ArticlePDF Available

Aging decreases collagen IV expression in vivo in the dermo-epidermal junction and in vitro in dermal fibroblasts: Possible involvement of TGF-β1

Authors:

Abstract and Figures

Collagen IV is a major component of the dermo-epidermal junction (DEJ). To study expression of collagen IV upon aging in the DEJ and dermal fibroblasts isolated from the same patients. A model of senescent fibroblasts was developed in order to identify biological compounds that might restore the level of collagen IV. Skin fragments of women (30 to 70 years old) were collected. Localisation of collagen IV expression in the DEJ was studied by immunofluorescence. Fibroblast collagen IV expression was studied by real-time PCR, ELISA, and western blotting. Premature senescence was simulated by exposing fibroblasts to subcytotoxic H2O2 concentrations. Collagen IV decreased in the DEJ and fibroblasts relative to age. TGF-β1 treatment significantly increased collagen IV gene and protein expression in fibroblasts and restored expression in the model of senescence. Addition of TGF-β1-neutralizing antibody to fibroblast cultures decreased collagen IV expression. Taken together, the results suggest that the decrease in collagen IV in the DEJ, relative to age, could be due to a decrease in collagen IV expression by senescent dermal fibroblasts and may involve TGF-β1 signalling.
Content may be subject to copyright.
The key scientific and
medical informations
www.jle.com
Find the contents of this issue hereafter:
http://www.john-libbey-eurotext.fr/fr/
revues/medecine/ejd/sommaire.md?type=
text.html
Montrouge, 27-08-2016
Sylvie Brassart-Pasco
You will find below the electronic reprint of your article (pdf format):
Aging decreases collagen IV expression in vivo in the dermo-epidermal junction and in vitro in
dermal fibroblasts: possible involvement of TGF-ˇ1
published in:
European Journal of Dermatology, 2016, Volume 26, Num´
ero 4
John Libbey Eurotext
This electronic reprint is provided for your exclusive use, and can’t be communicated but for scientific and individual purposes. It mustn’t,
under any circumstances, be used or distributed for advertising, promotional or commercial purposes.
© John Libbey Eurotext, 2016
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
doi:10.1684/ejd.2016.2782
350 EJD, vol. 26, n4, July-August 2016
To cite this article: Feru J, Delobbe E, Ramont L, Brassart B, Terryn C, Dupont-Deshorgue A, Garbar C, Monboisse JC, Maquart FX, Brassart-Pasco S. Aging decreases
collagen IV expression in vivo in the dermo-epidermal junction and in vitro in dermal fibroblasts: possible involvement of TGF-1. Eur J Dermatol 2016; 26(4): 350-60
doi:10.1684/ejd.2016.2782
Investigative report Eur J Dermatol 2016; 26(4): 350-60
Jezabel FERU1
Etienne DELOBBE1
Laurent RAMONT1,2
Bertrand BRASSART1
Christine TERRYN3
Aurelie DUPONT-DESHORGUE1
Christian GARBAR4
Jean-Claude MONBOISSE1,2
Francois-Xavier MAQUART1,2
Sylvie BRASSART-PASCO1
1Laboratoire de Biochimie Médicale
et de Biologie Moléculaire,
CNRS UMR 7369: Matrice Extracellulaire
et Dynamique Cellulaire (MEDyC),
UFR Médecine, Université de Reims
Champagne-Ardenne,
51 rue Cognacq Jay, CS 30018, 51095
2Laboratoire Central de Biochimie,
Hôpital Robert Debré,
CHU de Reims,
Avenue du Général Koenig, 51092
3Plate-forme d’Imagerie Cellulaire
et Tissulaire IBISA,
Université de Reims Champagne-Ardenne,
51 rue Cognacq Jay, CS 30018, 51095
4Départements de Biopathologies,
Institut Jean-Godinot-Unicancer,
1 rue du général KOENIG CS80014 51726
Reims Cedex,
France
Reprints: S. Brassart-Pasco
<sylvie.brassart-pasco@univ-reims.fr>
Article accepted on 06/3/2016
Aging decreases collagen IV expression
in vivo in the dermo-epidermal junction
and in vitro in dermal fibroblasts: possible
involvement of TGF-1
Background: Collagen IV is a major component of the dermo-epidermal
junction (DEJ). Objectives: To study expression of collagen IV upon
aging in the DEJ and dermal fibroblasts isolated from the same patients.
A model of senescent fibroblasts was developed in order to identify bio-
logical compounds that might restore the level of collagen IV. Materials
& methods: Skin fragments of women (30 to 70 years old) were col-
lected. Localisation of collagen IV expression in the DEJ was studied by
immunofluorescence. Fibroblast collagen IV expression was studied by
real-time PCR, ELISA, and western blotting. Premature senescence was
simulated by exposing fibroblasts to subcytotoxic H2O2concentrations.
Results: Collagen IV decreased in the DEJ and fibroblasts relative to
age. TGF-1 treatment significantly increased collagen IV gene and
protein expression in fibroblasts and restored expression in the model
of senescence. Addition of TGF-1-neutralizing antibody to fibroblast
cultures decreased collagen IV expression. Conclusion: Taken together,
the results suggest that the decrease in collagen IV in the DEJ, relative to
age, could be due to a decrease in collagen IV expression by senescent
dermal fibroblasts and may involve TGF-1 signalling.
Key words: collagen IV, dermo-epidermal junction, fibroblast, stress-
induced premature senescence, skin, TGF-1
Skin aging is a complex biological phenomenon
consisting of two components: intrinsic aging and
extrinsic aging caused by environmental expo-
sure. Reactive oxygen species (ROS) are highly reactive
molecules that consist of a number of diverse chemical
species, including superoxide anion (O2-), hydroxyl rad-
ical (OH), and hydrogen peroxide (H2O2). Because of
their potential to cause oxidative deterioration of DNA,
proteins, and lipids, ROS have been implicated as one of
the causative factors of aging [1, 2]. Fibroblast premature
senescence can be triggered upon treatment with subtoxic
H2O2doses [3]. During cellular senescence, normal human
fibroblasts change their morphology from a spindle shape to
an enlarged, flattened and irregular shape [4]. An increase in
lysosomal -galactosidase activity with cellular senescence
was also reported and this senescence-associated -
galactosidase (SA--Gal) is considered as a marker of cel-
lular senescence and aging [5-7]. Cellular senescence is also
characterized by a reduced proliferation rate, an increased
number of cells in G0-G1 phase, and an increase in
p21Waf-1 expression [8]. In addition, changes in extracellu-
lar matrix macromolecule synthesis have also been reported
in senescent fibroblasts, and H2O2is reported to increase
the level of MMP-1 mRNA in human dermal fibroblasts
[9]. Finally, cellular senescence is also reported to decrease
type I collagen expression in dermal fibroblasts [10].
The TGF-signalling pathway is involved in the synthe-
sis of many extracellular matrix macromolecules in dermal
fibroblasts [11] and stimulates type I collagen biosynthesis
[12]. Previous studies from Mori et al. [13] demonstrated
that collagen I expression was decreased in in vitro-aged
fibroblast cultures. The mRNA levels of 1(I) collagen,
TGF-1 and TGF-receptor II (TGFRII) were reduced
to 62%, 62% and 59%, respectively, in late-passage fibrob-
lasts, compared to early-passage fibroblasts. Quan et al.
also demonstrated that the TGF-/Smad pathway is sig-
nificantly reduced in aged dermal fibroblasts in vivo and
mediates reduced collagen I expression [14]. TGF-1is
also reported to stimulate type IV collagen synthesis in
murine mesangial cells and mouse embryonic fibroblasts
[15, 16].
Basement membranes are thin and amorphous special-
ized extracellular matrices that play roles in various
biological events, including embryonic development. The
skin basement membrane binds the epidermis tightly to
the dermis, determines the polarity of the basal ker-
atinocytes, and acts as a selective barrier to control
molecular and cellular exchange. Type IV collagen is a
major component of skin basement membrane. Type IV
collagen molecules are heterotrimers composed of three
-chains, which exist in six genetically distinct forms:
1(IV) to 6(IV). COL4A1/COL4A2,COL4A3/COL4A4
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
EJD, vol. 26, n4, July-August 2016 351
and COL4A5/COL4A6 genes are located pairwise in
a head-to-head fashion on chromosomes 2, 3 and X,
respectively [17]. Each chain is characterised by a long
collagenous domain of 1,400 residues of Gly-X-Y repeats,
interrupted by a short non-collagenous sequence, and a
non-collagenous (NC1) domain of 230 residues at the car-
boxyl terminus, which is conserved among different species
[18]. Only two collagen IV isoforms have been reported
in the adult skin basement membrane: 1(IV)2/2(IV), the
major isoform; and 5(IV)2/6(IV), the minor isoform [19-
21]. Temporal and spatial expression of 1(IV), 2(IV),
5(IV) and 6(IV) collagen chains was studied during the
formation of the basal lamina in an in vitro skin model
[22]. A sequential study was performed with 7-day and
14-day cultures (lamina densa absent), and with 28-, 36-,
and 56-day cultures (lamina densa present). In the pres-
ence of the lamina densa, type IV collagen chains were
mainly produced in the dermis. Type IV collagen expres-
sion by dermal fibroblasts was also reported by Sasaki
et al. [23]. A study from Vazquez and collaborators [24]
demonstrated decreased type IV collagen in skin samples
taken from a site, 6 cm above the pubic symphysis, in
women aged 35 to 60. In 1998, Le Varlet and collab-
orators [25] also studied the influence of donor age on
collagen expression in post-auricular skin biopsies from
four donors (women aged 10, 35, 50, and 64, respectively)
and showed less type IV collagen in adult dermo-epidermal
junctions, however, the cause of this decrease is currently
unknown.
