Content uploaded by Cleber Ferraresi
Author content
All content in this area was uploaded by Cleber Ferraresi on Jan 09, 2018
Content may be subject to copyright.
Sports Medicine
ORIGINAL RESEARCH ARTICLE
Effects of Light-Emitting Diode
Therapy on Muscle Hypertrophy, Gene
Expression, Performance, Damage,
and Delayed-Onset Muscle Soreness
Case-control Study with a Pair of Identical Twins
ABSTRACT
Ferraresi C,Bertucci D, Schiavinato J, Reiff R, Arau
´jo A, Panepucci R, Matheucci E,
Cunha AF, Arakelian VM, Hamblin MR, Parizotto N, Bagnato V: Effects of light-
emitting diode therapy on muscle hypertrophy, gene expression, performance,
damage, and delayed-onset muscle soreness: case-control study with a pair of
identical twins. Am J Phys Med Rehabil 2016;00:00Y00.
Objective: The aim of this study was to verify how a pair of monozygotic twins
would respond to light-emitting diode therapy (LEDT) or placebo combined with a
strength-training program during 12 weeks.
Design: This case-control study enrolled a pair of male monozygotic twins, allo-
cated randomly to LEDT or placebo therapies. Light-emitting diode therapy or pla-
cebo was applied from a flexible light-emitting diode array (L=850nm,total
energy = 75 J, t= 15 seconds) to both quadriceps femoris muscles of each twin
immediately after each strength training session (3 times/wk for 12 weeks) consisting
of leg press and leg extension exercises with load of 80% and 50% of the 1-repetition
maximum test, respectively. Muscle biopsies, magnetic resonance imaging, maximal
load, and fatigue resistance tests were conducted before and after the training program
to assess gene expression, muscle hypertrophy and performance, respectively.
Creatine kinase levels in blood and visual analog scale assessed muscle damage and
delayed-onset muscle soreness, respectively, during the training program.
Results: Compared with placebo, LEDT increased the maximal load in exercise
and reduced fatigue, creatine kinase, and visual analog scale. Gene expression
analyses showed decreases in markers of inflammation (interleukin 1A)andmuscle
atrophy (myostatin) with LEDT. Protein synthesis (mammalian target of rapamycin)
and oxidative stress defense (SOD2 [mitochondrial superoxide dismutase]) were up-
regulated with LEDT, together with increases in thigh muscle hypertrophy.
Conclusions: Light-emitting diode therapy can be useful to reduce muscle
damage, pain, and atrophy, as well as to increase muscle mass, recovery, and
athletic performance in rehabilitation programs and sports medicine.
Key Words: Biopsy, Creatine Kinase, Low-Level Laser Therapy, Photobiomodulation,
Visual Analog Scale
Authors:
Cleber Ferraresi, PhD, PT
Danilo Bertucci, MSc
Josiane Schiavinato, MSc
Rodrigo Reiff, PhD
Ame´ lia Arau´ jo, MSc
Rodrigo Panepucci, PhD
Euclides Matheucci, Jr, PhD
Anderson Ferreira Cunha, PhD
Vivian Maria Arakelian, PhD, PT
Michael R. Hamblin, PhD
Nivaldo Parizotto, PhD, PT
Vanderlei Bagnato, PhD
Affiliations:
From the Laboratory of
Electrothermophototherapy,
Department of Physical Therapy (CF,
NP), and Post-Graduation Program in
Biotechnology (CF, EM, NP), Federal
University of Sa˜o Carlos; Optics Group,
Physics Institute of Sa˜o Carlos,
University of Sa˜o Paulo, Sa˜o Carlos
(CF, VB), Sa˜o Paulo, Brazil; Wellman
Center for Photomedicine,
Massachusetts General Hospital,
Boston, Massachusetts (CF, MRH);
Department of Physiological Sciences,
Federal University of Sa˜o Carlos, Sa˜o
Carlos (DB); Faculty of Medicine,
University of Sa˜o Paulo, Ribeirao Preto
(JS, AA); Center for Cell Therapy and
Regional Blood Center of Ribeirao
Preto (JS, AA, RP); Departments of
Medicine (RR) and Genetic and
Evolution (AFC), Federal University of
Sa˜o Carlos, Sa˜o Carlos;
Post-Graduation Program in
Bioengineering, University of Sa˜o
Paulo, Sa˜o Carlos (VMA), Sa˜o Paulo,
Brazil; Department of Dermatology,
Harvard Medical School, Boston
(MRH); and Harvard-MIT Division of
Health Sciences and Technology,
Cambridge (MRH), Massachusetts.
