ArticlePDF Available

Rediscovery of Theloderma moloch (Amphibia: Anura: Rhacophoridae) from southeast Tibet, China after 102 years

Authors:

Abstract and Figures

Two individuals of Bug-eyed treefrogs were collected from Yarlung Zangbo Grand Canyon National Nature Reserve, Motuo County (= Medog), Linzhi Prefecture (=Nyingchi), Xizang Tibetan Autonomous Region (= Tibet), China in May 2014. According to our identification these treefrogs refer to Theloderma moloch (Annandale, 1912), which is the first rediscovery from China after 102 years since its description.
Content may be subject to copyright.
REDISCOVERY OF Theloderma moloch (AMPHIBIA: ANURA: RHACOPHORIDAE)
FROM SOUTHEAST TIBET, CHINA AFTER 102 YEARS
Cheng Li,1Mian Hou,1,2,4 Guo-hua Yu,3Fang Yan,3Bing-zhang Li,5
Ke Jiang,3Pi-peng Li,4and Nikolai L. Orlov6*
Submitted December 10, 2015.
Two individuals of Bug-eyed treefrogs were collected from Yarlung Zangbo Grand Canyon National Nature
Reserve, Motuo County (= Medog), Linzhi Prefecture (=Nyingchi), Xizang Tibetan Autonomous Region (= Tibet),
China in May 2014. According to our identification these treefrogs refer to Theloderma moloch (Annandale,
1912), which is the first rediscovery from China after 102 years since its description.
Keywords: Theloderma moloch; Xizang (Tibet); China; rediscovery.
INTRODUCTION
Currently genus Theloderma Tschudi, 1838 (bug-
eyed treefrogs) contains 27 species including Theloder-
ma albopunctatum (Liu et Hu, 1962), Theloderma ander-
soni (Ahl, 1927), Theloderma asperum (Boulenger,
1886), Theloderma baibengense (Jiang, Fei et Huang,
2009), Theloderma bicolor (Bourret, 1937), Theloderma
corticale (Boulenger, 1903), Theloderma gordoni Taylor,
1962, Theloderma horridum (Boulenger, 1903), Thelo-
derma kwangsiense (Liu et Hu, 1962), Theloderma laeve
(Smith, 1924), Theloderma lateriticum Bain, Nguyen et
Doan, 2009, Theloderma leporosum Tschudi, 1838, The-
loderma licin McLeod et Norhayati, 2007, Theloderma
margaritifer (Boulenger, 1882), Theloderma moloch
(Annandale, 1912) in question, Theloderma nagalanden-
se Orlov, Dutta, Ghate et Kent, 2006, Theloderma nebu-
losum Rowley, Le, Hoang, Dau et Cao, 2011, Theloder-
ma palliatum Rowley, Le, Hoang, Dau et Cao, 2011, The-
loderma petilum (Stuart et Heatwole, 2004), Theloderma
phrynoderma (Ahl, 1927), Theloderma pictum (Peters,
1871), Theloderma rhododiscus (Liu et Hu, 1962), The-
loderma ryabovi Orlov, Dutta, Ghate et Kent, 2006, The-
loderma spinosum (Taylor, 1920), Theloderma stellatum
Taylor, 1962, Theloderma truongsonense (Orlov et Ho,
2005), Theloderma vietnamense Poyarkov, Orlov, Moise-
eva, Pawangkhanant, Ruangsuwan, Vassilieva, Galoyan,
Nguyen et Gogoleva, 2015.
Frogs of this genus are distributed in Brunei, Cambo-
dia, China, India, Indonesia, Laos, Malaysia, Myanmar,
Singapore, Thailand, and Vietnam (Frost, 2016).
Theloderma moloch (Annandale, 1912), a poorly
known species in the genus Theloderma, since it is de-
scribed until 2014, has not been recorded again (Annan-
dale, 1912; Ahmed et al., 2009; Ao et al., 2003; Chanda
et al., 2000; Chanda, 2002; Das et al., 1998; Dinesh et al.,
2009; Dinesh et al., 2013; Dinesh et al., 2015; Dutta,
1997; Fei, 1999; Fei et al., 2009, 2010, 2012; Hu et al.,
1987; Mathew and Sen, 2010; Nguyen et al., 2009; Orlov
et al., 2006; Orlov and Ananjeva, 2007; Sarkar and Ray,
2006; Ye et al., 1993; Zhao and Adler, 1993; Zhao and
Adler, 2000). Several years ago a photo of treefrog was
published (Athreya, 2006); it is more close to a juvenile
of T. moloch or a new species. It was firstly identified as
Theloderma cf. asper and later as Theloderma sp. This
specimen was caught from Sessni (1250 m), Eaglenest
Wildlife Sanctuary, South Cona County (under control by
India in currently in region claimed by China) from Octo-
ber 2004 to May 2005 (Athreya, 2006). Recently, on 20
1026-2296/2016/2301-0041 © 2016 Folium Publishing Company
Russian Journal of Herpetology Vol. 23, No. 1, 2016, pp. 41 – 54
1Institute of Images Biodiversity Expedition, Beijing, Beijing Munici-
pality, 100107 China.
2Institute of Continuing Education, Sichuan Normal University,
Chengdu, Sichuan Province, 610068 China.
3State Key Laboratory of Genetic Resources and Evolution, Kunming
Institute of Zoology, Chinese Academy of Sciences, Kunming,
Yunnan Province, 650223 China.
4Institute of Herpetology, Shenyang Normal University, Shenyang,
Liaoning Province, 110034 China.
5Forestry Investigation, Planning and Research Institute of the Tibet
Autonomous Region, Lhasa, 850030 China.
6Zoological Institute, Russian Academy of Science, 1, Universitet-
skaya nab., St. Petersburg, 199034, Russia; e-mail: azemiops@zin.ru
*Corresponding author.
May 2015, Nandini Velho and Anjora Noronha shared
some images on wikimedia web, including life photos of
T. moloch in a pdf file named “Reptiles and amphibians
of Pakke Tiger Reserve” (http://pakketigerreserve.org/
?page_id=98). In 2009, Jia-tang Li and his colleagues
through molecular analysis questioned the status of
T. moloch and suggested that inclusion of this species
within Theloderma rendered this genus non-monophyle-
tic; this result is based on examination of a specimen
from Medog County, SE Tibet (tissue 6255Rao) which
they identified as T. moloch (Li et al., 2009, 2011). Then
some researchers used this point and DNA sequence, for
example Rowley et al. (2011) noted that at least basing
upon the existing molecular evidence “Thelodermamo-
loch is not a member of Theloderma; Pyron and Wiens
(2011) confirmed this result in their molecular tree based
on Genbank sequences, placing “Thelodermamoloch as
the sister taxon of Kurixalus +(Raorchestes +Pseudo-
philautus), Nguyen et al. (2015) also found that “T. mo -
loch” is not grouped together with other species of Thelo-
derma; Poyarkov et al. (2015) considered it forming
a monophyletic group with the remaining group of the
genus Theloderma and Nyctixalus. Thus the status of this
species is still in doubt from 2009 until now, and we can
not make this question clarified without additional study
of morphology and molecular analysis based on new
specimens due to the doubts of correct identification of
the tissue 6255Rao (Biju et al., 2016; Jiang et al., 2016).
During the Second Wild Animal Survey of Tibet in
April 2014, we collected two specimens of Theloderma
from Medog County, Linzhi Prefecture, southeastern
Xizang Tibetan Autonomous Region, and China. The re-
sults of morphological comparisons and molecular analy-
sis indicated these two specimens should be referred to T.
moloch, thus we describe the new specimens in detail and
consider the question of its status as below.
MATERIAL AND METHODS
Sampling. Specimens were collected in April 2014
by the first author, Cheng Li, from Medog County
(29°14¢24.35¢¢ N 95°11°10.73¢¢ E; 1360 m a.s.l.), South-
east Xizang Tibetan Autonomous Region, China. All pre-
served specimens fixed in 75% alcohol after preserving
muscle tissues in 95% alcohol. Specimens and tissue
samples are deposited at the Kunming Institute of Zool-
ogy, China with catalogue numbers KIZ014065 and
KIZ014066. These specimens were compared with speci-
mens of the other congeners and under comparisons on
the basis of literature descriptions (Table 1).
Museum abbreviations. KIZ, Kunming Institute of
Zoology, Chinese Academy of Sciences, Kunming,
China; ZSIC, Zoological Survey of India, Herpetology
Section, Fire-Proof Spirit Building, 27 JL Nehru Road,
Kolkata (formerly Calcutta), 700 016, India. Formerly
Indian Museum.
DNA sequencing. Genomic DNA was extracted
from muscle or liver tissue fixed in 99% ethanol. Tissue
samples were digested using proteinase K, and subse-
quently purified following a standard phenol/chloroform
isolation and ethanol precipitation. A fragment of mito-
chondrial 12S rRNA and 16S rRNAgenes was amplified
using primers L2519 (Richards, Moore, 1996) and 16Sbr
(Palumbi et al., 1991). PCR amplifications were per-
formed in 25 ìl rections using the following cycling con-
ditions: an initial denaturing step at 95°C for 4 min; 36
cycles of denaturing at 94°C for 45 sec, annealing at
50°C for 45 sec, and extending at 72°C for 45 sec; and a
final extending step of 72°C for 7 min. PCR products
were purified via spin columns. Sequencing was per-
formed directly using the corresponding PCR primers
and two internal primers (Table 2). DNA sequences of
both stands were obtained using the BigDye Terminator
v. 3.1 on an ABI PRISM 3730 following the manufac-
turer’s instructions.