In the present study, we set out to investigate whether
type IV collagen, as well as TGF-1 and TGFRII, is
decreased in the skin basement membrane upon aging.
As fibroblast premature senescence can be triggered by
treatment with subtoxic H2O2doses [3], we further inves-
tigated type IV collagen expression in this model of
stress-induced premature senescence (SIPS). The effect of
TGF-1 on type IV collagen expression was also inves-
tigated in dermal fibroblast cultures, as well as the SIPS
model.
Materials and methods
Reagents
Culture media and trypan blue were purchased from Invit-
rogen (distributed by Fischer Scientific, Illkirch, France),
TGF-1 and Senescence Cells Histochemical Staining
Kit from Sigma Aldrich (Saint-Quentin Fallavier, France),
Qiagen RNeasy kit from Qiagen (Courtaboeuf, France),
Maxima First Strand cDNA synthesis kit from Fermen-
tas France/Thermo-Fisher Scientific (Villebon sur Yvette,
France), SYBR Premix Ex Taq kit from Ozyme (Saint
Quentin en Yvelines, France), and anti-type IV collagen
from Dako (Les Ulis, France).
Ethics statement
Collection and utilisation of human skin fragments were
approved by the Institutional Review Board of the Reims
University Hospital (CHU de Reims), and conducted
according to the declaration of Helsinki principles. A writ-
ten informed consent was obtained from patients.
Cell culture
Skin fragments from patients from 30 to 70 years old,
following breast surgery, were cleaned of excess subcuta-
neous tissue and cut into small pieces (5×5 mm), and then
incubated with 0.25% trypsin in 0.01% ethylenediamine
tetraacetic acid solution at +4 C overnight. The epidermal
sheets were separated from the dermis by forceps. Primary
cultures of dermal fibroblasts were established by cutting
the dermis into small pieces (1×1 mm) and placing the frag-
ments into 25 cm2flasks. Cells were cultured in Dulbecco’s
modified Eagle’s medium supplemented with 10% foetal
bovine serum (FBS) and incubated at +37 C in a humidi-
fied atmosphere containing 5% CO2. Fibroblasts were then
trypsinized. Cultures between passages 3 and 5 were used
in this study.
Induction of fibroblast senescence
by H2O2treatment
Fibroblasts were seeded in 6-well plates and grown to 80%
confluence. The culture media were removed and the cells
were exposed to fresh culture medium containing 0 to
100 MH
2O2. After 1 hour and 30 minutes of H2O2expo-
sure, the culture medium was removed and the cells were
incubated with fresh culture medium for 48 hours.
Trypan blue exclusion test
The effect of H2O2exposure on cell viability was deter-
mined using the trypan blue exclusion test. Cells were
treated in the absence or presence of various concentra-
tions of H2O2for 48 hours. Then, cells were trypsinized and
diluted in phosphate-buffered saline. The floating dead cells
in the medium and cells that remained attached to the plates
were then counted using an automated cell counter (Count-
ess, Invitrogen, distributed by Fischer Scientific, Illkirch,
France) in the presence of trypan blue solution at a 1:1 ratio
(v/v) (Sigma), as described by the manufacturer.
Detection of senescence-associated
-galactosidase (SA--Gal) activity
Forty-eight hours after H2O2exposure, the culture media
were removed and the cells were stained using the Senes-
cence Cells Histochemical Staining Kit (Sigma-Aldrich,
Saint-Quentin Fallavier, France).
Quantitative real-time PCR
RNA isolation was performed using the Qiagen RNeasy kit
(Qiagen, Courtaboeuf, France), according to the manufac-
turer’s instructions. cDNA was prepared from 1 g of total
RNA by reverse transcription (RT) at +42 C for 45 min
using the Maxima First Strand cDNA synthesis kit (Fermen-
tas France/Thermo-Fisher Scientific, Villebon sur Yvette,
France). SYBR Premix Ex Taq (Ozyme, Saint Quentin en
Yvelines) was used for the PCR reaction. Primer sequences
are listed in table 1. Mx 3005P (Stratagene) was used for
amplification and data collection. A first denaturation step
was performed for 10 minutes at +95 C, then a cycling pro-
gram (40 cycles) included a 5-minute denaturation step at
+95 C, a 30-second annealing step at +60 C, followed by
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
352 EJD, vol. 26, n4, July-August 2016
Table 1. List of the primer sequences used in real-time PCR experiments.
Gene Forward primer (5’3’) Reverse primer (5’3’)
Human 1(IV) TAGAGAGGAGCGAGATGTTC GTGACATTAGCTGAGTCAGG
Human GAPDH ACGGATTTGGTCGTATTGGG TGATTTTGGAGGGATCTCGC
Human MMP-1 TGGCATTCAGTCCCTCTATGG AGGACAAAGCAGGATCACAGTT
Human p21WAF-1 CTGGAGACTCTCAGGGTCGAA CCAGGACTGCAGGCTTCCT
Human 1(I) CACCAATCACCTGCGGTACAGAA CAGATCACGTCATCGCACAAC
Human TGF-1 GCGTGCTAATGGTGGAAAC CGGTGACATCAAAAGATAACCAC
Human TGFRII GTCTACTCCATGGCTCTGGT ATCTGGATGCCCTGGTGGTT
a 15-second elongation step at +72 C. Fluorescence acqui-
sition was carried out at +72 C in single mode at the end
of the elongation step. After real-time PCR, melting curve
analysis was performed by continuously measuring fluores-
cence during heating from +55 to +95 C at a transition rate
of +0.2C/s. Product specificity was evaluated by melting
curve analysis and electrophoresis on 2% agarose gels. Flu-
orescence was analysed using the Data Analysis software
(Stratagene). Crossing points (Cp or Ct) were established
using the second derivative method. Real-time PCR effi-
ciency was calculated from the slope of the standard curve.
Target gene expression levels were normalised to reference
genes. The results were calculated using the delta-delta
method.
Immunohistochemistry
Breast samples were collected from 30 to 70-year-old
women. Skin sections, 5 m thick, were prepared using
a cryostat and placed on Superfrost slides. These slides
were then washed twice in distilled water for 5 minutes and
twice in PBS for 10 minutes. They were then incubated with
anti-collagen IV primary antibody (DAKO) (diluted 1:200)
for 45 minutes in a humid chamber at room temperature.
They were then rinsed in PBS for 10 minutes and incubated
for 10 minutes with the Alexa Fluor 488-conjugated sec-
ondary antibody (diluted at 1:200). They were rinsed with
PBS for 10 minutes and then with distilled H2O for 10 min-
utes. Slides were examined under a confocal laser scanning
microscope (Zeiss LSM 710) (Carl Zeiss MicroImaging
GmbH, Germany). Two image processing programs based
on ImageJ application were developed to measure basement
membrane invaginations and basement membrane type IV
collagen.
Western blot
Conditioned media were harvested, centrifuged at 500 g
for 10 min at 4 C to remove cellular debris, and concen-
trated using Sartorius Vivaspin concentrators (distributed
by Dominique Dutscher, Brumath, France). The protein
content of the media was determined by the Bradford
method, using bovine serum albumin as a standard. 50 g
of protein was separated by SDS-PAGE and transferred to
an Immobilon-P membrane (Millipore, St Quentin en Yve-
lines, France). After blocking with 5% non-fat dry milk in
TBS buffer (50 mM Tris, 138 mM NaCl, 2.7 mM KCl,
pH 8.0) containing 0.1% Tween-20 (TBS-T), the mem-
brane was incubated with an anti-type IV collagen rabbit
polyclonal antibody (1/5,000 in TBS-T containing 1% non-
fat dry milk) overnight at 4C. Then, the membrane was
washed in TBS-T buffer and incubated with a peroxidase-
conjugated goat anti-rabbit IgG (1/10,000) for 1 hour and
30 minutes. Signals were detected using an ECL+ kit (GE
Healthcare, Orsay, France), according to the manufacturer’s
instructions. Membranes were stained with Coomassie blue
and the total amount of protein per well was determined
using Image Lab software. Collagen IV was quantified rel-
ative to total loaded protein.
