.; Jones, L.A.; Holt, J.A.; Wong, S.G.; Keith, D.E.; Levin, W.J.; Stuart, S.G.; Udove, J.;
Ullrich, A.; et al. Studies of the HER-2/neu proto-oncogene in human breast and ovarian cancer. Science
1989,244, 707–712. [CrossRef] [PubMed]
3.
Zhang, J.; Liu, Y. HER2 over-expression and response to different chemotherapy regimens in breast cancer.
J. Zhejiang Univ. Sci. B 2008,9, 5–9. [CrossRef] [PubMed]
4.
Musolino, A.; Ciccolallo, L.; Panebianco, M.; Fontana, E.; Zanoni, D.; Bozzetti, C.; Michiara, M.; Silini, E.M.;
Ardizzoni, A. Multifactorial central nervous system recurrence susceptibility in patients with HER2-positive
breast cancer: Epidemiological and clinical data from a population-based cancer registry study. Cancer
2011
,
117, 1837–1846. [CrossRef] [PubMed]
5.
Rouanet, P.; Roger, P.; Rousseau, E.; Thibault, S.; Romieu, G.; Mathieu, A.; Cretin, J.; Barneon, G.; Granier, M.;
Maran-Gonzalez, A.; et al. HER2 overexpression a major risk factor for recurrence in pT1a-bN0M0 breast
cancer: Results from a French regional cohort. Cancer Med. 2014,3, 134–142. [CrossRef] [PubMed]

Pharmaceuticals 2016,9, 29 18 of 21
6.
Fight HER2+ Breast Cancer with Herceptin. Available online: http://www.herceptin.com (accessed on
25 June 2015).
7.
Bartsch, R.; Wenzel, C.; Steger, G.G. Trastuzumab in the management of early and advanced stage breast
cancer. Biologics 2007,1, 19–31. [PubMed]
8.
Claret, F.X.; Vu, T.T. Trastuzumab: Updated mechanisms of action and resistance in breast cancer. Front. Oncol.
2012,2. [CrossRef]
9.
Sengupta, P.P.; Northfelt, D.W.; Gentile, F.; Zamorano, J.L.; Khandheria, B.K. Trastuzumab-induced
cardiotoxicity: Heart failure at the crossroads. Mayo Clin. Proc. 2008,83, 197–203. [CrossRef]
10.
Ulrich, H. RNA aptamers: From basic science towards therapy. In RNA towards Medicine; Erdmann, V.,
Barciszewski, J., Brosius, J., Eds.; Springer: Berlin/Heidelberg, Germany, 2006; Volume 173, pp. 305–326.
11.
Bouchard, P.R.; Hutabarat, R.M.; Thompson, K.M. Discovery and development of therapeutic aptamers.
Annu. Rev. Pharmacol. Toxicol. 2010,50, 237–257. [CrossRef] [PubMed]
12.
Hu, M.; Zhang, K. The application of aptamers in cancer research: An up-to-date review. Future Oncol.
2013
,
9, 369–376. [CrossRef] [PubMed]
13.
Barbas, A.S.; Mi, J.; Clary, B.M.; White, R.R. Aptamer applications for targeted cancer therapy. Future Oncol.
2010,6, 1117–1126. [CrossRef] [PubMed]
14.
Bruno, J.G. A review of therapeutic aptamer conjugates with emphasis on new approaches. Pharmaceuticals
2013,6, 340–357. [CrossRef] [PubMed]
15.
Meyer, C.; Hahn, U.; Rentmeister, A. Cell-specific aptamers as emerging therapeutics. J. Nucleic Acids
2011
,
2011. [CrossRef] [PubMed]
16.
Thiel, K.W.; Giangrande, P.H. Therapeutic applications of DNA and RNA aptamers. Oligonucleotides
2009
,
19, 209–222. [CrossRef] [PubMed]
17.
Keefe, A.D.; Pai, S.; Ellington, A. Aptamers as therapeutics. Nat. Rev. Drug Discov.
2010
,9, 537–550.
[CrossRef] [PubMed]
18. Weinberg, M.S. Therapeutic aptamers march on. Mol. Ther. Nucleic Acids 2014,3. [CrossRef] [PubMed]
19.
Sundaram, P.; Kurniawan, H.; Byrne, M.E.; Wower, J. Therapeutic RNA aptamers in clinical trials. Eur. J.