Molecular analysis. Phylogenetic relationship was
constructed using maximum parsimony (MP) and
Bayesian inference (BI). The MP method was performed
in PAUP* v. 4.0b10 (Swofford, 2002) using heuristic
search with 1000 random-addition sequence replicates,
and gaps were treated as missing data. Support for nodes
of the resulting MP tree was assessed by analyses of 1000
bootstrap replicates (Felsenstein, 1985). BI analysis
was performed using MrBayes v. 3.1.2 (Huelsenbeck,
Ronquist, 2001), and two runs were performed simulta-
neously with four Markov chains starting from random
trees. The Markov chains were run for 2,000,000 genera-
tions and sampled every 100 generations, Convergence
was confirmed by plots of ln Lscores and low standard
deviation of split frequencies. Generations sampled be-
fore the chain reached stationarity were discarded as
burn-in, and the remaining trees were used to create a
50% majority-rule consensus tree and to estimate
Bayesian posterior probabilities (BPPs).
Morphology. All measurements were taken with
digital calipers to the nearest 0.01 mm and rounded to
0.1 mm. The following abbreviations are used:
1. Body and head: SVL, snout-vent length; AG,
axilla to groin, distance from posterior base of forelimb at
its emergence from body to anterior base of hindlimb at
its emergence from body; HL, head length from the rear
of the lower jaw to the tip of the snout; HW, head width at
the greatest cranial width; HD, head depth, greatest trans-
verse depth of head, taken beyond interorbital region;
FIOD, fore-interorbital distance; HIOD, hind-interorbital
42 Cheng Li et al.
distance; UEL, upper eyelid length: greatest diameter of
upper eyelid; SED, upper eyelid depth: greatest depth of
upper eyelid; OL, orbital length: the greatest diameter of
orbital; OD, orbital depth: the greatest depth of supra-
eyelid; TDH, horizontal diameter of tympanum; TDV,
vertical diameter of tympanum; ESL, tip of snout-eye
distance; TED, tympanum-eye distance from anterior
edge of tympanum to posterior corner of the eye; IND,
internarial distance: distance between nostrils; END, eye
to nostril distance: distance from anterior corner of eye to
nostril; MOP, mandible to posterior orbital, distance from
the posterior end of mouth to posterior edge of orbital;
MOA, mandible to orbital, distance from the posterior
end of mouth to anterior edge of orbital; MN, mandible to
nostril, distance from the posterior end of mouth to poste-
rior edge of orbital.
2. Forelimbs: FLL, length of forelimb from tip of
disk of finger III to axilla; ABL, length of antebrachium
from wrist to elbow joint; PL, length of Palm tip of disk
of finger III to wrist; FD1, wide of first finger disk, great-
est wide of disk on first finger; FD2, wide of first second
disk, greatest wide of disk on second finger; FD3, wide of
third finger disk, greatest wide of disk on third finger;
FD4, wide of forth finger disk, greatest wide of disk on
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 43
TABLE 1. Samples Used in This Study
Species Voucher Locality GenBank Accession Nos.
Sequence Source (16s/12s)
Theloderma asperum VNMN J 2888 Tam Dao, Vin Phu, Vietnam LC012853/LC012853
Theloderma asperum VNMN 4404 Ngoc Linh, Kon Tum, Vietnam LC012854/LC012854
Theloderma asperum VNMN 4405 Kon Ka Kinh, Gia Lai, Vietnam LC012855/LC012855
Theloderma asperum VNMN 4406 Xuan Lien, Thanh Hoa, Vietnam LC012856/LC012856
Theloderma asperum VNMN PAE 262 Ta, Son La, Vietnam LC012857/LC012857
Theloderma baibengense YPX31940 Medog, Tibet KU981089
Theloderma bicolor VNMN 3536 Lao Cai, Vietnam KJ1802915/KJ1802915
Theloderma corticale AMNH A 161499 Tam Dao, Vin Phu, Vietnam DQ283050/DQ283050
Theloderma corticale VNMN 3556 Tam Dao, Vietnam LC012841
Theloderma chuyangsinense NAP 2735 Daklac, Vietnam LC012843/LC012843
Theloderma gordoni VNMN 4407 Ngoc Linh, Kon Tum, Vietnam LC012852/LC012852
Theloderma horridum KUHE 52582 Kenaboi, Negeri Sembilan, Malaysia LC012861/LC012861
Theloderma laeva VNMN 4403 Mang Yang, Gia Lai, Vietnam LC012846/LC012846
Theloderma lateriticum VNMN 1216 Yen Tu, Bac Giang, Vietnam LC012851/LC012851
Theloderma leporosum LJT W46 Malaysia KC465841/KC465841
Theloderma licin KUHE 19426 Nakon Sri Tamarat, Tailand LC012859/LC012859
Theloderma moloch 6255Rao Motuo, Xizang (= Medog, Tibet) GQ285679/GQ285679
Theloderma moloch YPX31941 Medog, Tibet This study
Theloderma petilum HNUE MNA 2012.0001 Muong Nhe, Dien Bien, Vietnam KJ802925/KJ802925
Theloderma rhododiscus CIB GX200807017 Guangxi, China LC012842/LC012842
Theloderma ryabovi VNMN 3924 Mang Canh, Kon Tum, Vietnam LC012860/LC012860
Theloderma stellatum KUHE 22056 Mae Yom, Thailand LC012862/LC012862
Theloderma truongsonense VNMN 4402 Hon ba, Khanh Hoa, Vietnam LC012847/LC012847
Buergeria buergeri AF458122/AF458122
Gracixalus gracilipes 060821196Rao Pingbian, Yunnan, China GQ285668/GQ285668
Liuixalus hainanus LJT V15 Hainan, China KC465826/KC465826
Nyctixalus pictus FMNH 231094 AF458135/AF458135
Nyctixalus spinosus ACA 940 AF458136/AF458136
TABLE 2. Primers Used for PCR Amplification and Sequencing in This Study
Locus Primer Primer sequence 50 – 30 Temperature, °C References
12S L2519 AAACTGGGATTAGATACCCCACTAT 55°C Richards and Moore 1996
12S H3296 GCTAGACCATKATGCAAAAGGTA 55°C Richards and Moore 1996
16S 16SAR CGCCTGTTTAYCAAAAACAT 55°C Palumbi et al. (1991)
16S 16SBR CCGGTYTGAACTCAGATCAYGT 55°C Palumbi et al. (1991)
forth finger; FFL1, first finger length; FFL2, second fin-
ger length; FFL3, third finger length; FFL4, forth finger
length; IMPL, inner metacarpal tubercle length.
3. Hindlimbs: HLL, length of hindlimb from tip of
disk of toe IV to groin; FL, femur length; TL, tibia
length; FOT, length of hindlimb from tip of disk of toe IV
to posterior edge of tibia; TD1, wide of first toe disk,
greatest wide of disk on first toe; TD2, wide of second toe
disk, greatest wide of disk on second toe; TD3, wide
of third toe disk, greatest wide of disk on third toe; TD4,
wide of forth toe disk, greatest wide of disk on forth toe;
TD5, wide of second fifth disk, greatest wide of disk
on fifth toe; FTL1, first toe length; FTL2, second toe
length; FTL3, third toe length; FTL4, forth toe length;
FTL5, fifth toe length; IMTL, length of inner metatarsal
tubercle.
Roman figures refer to the fingers and toes, and
the Arabic numbers refer to the number of subarticular
tubercles and phalanges: I, inner side; e, exterior side of
phalanges.
TAXONOMY AND NOMENCLATURE
Theloderma moloch (Annandale, 1912)
Phrynoderma moloch Annandale, 1912, Rec. Indian Mus.,
8:18 – 19, 25 – 27, Plate III-4, IV-6.
Rhacophorus (Phrynoderma)moloch — Ahl, 1931, Das
Tierreich, 55:60.
Rhacophorus (Rhacophorus)leprosus moloch — Wolf, 1936,
Bull. Raffles Mus., 12:158.
Nyctixalus moloch — Dubois, 1981, Monit. Zool. Ital. Nov.
Ser. Suppl., 15:257.
Theloderma moloch — Inger In Frost, 1985, Amph. Species
World: 550;
Theloderma moloch — Hu, 1987, Zhao, Jiang, Fei, Ye, Hu,
Huang, Huang, Tian, 1987. Amph. Rept. Xizang:
102 – 103.
Theloderma moloch — Fei, Ye, and Huang, 1990, Key to Chi-
nese Amph.: 183;
Theloderma moloch — Ye, Fei, and Hu, 1993. Rar. Econ.
Amph. China: 324.
Theloderma moloch — Zhao and Adler, 1993, Herpetol.
China: 160;
Theloderma moloch — Das and Dutta, 1998, Hamadryad,
23:67;
Theloderma moloch — Chanda, Das and Dubois, 2000, Hama-
dryad,25(2): 113.