Enzyme-linked immunosorbent assay
Type IV collagen was determined using the ELISA Kit for
Collagen Type IV (Uscn Life Science Inc., Euromedex,
Souffelweyersheim, France), according to the manufacturer
instructions.
Statistical analyses
For in vitro experiments, the student t-test was performed
and results are expressed as mean ±SD. For in vivo exper-
iments, comparisons between the two groups were made
using the non-parametric u-test of Mann and Whitney and
results are depicted as box plots.
Results
Aging decreases basement membrane
type IV collagen in the skin
Transversal skin sections were prepared from breast frag-
ments derived from 30 to 70-year-old women. Localisation
of type IV collagen expression was studied by immunoflu-
orescence (figure 1A). Type IV collagen was localised to
blood vessels and the dermo-epidermal junction (DEJ).
Invagination of the basement membrane decreased rela-
tive to age (figure 1B). Image analysis of the skin sections
demonstrated that DEJ type IV collagen decreased by 36%
in the skin of women aged 50-70 versus 30-50 (figure 1C).
Aging decreases type IV collagen, TGF1
and TGFRII expression in dermal fibroblasts
Fibroblasts were isolated from breast skin fragments
derived from 30 to 70-year-old women. Type IV
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
EJD, vol. 26, n4, July-August 2016 353
B
A
C
1.5
1.0
0.5
0.0 31-40 51-60
***
***
***
41-50 61-70
Age (years)
Basement membrane
invagination (A.U.)
Type IV collagen
quantification (A.U.)
30-50 50-70
***
Age (years)
0
2
4
5
6
3
1
35 years 65 years
BM BM
Figure 1. Quantification of type IV collagen in skin basement membrane. A) Frozen skin sections were immunostained with
an anti-collagen IV primary antibody; scale bar: 1 mm. B) Quantification of basement membrane (BM) invaginations relative to
age. C) Quantification of type IV collagen in the DEJ using an image processing program based on ImageJ application.
For each age group, n= 16; ***p<0.001.
collagen gene expression was studied by real-time PCR;
1(IV) chain expression was decreased by 66% in
women aged 50-70 versus 30-50 (figure 2A) and this
was also the case for 2(IV) chain expression (data
not shown). 5(IV) and 6(IV) chains were expressed
at a much lower level compared to 1(IV) and 2(IV)
chains (data not shown). Type IV collagen protein
level was quantified by ELISA, and was shown to
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
354 EJD, vol. 26, n4, July-August 2016
CD
AB
α1(IV)/GAPDH (x10-2)
2.500
2.000
1.500
1.000
0.250
0.125
30-50 50-70
***
Age (years)
0.500
Collagen IV (pg/mL)
0.4
0.3
0.2
0.1
0.0
30-50 50-70
**
Age (years)
TGFβ1/GAPDH
0.3
0.2
0.0
30-50 50-70
**
Age (years)
0.1
TGFβRII/GAPDH
Age (years)
0.8
0.6
0.4
0.2
0.0
30-50 50-70
***
Figure 2. Quantification of type IV collagen expression in fibroblasts. Fibroblasts were isolated from breast fragments derived
from 30 to 70-year-old women. A) Type IV collagen gene expression was investigated by real-time PCR. B) Protein expression
was measured by ELISA. TGF-1(C) and TGFRII (D) gene expression analysed by real-time PCR. For each age group, n= 16;
**p<0.005; ***p<0.001.
decrease by 35% in women aged 50-70 versus 30-50
(figure 2B).
Since TGF-1 is reported to modulate type IV collagen and
1(I) collagen synthesis in mouse embryonic fibroblasts,
we investigated TGF1 and TGFRII gene expression
for both age groups. TGF1 and TGFRII mRNA levels
decreased by 68% and 70%, respectively, in women aged
50-70 versus 30-50 (figure 2D).
Induction of SIPS phenotype
in dermal fibroblasts
We then studied type IV collagen expression in a model
of accelerated senescence. Fibroblasts were treated for
48 hours with 0 to 200 MH
2O2and cell viability was
assessed using the trypan blue exclusion test (figure 3A).
Treatments with 50 and 100 MH
2O2did not alter
cell viability (98.8% and 97.3% viability, respectively).
A 200-MH
2O2treatment decreased cell viability
(84.6% viability). We decided to use 50 and 100 M
H2O2to induce cell senescence without affecting cell
viability. Fibroblast morphology was analysed using an
inverted microscope. After treatment with 50 MH
2O2,
cells appeared slightly flattened and this morphology
was exaggerated after treatment with 100 MH
2O2
(figure 3B). To confirm the senescent phenotype, SA--Gal
activity was measured. Treatment with 50 MH
2O2
triggered an increase in SA--Gal activity that was
slightly amplified after treatment with 100 MH
2O2
(figure 3C). Cellular senescence is also reported to be char-
acterised by a reduced proliferation rate and an increase
in p21Waf-1 expression. p21Waf-1 expression, analysed
by real-time PCR, was increased by 42.2 % and 78.1%
after treatments with 50 and 100 MH
2O2, respectively
(figure 3D). A decrease in type I collagen expression and
increase in MMP-1 expression were reported in senescent
fibroblasts. Based on real-time PCR analysis, we demon-
strated that 50-M and 100-MH
2O2treatments decreased
COL1A1 expression by 60.8% and 88.2%, respectively
(figure 3E), whereas MMP-1 expression, also determined
by real-time PCR, was increased by 42% and 73% in
the presence of 50 M and 100 MH
2O2treatments,
respectively (figure 3F). Collectively, these results confirm
that treatment with 100 MH
2O2induces a senescent
phenotype in fibroblasts without affecting cell viability.
Inhibition of collagen IV expression
in fibroblasts after H2O2treatment
Type IV collagen gene expression was studied in the
SIPS model by real-time PCR. COL4A1 gene expres-
sion was significantly decreased after treatment with
50 and 100 MH
2O2(-35.4% and -50.6%, respec-
tively) (figure 4A). COL4A2 gene expression was similarly
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
EJD, vol. 26, n4, July-August 2016 355
C
0 50 100
B
A120
100
Viabiliy (%)
100 150 200
80
60
50
40
20
0
0
0 50 100
[H2O2] (μM)
[H2O2] (μM)
[H2O2] (μM)
F
D
10050
0.14
0
p21WAF -/GAPDH
0.00
0.02
0.04
0.06
0.08
0.10
0.12 **
***
[H2O2] (μM) [H2O2] (μM)[H2O2] (μM)
E
10050
0.80
0
α1(I)/GAPDH
0.00
0.10
0.20
0.30
0.40
0.50
0.60
0.70
***
***
MMP-1/GAPDH
10050
0.00
0.02
0.04
0.06
0.08
0.10
0.12
0.14
0
***
***
Figure 3. Validation of the fibroblast senescent phenotype after H2O2treatment. A) Cell viability assessed by trypan blue
exclusion. B) Cell morphology observed under an inverted microscope; scale bar: 10 m. C) SA--Gal activity observed under
an inverted microscope; senescent cells are stained blue; scale bar: 10 m. Real-time PCR of p21Waf-1 (D), COL1A1 (E), and
MMP-1 (F). Results are expressed as mean ±SD; **p<0.005; ***p<0.001.
decreased (data not shown). The level of type IV collagen
in the SIPS model was also analysed by western blot. The
level of type IV collagen was significantly decreased after
treatment with 50 and 100 MH
2O2(-30.5% and -49.1%,
respectively) (figure 4B).
Effect of exogenous TGF-1 and
TGF-1-neutralizing antibody on type IV
collagen in normal dermal fibroblasts
We tested the effect of TGF-1 on type IV colla-
gen expression in normal dermalfibroblasts. COL4A1
gene expression, analysed by real-time PCR, was
increased in response to TGF-1 in a dose-dependent
manner. The effect was significant above a threshold
of 0.5 ng/mL and increased progressively with a max-
imal stimulation at 10 ng/mL (figure 5A). Collagen IV,
analysed by western blotting, was significantly increased
above a threshold of 0.5 ng/mL and increased pro-
gressively with a maximal stimulation at 10 ng/mL
(figure 5B).
Normal dermal fibroblasts were incubated with or with-
out TGF-1-neutralizing antibody for 48 hours. The level
of collagen IV, analysed by western blotting, was signifi-
cantly decreased in the presence of the blocking antibody
(figure 6).
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
356 EJD, vol. 26, n4, July-August 2016
0.0
0.5
1.0
1.5
2.0
2.5
3.0
A
α1(IV)/GAPDH (x10
-2
)
**
**
500 100
[H2O2] (μM)
[H2O2] (μM)
B
500 100
Coomassie blue staining
[H2O2] (μM)
Collagen IV
50
0 100
Western blot
[H2O2] (μM)
0
***
**
0,0000
0,0010
Collagen IV/total protein
0,0015
0,0020
0,0025
0,0005
50 100
Figure 4. Type IV collagen expression in fibroblasts after H2O2treatment. Fibroblasts were incubated with 0, 50 or 100 M
H2O2for 1 hour and 30 minutes, washed, and further incubated for 48 hours. A)COL4A1 gene expression measured by real-time
PCR. B) Type IV collagen protein analysed by western blotting and quantified; the membrane was stained with Coomassie blue
to control for loaded protein. Results are expressed as mean ±SD; **p<0.005; ***p<0.001.