Pharm. Sci. 2013,48, 259–271. [CrossRef] [PubMed]
20.
Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage
T4 DNA polymerase. Science 1990,249, 505–510. [CrossRef] [PubMed]
21.
Ellington, A.D.; Szostak, J.W.
In vitro
selection of RNA molecules that bind specific ligands. Nature
1990
,346,
818–822. [CrossRef] [PubMed]
22.
Robertson, D.L.; Joyce, G.F. Selection
in vitro
of an RNA enzyme that specifically cleaves single-stranded
DNA. Nature 1990,344, 467–468. [CrossRef] [PubMed]
23.
Graham, J.C.; Zarbl, H. Use of cell-selex to generate DNA aptamers as molecular probes of HPV-associated
cervical cancer cells. PLoS ONE 2012,7, e36103. [CrossRef] [PubMed]
24.
Penner, G. Dubbles, an Alternative to Selex. Available online: https://www.youtube.com/watch?v=
rmpvqCX1WqA (accessed on 25 June 2015).
25.
Blind, M.; Blank, M. Aptamer selection technology and recent advances. Mol. Ther. Nucleic Acids
2015
,4.
[CrossRef]
26.
Pan, W.; Xin, P.; Patrick, S.; Dean, S.; Keating, C.; Clawson, G. Primer-free aptamer selection using a random
DNA library. J. Vis. Exp. 2010. [CrossRef] [PubMed]
27.
Pan, W.; Clawson, G.A. The shorter the better: Reducing fixed primer regions of oligonucleotide libraries for
aptamer selection. Molecules 2009,14, 1353–1369. [CrossRef] [PubMed]
28.
Marimuthu, C.; Tang, T.H.; Tominaga, J.; Tan, S.C.; Gopinath, S.C. Single-stranded DNA (ssDNA) production
in DNA aptamer generation. Analyst 2012,137, 1307–1315. [CrossRef] [PubMed]
29.
Le, L.C.; Cruz-Aguado, J.A.; Penner, G.A. DNA Ligands for Aflatoxin and Zearalenone. U.S. Patent
20,120,225,494, 6 September 2011.
30.
Penner, G. Detection Systems. Available online: http://neoventures.ca/products/mycotoxin-testing/
(accessed on 26 June 2015).
31.
Schütze, T.; Wilhelm, B.; Greiner, N.; Braun, H.; Peter, F.; Mörl, M.; Erdmann, V.A.; Lehrach, H.; Konthur, Z.;
Menger, M.; et al. Probing the SELEX process with next-generation sequencing. PLoS ONE
2011
,6, e29604.
[CrossRef] [PubMed]

Pharmaceuticals 2016,9, 29 19 of 21
32.
Cho, M.; Xiao, Y.; Nie, J.; Stewart, R.; Csordas, A.T.; Oh, S.S.; Thomson, J.A.; Soh, H.T. Quantitative selection
of DNA aptamers through microfluidic selection and high-throughput sequencing. Proc. Natl. Acad. Sci. USA
2010,107, 15373–15378. [CrossRef] [PubMed]
33.
Dausse, E.; Taouji, S.; Evade, L.; di Primo, C.; Chevet, E.; Toulme, J.J. HAPIscreen, a method for
high-throughput aptamer identification. J. Nanobiotechnol. 2011,9. [CrossRef] [PubMed]
34.
Thiel, W.H.; Bair, T.; Thiel, K.W.; Dassie, J.P.; Rockey, W.M.; Howell, C.A.; Liu, X.Y.; Dupuy, A.J.; Huang, L.;
Owczarzy, R.; et al. Nucleotide bias observed with a short SELEX RNA aptamer library. Nucleic Acid Ther.
2011,21, 253–263. [CrossRef] [PubMed]
35.
Kang, H.-S.; Huh, Y.-M.; Kim, S.; Lee, D.K. Isolation of RNA aptamers targeting HER2-overexpressing breast
cancer cells using cell-SELEX. Bull. Korean Chem. Soc. 2009,30, 1827–1831.
36.
Kim, M.Y.; Jeong, S.
In vitro
selection of RNA aptamer and specific targeting of ErbB2 in breast cancer cells.
Nucleic Acid Ther. 2011,21, 173–178. [CrossRef] [PubMed]
37.