Theloderma moloch — Chanda, 2002, Handb. Indian Amph.:
182.
Theloderma moloch — Orlov, Dutta, Ghate et Kent, 2006,
Russ. J. Herpetol.,13(2):135 – 154.
Theloderma moloch — Orlov and Ananjeva, 2007, Amphib-
ians of South-East Asia, 309:143 (1 – 269).
Theloderma cf. asper — Athreya, 2006, Eaglenest Biodiv.
Proj.: 139, 154.
Theloderma moloch — Fei, Ye, and Huang, 2009,
Thelodermamoloch — Li, Che, Murphy, Zhao, Zhao,
Rao and Zhang, 2009, Mol. Phylogen. Evol.,
53:509 – 522.
Theloderma moloch — Orlov, Ryabov, Ananjeva and
Evsyunin, 2010, Zool. Inst. Russ. Acad. Sci.: 33.
Theloderma moloch — Li, Zhao and Dong, 2010, Amph. Rept.
Tibet: 73.
Theloderma moloch — Mathew and Sen, 2010. Picto. Gui.
Amphi. Nor. Eas. India: 121.
Thelodermamoloch — Li, Rao, Murphy and Zhang, 2011,
Asian Herpetol. Res.,3,2(1): 1 – 11.
Thelodermamoloch — Pyron and Wiens, 2011, Mol.
Phylogen. Evol., 61:543 – 583
Thelodermamoloch — Rowley, Le, Hoang, Dau and Cao,
2011, Zootaxa, 3098:1 – 20.
Thelodermamoloch — Frost, 2013, Amph. Spec. World.
Vers. 6 (25 June 2013).
Thelodermamoloch — Frost, 2014, Amph. Spec. World.
Vers. 6 (25 December 2014).
Theloderma moloch — Frost, 2016, Amph. Spec. World. Vers.
6(18 February 2016).
English name. Tibetan Bug-eyed Frog, Assam Indo-
nesian Treefrog (Frank and Ramus, 1995; Wrobel, 2004;
Gururaja and Bhatta, 2009; Li, Zhao, and Dong, 2010),
Eerie Tree Frog (Das and Dutta, 1998; Mathew and Sen,
2010; Li, Zhao, and Dong, 2010), Xizang Warty Treefrog
(Fei, 1999), Black-spotted Frog (Chanda, 2002).
Chinese name. (Zàng Léng Pí Shù
)
Type specimens. Two syntypes (ZSIC 16951,
16952) by original designation.
New finding specimens. Two females (KIZ 014065,
014066).
Type locality. “Upper Renging, 2,150 ft. [655.32 m]:
5 10 Jan., 1912),” “Abor country, Arunachal Pradesh,
India (in region claimed by China)]” (Frost, 2016). About
28°30¢N 95°00¢E in south Motuo County, Linzhi Pre-
fecture, southeastern Xizang Tibetan Ethnicity Autono-
mous Region, China (it is controlled by India as a part of
Arunachal Pradesh, in region claimed by China (https:
//en.wikipedia.org/wiki/Médog County)
Etymology. The specific epithet is derived from
Hebrew Molech, a god of the Canaanites and Phoeni-
cians to whom parents sacrificed their children (Beolens
et al., 2013).
Diagnosis. medium-sized frog in genus Theloderma;
canthus prominent; fore interorbital distance 81.90% or
almost equal of upper eyelid, hind interorbital distance at
least 0.9 of length of upper eyelid; orbital length slightly
longer or shorter than tip of snout-eye distance; tympa-
num distinct; vomerine teeth present; tongue notched be-
hind; fingers slightly webbed, toes almost four-fifths
webbed; tips of all digits dilated but all considerably
smaller than tympanum except the third fingers; subarti-
44 Cheng Li et al.
cular tubercles large; the wrist much exceed the tip of
snout or between the snout and the eyes; have long
ovaled inner palmar tubercles and indistinct rounded
small outer palmar tubercles; tibiotarsal articulation
reaches to the tip of snout; an small oval inner metatarsal
tubercle; no outer tubercle apparent; skin above very
rough with large irregular tubercular ridges and warts,
ventral surface granular; above brown or coffee ground
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 45
Fig. 1. Bayesian tree of Theloderma based on 1962 bp of 12S rRNA and 16S rRNA. The nodal numbers above and under the branches are BPP and
MP bootstrap values (only values above 50% are shown), respectively.
and mottled cream warts, bluish-white and dark mauve
patterns, venter dark purple mottled and reticulated with
white patterns.
DESCRIPTION OF NEW SPECIMENS
Habitus rather stout, flattened, medium-sized frog of
genus Theloderma.
Head large, very strongly depressed; snout truncate,
tip slightly concave (ESL 13.75% of SVL), have dis-
tinctly ridges, projecting beyond mandible, mouth
extending beyond the middle of tympanum; canthus
prominent, loreal region oblique and slightly concave;
HL 37.42% of SVL, longer than width or slightly wider
than long (HW 36.54% of SVL; HL 98.30% of HW or
HW 93.53% of HL; HD 43.65% of HL); inferior aspect
of snout not nicked, notch in inner margin of tip of man-
dible absent; eye large (OL 36.61% of HL); nostril
pointed, oval, cut in lateral direction inside the rather en-
larged tubercle on the tip of snout, nostrils nearer to tip of
the snout than to eyes (END 73.22% of ESL), internarial
area narrow and concave (IND 76.70% of OL); eye to
nostril distance distinctly less than eye diameter (END
73.47% of OL); pupil circular; upper eyelid slightly lon-
ger or shorter than the anterior interorbital and distinctly
smaller than posterior interorbital (FIOD 98.62% OF
UEL or UEL 87.46% of FIOD; UEL 75.87% of HIOD;
HIOD 47.56% of HW); tympanum distinctly less than
the eye diameter and almost equal the wide of third finger
disk (TDH 64.03% of OL; TDH 93.66% of FD3 or FD3
95.26% of TDH), separated from eye by distance (TED)
57.37% of tympanum length(TDH); supratympanic fold
absent; vomerine teeth in two small oblique groups be-
tween the choanae and widely separated from each other;
tongue large (almost occupied 1.3 times of mouth size),
pyriform, dorsal surface smooth, weakly bifid and free
posteriorly (Fig. 2).
Body flattened and stout, have a slightly concave
area on central, largest ridges and tubercles on foreback
area; distance from gular to the lower edge of the vent is
62.58% of the length between the latter and tip of snout;
distance from axilla to groin is 58.00% of SVL; distance
between axilla to groin is 92.68% of the length from
gular to the lower edge of the vent (Fig. 3).
Forelimbs moderate strong and long, 78.39% of
SVL, much shorter than hindlimbs (FLL 52.62% of
HLL), the wrist much exceed the tip of snout or between
the snout and the eyes when the forelimbs adpressed are
carried forward; relative length of fingers: I < II < IV <
III; finger tips dilated into large, rounded and flattened
disks, with grooves separating dorsum of disks from
venter; larger digital disk on finger III (FFL3 28.55% of
FLL), smallest on first finger (FFL1 12.87% of FLL);
subarticular tubercles large and distinct, without indis-
tinct supernumerary tubercles; formula of subarticular tu-
bercles: 1, 1, 2, 2; inner palmar tubercles developed, oval
and long, and have a indistinct outer palmar tubercle,
rounded and small; outer side of fourth finger fringed
which outer edge distinctly serrated; webbing between
fingers slightly developed, about 50% between base up to
proximal subarticular tubercles (Fig. 4).
Hindlimbs strong and long, about 2 times length of
forelimb and closely twice larger than body length (FLL
52.62% of HLL; SVL 67.12% of HLL); TL 43.31% of
SVL; FOT 59.73% of SVL; FL 45.95% of SVL; tibio-tar-
sal articulation reaching the tip of snout when hindlimbs
adpressed are carried forward; toes webbed, relative
length I < II < V < III < IV (FTL1 16.76% of SVL and
11.25% of HLL; FTL4 40.96% of SVL and 27.49% of
HLL); toes with rounded disks, tips of toes dilated into
flattened disks with grooves that separate dorsum of
disks from ventrum, smaller than the ones on fingers;
large subarticular tubercles roundish: 1, 1, 2, 3, 2; small
inner metatarsal tubercle ovaled and raised (IMTL
25.78% of FTL1); without outer metatarsal tubercle;
have small warts on the inner aspect of metatarsal area;
outer side of fifth toe fringed which outer edge distinct-
ly serrated; webs between toes well developed:
I(0)-(0)II(0)-(1)III(0)-(0)IV(1)-(0)V (Fig. 5).
46 Cheng Li et al.
Fig. 2. Lateral, mouth, and dorsal close-up view of the head of specimen KIZ-014066. Photographs by Mian Hou.
Skin above very rough with large irregular gland
ridges and warts studded with small granules, on top of
each supraorbital have a distinct horned tubercles, have
4 – 5 enlarged tubercles around or behind the tympanum,
and 5 6 enlarged tubercle ridges between head and
body, 3 4 irregular on occipital, another two continu-
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 47
Fig. 3. Dorsal, lateral, and ventral view of the specimen KIZ-014065. Photographs by Mian Hou.