Effect of TGF-1 on type IV collagen
expression in senescent fibroblasts
Fibroblasts were treated with 100 MH
2O2for 1 hour and
30 minutes. The medium was then removed and cells were
incubated without H2O2for 48 hours until induction of
senescence. Type IV collagen gene and protein levels were
shown to decrease after 48 hours (figure 7A, B). Senes-
cent cells were further treated with or without TGF-1
(10 ng/mL). TGF-1 treatment completely restored type
IV collagen gene and protein expression in the senescent
fibroblasts (figure 7C, D).
Discussion
During aging, the extracellular matrix undergoes significant
alterations. Using immunohistochemistry and transmission
electron microscopy, Vazquez et al showed that type IV
collagen was decreased with aging in skin samples, taken
from a site 6 cm above the pubic symphysis of women
from 35 to 60 years old [24]. Le Varlet et al. also stud-
ied the influence of donor age on collagen expression in
post-auricular skin biopsies from four donors (women aged
10, 35, 50, and 64, respectively). Post-embedding type IV
collagen immunostaining and image analysis showed less
type IV collagen in adult dermo-epidermal junctions [25].
In the current study, we confirmed the decrease in type
IV collagen in the skin basement membrane of women
aged 50-70 compared to women aged 30-50. As type IV
collagen from the dermo-epidermal junction is mainly pro-
duced by fibroblasts [22, 23], we studied type IV collagen
expression in fibroblasts derived from women aged 30-70
years. 1(IV) chain gene expression decreased in women
aged 50-70, compared to women aged 30-50, and a sim-
ilar decrease in 2(IV) chain gene expression was also
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
EJD, vol. 26, n4, July-August 2016 357
A
TGF-β1 (ng/mL)
0.50
0
5
10
15
20
25
30
35
40
α1(IV)/GAPDH X10-2
1 2.5 5 10
***
***
***
**
BCoomassie blue staining
TGF-β1 (ng/mL)
0 0,5 1 2,5 5 100
Collagen IV
Western blot
TGF-β1 (ng/mL)
0,5 1 2,5 5 10
0.0014
0.0012
TGF-β1 (ng/mL)
Collagen IV/total protein
0.50
*
**
***
***
***
1 2.5 5 10
0.0010
0.0008
0.0006
0.0004
0.0002
0.0000
Figure 5. Stimulation of type IV collagen expression by TGF-1 in normal fibroblasts. Fibroblasts were stimulated with increasing
concentrations of TGF-1 for 48 hours. A)COL4A1 gene expression measured by real-time PCR. B) Protein analysed by western
blotting and quantified; the membrane was stained with Coomassie blue to control for loaded protein. Results are expressed as
mean ±SD; *p<0.01; **p<0.005; ***p<0.001.
observed (data not shown). This result is not surprising,
as both genes are under the control of a bidirectional pro-
moter [17]. 5(IV) and 6(IV) chains were expressed at a
much lower level, compared to 1(IV) and 2(IV) chains
(data not shown). This may explain the skin basement
membrane type IV collagen decrease with aging. Previ-
ous studies from Mori et al. [13] reported a decrease in
1(I) collagen, TGF-1, and TGF-receptor II (62%,
62% and 59%, respectively) in late-passage, compared
to early-passage, fibroblasts, suggesting that TGF-sig-
nalling plays a critical role in collagen I regulation. We
have confirmed the decrease in TGF-1 and TGF-RII in
aged-fibroblasts.
Since it appears to be difficult to study type IV collagen
regulation relative to aging in fibroblasts from patients due
to inter-individual variation, we decided to study type IV
expression in a model of accelerated fibroblast senescence.
We developed a stress-induced model of cell senescence
based on H2O2treatment. The senescent phenotype was
assessed using different methods. During cellular senes-
cence, normal human fibroblasts change their morphology
from a spindle shape to an enlarged, flattened and irregular
shape [4]. These alterations were clearly observed in our
model. In addition, an increase in SA--Gal activity was
reported [5-7], which we also observed in our model.
Cellular senescence is also characterised by a reduced rate
of proliferation, an increased number of cells in G0-G1, and
consequently an increase in p21Waf-1 expression [8]. We
observed an increase in p21Waf-1 expression in our model.
Collectively, our results confirm the senescent phenotype of
fibroblasts treated with 100 MH
2O2. A change in matrix
macromolecule expression was also reported in stress-
induced fibroblasts, such as a decrease in type I collagen
expression [10] and an increase in MMP-1 expression [9].
Our results are consistent with those previously reported
and validate our aging model. We found that type IV
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
358 EJD, vol. 26, n4, July-August 2016
Control
TGF-β1 neutr. Ab
Irrelevent Ab
Coomassie blue stainingWestern blot
Collagen IV
Control
TGF-β1 neutr. Ab
Irrelevent Ab
0.0030
***
0.0025
0.0020
0.0015
0.0010
0.0005
0.0000
Control
Collagen IV/total protein
TGF-β1 neutr. Ab
Irrelevent Ab
Figure 6. Decrease in type IV collagen expression in normal fibroblasts in the presence of TGF-1-neutralizing antibody.
Fibroblasts were incubated without antibody (control), with 1 g/mL TGF-1-neutralizing antibody (TGF-1-neutr. Ab) or
with 1 g/mL IgG1 (irrelevant Ab) for 48 hours. The level of collagen IV was analysed by western blotting and quantified; the
membrane was stained with Coomassie blue to control for loaded protein. Results are expressed as mean ±SD; ***p<0.001.
collagen expression was largely decreased after
H2O2treatment. This result suggests that the decrease in
basement membrane type IV collagen expression in the
skin could be due, at least in part, to a decrease in type
IV collagen expression in senescent dermal fibroblasts.
It was previously reported that such senescent cells exist
and accumulate with age in vivo [26]. We then tested the
effect of TGF-1 on type IV collagen expression in dermal
fibroblasts and found that TGF-1 largely increased type
IV collagen expression. This is in accordance with previous
results which showed that TGF-1 stimulates type IV col-
lagen expression in murine mesangial cells [15] and mouse
embryo NIH-3T3 fibroblasts [16]. Moreover, incubation
of normal dermal fibroblasts with TGF-1-neutralizing
antibody led to a decrease in collagen IV expression and
this highlights the involvement of TGF-1 in the control
of type IV collagen levels. We tested the effect of TGF-1
in the SIPS model and found that TGF-1 restored type
IV collagen expression under these conditions. The level
of TGF-1 was reported to decrease during fibroblast
replicative senescence [27]. Taken together, the results
suggest that type IV collagen decrease with aging involves
a TGFsignalling pathway.
Future research, following on from this study, should aim to
elucidate the mechanisms leading to collagen IV decrease at
the dermo-epidermal junction level with a view to propos-
ing strategies to restore expression, and at the same time,
maintain the integrity of the dermo-epidermal basement
membrane during aging. The SIPS model of dermal fibrob-
lasts thus represents a simple model to study type IV
collagen regulation over a relatively short period of time
in response to bioactive compounds for cosmetic purposes.
A similar decrease in collagen IV expression was obtained
in a replicative senescence model, based on cell cultures
from different passages (figure 8), however, this model is
less suited to rapid screening.
Non-collagenous NC1(1[IV]) (arresten) and
NC1(2[IV]) (canstatin) domains have anti-angiogenic
and/or anti-tumour properties [28]. The reduced level of
type IV collagen expression in the DEJ could therefore
play a role in the development of skin cancer in the elderly.
Further elucidation of these molecular mechanisms may
provide clues for future oncologic treatment.
Since type IV collagen chains are reported to be produced
largely by fibroblasts in an in vitro skin model [15], we
focused on type IV expression in fibroblasts during phys-
iological aging. Nevertheless, type IV collagen is also
expressed in keratinocytes and preliminary studies per-
formed in our laboratory demonstrate that COL4A1 and
COL4A2 gene expression is also decreased in aged ker-
atinocytes, even though these cells appear to produce five
times less type IV collagen relative to fibroblasts (data not
shown).