Thiel, K.W.; Hernandez, L.I.; Dassie, J.P.; Thiel, W.H.; Liu, X.; Stockdale, K.R.; Rothman, A.M.; Hernandez, F.J.;
McNamara, J.O., 2nd; Giangrande, P.H. Delivery of chemo-sensitizing siRNAs to HER2+-breast cancer cells
using RNA aptamers. Nucleic Acids Res. 2012,40, 6319–6337. [CrossRef] [PubMed]
38.
Gupta, S.; Thirstrup, D.; Jarvis, T.C.; Schneider, D.J.; Wilcox, S.K.; Carter, J.; Zhang, C.; Gelinas, A.; Weiss, A.;
Janjic, N.; et al. Rapid histochemistry using slow off-rate modified aptamers with anionic competition.
Appl. Immunohistochem. Mol. Morphol. 2011,19, 273–278. [CrossRef] [PubMed]
39.
Liu, Z.; Duan, J.-H.; Song, Y.-M.; Ma, J.; Wang, F.-D.; Lu, X.; Yang, X.-D. Novel HER2 aptamer selectively
delivers cytotoxic drug to HER2-positive breast cancer cells
in vitro
.J. Transl. Med.
2012
,10, 148. [CrossRef]
[PubMed]
40.
Mahlknecht, G.; Maron, R.; Mancini, M.; Schechter, B.; Sela, M.; Yarden, Y. Aptamer to ErbB-2/HER2
enhances degradation of the target and inhibits tumorigenic growth. Proc. Natl. Acad. Sci. USA
2013
,110,
8170–8175. [CrossRef] [PubMed]
41.
Hu, Y.; Duan, J.; Cao, B.; Zhang, L.; Lu, X.; Wang, F.; Yao, F.; Zhu, Z.; Yuan, W.; Wang, C.; et al. Selection of a
novel DNA thioaptamer against HER2 structure. Clin. Transl. Oncol.
2015
,17, 647–656. [CrossRef] [PubMed]
42.
Ozer, A.; Pagano, J.M.; Lis, J.T. New technologies provide quantum changes in the scale, speed, and success
of SELEX methods and aptamer characterization. Mol. Ther. Nucleic Acids 2014,3. [CrossRef] [PubMed]
43.
Bishop, J.S.; Guy-Caffey, J.K.; Ojwang, J.O.; Smith, S.R.; Hogan, M.E.; Cossum, P.A.; Rando, R.F.;
Chaudhary, N. Intramolecular G-quartet motifs confer nuclease resistance to a potent anti-HIV
oligonucleotide. J. Biol. Chem. 1996,271, 5698–5703. [CrossRef] [PubMed]
44.
Casals, J.; Viladoms, J.; Pedroso, E.; Gonzalez, C. Structure and stability of a dimeric G-quadruplex formed
by cyclic oligonucleotides. J. Nucleic Acids 2010,2010. [CrossRef] [PubMed]
45. Breaker, R.R. DNA aptamers and DNA enzymes. Curr. Opin. Chem. Biol. 1997,1, 26–31. [CrossRef]
46.
Tucker, W.O.; Shum, K.T.; Tanner, J.A. G-quadruplex DNA aptamers and their ligands: Structure, function
and application. Curr. Pharm. Des. 2012,18, 2014–2026. [CrossRef] [PubMed]
47.
Kikin, O.; D’Antonio, L.; Bagga, P.S. QGRS mapper: A web-based server for predicting G-quadruplexes in
nucleotide sequences. Nucleic Acids Res. 2006,34, W676–W682. [CrossRef] [PubMed]
48.
Cload, S.T.; McCauley, T.G.; Keefe, A.D.; Healy, J.M.; Wilson, C. Properties of therapeutic aptamers. In The
Aptamer Handbook; Wiley-VCH Verlag GmbH & Co. KGaA: Weinheim, Germany, 2006; pp. 363–416.
49.
Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res.
2003
,
31, 3406–3415. [CrossRef] [PubMed]
50. The Unafold Web Server. Available online: http://mfold.rna.albany.edu/ (accessed on 25 June 2015).
51.
DeFazio-Eli, L.; Strommen, K.; Dao-Pick, T.; Parry, G.; Goodman, L.; Winslow, J. Quantitative assays for
the measurement of HER1-HER2 heterodimerization and phosphorylation in cell lines and breast tumors:
Applications for diagnostics and targeted drug mechanism of action. Breast Cancer Res.
2011
,13. [CrossRef]
[PubMed]
52.