Fig. 4. Forelimbs of specimen KIZ-014066: close-up view of the left hand and ventral view of the right hand. Photographs by Mian Hou.
ously ridges Ë-like shaped on foreback; lateral parts
smooth, slightly granular; large conical tubercles on the
back of the thighs near the vent; irregular enlarged trans-
verse ridge of tubercles on limbs; ventral surface smooth
with thickend flat granules (Fig. 6).
Color. The ground coloration of dorsum is cof-
fee-brown, with irregular black patterns on the crown;
some light brown or reddish brown enlarged tubercular
ridges on the occipital and tympanic area; dark purple en-
larged tubercular ridges on back; elongate black band on
Ë-like shaped foreback which; from wrists to central
forelimbs crosses 2 3 black band, all the ridges and
conical tubercles on band dark purple, other conical tu-
bercles light brown; a broad black band with bluish-gray
edge transverse central hindlimbs, the enlarged tubercle
ridges dark purple, other tubercles light brown; the part
between axilla and crotch clouded, have some irregular
dark purple and black patterns which spasmodically have
bluish-gray edge, a large white pattern behind axilla, and
a enlarged black or dark purple pattern on waist with 2 ir-
regular enlarged white patterns on each side, tip of some
small tubercles whitish; cloacae area cream or whitish,
some irregular black patterns above the vent, the conical
tubercles around the vent light brown, but tip whitish;
more white speckles diffused on opisthenars, have two
dark brown band, some vermeil tubercles on third and
fourth fingers, above disks dark bluish violet; ground
color of insteps and webs bluish violet, more white
speckles diffused on it, every section of toes have dark vi-
olet broad band with whitish side, these bands linked
through the web, some vermeil tubercles on out side of
fourth and fifth toes, above disks dark bluish violet; ven-
tral surface dark bluish violet, have more irregular white
patterns and speckles on it (Figs.4–6).
Measurements of KIZ-014065/66 (in mm): SVL
46.3/39.6; HL 16.2/15.9; HW 16.5/14.9; HD 7.2/6.8;
MN 14.0/13.0; MOA 7.9/7.4; MOP 12.1/11.2; SED
5.2/4.0; UEL 5.5/5.8; OL 5.7/6.1; OD 5.1/5.0; FIOD
6.3/5.7; HIOD 8.7/6.2; IND 5.2/3.8; END 4.8/3.9; ESL
6.4/5.4; TDH 4.4/3.1; TDV 3.8/2.8; TED 2.6/1.8; AD
48 Cheng Li et al.
Fig. 5. Hindlimbs of specimen KIZ-014066: A, Close-up view of the of the thighs; B, posterior view of the of the thighs; C, Close-up view of the
right foot; D, ventral view of the right foot. Photographs by Mian Hou.
27.4/22.4; FLL 37.8/29.5; ABL 10.9/10.4; PL
16.9/14.3; FFL1 4.8/3.9; FFL2 6.4/5.4; FFL3 10.6/8.6;
FFL4 8.3/6.7; FD1 2.3/2.0; FD2 3.5/2.9; FD3 4.2/3.3;
FD4 3.8/3.2; IMPL 2.5/2.8; HLL 73.9/54.0; TL
20.0/17.2; FOT 33.1/18.1; FL 20.8/18.6; FTL1 8.2/6.2;
FTL2 10.4/7.9; FTL3 13.6/13.2; FTL4 19.1/16.1; FTL5
9.4/9.0; TD1 2.4/2.1; TD2 2.7/2.6; TD3 2.9/2.7; TD4
3.2/2.8; TD5 3.1/2.6; IMTL 1.9/1.8.
Molecular analyses. Both MP and BI analysis of
molecular data supported that Theloderma moloch
(YPX31941) is the sister taxon to Theloderma ryabovi
(100 and 100%, respectively), and “Theloderma moloch
(6255Rao) was not in the clade of Theloderma (Fig. 1).
Variation. Annandale (1912) recorded as “...No
supratympanic...” and “...external and internal subcarpal
tubercles indistinct...,” which is different from our speci-
mens. Ours have intermittent supratympanic which is
shaped by some small ridged tubercles, and have a long
oval inner palmar tubercle and an indistinct rounded
small outer palmar tubercle on each palm (Fig. 7).
Distribution. Currently known only from southeast-
ern Himalayan Region with four localities: one in north
Medog (Beibeng Town) under control by China, the other
three in south Medog (Upper Renging) and two localities
in Cuona County (= Tsona) (Eaglenest Wildlife Sanctu-
ary [Sessni] and Pakke Tiger Reserve [Seijosa]) under
control by India in Arunachal Pradesh, in region claimed
by China (Fig. 8). Biju et al. (2016) provided a new local-
ity as ‘Namdapha, Arunachal Pradesh’, where on the
southeast side at the upper reaches of Brahmaputra River,
NW Arakan Mountain Range, we are not include this in-
formation in the locality list of T. moloch provisionally,
because this locality not in the Himalyan Region and
without any photos can make identification, soon after
the molecular analysis will figure it out the connection
between this population and Medog population, thus we
can make it in clear.
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 49
Fig. 6. Skin and color view of dorsal, lateral (include axilla and groin) and ventral part of the specimen KIZ-014066. Photographs by Mian Hou.
Natural history. Our new specimens caught on 6th of
April 2014, at 1360 m elevation, ambient temperature
about 18 20°C, it is covered by thickened montane
tropical primitive rain forest. It has rich lichen at there, a
individual is creepy on the lichened trunk, another one in
a bamboo cave, and has 0.15 m water depth inside, much
defoliations under water, none tadpole was found
(Fig. 9).
Conservation. IUCN status is Vulnerable (VU), de-
clared by India (Dinesh et al., 2013). Species is not in Na-
tional Protect Animal List of China, also has not been
evaluated in Chinese Red List (Zhao, 1998; Wang and
Xie, 2009), because of lacking the population data of this
species. As there have some highway building activities
in Medog County, apparently they may really hurt the
habitat of T. moloch, besides more and more tourists visit
there in currently, even some hobbyists make special trip
to there catching amphibians and reptiles, so we strongly
suggest make this rare and restricted distribution species
on the Chinese Red List and promote its status as
Endangerd (EN).
Remarks. Our locality is from about 190 km up-
stream of Yalung Zangbo River with type locality,
straight line distance between these two places is about
80 km, where environments, climates and altitudes are
much closed. Important that our locality is first record of
50 Cheng Li et al.
Fig. 7. A, the intermittent supratympanic of the specimen KIZ-014066; B, the intermittent supratympanic of the specimen KIZ-014065; C, the long
ovaled inner palmar tubercle of the specimen KIZ-014066; D, the indistinct rounded small outer palmar tubercle of the specimen KIZ-014066.
Photographs by Mian Hou.
T. moloch in the east side of Yalung Zangbo River, that
promises a new perspective to study distribution and
bionomics in the future. Besides, we had no chance to
check and make measurements of the Athreya’s speci-
men from Eaglenest (Athreya, 2006), but it is possible
that this uncertain specimen refers to T. moloch complex.
DISCUSSION
All the references support the view that Theloderma
moloch (Annandale, 1912) should be put in genus
Theloderma (Annandale, 1912; Athreya, 2006; Chanda
et al., 2000; Fei et al., 2009; Hu et al., 1987; Li, et al.,
2010; Mathew and Sen, 2010; Orlov et al., 2006; Orlov
and Ananjeva, 2007; Orlov et al., 2010; Wolf, 1936; Ye et
al., 1993; Zhao and Adler, 1993) especially two sources
with color photos of type specimen of T. moloch
(Mathew and Sen, 2010; Lost amphibians of India, 2010
[web]). Since Li et al. (2009) doubted its status; since it is
in questioning until now. The latest research show that
the earlier considered as “Theloderma moloch” (larva
voucher 6225Rao) from Li et al. (2009, 2011) nested
within the newly described genus Frankixalus Biju,
Senevirathne, Garg, Mahony, Kamei, Thomas, Shouche,
Raxworthy, Meegaskumbura, and Van Bocxlaer, 2016
(Biju et al., 2016), whereas Jiang et al. (2016) refer this
problematic specimen 6255Rao together with new speci-
men KIZ016395 China: Medog, Tibet to new genus and
species of treefrog Nasutixalus medogensis.
Tschudi (1838) designated the diagnosis of genus
Theloderma by Latin as: “Head very large, trigonal;
snout triangular; nares at the tip of canthus rostralis, pal-
ate teeth very few (three ends); tongue large, behind com-
plete, tip longer; the end of digits enwrap in disked man-
ger; plantar palmated; covered rugged skin, many trian-
gles and oblong nipples, ends sharp; tympanum latent.”
And he mentioned it in same book by German as: “This
very special new genus was caught by Mr. Müller on Su-
matra and is shown in his “Observations Zoologiques” on
a table and described. It is so far the only Hyla with such
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 51
Fig. 8. Geographic distribution of Theloderma moloch. There are four locations on Medog and Cuona Counties: blue pentacle is the type locality
Upper Renging, and the three blue circles are the only known localities out of the type locality where as Beibeng Town, Medog and Eaglenest Wild-
life Sanctuary, Cona.
a kind of cover on the body. The skin on the upper part of
the body is like at in the exotic toad Bufo asper or scaber
with strong angular and acuminated warts.” In compari-
son with descriptions given above, our specimens and
type specimen on the photo of T. moloch clearly demon-
strate the morphological characters of genus Theloderma.