Disclosure. Financial support: This work was sup-
ported by the CNRS (PIR Longévité et vieillissement), the
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
EJD, vol. 26, n4, July-August 2016 359
0
3.0
2.5
2.0
1.5
1.0
0.5
0.0
100
t = 48h
**
H2O2 (μM)
H2O2 (μM) H2O2 (μM)
α1(IV)/GAPDH (x10-2)
A
0
3.0
2.5
2.0
1.5
1.0
0.5
0.0
100
TGF-β1 (ng/mL)
α1(IV)/GAPDH (x10-2)
t = 96h
***
C
Coomassie
blue staining
010
TGF-β1 (ng/mL)
D
10
Western blot
0
TGF-β1 (ng/mL)
Collagen IV
Collagen IV/total protein
0.0030
0.0025
0.0020
0.0015
0.0010
0.0005
0.0000
***
Coomassie
blue staining
0100
B
100
Western blot
Collagen IV
0
Collagen IV/total protein
***
0.0030
0.0025
0.0020
0.0015
0.0010
0.0005
0.0000
Figure 7. Restoration of type IV collagen expression by TGF-1 in senescent fibroblasts. Fibroblasts were incubated with
100 MH
2O2for 1 hour and 30 minutes, washed, and further incubated for 48 hours. A)COL4A1 gene expression at 48 hours
measured by real-time PCR. B) Protein analysed by western blotting and quantified. At the end of the first 48-hour incubation
period, the senescent fibroblasts were then treated with 10 ng/mL TGF-1 for another 48-hour incubation period. C)COL4A1
gene expression was measured after the 48-hour incubation period (total incubation time: 96 hours). D) Protein was analysed by
western blotting after a 48-hour incubation period (total incubation time: 96 hours) and quantified; the membranes were stained
with Coomassie blue to control for loaded protein. Results are expressed as mean ±SD; **p<0.005; ***p<0.001.
0.10
α1(IV)/GAPDH
0.08
0.06
0.04
0.02
0.00
410
Number of passage
0.12
α2(IV)/GAPDH
0.10
0.08
0.06
0.04
0.02
0.00 410
***
***
Number of passage
Figure 8. 1 (IV) and 2 (IV) gene expressions were studied by real time PCR in 4-passage and 10-passage fibroblat cultures.
*** p<0.001.
Author offprint
© John Libbey Eurotext, 2016
Journal Identification = EJD Article Identification = 2782 Date: August 2, 2016 Time: 2:57pm
360 EJD, vol. 26, n4, July-August 2016
University of Reims Champagne-Ardenne. Jezabel FERU
was a PhD student with a fellowship from the Région
Champagne-Ardenne. Conflict of interest: none.
References
1. Harman D. The free radical theory of aging. Antioxid Redox Signal
2003; 5: 557-61.
2. Long YC, Tan TM, Takao I, Tang BL. The biochemistry and cell biol-
ogy of aging: metabolic regulation through mitochondrial signaling.
Am J Physiol Endocrinol Metab 2014; 306: E581-91.
3. Bladier C, Wolvetang EJ, Hutchinson P, de Haan JB, Kola I.
Response of a primary human fibroblast cell line to H2O2: senescence-
like growth arrest or apoptosis? Cell Growth Differ 1997; 8: 589-98.
4. Chen QM, Tu VC, Catania J, Burton M, Toussaint O, Dilley T.
Involvement of Rb family proteins, focal adhesion proteins and protein
synthesis in senescent morphogenesis induced by hydrogen peroxide.
J Cell Sci 2000; 113: 4087-97.
5. Lee BY, Han JA, Im JS, et al. Senescence-associated beta-
galactosidase is lysosomal beta-galactosidase. Aging Cell
2006; 5: 187-95.
6. Maier AB, Westendorp RG, Van Heemst D. Beta-galactosidase
activity as a biomarker of replicative senescence during the course
of human fibroblast cultures. Ann N Y Acad Sci 2007; 1100: 323-32.
7. Itahana K, Campisi J, Dimri GP. Methods to detect biomarkers of cel-
lular senescence: the senescence-associated beta-galactosidase assay.
Methods Mol Biol 2007; 371: 21-31.
8. Chen QM. Replicative senescence and oxidant-induced premature
senescence. Beyond the control of cell cycle checkpoints. Ann N Y
Acad Sci 2000; 908: 111-25.
9. Brenneisen P, Briviba K, Wlaschek M, Wenk J, Scharffetter-
Kochanek K. Hydrogen peroxide (H2O2) increases the steady-state
mRNA levels of collagenase/MMP-1 in human dermal fibroblasts. Free
Radic Biol Med 1997; 22: 515-24.
10. Bigot N, Beauchef G, Hervieu M, et al. NF-B accumulation
associated with COL1A1 transactivators defects during chronological
aging represses type I collagen expression through a -112/-61-bp
region of the COL1A1 promoter in human skin fibroblasts. J Invest
Dermatol 2012; 132: 2360-7.
11. Rolfe KJ, Irvine LM, Grobbelaar AO, Linge C. Differential gene
expression in response to transforming growth factor-beta1 by fetal
and postnatal dermal fibroblasts. Wound Repair Regen 2007;15: 897-
906.
12. Chen SJ, Yuan W, Mori Y, Levenson A, Trojanowska M, Varga J.
Stimulation of type I collagen transcription in human skin fibroblasts by
TGF-beta: involvement of Smad 3. J Invest Dermatol 1999; 112: 49-57.
13. Mori Y, Hatamochi A, Arakawa M, Ueki H. Reduced expression
of mRNA for transforming growth factor beta (TGF beta) and TGF beta
receptors I and II and decreased TGF beta binding to the receptors in
in vitro-aged fibroblasts. Arch Dermatol Res 1998; 290: 158-62.
14. Quan T, Shao Y, He T, Voorhees JJ, Fisher GJ. Reduced expression
of connective tissue growth factor (CTGF/CCN2) mediates colla-
gen loss in chronologically aged human skin. J Invest Dermatol
2010; 130: 415-24.
15. Silbiger S, Lei J, Ziyadeh FN, Neugarten J. Estradiol reverses
TGF-beta1-stimulated type IV collagen gene transcription in murine
mesangial cells. Am J Physiol 1998; 274: 1113-8.
16. Grande J, Melder D, Zinsmeister A, Killen P. Transforming growth
factor-beta 1 induces collagen IV gene expression in NIH-3T3 cells.
Lab Invest 1993; 69: 387-95.
17. Hudson BG, Reeders ST, Tryggvason K. Type IV collagen: struc-
ture, gene organization, and role in human diseases. Molecular basis
of Goodpasture and Alport syndromes and diffuse leiomyomatosis.J
Biol Chem 1993; 268: 26033-6.
18. LeBleu VS, Macdonald B, Kalluri R. Structure and function of base-
ment membranes. Exp Biol Med (Maywood) 2007; 232: 1121-9.
19. Tanaka K, Iyama K, Kitaoka M, et al. Differential expression
of alpha 1(IV), alpha 2(IV), alpha 5(IV) and alpha 6(IV) collagen
chains in the basement membrane of basal cell carcinoma. Histochem
J1997; 29: 563-70.
20. Tanaka N, Tajima S, Ishibashi A, et al. Expression of the alpha1-
alpha6 collagen IV chains in the dermoepidermal junction during
human foetal skin development: temporal and spatial expression of
the alpha4 collagen IV chain in an early stage of development.BrJ
Dermatol 1997; 139: 371-4.
21. Hasegawa H, Naito I, Nakano K, et al. The distributions of type
IV collagen alpha chains in basement membranes of human epidermis
and skin appendages. Arch Histol Cytol 2007; 70: 255-65.
22. Fleischmajer R, Kuhn K, Sato Y, et al. There is temporal and spatial
expression of alpha1 (IV), alpha2 (IV), alpha5 (IV), alpha6 (IV) colla-
gen chains and beta 1 integrins during the development of the basal
lamina in an “in vitro” skin model. J Invest Dermatol 1997; 109: 527-
33.
23. Sasaki S, Zhou B, Fan WW, et al. Expression of mRNA for type
IV collagen alpha1, alpha5 and alpha6 chains by cultured dermal
fibroblasts from patients with X-linked Alport syndrome. Matrix Biol
1998; 17: 279-91.
24. Vázquez F, Palacios S, Alema˜
n N, Guerrero F. Changes of the
basement membrane and type IV collagen in human skin during aging.
Maturitas 1996; 25: 209-15.
25. Le Varlet B, Chaudagne C, Saunois A, et al. Age-related functional
and structural changes in human dermo-epidermal junction compo-
nents. J Investig Dermatol Symp Proc 1998; 3: 172-9.
26. Dimri GP, Lee X, Basile G, et al. A biomarker that identifies senes-
cent human cells in culture and in aging skin in vivo. Proc Natl Acad
Sci USA 1995; 92: 9363-7.
27. Zeng G, McCue HM, Mastrangelo L, Millis AJ. Endogenous
TGF-beta activity is modified during cellular aging: effects on metal-
loproteinase and TIMP-1 expression. Exp Cell Res 1996; 228: 271-6.
28. Monboisse JC, Oudart JB, Ramont L, Brassart-Pasco S, Maquart
FX. Matrikines from basement membrane collagens: a new anti-cancer
strategy. Biochim Biophys Acta 2014; 1840: 2589-98.
Author offprint
... 8 It is also a major component of the dermo-epidermal junction, where it is thought to be important in the skin aging process. 9,10 In addition, it is crucial in a range of physiological processes 11 including cell adhesion, migration, differentiation, 12 tissue regeneration, 13 embryogenesis, 8 and would healing. 8 Furthermore, it has been shown to also regulate angiogenesis for the growth and remodeling of new vessels, 14 Due to these varied and life-crucial roles, even minor structural differences or damage in collagen IV could lead to many different clinical diseases. ...