Tolmachev, V. Imaging of HER2 overexpression in tumors for guiding therapy. Curr. Pharm. Des.
2008
,14,
2999–3019. [CrossRef] [PubMed]
53.
Subik, K.; Lee, J.F.; Baxter, L.; Strzepek, T.; Costello, D.; Crowley, P.; Xing, L.; Hung, M.C.; Bonfiglio, T.;
Hicks, D.G.; et al. The expression patterns of ER, PR, HER2, CK5/6, EGFR, Ki-67 and AR by
immunohistochemical analysis in breast cancer cell lines. Breast Cancer 2010,4, 35–41. [PubMed]

Pharmaceuticals 2016,9, 29 20 of 21
54.
Savinainen, K.J.; Saramaki, O.R.; Linja, M.J.; Bratt, O.; Tammela, T.L.; Isola, J.J.; Visakorpi, T. Expression
and gene copy number analysis of ErbB2 oncogene in prostate cancer. Am. J. Pathol.
2002
,160, 339–345.
[CrossRef]
55.
Hermanto, U.; Zong, C.S.; Wang, L.H. ErbB2-overexpressing human mammary carcinoma cells display an
increased requirement for the phosphatidylinositol 3-kinase signaling pathway in anchorage-independent
growth. Oncogene 2001,20, 7551–7562. [CrossRef] [PubMed]
56.
Ginestier, C.; Adelaide, J.; Goncalves, A.; Repellini, L.; Sircoulomb, F.; Letessier, A.; Finetti, P.; Geneix, J.;
Charafe-Jauffret, E.; Bertucci, F.; et al. ErbB2 phosphorylation and trastuzumab sensitivity of breast cancer
cell lines. Oncogene 2007,26, 7163–7169. [CrossRef] [PubMed]
57.
Magnifico, A.; Albano, L.; Campaner, S.; Delia, D.; Castiglioni, F.; Gasparini, P.; Sozzi, G.; Fontanella, E.;
Menard, S.; Tagliabue, E. Tumor-initiating cells of HER2-positive carcinoma cell lines express the highest
oncoprotein levels and are sensitive to trastuzumab. Clin. Cancer Res.
2009
,15, 2010–2021. [CrossRef]
[PubMed]
58.
Cuello, M.; Ettenberg, S.A.; Clark, A.S.; Keane, M.M.; Posner, R.H.; Nau, M.M.; Dennis, P.A.; Lipkowitz, S.
Down-regulation of the ErbB-2 receptor by trastuzumab (herceptin) enhances tumor necrosis factor-related
apoptosis-inducing ligand-mediated apoptosis in breast and ovarian cancer cell lines that overexpress ErbB-2.
Cancer Res. 2001,61, 4892–4900. [PubMed]
59.
Govindarajan, S.; Sivakumar, J.; Garimidi, P.; Rangaraj, N.; Kumar, J.; Rao, N.; Gopal, V. Targeting human
epidermal growth factor receptor 2 by a cell-penetrating peptide-affibody bioconjugate. Biomaterials
2011
,33,
2570–2582. [CrossRef] [PubMed]
60.
Lewis, G.; Figari, I.; Fendly, B.; Wong, W.; Carter, P.; Gorman, C.; Shepard, H. Differential responses of human
tumor cell lines to anti-p185HER2 monoclonal antibodies. Cancer Immunol. Immunother.
1993
,37, 255–263.
[CrossRef] [PubMed]
61.
Schnell, U.; Dijk, F.; Sjollema, K.A.; Giepmans, B.N. Immunolabeling artifacts and the need for live-cell
imaging. Nat. Methods 2012,9, 152–158. [CrossRef] [PubMed]
62.
Austin, C.D.; de Maziere, A.M.; Pisacane, P.I.; van Dijk, S.M.; Eigenbrot, C.; Sliwkowski, M.X.;
Klumperman, J.; Scheller, R.H. Endocytosis and sorting of ErbB2 and the site of action of cancer therapeutics
trastuzumab and geldanamycin. Mol. Biol. Cell 2004,15, 5268–5282. [CrossRef] [PubMed]
63.
Rudnick, S.I.; Lou, J.; Shaller, C.C.; Tang, Y.; Klein-Szanto, A.J.; Weiner, L.M.; Marks, J.D.; Adams, G.P.
Influence of affinity and antigen internalization on the uptake and penetration of anti-HER2 antibodies in
solid tumors. Cancer Res. 2011,71, 2250–2259. [CrossRef] [PubMed]
64.