0894-9115/16/0000-0000
American Journal of Physical
Medicine & Rehabilitation
Copyright *2016 Wolters Kluwer
Health, Inc. All rights reserved.
DOI: 10.1097/PHM.0000000000000490
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 1
Phototherapy using lasers and other light
sources is commonly used in medicine for different
treatments.
1,2
Since 1960s, low-level lasers (up to
500 mW)
3
have provided a successful and nonin-
vasive therapy to manage pain
4
and inflammatory
processes and accelerate tissue healing.
5
The mechanisms of action of phototherapy on
biological tissues are related to light absorption by
chromophores in the cells, with cytochrome c oxi-
dase (Cox) proposed as the main light-absorbing
protein.
6
The Cox enzyme, unit IV in the mitochon-
drial respiratory chain, triggers a variety of secondary
effects after light absorption. Among these effects,
the literature highlights increases in adenosine
triphosphate (ATP) synthesis
7,8
and modulations in
DNA and RNA synthesis rates, which in turn affect
cell proliferation and gene expression related to several
cellular pathways such as mitosis, apoptosis, inflam-
mation, and mitochondrial energy metabolism.
6Y9
Recently, photobiomodulation in the form of
low-level laser therapy and light-emitting diode ther-
apy (LEDT) has been applied over human skeletal
muscles before or after bouts of exercises in order to
(i) accelerate muscle recovery, (ii) protect against
muscle damage induced by exercise, and (iii) improve
performance, such as increasing muscle strength
and fatigue resistance.
10Y14
These effects are valuable
in rehabilitation processes that involve exercise
programs to recover from muscle lesions and can
mitigate the adverse effects of orthopedic surgical
procedures, such as muscle weakness and atrophy,
15
and accelerate the return to athletic sports or func-
tional activity.
Few studies have evaluated the chronic effects
(Q8 weeks) of applying phototherapy to muscles
that are under metabolic and/ or mechanical stress,
as seen in exercise training-programs used in
humans to increase performance.
11,13
Moreover, there
has been no study reporting the chronic effects of
phototherapy on muscle performance (including
maximal load tests and fatigue resistance), hypertro-
phy, muscle damage, delayed-onset muscle soreness
(DOMS), and molecular responses (gene expression)
in humans. In addition, it is also important to establish
the safety of this treatment applied in a chronic
manner, because this therapy produces effects on
muscle tissue lasting 24 to 48 hours,
8,16,17
suggesting
possible cumulative effects if applied repetitively.
Finally, no published study has controlled the
genetic aspects of the subjects, because it is known
that genetic differences between individual subjects
can promote different adaptations to exercise.
18
With these perspectives in mind, our case-
control study investigated whether an intense
strength training program combined with the
chronic use of LEDT could increase muscle recov-
ery, performance (strength and fatigue resistance),
and muscle hypertrophy (volume); modulate gene
expression; and also decrease the score for DOMS in a
pair of identical twins. This study enrolled a pair of
identical twins because of their genetic identity
19
in
order to exclude or drastically minimize the effects of
genetic disparities between the subjects, because it
is known that muscle performance and recovery can
depend on intrinsic genetic responses to exercise
18,20,21
and moreover that phototherapy promotes modula-
tion in gene expression.
6,9
METHODS
Subjects
Two 19-year-old male identical (monozygotic)
twins, 1.72 m, 70 kg, college soccer players, living
together and having the same habits and diet, were
enrolled in this study approved by the human ethics
committee of the Federal University of Sa˜o Carlos,
Brazil (opinion n-205/2012) and conducted in this
university in compliance with the Declaration of
Helsinki (1964) and its later amendments.