Article
Full-text available
Collagen IV networks are an essential component of basement membranes that are important for their structural integrity and thus that of an organism's tissues. Improper functioning of these networks has been associated with several diseases. Cross-links, such as sulfilimine bonds interconnecting NC1 domains, are critical for forming and mechanically stabilizing these collagen IV networks. More specifically, the sulfilimine cross-links form between methionine (Met93) and lysine/hydroxylsine (Lys211/Hyl211) residues of NC1 domains. Therefore, the dynamic nature of the sulfilimine bond in collagen IV is crucial for network formation. To understand the dynamic nature of a neutral and protonated sulfilimine bond in collagen IV, we performed molecular dynamics (MD) simulations on four sulfilimine cross-linked systems (i.e., Met93S-NLys211, Met93S-NHLys211 +, Met93S-NHyl211, and Met93S-NHHyl211 +) of collagen IV. The MD results showed that the neutral Met93S-NLys211 system has the smallest protein backbone and showed the cross-linked residues' RMSD value. The conformational change analyses showed that the conformations of the sulfilimine cross-linked residues take on a U-shape for the Met93S-NHyl211 and Met93S-HNHyl211 + systems, whereas the conformations of the sulfilimine cross-linked residues are more open for the Met93S-NLys211, and Met93S-NHLys211 + systems. Protonation is a crucial biochemical process to stabilize the protein structure or the biological cross-links. Furthermore, the protonation of the sulfilimine bond could potentially influence hydrogen bond interaction with near amino acid residues, and according to water distribution analyses, the sulfilimine bond can potentially exist in one or more protonation states.
... Even though less well-established in literature, increased expression of CH3L1 and ECM-1 has been linked to liver and cardiac aging, respectively [60,61]. Consistently, a decreased expression of collagen IV has been identified in senescent dermal fibroblasts [62]. Therefore, these proteomic profile differences are in line with a rejuvenated signature of iMSCs. ...
Article
Full-text available
Mesenchymal stem cells (MSCs) hold promising therapeutic potential in several clinical applications, mainly due to their paracrine activity. The implementation of future secretome-based therapeutic strategies requires the use of easily accessible MSCs sources that provide high numbers of cells with homogenous characteristics. MSCs obtained from induced pluripotent stem cells (iMSCs) have been put forward as an advantageous alternative to the gold-standard tissue sources, such as bone marrow (BM-MSCs). In this study, we aimed at comparing the secretome of BM-MSCs and iMSCs over long-term culture. For that, we performed a broad characterization of both sources regarding their identity, proteomic secretome analysis, as well as replicative senescence and associated phenotypes, including its effects on MSCs secretome composition and immunomodulatory action. Our results evidence a rejuvenated phenotype of iMSCs, which is translated into a superior proliferative capacity before the induction of replicative senescence. Despite this significant difference between iMSCs and BM-MSCs proliferation, both untargeted and targeted proteomic analysis revealed a similar secretome composition for both sources in pre-senescent and senescent states. These results suggest that shifting from the use of BM-MSCs to a more advantageous source, like iMSCs, may yield similar therapeutic effects as identified over the past years for this gold-standard MSC source. Graphical Abstract
... This indeed turned out to be the case at the transcriptional level in human full thickness skin substitutes and was further confirmed at the protein level in normal adult human dermal fibroblast culture ( Figure S5B). Type IV collagen is an essential component of the dermalepidermal junction, shown to be decreased in aged (Roig-Rosello and Rousselle 2020; Feru et al. 2016) and diseased (atopic dermatitis; Kim et al. 2018) skin. Bakusylan, which was found to upregulate this basement membrane component, could potentially provide relief from both conditions, although additional studies are necessary to determine whether these in vitro findings translate into clinical anti-aging and skinregenerative benefits. ...
Article
Bakusylan (bakuchiol salicylate) is a bipartite compound obtained by merging two skin-active entities with complementary bioactivities-bakuchiol and salicylic acid-for the purpose of generating a new class of functional retinoids with enhanced skin benefits. Here, we describe its preparation process and report that pure bakusylan exhibits potential for an improved permeation through the stratum corneum, enhances type IV collagen gene expression in organotypic skin substitutes containing both epidermal and dermal layers, and upregulates this protein in adult human dermal fibroblast cultures. The mechanism of action underlying these effects appears to involve the components of the IP3K/Akt signaling pathway selectively implicated in the maintenance of skin integrity, further underlying the suitability of this ester for skin care applications requiring enhanced cutaneous permeation targeting the dermal-epidermal junction.
... Studies have shown that wrinkles in human skin depend on either the deteriorated moisturizing ability of collagen or its reduced expression and the resultant intra-/intermolecular cross-linkage [3,7,8,10,21,22]. In human artificial three-dimensional skin, type I collagen is known to be widely distributed inside the dermis [10,19,23,25]; meanwhile, type IV collagen is localized inside the basement membrane that connects the dermis and the epidermis [22,29]. The "basement membrane" forms a "scaffold" for the growth of keratinocytes that occupy most of the epidermis, and type IV collagen creates a lattice-like structure that becomes the basement membrane. ...
Article
Full-text available
Hydrogen-rich warm water (HW) has not been verified yet for skin anti-aging effects. Daily 10 min HW (dissolved hydrogen: 338–682 μg/mL, 41 °C) bathing and skin poultice with HW-impregnated towels for 11–61 days were demonstrated to improve wrinkle degrees (29 skin-loci) from 3.14 ± 0.52 to 1.52 ± 0.74 (p < 0.001) and blotch degrees (23 loci) from 3.48 ± 0.67 to 1.74 ± 0.86 (p < 0.001) in five healthy subjects (49–66 years old), by densito-/planimetrically evaluating with an Image-J software, and ranked into six hierarchies (0, 1–5). Meanwhile, skin oiliness was evaluated to increase for the oil-poor skins, but inversely decrease for excessively oily skins, suggesting the HW’s function as skin-oiliness modulation, with an appreciably negative correlation in prior oiliness contents versus change after HW application (r = −0.345, 23 loci). Skin moisture increased upon HW application, with a negative correlation (r = −0.090, 23 loci) in prior moisture contents versus post-HW-application moisture-changing rates, meaning that HW application compensated moisture for water-deficient skins (27.5–40% moisture), but not for wet skins (>41% moisture). Thus, the HW bath together with HW poultice exerted beneficial effects on skin appearances such as wrinkles, blotches and moisture/oiliness, some of which might ensue from enhanced antioxidant ability in blood, as was previously demonstrated for the HW bath.
... Air pollution, smoking, poor nutrition and sun exposure are extrinsic ageing factors that result in crepey skin, loss of elasticity, increase in sagging and roughtextured appearance [7,8]. With advancing age, there is a decrease in the collagen IV expression of matured dermal fibroblasts [9]. Furthermore, a previous immunohistochemical study revealed that significant reduction in the levels of collagen IV in non-photodamaged skin of older individuals (mean age: 71.5 years) compared with the younger individuals (mean age: 23.4 years) [10]. ...
Article
Full-text available
Introduction: Peroxisome proliferator-activated receptor (PPAR) agonists are known to modulate the synthesis of dermal lipids and proteins including collagens. Olive (Olea europaea) leaves have been reported to contain PPAR-binding ligands. Collagen IV, a major dermal-epidermal junction (DEJ) protein, degrades with both age and disease. Here, we report the formulation of a novel multi-ligand complex, Linefade, and its effects on collagen IV synthesis. Methods: Linefade prepared from the leaves of Olea europaea contains 2% w/w plant extract solids dissolved in a mixture of glyceryl monoricinoleate and dimethyl isosorbide. In silico docking was performed with PPAR-α (PDB ID: 2P54). Linefade was evaluated for PPAR-α-dependent transcription in a luciferase reporter assay system. Cell viability and collagen IV levels in human dermal fibroblast cultures were measured using the MTT method and ELISA assay, respectively. Transcriptome analysis was conducted on a full-thickness reconstituted human skin (EpiDermFT) model. Ex vivo cell viability and collagen IV immunostaining were performed on human skin explants. Results: In silico docking model of the major constituents (oleanolic acid and glyceryl monoricinoleate) produced a co-binding affinity of -6.7 Kcal/mole. Linefade significantly increased PPAR-α transcriptional activity in CHO cells and collagen IV synthesis in adult human dermal fibroblasts. Transcriptome analysis revealed that 1% Linefade modulated the expression of 280 genes with some related to epidermal differentiation, DEJ, PPAR, Nrf2 and retinoid pathways. An ex vivo human explant study showed that 1% Linefade, delivered via a triglycerides excipient, increased collagen IV levels along the dermal-epidermal junction by 52%. Conclusion: In silico modelling and in vitro and ex vivo analyses confirmed Linefade-mediated activation of PPAR-α and stimulation of collagen IV synthesis.