De Goeij, B.E.; Peipp, M.; de Haij, S.; van den Brink, E.N.; Kellner, C.; Riedl, T.; de Jong, R.; Vink, T.;
Strumane, K.; Bleeker, W.K.; et al. HER2 monoclonal antibodies that do not interfere with receptor
heterodimerization-mediated signaling induce effective internalization and represent valuable components
for rational antibody-drug conjugate design. MAbs 2014,6, 392–402. [CrossRef] [PubMed]
65.
Pruszynski, M.; Koumarianou, E.; Vaidyanathan, G.; Revets, H.; Devoogdt, N.; Lahoutte, T.;
Lyerly, H.K.; Zalutsky, M.R. Improved tumor targeting of anti-HER2 nanobody through N-succinimidyl
4-guanidinomethyl-3-iodobenzoate radiolabeling. J. Nucl. Med. 2014,55, 650–656. [CrossRef] [PubMed]
66.
Wallberg, H.; Orlova, A. Slow internalization of anti-HER2 synthetic affibody monomer
111In-DOTA-ZHER2:342-pep2: Implications for development of labeled tracers. Cancer Biother. Radiopharm.
2008,23, 435–442. [CrossRef] [PubMed]
67.
Ahlgren, S.; Orlova, A.; Wallberg, H.; Hansson, M.; Sandstrom, M.; Lewsley, R.; Wennborg, A.; Abrahmsen, L.;
Tolmachev, V.; Feldwisch, J. Targeting of HER2-expressing tumors using 111In-ABY-025, a second-generation
affibody molecule with a fundamentally reengineered scaffold. J. Nucl. Med.
2010
,51, 1131–1138. [CrossRef]
[PubMed]
68.
Xiao, Z.; Levy-Nissenbaum, E.; Alexis, F.; Lupták, A.; Teply, B.A.; Chan, J.M.; Shi, J.; Digga, E.; Cheng, J.;
Langer, R.; et al. Engineering of targeted nanoparticles for cancer therapy using internalizing aptamers
isolated by cell-uptake selection. ACS Nano 2012,6, 696–704. [CrossRef] [PubMed]
69.
Chen, C.H.; Dellamaggiore, K.R.; Ouellette, C.P.; Sedano, C.D.; Lizadjohry, M.; Chernis, G.A.; Gonzales, M.;
Baltasar, F.E.; Fan, A.L.; Myerowitz, R.; et al. Aptamer-based endocytosis of a lysosomal enzyme. Proc. Natl.
Acad. Sci. USA 2008,105, 15908–15913. [CrossRef] [PubMed]

Pharmaceuticals 2016,9, 29 21 of 21
70.
Porciani, D.; Signore, G.; Marchetti, L.; Mereghetti, P.; Nifosi, R.; Beltram, F. Two interconvertible folds
modulate the activity of a DNA aptamer against transferrin receptor. Mol. Ther. Nucleic Acids
2014
,3.
[CrossRef] [PubMed]
71.
Veldhoen, S.; Laufer, S.D.; Restle, T. Recent developments in peptide-based nucleic acid delivery. Int. J.
Mol. Sci. 2008,9, 1276–1320. [CrossRef] [PubMed]
72.
Gourronc, F.A.; Rockey, W.M.; Thiel, W.H.; Giangrande, P.H.; Klingelhutz, A.J. Identification of RNA
aptamers that internalize into HPV-16 E6/E7 transformed tonsillar epithelial cells. Virology
2013
,446,
325–333. [CrossRef] [PubMed]
73.
Lodish, H.; Berk, A.; Kaiser, C.A.; Krieger, M.; Scott, M.P.; Bretscher, A.; Ploegh, H.; Matsudaira, P.
Molecular Cell Biology; W. H. Freeman: New York, NY, USA, 2000.
74.
Brockhoff, G.; Heckel, B.; Schmidt-Bruecken, E.; Plander, M.; Hofstaedter, F.; Vollmann, A.; Diermeier, S.
Differential impact of Cetuximab, Pertuzumab and Trastuzumab on BT474 and SK-BR-3 breast cancer cell
proliferation. Cell Prolif. 2007,40, 488–507. [CrossRef] [PubMed]
75.