On the other hand, Annandale noted that the adult
specimens of T. moloch were caught near the side of a
tree hole with deep water together with some their tad-
poles in treehole (Annandale, 1912). The habitat of our
specimens almost the same as in the record of Annandale,
their behavior also correspond other Theloderma species
(Taylor, 1962; Orlov, 1997; Malkmus et al., 2002;
Grosjean et al., 2008). Moreover we never have seen
other continental treefrogs with such behavior in the na-
ture except the species of genus Theloderma and Nasuti-
xalus (Frankixalus [be the Junior synonym of Nasutixa-
lus due to the publish time latish]) (Jiang et al.,2016; Biju
et al., 2016).
Molecular analysis shown the both MP and BI analy-
sis supported that Theloderma moloch (YPX31941) is
the sister taxon to Theloderma ryabovi (100 and 100%,
respectively), and “Theloderma moloch” (6255Rao) was
not in the clade of Theloderma which indicate this speci-
men based on a wrong identification in Li et al. (2009,
2011).
On the base of considerations given above about
T. moloch status, we strongly recommend to be careful in
taxonomic identification or conclusion especially in
results of molecular studies if there are not complete
morphological evidences or other detailed studies to
avoid chaotic taxonomical and unstable nomenclature
problems.
Acknowledgments. We are grateful to Liang Fei (Chengdu
Institute of Biology, CAS) for help with the morphological
study, Yun-lei Lue, Wu-lin Liu, Jian-pu Wu, and the other col-
leagues (Forestry Investigation, Planning and Research Insti-
tute of the Tibet Autonomous Region) for field work organiza-
tion and survey, Liang Guo and Bin Cheng (Institute of Images
Biodiversity Expedition) for field survey, Jie-qiong Jin
(Kunming Institute of Zoology, CAS) helped for molecular
experiment, Gernot Vogel (Society for Southeast Asian Herpe-
tology) helped with the translation of old German description,
Dr. Axel Hernandez (University of Corsica Pasquale Paoli)
helped with the translation of old Latin description, and Dr.
52 Cheng Li et al.
Fig. 9. The habitat of Theloderma moloch on Beibeng Town, Medog County: A, the holistic habitat; B, the microhabitat; C, an individual on the
lichened trunk; D, another one in a bamboo cave. Photographs by Cheng Li.
Ding-qi Rao for providing his Tibetan specimen. This work was
supported by a grant from the National Natural Science Foun-
dation of China (30970315), a grant from the Ministry of Sci-
ence and Technology of China (Grant No. 2014FY210200)
and Program for Liaoning Excellent Talents in University
(2008RC48) to Pi-peng Li and by grants of the Ministry of Sci-
ence and Technology of China (MOST 2014FY210200;
2011FY120200), the Strategic Priority Research Program (B)
(XDB03030113) of the Chinese Academy of Sciences, and the
Animal Branch of the Germplasm Bank of Wild Species, Chi-
nese Academy of Sciences (the Large Research Infrastructure
Funding) to Jing Che. The partial support was directed by the
Russian Foundation of Basic Research (Grant No. RFBR
15–04-02029a to Nikolai Orlov).
REFERENCES
Ahl E. (1927), “Zur Systematik der asiatischen Arten der
Froschgattung Rhacophorus,” Sitzungsber. Gesellschaft
Naturforsch. Freunde zu Berlin,15,35–47.
Ahl E. (1931), “Amphibia, Anura III, Polypedatidae,” Das
Tierreich,55.
Ahmed M. F., Das A., and Dutta S. K. (2009). Amphibians
and Reptiles of Northeast India — A Photographic Guide,
Aaranyak, Guwahati, India.
Annandale N. (1912), “Zoological results of the Abor Expedi-
tion, 1911 – 1912. I. Amphibia,” Rec. Indian Mus.,8,7–
– 36.
Ao J. M., Bordoloi S., and Ohler A. (2003), “Amphibian
fauna of Nagaland with nineteen new records from the state
including five new records for India,” Zoos’ Print J.,18,
1117 – 1125.
Athreya R. (2006), Eaglenest Biodiversity Project (2003 –
– 2006): Conservation Resources for Eaglenest Wildlife
Sanctuary, Kaati Trust, Pune, web-version.
Bain R. H., Nguyen T. Q., and Doan K. V. (2009), “A new
species of the genus Theloderma Tschudi, 1838 (Anura:
Rhacophoridae) from northwestern Vietnam,” Zootaxa,
2191,58–68.
Biju S. D. Senevirathne G., Garg S., Mahony S., Ka-
mei R. G., Thomas A., Shouche Y., Raxworthy C. J.,
Meegaskumbura M., and van Bocxlaer I. (2016),
Frankixalus, a New Rhacophorid Genus of Tree Hole
Breeding Frogs with Oophagous Tadpoles,” PLoS ONE,
11(1), e0145727; doi: 10.1371/journal.pone.0145727
Beolens B., Watkins M., and Grayson M. (2013), The Epo-
nym Dictionary of Amphibians, Pelagic Publishing, Milton
Keynes, UK.
Boulenger G. A. (1886), “First report on additions to the batra-
chian collection in the Natural History Museum,” Proc.
Zool. Soc. London, 411 – 416.
Boulenger G. A. (1903), “Descriptions of three new batrachi-
ans from Tonkin,” Ann. Mag. Nat. Hist. Ser. 7,12,
186 – 188.
Bourret R. (1937), “Notes herpétologiques sur l’Indochine
française. XIV. Les batraciens de la collection du Labora-
toire des Sciences Naturelles de l’Université. Descriptions
de quinze especes ou variétés nouvelles,” Ann. Bull. Gén.
l’Inst. Publ. Hanoi,1937,5–56.
Chanda S. K., Das I., and Dubois A. (2000), “Catalogue of
amphibian types in the collection of the zoological survey
of India,” Hamadryad,25(2), 100 – 128.
Chanda S. K. (2002), Handbook. Indian Amphibians, Zoo-
logical Survey of India, Calcutta.
Das I. and Dutta S. K. (1998), “Checklist of the amphibians of
India, with English common names,” Hamadryad,23(2),
63 – 68.
Dinesh K. P., Radhakrishnan C., Gururaja K. V., and
Bhatta G. (2009), “An annotated checklist of Amphibia of
India with some insights into the patterns of species discov-
eries, distribution and endemism,” Rec. Zool. Surv. India
Occas. Pap.,302, 1 – 153.
Dinesh K. P., Radhakrishnan C., Gururaja K. V., Deuti K.,
and Bhatta G. (2013), A Checklist of Amphibia of
India with IUCN Red List Status, Zoological Survey of
India, http://zsi.gov.in/checklist/Amphibia$final.pdf (on-
line version).
Dubois A. (1981), “Liste des genres et sous-genres nominaux
de Ranoidea (Amphibiens Anoures) du monde, avec identi-
fication de leurs espèces types; consequences nomenclatu-
rales,” Monit. Zool. Ital. N. Ser. Suppl.,15, 225 – 284.
Dutta S. K. (1997), Amphibians of India and Sri Lanka
(Checklist and Bibliography ), Odyssey Publishing House,
Bhubaneswar, Orissa, India.
Fei L. (1999), Atlas of Amphibians of China, Henan Press of
Science and Technology [in Chinese].
Fei L., Hu S. Q, Ye C. Y., and Huang Y. Z. (2009), Fauna
Sinica. Amphibia. Vol. 2. Anura, Chinese Academy of Sci-
ence, Science Press, Beijing [in Chinese].
Fei L., Ye C. Y., and Jiang J. P. (2010), Colored Atlas of Chi-
nese Amphibians, Sichuan Publishing Group/Sichuan Pub-
lishing House of Science and Technology [in Chinese].
Fei L., Ye C. Y., and Jiang J. P. (2012), Colored Atlas of Chi-
nese Amphibians and Their Distributions, Sichuan Pub-
lishing Group/Sichuan Publishing House of Science and
Technology [in Chinese].
Felsenstein J. (1985), “Phylogenies and the comparative
method,” Am. Naturalist,126,1–25.
Feng R. J., Bo Y., Zhang D. H., and Lu Y. H. (2011), “Frog
singing in forest,” Forestry of Guangxi,29(5), 40 – 41 [in
Chinese].
Frost D. R. (ed.) (1985), Amphibian Species of the World: a
Taxonomic and Geographic Reference, Association of Sys-
tematic Collections, Lawrence (Kansas).
Grosjean S., Delorme M., Dubois A., and Ohler A. (2008),
“Evolution of reproduction in the Rhacophoridae (Amphi-
bia, Anura),” J. Zool. Syst. Evol. Res.,46(2), 169 – 176.
Hu S. Q., Zhao E. M, Jiang Y. M., L. Fei L., Ye C. Y.,
Hu Q. X., Huang Q. Y., Huang Y. Z., and Tian W. S.
(1987), “Amphibia-Reptilia of Xizang,” in: The Series of
the Scientific Expedition to the Qinghai-Xizang Plateau,
Science Press, Beijing [in Chinese].
Huelsenbeck J. P. and Ronquist F. (2001), “MrBayes:
Bayesian inference of phylogeny,” Bioinformatics,17,
754 – 755.