After signing an informed consent form, the
subjects were subjected to (i) genomic analysis to
confirm their identity as monozygotic twins
19
; (ii)
an intense strength training program using a leg
press and leg extension fitness machine combined
with LEDT or placebo; (iii) assessments of muscle
performance, score of DOMS by visual analog scale
(VAS), and a biochemical marker of muscle damage
(creatine kinase [CK]; (iv) magnetic resonance imaging
(MRI) analysis to calculate thigh muscle volume
22,23
;
Correspondence:
All correspondence and requests for
reprints should be addressed to:
Cleber Ferraresi, PhD, PT, Federal University
of Sa˜o Carlos, Rodovia Washington
Luı´s, Km 235, 13565-905, Sa˜ o Carlos,
Sa˜o Paulo, Brazil.
Disclosures:
CF received financial support from
Fundac¸a˜o de Amparo a` Pesquisa
do Estado de Sa˜o PauloYFAPESP as PhD
scholarships (processes 2010/07194-7
and 2012/05919-0).
Financial disclosure statements
have been obtained, and no conflicts
of interest have been reported by the
authors or by any individuals in control
of the content of this article.
2Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
and (v) muscle biopsies of the vastus lateralis
24
to
quantify gene expression modulation by quantitative
real-time polymerase chain reaction (qPCR). Figure 1
shows a flowchart of the study.
Genomic Analysis
Sixteen loci with short tandem repeats were
investigated to determine whether both brothers
were monozygotic twins. DNA samples were obtained
from cells of the oral mucosa using a swab, and DNA
was extracted using Qiamp DNA Mini Kit (Qiagen,
Valencia, CA). Coamplifications of the loci D3S1358,
vWA, D16S539, D8S1179, D21S11, D18S51, TH01,
FGA, D5S818, D13S317, D7S820, TPOX, CSF1PO,
penta D, penta E, and amelogenin were performed
by PCR using Human ID kit (QGene, Sa˜o Carlos,
Brazil). Reactions for multiplex PCR were prepared
according to the manufacturer_s guidelines. Brief-
ly,thesereactionsused15ngofgenomicDNA,1U
of Taq DNA polymerase, buffer (1), primers and
water to complete 15 KL of reaction volume. All loci
were amplified in a Veriti 96-Well Thermal Cycler
(Applied Biosystems, Waltham, MA) following the
program: step 1: 1(95-C, 7 minutes); step 2:
10(94-C, 1 minute; 60-C, 1 minute; 70-C, 1.5
minutes); step 3: 22(90-C, 1 minute; 60-C, 1 min-
ute; 70-C, 1.5 minutes); step 4: 1(60-C, 30
minutes); step 5: keep at 4-C. Amplified products
were detected and separated by capillary electro-
phoresis using a MegaBACE 1000 (GE Healthcare
Bio-Sciences Corp., Pittsburgh, PA). Results were
analyzed, and allele designations were set auto-
matically using Fragment Profiler software, version
1.2 (GE).
FIGURE 1 Flowchart of the study.
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 3
Magnetic Resonance Imaging and Muscle
Hypertrophy (Volume)
These analyses quantified the muscle volume
after the training program, because strength exer-
cises are known to promote muscle hypertrophy.
25
A MAGNETOM C! 0.35-T (Siemens, Mu¨ nchen,
Deutschland) scanner was used to acquire axial
images from thigh muscles. T1-weighted spin echo
with a 430-millisecond repetition time, 26-
millisecond echo time in matrix of 256 256
pixels was used to acquire MRI data using 10-mm-
thick sections similarly to previous studies.
22,23
Subjects
did not eat or drink for 8 hours before their scans in
the supine position.
22
Slices from the proximal bor-
der of the patella to the anterior superior iliac spine
were used to quantify the volume of the thigh
muscles, subtracting bone and fat tissues. Cross-
sectional areas were measured every each 4 con-
secutive slices (3-cm gap between slices)
22
using
Weasis software (version 1.1.2). Muscle volume (in
cm
3
) of the slices was calculated by multiplying the
tissue area (in cm
2
) by slice thickness (10 mm).
Volume of all gaps was calculated using truncated
pyramids
22,23
as follows:
V¼~
N
i¼1Aitþh=3~
N
i¼2Aij1þAiþffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffiffi
Aij1Ai
ðÞ
p
hi
where Vis the total thigh volume, Ais the muscle
cross-sectional area, tis slice thickness, his the
distance (gap) between every 4 consecutive slices,
and Nis the number of slices used to calculations.