Kim, S.Y.; Kim, H.P.; Kim, Y.J.; Oh do, Y.; Im, S.A.; Lee, D.; Jong, H.S.; Kim, T.Y.; Bang, Y.J. Trastuzumab
inhibits the growth of human gastric cancer cell lines with HER2 amplification synergistically with cisplatin.
Int. J. Oncol. 2008,32, 89–95. [CrossRef] [PubMed]
76.
Famulok, M.; Hartig, J.; Mayer, G. Functional aptamers and aptazymes in biotechnology, diagnostics, and
therapy. Chem. Rev. 2007,107, 3715–3743. [CrossRef] [PubMed]
77.
Kaur, G.; Roy, I. Therapeutic applications of aptamers. Expert Opin. Investig. Drugs
2008
,17, 43–60. [CrossRef]
[PubMed]
78.
QGRS Mapper. Available online: http://bioinformatics.ramapo.edu/QGRS/index.php (accessed on
25 June 2015).
79. Ohuchi, S. Cell-SELEX technology. BioRes. Open Access 2012,1, 265–272. [CrossRef] [PubMed]
80.
Zhang, Y.; Chen, Y.; Han, D.; Ocsoy, I.; Tan, W. Aptamers selected by cell-SELEX for application in cancer
studies. Bioanalysis 2010,2, 907–918. [CrossRef] [PubMed]
81.
Sefah, K.; Shangguan, D.; Xiong, X.; O’Donoghue, M.B.; Tan, W. Development of DNA aptamers using
cell-SELEX. Nat. Protoc. 2010,5, 1169–1185. [CrossRef] [PubMed]
82.
Ye, M.; Hu, J.; Peng, M.; Liu, J.; Liu, J.; Liu, H.; Zhao, X.; Tan, W. Generating aptamers by cell-SELEX for
applications in molecular medicine. Int. J. Mol. Sci. 2012,13, 3341–3353. [CrossRef] [PubMed]
83.
Thiel, W.H.; Bair, T.; Peek, A.S.; Liu, X.; Dassie, J.; Stockdale, K.R.; Behlke, M.A.; Miller, F.J., Jr.;
Giangrande, P.H. Rapid identification of cell-specific, internalizing rna aptamers with bioinformatics analyses
of a cell-based aptamer selection. PLoS ONE 2012,7, e43836. [CrossRef] [PubMed]
84.
Juweid, M.; Neumann, R.; Paik, C.; Perez-Bacete, M.J.; Sato, J.; van Osdol, W.; Weinstein, J.N.
Micropharmacology of monoclonal antibodies in solid tumors: Direct experimental evidence for a binding
site barrier. Cancer Res. 1992,52, 5144–5153. [PubMed]
85.
Fujimori, K.; Covell, D.G.; Fletcher, J.E.; Weinstein, J.N. A modeling analysis of monoclonal antibody
percolation through tumors: A binding-site barrier. J. Nucl. Med. 1990,31, 1191–1198. [PubMed]
86.
Van Osdol, W.; Fujimori, K.; Weinstein, J.N. An analysis of monoclonal antibody distribution in microscopic
tumor nodules: Consequences of a “binding site barrier”. Cancer Res. 1991,51, 4776–4784. [PubMed]
87.
Adams, G.P.; Schier, R.; McCall, A.M.; Simmons, H.H.; Horak, E.M.; Alpaugh, R.K.; Marks, J.D.; Weiner, L.M.
High affinity restricts the localization and tumor penetration of single-chain fv antibody molecules.
Cancer Res. 2001,61, 4750–4755. [PubMed]
88.
Witsch, E.; Sela, M.; Yarden, Y. Roles for growth factors in cancer progression. Physiology
2010
,25, 85–101.
[CrossRef] [PubMed]
89.
Fink, M.Y.; Chipuk, J.E. Survival of HER2-positive breast cancer cells: Receptor signaling to apoptotic control
centers. Genes Cancer 2013,4, 187–195. [CrossRef] [PubMed]
90.
Iqbal, N.; Iqbal, N. Human epidermal growth factor receptor 2 (HER2) in cancers: Overexpression and
therapeutic implications. Mol. Biol. Int. 2014,2014. [CrossRef] [PubMed]
91.
Neve, R.M.; Lane, H.A.; Hynes, N.E. The role of overexpressed HER2 in transformation. Ann. Oncol.
2001
,
12, S9–S13. [CrossRef] [PubMed]
©
2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC-BY) license (http://creativecommons.org/licenses/by/4.0/).