Rediscovery of Theloderma moloch from Southeast Tibet, China After 102 Years 53
Jiang K., Yan F., Wang K., Zou Da-Hu, Li C., and Che J.
(2016), “A new genus and species of treefrog from Medog,
southeastern Tibet, China (Anura, Rhacophoridae),” Zool.
Res.,37(1), 15 – 20.
Li J. T., Che J., Murphy R. W., Zhao H., Zhao E. M.,
Rao D. Q., and Zhang Y. P. (2009), “New insights to the
molecular phylogenetics and generic assessment in the
Rhacophoridae (Amphibia: Anura) based on five nuclear
and three mitochondrial genes, with comments on the evo-
lution of reproduction,” Mol. Phylogen. Evol.,53, 509 –
– 522.
Li J.-T., Rao D. Q., Murphy R. W., and Zhang Y. P. (2011),
“The systematic status of rhacophorid frogs,” Asiatic
Herpetol. Res. Ser. 3,2(1),1–11.
Li P. P., Zhao E. M., and Dong B. J. (2010), Amphibians and
Reptiles of Tibet, Science Press, Beijing.
Lost amphibians of India (2010), in: Search of Lost Species,
Systematics Lab, Department of Environmental Biology,
University of Delhi, web-version http://www.lostspecies-
india.org/LAI2/wanted.php
Malkmus R., Manthey U., Vogel G., Hoffmann P., and Ko-
such J. (2002), Amphibians and Reptiles of Mount Kina-
balu (North Borneo), Ruggell ARG Gantner Verlag KG,
Münster.
Mathew R. and Sen N. (2010), Pictorial Guide to Amphibians
of North East India, Zoological Survey of India, Kolkata.
McLeod D. S. and Norhayati A. (2007), “A new species of
Theloderma (Anura: Rhacophoridae) from southern Thai-
land and peninsular Malaysia,” Russ. J. Herpetol.,14(1),
65 – 72.
Nguyen T. T., Matsui M., and Eto K. (2015), “Mitochondrial
phylogeny of an Asian tree frog genus Theloderma (Anura:
Rhacophoridae),” Mol. Phylogen. Evol., 85, 59 – 67.
Orlov N. L. (1997), “Die Theloderma-Arten Vietnams,” Her-
petofauna,19(110),5–9.
Orlov N. L., Dutta S. K., Ghate H. V., and Kent Y. (2006),
“New species of Theloderma from Kon Tum Province
(Vietnam) and Nagaland State (India) (Anura: Rhacophor-
idae),” Russ. J. Herpetol.,13(2), 135 – 154.
Orlov N. L. and Ananjeva N. B. (2007), “Amphibians of
South-East Asia,” Trudy Zool. Inst. RAN,309, 1 – 269 [in
Russian].
Orlov N. L., Ryabov S. A., Ananjeva N. B., and Evsyu-
nin A. A. (2010), Asian treefrogs of genus Theloderma
Tschudi, 1838 (Amphibia: Anura: Rhacophoridae: Rhaco-
phorinae), Zoological Institute, Russian Academy of Sci-
ences, RAS [in Russia with English title].
Orlov N. L., Poyarkov N. A., Vassilieva A. V., N. B.,
Nguyen T. T., Sang N. V., and Geissler P. (2012), “Taxo-
nomic notes on rhacophorid frogs (Rhacophorinae: Rhaco-
phoridae: Anura) of southern part of Annamite Mountains
(Truong Son, Vietnam), with description of three new spe-
cies,” Russ. J. Herpetol.,19(1), 23 – 64.
Palumbi S. R, Martin A. P., Romano S. L., McMillan W. O.,
Stice L., Grabowski G. (1991), The Simple Fool’s Guide to
PCR, Dept. of Zoology, University of Hawaii, Honolulu.
Poyarkov N. A. Jr., Orlov N. L., Moiseeva A. V., Pawang-
khanant P., Ruangsuwan T., Vassilieva A. V., Galo-
yan E. A., Nguyen T. T., and Gogoleva S. S. (2015),
“Sorting out moss frogs: mtDNA data on taxonomic diver-
sity and phylogenetic relationships of the indochinese spe-
cies of the genus Theloderma (Anura, Rhacophoridae),”
Russ. J. Herpetol.,22(4), 241 – 280.
Pyron R. A. and Wiens J. J. (2011), “A large-scale phylogeny
of Amphibia including over 2800 species, and a revised
classification of advanced frogs, salamanders, and caecili-
ans,” Mol. Phylogen. Evol.,61, 543 – 583.
Richards C. M. and Moore W. S. (1996), “A phylogeny for
the African treefrog family Hyperoliidae based on mito-
chondrial rDNA,” Mol. Phyl. Evol.,5, 522 – 532.
Rowley J. J. L., Le D. T. T., Hoang H. D., Dau V. Q., and
Ca o T. T. (2011), “Two new species of Theloderma (Anura:
Rhacophoridae) from Vietnam,” Zootaxa,3098,1–20.
Sarkar A. K. and Ray S. (2006), “Amphibia,” in: Alfred J. R.
B. (ed.), Fauna of Arunachal Pradesh. Part 1, Zoological
Survey of India, Calcutta.
Smith M. A. (1924), “New tree-frogs from Indo-China and the
Malay Peninsula,” Proc. Zool. Soc. London,1924, 225 –
– 234.
Smith M. A. (1926), “Spolia Mentawia”: Reptiles and amphib-
ians,” Ann. Mag. Nat. Hist. Ser. 9,18,76–81.
Smith M. A. (1930), “The Reptilia and Amphibia of the Malay
Peninsula. A supplement to G. A. Boulenger’s Reptilia and
Batrachia, 1912,” Bull. Raffles Mus.,3, 1 – 149.
Stuart B. L. and Heatwole H. F. (2004), “A new Philautus
(Amphibia: Rhacophoridae) from northern Laos,” Asiatic
Herpetol. Res.,10,17–21.
Taylor E. H. (1962), “The amphibian fauna of Thailand,”
Univ. Kansas Sci. Bull.,43, 265 – 599.
Tschudi J. J. V. (1838), Classification der Batrachier mit
Berücksichtigung der fossilen Thiere dieser Abtheilung der
Reptilien, Petitpierre, Neuchâtel.
Velho N. and Noronha A. (2015), Reptiles and Amphibians
of Pakke Tiger Reserve, web-version https://commons.
wikimedia.org/wiki/File: Reptiles_and_amphibians_of_
Pakke_ Tiger_Reserve.df#file)
Wang S. and Xie Y. (eds.) (2009), China Species Red List,
Higher Education Press, Beijing, China.
Wolf S. (1936), “Revision der Untergattung Rhacophorus
(ausschliesslich der Madagaskar-Formen),” Bull. Raffles
Mus.,12, 137 – 217.
Wrobel M. (2004), Elsevier’s Dictionary of Amphibians: in
Latin, English, German, French, Italian, Elsevier Science.
Ye C. Y., Fei L., Hu S.-Q. (1993), Rare and Economic Am-
phibians of China, Sichuan Publishing House of Science
and Technology, Chengdu, China [in Chinese].
Zhao E. M. and Adler K. (1993), Herpetology of China: Con-
tributions to Herpetology 10, Soc. for the Study of Amphib-
ians and Reptiles, Oxford, Ohio.
Zhao E. M. (ed.) (1998), China Red Data Book of Endangered
Animals: Amphibians and Reptiles, Science Press, Beijing,
China.
Zhao E. M., Chang H. W., Zhao H., and Adler K. (2000),
“Revised checklist of Chinese amphibian and reptilian,”
Sichuan J. Zool.,19(3), 196 – 207 [in Chinese with English
title].
54 Cheng Li et al.
... and Biju et al. (2016) both mentioned this species, but their fresh tissues all indicate that it should be paraphyletic within the genus Theloderma; the "Theloderma moloch" sequence of Li et al. (2009) is belonging to the new species Nasutixalus medogensis. Li et al. (2016) completely cleared the status of this species and provided redescription by morphometric and molecular analysis based the fresh specimens from locality very close to the type locality (Fig. 23). Biju et al. (2016) recorded a new locality of T. moloch as "Namdapha," the SE area of Brahmaputra River, on the NW ranges of Arakan Mountains. ...
... Biju et al. (2016) recorded a new locality of T. moloch as "Namdapha," the SE area of Brahmaputra River, on the NW ranges of Arakan Mountains. Li et al. (2016) noted this locality but not confirmed this record due to absence of reliable T. moloch photos or any morphological descriptions from there. Now we checked this record by molecular analysis (Fig. 1): the specimen from this locality (SDBDU 2011.345) is clustered together with T. moloch from Medog with strong support value, and the genetic distance between them is very low. ...
... Frost (2009Frost ( -2016 referenced it as "T. baibengensis," some researchers followed this name: Rowley et al., 2011;Nguyen et al., 2015;Poyarkov et al., 2015;Li et al., 2016; corrected it as "T. baibungensis, made gender correction as "Theloderma (Theloderma) baibengense." ...