... The effect of aging on the matrisome of mammary gland has not been well-studied, but cytokine levels are known to increase with age in other tissues, [1,5,23] and collagen I and IV, laminin 1 (Ln), and periostin (Postn) to decrease. [24][25][26] Our data show that the levels of Cd14, Cd40, Ccl21, complement factor D (Cfd), endostatin (Col18a1), cystatin C (Cst3), myeloperoxidase (Mpo), and fetuin A (Ahsg) were elevated with age, and this trend was preserved after decellularization/delipidation, although total cytokine levels decreased compared to native tissue ( Figure 1E, and Figure S1C and Table S1, Supporting Information). We also tested the release of these cytokines from the decellularized matrices. ...
Article
Full-text available
Age is a major risk factor for cancer. While the importance of age related genetic alterations in cells on cancer progression is well documented, the effect of aging extracellular matrix (ECM) has been overlooked. This study shows that the aging breast ECM alone is sufficient to drive normal human mammary epithelial cells (KTB21) to a more invasive and cancer‐like phenotype, while promoting motility and invasiveness in MDA‐MB‐231 cells. Decellularized breast matrix from aged mice leads to loss of E‐cadherin membrane localization in KTB21 cells, increased cell motility and invasion, and increased production of inflammatory cytokines and cancer‐related proteins. The aged matrix upregulates cancer‐related genes in KTB21 cells and enriches a cell subpopulation highly expressing epithelial‐mesenchymal transition‐related genes. Lysyl oxidase knockdown reverts the aged matrix‐induced changes to the young levels; it relocalizes E‐cadherin to cell membrane, and reduces cell motility, invasion, and cytokine production. These results show for the first time that the aging ECM harbors key biochemical, physical, and mechanical cues contributing to invasive and cancer‐like behavior in healthy and cancer mammary cells. Differential response of cells to young and aged ECMs can lead to identification of new targets for cancer treatment and prevention.
Article
Lycopene as a natural antioxidant that have been studied for ultraviolet radiation (UVR) photo protection and is one of the most effective carotenoids to scavenge reactive oxygen species (ROS). This review aims to summarize the protective effect of tomato and lycopene on skin photo damage and skin photoaging in healthy subjects by reviewing the existing population intervention experiments. A total of five electronic databases including PubMed, Scopus, EBSCO, Web of Science and Cochrane Library were searched from inceptions to January 2021 without any restriction. Out of 19336 publications identified, 21 fulfilled the inclusion criteria and were meta-analysis. Overall, interventions supplementing tomato and lycopene were associated with significant reductions in Δa*, MMP-1, ICAM-1 and skin pigmentation; while tomato and lycopene supplementation were associated with significant increase in MED, skin thickness and skin density. Based on the results of this systematic review and meta-analysis, supplementation with tomato and lycopene could reduce skin erythema formation and improve the appearance and pigmentation of the skin, thereby preventing light-induced skin photodamage and skin photoaging. Lycopene-rich products could be used as endogenous sun protection and may be a potential nutraceutical for sun protection.
Article
With age, the dermal‑epidermal junction (DEJ) becomes thinner and production of its protein components decreases; this may be associated with increased fragility and wrinkling of skin. Topical treatment with palmitoyl‑Arg‑Gly‑Asp (PAL‑RGD) improves facial wrinkles, skin elasticity and dermal density in humans. In the present study, the effect of PAL‑RGD on expression of DEJ components, such as laminin and collagen, was assessed. Human HaCaT keratinocytes were treated with PAL‑RGD. The protein expression levels of laminin‑332, collagen IV and collagen XVII were examined by western blotting. Reverse transcription-quantitative PCR was used to analyze laminin subunit (LAM)A3, LAMB3, LAMC2, collagen type IV α 1 chain (COL4A1) and COL17A1 mRNA expression levels. Western blot analysis showed that the expression levels of proteins comprising the DEJ, including laminin α3, β3 and γ2 and collagen IV and XVII demonstrated a significant dose‑dependent increase following PAL‑RGD treatment. Furthermore, PAL‑RGD treatment significantly enhanced LAMA3, LAMB3, LAMC2, COL4A1 and COL17A1 mRNA expression levels. PAL‑RGD may enhance the DEJ by inducing the expression of laminin‑332, collagen IV and collagen XVII.
Article
Aging of the skin is accompanied by cellular as well as tissue environmental changes, ultimately reducing the ability of the tissue to regenerate and adequately respond to external stressors. Macrophages are important gatekeepers of tissue homeostasis, and it has been reported that their number and phenotype change upon aging in a site-specific manner. How aging affects human skin macrophages and what implications this has for the aging process in the tissue is still not fully understood. Using scRNA-seq analysis, we show that there is an at least 50% increase of macrophages in human aged skin, which appear to have developed from monocytes and exhibit more pro-inflammatory M1-like characteristics. In contrast, the cell-intrinsic ability of aged monocytes to differentiate into M1 macrophages was reduced. Using co-culture experiments with aged dermal fibroblasts, we demonstrate that it is the aged microenvironment that drives a more pro-inflammatory phenotype of macrophages in the skin. This pro-inflammatory M1-like phenotype in turn negatively influenced the expression of extracellular matrix proteins by fibroblasts, emphasizing the impact of the aged macrophages on the skin phenotype.
Article
Transplanting aged human skin onto young SCID/beige mice morphologically rejuvenates the xenotransplants. This is accompanied by angiogenesis, epidermal repigmentation, and substantial improvements in key aging-associated biomarkers, including ß-galactosidase, p16 ink4a , SIRT1, PGC1α, collagen 17A, and MMP1. Angiogenesis- and hypoxia-related pathways, namely, vascular endothelial growth factor A (VEGF-A) and HIF1A, are most up-regulated in rejuvenated human skin. This rejuvenation cascade, which can be prevented by VEGF-A–neutralizing antibodies, appears to be initiated by murine VEGF-A, which then up-regulates VEGF-A expression/secretion within aged human skin. While intradermally injected VEGF-loaded nanoparticles suffice to induce a molecular rejuvenation signature in aged human skin on old mice, VEGF-A treatment improves key aging parameters also in isolated, organ-cultured aged human skin, i.e., in the absence of functional skin vasculature, neural, or murine host inputs. This identifies VEGF-A as the first pharmacologically pliable master pathway for human organ rejuvenation in vivo and demonstrates the potential of our humanized mouse model for clinically relevant aging research.
Article
Full-text available
The aging process, especially of the skin, is governed by changes in the epidermal, dermo-epidermal, and dermal compartments. Type I collagen, which is the major component of dermis extracellular matrix (ECM), constitutes a prime target for intrinsic and extrinsic aging-related alterations. In addition, under the aging process, pro-inflammatory signals are involved and collagens are fragmented owing to enhanced matrix metalloproteinase activities, and fibroblasts are no longer able to properly synthesize collagen fibrils. Here, we demonstrated that low levels of type I collagen detected in aged skin fibroblasts are attributable to an inhibition of COL1A1 transcription. Indeed, on one hand, we observed decreased binding activities of specific proteins 1 and 3, CCAAT-binding factor, and human collagen-Krüppel box, which are well-known COL1A1 transactivators acting through the -112/-61-bp promoter sequence. On the other hand, the aging process was accompanied by elevated amounts and binding activities of NF-κB (p65 and p50 subunits), together with an increased number of senescent cells. The forced expression of NF-κB performed in young fibroblasts was able to establish an old-like phenotype by repressing COL1A1 expression through the short -112/-61-bp COL1A1 promoter and by elevating the senescent cell distribution. The concomitant decrease of transactivator functions and increase of transinhibitor activity is responsible for ECM dysfunction, leading to aging/senescence in dermal fibroblasts.
Article
Full-text available
Reduced production of type I procollagen is a prominent feature of chronologically aged human skin. Connective tissue growth factor (CTGF/CCN2), a downstream target of the transforming growth factor-beta (TGF-beta)/Smad pathway, is highly expressed in numerous fibrotic disorders, in which it is believed to stimulate excessive collagen production. CTGF is constitutively expressed in normal human dermis in vivo, suggesting that CTGF is a physiological regulator of collagen expression. We report here that the TGF-beta/Smad/CTGF axis is significantly reduced in dermal fibroblasts, the major collagen-producing cells, in aged (> or = 80 years) human skin in vivo. In primary human skin fibroblasts, neutralization of endogenous TGF-beta or knockdown of CTGF substantially reduced the expression of type I procollagen mRNA, protein, and promoter activity. In contrast, overexpression of CTGF stimulated type I procollagen expression, and increased promoter activity. Inhibition of TGF-beta receptor kinase, knockdown of Smad4, or overexpression of inhibitory Smad7 abolished CTGF stimulation of type I procollagen expression. However, CTGF did not stimulate Smad3 phosphorylation or Smad3-dependent transcriptional activity. These data indicate that in human skin fibroblasts, type I procollagen expression is dependent on endogenous production of both TGF-beta and CTGF, which act through interdependent yet distinct mechanisms. Downregulation of the TGF-beta/Smad/CTGF axis likely mediates reduced type I procollagen expression in aged human skin in vivo.