Article
Full-text available
The problems of identification, number and distribution of Theloderma species living in China are discussed on the base of new original morphological and molecular data collected during the last years. According to the author’s results there are six known Theloderma species living in China: Theloderma albopunctatum (Liu et Hu, 1962), Theloderma baibungense Jiang, Fei et Huang, 2007, Theloderma bicolor (Bourret, 1937), Theloderma corticale (Boulenger, 1903), Theloderma moloch (Annandale, 1912), and Theloderma rhododiscus Liu et Hu, 1962.
... The genus Theloderma Tschudi 1838 is a group of Asian rhacophorid treefrogs that has long captured the interests of herpetologists and hobbyists alike. Many of the species are charismatically ornamented with spines, cryptic color patterns resembling moss or bird droppings, and/or bright or highly contrasting color patterns (Orlov 1997;Orlov et al. 2006;Dever et al. 2015;Li et al. 2016). Some species perform a balled defensive posture, and those with known modes of reproduction breed in rain-filled tree or bamboo cavities (Orlov 1997;Orlov et al. 2006;Grosjean et al. 2008;Nguyen et al. 2009;Rowley et al. 2011;Vassilieva et al. 2016). ...
... The taxonomic content of the genus is currently in a state of flux (Poyarkov et al. 2015;Frost 2016;Li et al. 2016). Twenty-four species are recognized here, following recent synynomies of two species from southern Vietnam (Poyarkov et al. 2015), but excluding three species that were transferred from Nyctixalus Boulenger 1882 to Theloderma (Poyarkov et al. 2015;below). ...
... The monophyly of Theloderma has been questioned, but primarily on the bases of an erroneously identified voucher that has been perpetuated in the literature and misinterpretation of unresolved nodes in phylogenetic trees. Sequences attributed to Theloderma moloch (voucher specimen "6255Rao," GenBank accessions GQ285679, GQ285690, GQ285721, GQ285753, GQ285782, GQ285800) by Li et al. (2009), and that were re-incorporated into numerous other phylogenetic studies (e.g., Rowley et al. 2011, Hertwig et al. 2013Li et al. 2013;Nguyen et al. 2015;Poyarkov et al. 2015;Biju et al. 2016;Jiang et al. 2016;Li et al. 2016), resulted in the disparate placement of T. moloch within the Rhacophoridae, and consequently, the non-monophyly of Theloderma. Voucher "6255Rao" (and its associated sequences) has been re-assigned to the newly-described genus and species Nasutixalus medogensis Jiang, Yan, Wang, Zou, Li & Che 2016, and, almost concurrently, to an unnamed species in the newlydescribed genus Frankixalus Biju, Senevirathne, Garg, Mahony, Kamei, Thomas, Shouche, Raxworthy, Meegaskumbura & Van Bocxlaer 2016. ...
Article
A new species of the rhacophorid frog genus Theloderma is described from the forested shoreline of the Nam Lik Reservoir, Vientiane Province, Laos. The new species differs from its congeners by having the combination of males with SVL 17.0-20.6; pearly asperities on dorsum; no vomerine teeth; disc diameter of finger III ca. 40% of tympanum diameter; uniformly gray venter; light brown dorsum with darker brown and black markings; and a uniformly bronze iris with small black reticulations. Molecular phylogenetic analysis of mitochondrial DNA sequence data infers that the new species is most closely related to T. lateriticum from northern Vietnam. Evidence for the monophyly of Theloderma is reviewed.
... Aruanchal Pradesh-the easternmost state of India-due to its close proximity with Xizang Province of China and sharing similar topological features, has a high chance of harbouring many species of amphibians distributed in China, especially Xizang. In recent decades, a few Chinese frog species have been reported from India (Ao et al., 2003;Borah et al., 2013;Sarania et al., 2015), while a few Indian frogs (described from Arunachal Pradesh) were reported from Xizang, China (Li et al., 2016;Liang et al., 2017); however, such findings are far less than what the geographical similarities suggest. ...
... Mahony et al., (2013) expressed the difficulty amphibian taxonomists working on the bordering areas of neighbouring countries with China face, as most Chinese species were described in various Chinese languages. But the recent reports of a couple of Indian amphibians like Theloderma moloch (Annandale, 1912) and Leptobrachium bompu Sondhi and Ohler, 2011 (described from Arunachal Pradesh) from Xizang, China (Li et al., 2016;Liang et al., 2017) re-affirm that both Arunachal Pradesh (India) and Xizang (China) shares similar habitats and topology to support related faunal resources. Sarkar and Ray (2006) reported 39 species of amphibians from Arunachal Pradesh, which was revised up to 63 species (Bordoloi and Borah, 2009). ...
Article
Full-text available
The endemic Asian megophryid genus Megophrys is represented by a total of 77 species of which 14 are reported to occur in India. Due to its close proximity to China, Arunachal Pradesh- the easternmost state of India- is believed to harbor many species of amphibians endemic to China. One such Megophrys species endemic to China, Megophrys pachyproctus, is reported herein this paper as the first record for India, based on a single specimen collected from Talle Valley Wildlife Sanctuary in Ziro Valley of Arunachal Pradesh.
... Theloderma moloch (Annandale, 1912), an enigmatic taxon whose phylogenetic position and assignment to Theloderma became uncertain due to sequences published by Li et al. (2009), was simultaneously rediscovered in Chinese and Indian regions of the Himalayas and shown to be a member of Theloderma s. str. (Hou et al., 2017;Lalronunga & Lalrinchhana, 2017;Li et al., 2016). In addition, and Biju et al. (2016) concurrently demonstrated that sequences previously reported as "Th. ...
... Data and adult morphological characters chosen for comparison with other Theloderma species and allied taxa were taken from the following sources: Ahl (1927Ahl ( , 1931; Anderson (1879); Annandale (1912); Bain et al. (2009);Boulenger (1882Boulenger ( , 1886Boulenger ( , 1893Boulenger ( , 1903; Bourret (1937Bourret ( , 1942; Chan & Ahmad (2009); Chan-ard (2003); Das et al. (2013); Das (2007); Dever et al. (2015); Dever (2017); Fei et al. (1990Fei et al. ( , 2009Fei et al. ( , 2010; Hou et al. (2017);Inger (1954Inger ( , 1966; Lalronunga & Lalrinchhana (2017); Li et al. (2011Li et al. ( , 2016; Liem (1970); Liu & Hu (1962); Manthey & Grossmann (1997); Mathew & Sen. (2010);McLeod & Ahmad (2007);Nguyen et al. (2014);Orlov & Ananjeva (2007); Orlov & Ho (2005);Orlov et al. (2006Orlov et al. ( , 2010Orlov et al. ( , 2012Orlov (2007); Peters (1871); Poyarkov et al. (2015); Rowley et al. (2011);Sivongxay et al. (2016); Smith (1924Smith ( , 1926Smith ( , 1931; Stuart & Heatwole (2004); Taylor (1920Taylor ( , 1962; Von Tschudi (1838); Wolf (1936); Zhao & Adler (1993). ...
Article
Full-text available
A new species of small tree frog from a primary montane tropical forest of central Vietnam, Tay Nguyen Plateau, is described based on morphological, molecular, and acoustic evidence. The Golden Bug-Eyed Frog, Theloderma auratum sp. nov., is distinguishable from its congeners and other small rhacophorid species based on a combination of the following morphological attributes: (1) bony ridges on head absent; (2) smooth skin completely lacking calcified warts or asperities; (3) pointed elongated tapering snout; (4) vocal opening in males absent; (5) vomerine teeth absent; (6) males of small body size (SVL 21.8-26.4 mm); (7) head longer than wide; ED/SVL ratio 13%-15%; ESL/SVL ratio 16%-20%; (8) small tympanum (TD/EL ratio 50%-60%) with few tiny tubercles; (9) supratympanic fold absent; (10) ventral surfaces completely smooth; (11) webbing between fingers absent; (12) outer and inner metacarpal tubercles present, supernumerary metacarpal tubercle single, medial, oval in shape; (13) toes half-webbed: I 2-2¼ II 1½-2¾ III 2-3¼ IV 3-1½ V; (14) inner metatarsal tubercle present, oval; outer metatarsal tubercle absent; (15) iris bicolored; (16) dorsal surfaces golden-yellow with sparse golden-orange speckling or reticulations and few small dark-brown spots; (17) lateral sides of head and body with wide dark reddish-brown to black lateral stripes, clearly separated from lighter dorsal coloration by straight contrasting edge; (18) ventral surfaces of body, throat, and chest greyish-blue with indistinct brown confluent blotches; (19) upper eyelids with few (3-5) very small flat reddish superciliary tubercles; (20) limbs dorsally reddish-brown, ventrally brown with small bluish-white speckles. The new species is also distinct from all congeners in 12S rRNA to 16S rRNA mitochondrial DNA fragment sequences (uncorrected genetic distance P>8.9%). Advertisement call and tadpole morphology of the new species are described. Our molecular data showed Theloderma auratum sp. nov. to be a sister species of Th. palliatum from Langbian Plateau in southern Vietnam.
... Members of the rhacophorid genus Theloderma Tschudi, 1838 (known as warty tree frogs, bug-eyed frogs or mossy frogs) are arboreal frogs of a size of three to six centimetres, distributed from East India eastwards to South China and southwards to Borneo and Sumatra (Frost, 2019). The little knowledge on life history traits of Theloderma in the wild is based on few observations only (Li et al., 2016;Wassersug et al., 1981). In general mossy frogs occupy tree or bamboo holes filled with water in primary and secondary forests, but they were also observed in man-made water bodies in cultivated areas (Leong and Lim, 2003). ...
... Earlier, T. moloch has been reported from Eaglenest Wildlife Sanctuary (Athreya, 2006), Abor Hills (Borah and Bordoloi, 2003) with no specific location or information on vouchers, and from Mouling National Park of Arunachal Pradesh based on secondary information (Pawar and Birand, 2001). It was recently reported from Medog, Southeast Tibet (Li et al., 2016) followed by a mention from Namdapha, Arunachal Pradesh, without mentioning any locality (Biju et al., 2016). While this finding and observation on T. moloch from Lower Dibang Valley of Arunachal Pradesh is a new distribution record and microhabitat details since it was rediscovered by Li and his team (2016) followed by Annandale (1912). ...
Article
Full-text available
This report on Theloderma moloch from Lower Dibang Valley is a new distribution record of this species from the region. This report also describes microhabitats and environmental features (temperature and relative humidity) and conservation status of T. moloch in the area. This record of T. moloch is significant as this is a poorly known species and its known habitats are being lost due to deforestation and proposed development projects in the river valleys that would inundate habitats of this species available in the altitudinal range in the tropical habitats.
Article
A new species of Theloderma is described from the Hoang Lien Mountains of northwestern Vietnam from between 1300–1400 m elevation. Theloderma lateriticum sp. nov. was found at night inside a water-filled chamber of bamboo, which was within disturbed, submontane, semi-evergreen forest. The new species of Theloderma can be immediately differentiated from all other congeners by its solid, brick-red dorsal wash and minimal foot webbing (proximal to proximal subarticular tubercle on Toe I; to level of proximal subarticular tubercle on postaxial side of II; proximal to proximal subarticular tubercle on preaxial side of III; just beyond proximal subarticular tubercle on postaxial side of III; to level of proximal subarticular tubercle on preaxial side of IV; just beyond proximal subarticular tubercle on postaxial side of IV; and just beyond proximal subarticular tubercle on preaxial side of V). The female and tadpole remain unknown.
Article
Full-text available
We describe a new species of Theloderma from northeastern Vietnam based on morphological differences and molecular divergence. Theloderma khoii sp. nov. is distinguishable from its congeners on the basis of a combination of the following characters: large size, SVL 52.1 mm in male, 59.4 mm NINH H.T. et al., A new Theloderma from Vietnam 73 in female; head length and width equal; vomerine teeth present; snout pointed and truncated, eye large, ED 4.7 mm in male, 5.6 mm in female, spinules on upper eyelid; tibiotarsal articulation reaches to the posterior border of the eye or the tip of the snout; dorsal skin very rough with large irregular gland ridges and warts, ventral surface of body granular; tips of all digits dilated but all considerably smaller than tympanum; dorsal surface mossy green or olive mottled with dark magenta. The distribution of the new species is unknown but probably extends into adjacent high elevation forested areas in Ha Giang Province, Vietnam and in Yunnan Province, China with an extent of occurrence of only < 1000 km 2 and continuing decline in the quality of its habitat due to deforestation. Thus, we suggest the species should be considered Endangered following IUCN's Red List categories.
Article
We describe a new species of Theloderma from northwestern Vietnam based on morphological differences and molecular divergence. Theloderma annae sp. nov. is distinguishable from its congeners on the basis of a combination of the following characters: Size small, SVL 27.1–28.5 mm in males, 30.3–32.6 mm in females; head longer than wide; vomerine teeth absent; snout long (SL/SVL 0.16–0.19); spines on upper eyelid absent; tibiotarsal projection absent; dorsal skin smooth; dermal fringes on forearm and tarsus absent; dorsal surface grayish green; and throat and ventral surface of arms and thighs brown with white spots.
Article
Full-text available
A new genus and species of threefrog is described from Medog, southeastern Tibet, China based on morphological and phylogenetic data. The new genus can be distinguished from other treefrog genera by the following combination of characters: (1) body size moderate, 45.0 mm in male; (2) snout rounded; (3) canthus rostralis obtuse and raised prominently, forming a ridge from nostril to anterior corner of eyes; (4) web rudimentary on fingers; (5) web moderately developed on toes; (6) phalange "Y" shaped, visible from dorsal side of fingers and toes; (7) skin of dorsal surfaces relatively smooth, scatted with small tubercles; (8) iris with a pale yellow, "X" shaped pattern of pigmentation.
Article
Full-text available
Despite renewed interest in the biogeography and evolutionary history of Old World tree frogs (Rhacophoridae), this family still includes enigmatic frogs with ambiguous phylogenetic placement. During fieldwork in four northeastern states of India, we discovered several populations of tree hole breeding frogs with oophagous tadpoles. We used molecular data, consisting of two nuclear and three mitochondrial gene fragments for all known rhacophorid genera, to investigate the phylogenetic position of these new frogs. Our analyses identify a previously overlooked, yet distinct evolutionary lineage of frogs that warrants recognition as a new genus and is here described as Frankixalus gen. nov. This genus, which contains the enigmatic ‘Polypedates’ jerdonii described by Günther in 1876, forms the sister group of a clade containing Kurixalus, Pseudophilautus, Raorchestes, Mercurana and Beddomixalus. The distinctiveness of this evolutionary lineage is also corroborated by the external morphology of adults and tadpoles, adult osteology, breeding ecology, and life history features.
Article
Full-text available
A new species of Theloderma is described from the Hoang Lien Mountains of northwestern Vietnam from between 1300-1400 m elevation. Theloderma lateriticum sp. nov. was found at night inside a water-filled chamber of bamboo, which was within disturbed, submontane, semi-evergreen forest. The new species of Theloderma can be immediately differentiated from all other congeners by its solid, brick-red dorsal wash and minimal foot webbing (proximal to proximal subarticular tubercle on Toe I; to level of proximal subarticular tubercle on postaxial side of II; proximal to proximal subarticular tubercle on preaxial side of III; just beyond proximal subarticular tubercle on postaxial side of III; to level of proximal subarticular tubercle on preaxial side of IV; just beyond proximal subarticular tubercle on postaxial side of IV; and just beyond proximal subarticular tubercle on preaxial side of V). The female and tadpole remain unknown.
Article
Full-text available
We discuss phylogenetic relationships and taxonomic diversity of the rhacophorid frogs of the genus Theloderma in sight of the novel phylogenetic data obtained from the Bayesian analysis of the up to 1987 bp length fragment of mtDNA (12S rRNA, tRNAval, and 16S rRNA) from the 90 specimens of 21 nominal species of Theloderma and 3 species of Nyctixalus. Our data suggest monophyly of the tribe Nyctixalini, including Th. moloch, and indicate deep divergence between the three major clades: Th. horridum + Th. stellatum group, Nyctixalus and the rest of the Theloderma species (Theloderma sensu stricto). We establish new subgenus Stelladerma subgen. nov. for Th. horridum + Th. stellatum group and discuss provisional taxonomy of Nyctixalini.We also indicate that the taxonomic status of the certain Indochinese Theloderma requires reassessment. In particular, our data suggest deep divergence between Malayan and Indochinese taxa of Th. asperum group and indicate non-monophyly of Th. asperum sensu lato; we resurrect the name Th. albopunctatum (Liu et Hu, 1962) for the Indochinese species. We provide molecular evidence for synonimization of Th. chuyangsinense Orlov et al., 2012 with Th. palliatum Rowley et al., 2011; as well as morphological and genetic evidence for syninomization of Th. bambusicola Orlov et al., 2012 with Th. laeve (Smith, 1924). We indicate a deep morphological and genetic differentiation within the Th. truongsonense (Orlov et Ho, 2005) complex. Finally, we report on the deep divergence within Th. stellatum Taylor, 1962 from eastern Thailand, southern Cambodia, and Vietnam, and describe a new species, Theloderma vietnamense sp. nov., based on morphological, acoustic and genetic lines of evidence.
Article
A list of the nominal genera and subgenera of Ranoidea (Amphibia Anura) of the world is given, with identification of their type-species. The nomenclatural consequences of the rediscovery of overlooked names or type-species designations are discussed. The following genus-group names are resurrected: Limnonectes Fitzinger, 1843 as a subgeneric name for Rana kuhlii Dumeril & Bibron, 1841 and its allies; Occidozyga Kuhl & Van Hasselt, 1822a in the place of Ooeidozyga Kuhl & Van Hasselt, 1822b; Nyctixalus Boulenger, 1882 in the place of Edwardtayloria Marx, 1975; and Tachycnemis Fitzinger, 1843 in the place of Megalixalus Gunther, 1869. The familial and subfamilial classification and nomenclature of the Ranoidea and the generic and subgeneric classification and nomenclature of the Rani-nae are also discussed. Five families are recognized in the superfamily Ranoidea: the Ranidae (Raninae, Phrynobatrachinae and Mantellinae), the Rhacophoridae (Rhacophorinae and Philautinae, the latter subfamily being created here), the Arthroleptidae (Astylosterninae and Arthroleptinae), the Hyperoliidae (Leptopelinae, Kassininae and Hyperoliinae) and the Hemi-sidae.