Article
Cellular and organ metabolism affects organismal lifespan. Aging is characterized by increased risks for metabolic disorders, with age-associated degenerative diseases exhibiting varying degrees of mitochondrial dysfunction. The traditional view of the role of mitochondria generated reactive oxygen species (ROS) in cellular aging, assumed to be causative and simply detrimental for a long time now, is in need of reassessment. While there is little doubt that high levels of ROS are detrimental, mounting evidence points towards a lifespan extension effect exerted by mild to moderate ROS elevation. Dietary caloric restriction (CR), inhibition of insulin-like growth factor (IGF)-1 signaling, and inhibition of the nutrient-sensing mechanistic target of rapamycin (mTOR) are robust longevity promoting interventions. All of these appear to elicit mitochondrial retrograde signaling processes (defined as signaling from the mitochondria to the rest of the cell, for example, the mitochondrial unfolded protein response, or UPR(mt)). The effects of mitochondrial retrograde signaling may even spread to other cells/tissues in a non-cell autonomous manner by yet unidentified signaling mediators. Multiple recent publications support the notion that an evolutionarily conserved, mitochondria-initiated signaling is central to the genetic and epigenetic regulation of cellular aging and organismal lifespan.
Article
Tumor microenvironment is a complex system composed of a largely altered extracellular matrix with different cell types that determine angiogenic responses and tumor progression. Upon the influence of hypoxia, tumor cells secrete cytokines that activate stromal cells to produce proteases and angiogenic factors. In addition to stromal ECM breakdown, proteases exert various pro- or anti-tumorigenic functions and participate in the release of various ECM fragments, named matrikines or matricryptins, capable to act as endogenous angiogenesis inhibitors and to limit tumor progression. We will focus on the matrikines derived from the NC1 domains of the different constitutive chains of basement membrane-associated collagens and mainly collagen IV. The putative targets of the matrikine control are the proliferation and invasive properties of tumor or inflammatory cells, and the angiogenic and lymphangiogenic responses. Collagen-derived matrikines such as canstatin, tumstatin or tetrastatin for example, decrease tumor growth in various cancer models. Their anti-cancer activities comprise anti-proliferative effects on tumor or endothelial cells by induction of apoptosis or cell cycle blockade and the induction of a loss of their migratory phenotype. They were used in various preclinical therapeutic strategies: i) induction of their overexpression by cancer cells or by the host cells, ii) use of recombinant proteins or synthetic peptides or structural analogues designed from the structure of the active sequences, iii) used in combined therapies with conventional chemotherapy or radiotherapy. Collagen-derived matrikines strongly inhibited tumor growth in many preclinical cancer models in mouse. They constitute a new family of anticancer agents able to limit cancer progression.
Article
Transforming growth factor-β (TGF-β) stimulates the transcription of the α2(I) procollagen gene (COL1A2). The intracellular mediators involved in this response remain poorly understood. In this study, we demonstrate that primary human skin fibroblasts express Smads, a novel family of signaling molecules, in vitro in the absence of TGF-β. The levels of Smad 7 mRNA was rapidly and transiently increased by TGF-β. Transient overexpression of Smad 3 and Smad 4, but not Smad 1 or Smad 2, caused trans-activation of a CAT reporter gene driven by a 772 bp segment of the human COL1A2 promoter containing putative TGF-β response elements. Smad stimulation of promoter activity was ligand independent, but was further enhanced by TGF-β. Overexpression of a phosphorylation-deficient Smad 3 mutant or wild-type Smad 7, which lacks the carboxy-terminal phosphorylation motif, specifically inhibited TGF-β-induced activation of COL1A2 promoter. A CAGACA sequence shown to be a functional Smad-binding element in the plasminogen activator inhibitor-1 gene promoter was found within the TGF-β-response region of the proximal COL1A2 promoter. Gel mobility shift assays showed protein phosphorylation-dependent binding activity in fibroblast nuclear extracts specific for this sequence; TGF-β treatment strongly stimulated the formation of this DNA-protein complex. Smad was identified as a component of the CAGACA-binding transcription complex in TGF-β-treated fibroblasts by antibody supershifting. These results demonstrate that (i) Smad 3 transmits TGF-β signals from the receptor to the COL1A2 promoter in human fibroblasts, and is likely to play an important role in stimulation of COL1A2 promoter activity elicited by TGF-β; (ii) in fibroblasts, Smads appear to function as inducible DNA-binding transcription factors; and (iii) Smad 7 may be involved in autocrine negative feedback in the regulation of COL1A2 promoter activity by TGF-β.
Article
The free radical theory of aging postulates that free radical reactions are responsible for the progressive accumulation of changes with time associated with or responsible for the ever-increasing likelihood of disease and death that accompanies advancing age. Modulation of the normal distribution of deleterious free radical reaction-induced changes throughout the body by genetic and environmental differences between individuals results in patterns of change, in some sufficiently different from the normal aging pattern to be recognized as disease. These “free radical” diseases can be classified into three groups in which a given disorder is mainly due to: 1) genetics, 2) a combination of genetic and environmental factors, and 3) largely to environmental influences. The growing number of “free radical” diseases includes the two major causes of death, cancer and atherosclerosis. To illustrate the role of free radicals in disease a discussion is presented, of cancer, atherosclerosis, essential hypertension, senile dementia of the Alzheimer’s type, amyloidosis, and the immune deficiency of age. Dietary intervention in the “free radical” diseases can reasonably be expected to decrease the period of senescence and to increase by 5 or more years the span of healthy productive life.
Article
COL4A5 mutations causing X-linked Alport syndrome (XLAS) are frequently associated with absence of the α3, α4, α5 and α6 chains of type IV collagen from basement membranes and increased amounts of the α1(IV) and α2(IV) chains in glomerular basement membrane. Although many COL4A5 mutations have been described in XLAS, the mechanisms by which these mutations influence the basement membrane appearance of chains other than α5(IV) remain poorly understood. In this study, we used dermal fibroblasts from eight normal individuals and nine males with XLAS to test the hypotheses that COL4A5 mutations increase transcription of COL4A1 and suppress transcription of COL4A6. Ribonuclease protection assays revealed that α1(IV), α5(IV) and α6(IV) transcripts were expressed in cultures of dermal fibroblasts. The mRNA levels for α1(IV) in eight nine patients with XLAS were not increased compared to controls; one patient with a large COL4A5 deletion showed significant elevation of α1(IV) mRNA levels. No differences in steady-state mRNA levels for α6(IV) were found when XLAS fibroblasts were compared with controls, even though little or no α6(IV) protein was detectable at the dermal-epidermal junction by immunofluorescence study. This finding suggests that post-transcriptional events account for the absence of α6(IV) in the Alport dermal-epidermal junction.
Article
While recent studies have implicated transforming growth factor-beta 1 (TGF-beta 1) in the development of glomerular scarring, extraglomerular matrix production is frequently associated with glomerulonephritis and is an important determinant of disease progression. TGF-beta 1 may be an important mediator of extracellular matrix synthesis, both by glomerular and extraglomerular mesenchymal cells. TGF-beta 1-mediated collagen IV gene expression was studied in two mesenchymal cell lines. Initial studies were performed utilizing NIH-3T3 cells, a fibroblast-like line derived from murine embryo that has been used to study regulation of fibrillar collagen (collagen I and collagen III) synthesis by TGF-beta 1. Additional studies were performed using normal rat kidney cells (NRK-49F). Cells were grown in medium supplemented with 0.5% calf serum for 24 hours before treatment with TGF-beta 1. RNA was isolated after the addition of varying amounts of TGF-beta 1 to the cells in culture for varying periods of time, and collagen alpha 1(IV) RNA was quantitated by filter hybridization. Transcription of the alpha 1(IV) and alpha 2(IV) collagen genes was assessed by an in vitro transcription assay. Deposition of collagen IV was identified by immunoblotting. Induction of alpha 1(IV) gene expression by NIH-3T3 cells and by NRK-49F cells was first seen 2 to 4 hours after TGF-beta 1 treatment, and was maximal after 12 to 18 hours. Maximal induction was observed following addition of 5 ng/ml TGF-beta 1 to NIH-3T3 cells, and following addition of 10 ng/ml of TGF-beta 1 to NRK-49F cells. In the presence of cycloheximide, TGF-beta 1 induction of alpha 1(IV) mRNA was markedly attenuated in both cell lines, suggesting that this effect of TGF-beta 1 requires protein synthesis. TGF-beta 1 increased transcription of both the alpha 1(IV) and alpha 2(IV) collagen genes by NIH-3T3 cells. TGF-beta 1 induces collagen IV gene expression in both NIH-3T3 cells and normal rat kidney fibroblasts (NRK-49F cells). Further studies of cytokine-mediated transcriptional regulation of collagen IV, utilizing these cell lines, may provide important information regarding the role of extraglomerular matrix production in the progression of renal disease.