Total volume was calculated as the summation of
volume of the slices and gaps of the left thigh. The
same number of slices (12) was used before and
after the training program for both twins. Magnetic
resonance imaging was carried out at baseline (prior
baseline biopsy) and final (24 hours after second
biopsy). Cross-sectional area of each slice was quan-
tified by evaluator 1, who was blinded to the therapy
(LEDTorplacebo)andtrainingprogram.
Muscle Biospy
Muscle biopsies were performed to acquire mus-
cle samples for gene expression analyses to identify
molecular responses resulting from the training pro-
gram combined with phototherapy. Both twins were
instructed to not perform any kind of training or ex-
ercise for 7 days prior to the first muscle biopsy
(baseline). The fragment of the vastus lateralis was
obtained from the half distance between an imaginary
line beginning at the greater trochanter to the supe-
rior border of the patella.
24
The skin was cleansed, and
local anesthesia was applied using 2% lidocaine with-
out vasoconstrictor. Afterward, a small incision using
scalpel no. 11 was made in the skin (approximately
0.5 cm), through subcutaneous tissue and fascia.
24
Thereafter, a biopsy needle of 4.5 mm was inserted to
collect the muscle fragment. Immediately after
withdrawal, the muscle fragment was deposited in a
cryotube free of DNase and RNAse, frozen in liquid
nitrogen and stored at j80-C until analysis of gene
expression. The final biopsy was conducted exactly
24 hours after the last training session.
Muscle Performance
Muscle performance assessments were per-
formed to measure (i) muscle fatigue resistance and
(ii) the maximal muscle strength. Three weeks after
thefirstmusclebiopsy,bothtwinswereevaluated
for muscle fatigue using the fatigue index in an
isokinetic dynamometer (Multi-Joint System 3;
Biodex, New York, NY), and the load of 1-repetition
maximum (1RM) test using the leg press as prev-
iously described
11,13
for baseline. One-repetition
maximum test in leg extension fitness machine was
conducted for each leg with the range of motion
(ROM) from 90 to 15 degrees of knee flexion. This
ROM was chosen (i) based on scientific evidence
reporting the peak of the torque of the knee ex-
tensor muscles occurring near 60 to 70 degrees of
knee flexion
26Y28
; (ii) to keep the same ROM used in
FIGURE 2 A, Exercise in leg press. B, Exercise in leg extension fitness machine.
4Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
the isokinetic test
15
; and (iii) to make it possible
for both volunteers to extend their knee joint to a
comfortable position,
29
reducing the possibility of
resistance occurring via stretching of hamstring
muscles.
30
The final evaluations of muscle per-
formance were performed at the 35th training
session. Both twins performed all these evalua-
tions individually and were blinded to the results.
In addition, all tests were performed by evaluator
2, who was blinded to therapy (LEDT or placebo)
and MRI analyses.
Training Program
The intense strength training program using
leg press and leg extension was based on literature
protocols to obtain the maximum muscle strength
and volume increase.
25
Two days after baseline eval-
uations for muscle performance, both monozygotic
twins started the training program for 12 consecutive
weeks, with a relatively high frequency (3 days a
week: Monday, Wednesday, Friday) in blinded mode;
that is, each twin did not see the training of his
brother. The intensity of each training session was
80% and 50% of the load determined by the 1RM test
in the leg press and leg extension fitness machine,
respectively
11
(Fig. 2). Each training session com-
prised 40 repetitions of leg press (4 sets of 10) plus
30 repetitions of leg extension (3 sets of 10) or until
exhaustion understood as an incapacity of the sub-
jects to lift the weights (leg press or leg extension
exercises). If a set was not completed, the number of
repetitions was recorded, and immediately a rest in-
terval was started consisting of 2 minutes between
sets.
11
For leg extension, the rest interval started
immediately after both legs performed each set of
exercises. Retests of 1RM by the leg press and leg
extension machine were carried out at the 12th and
24th training session, replacing these sessions. Eval-
uator 2 supervised all training sessions.
Light-Emitting Diode Therapy or Placebo
Light-emitting diode therapy was chosen as
the phototherapy of this study because of its ease of
application. Evaluator 3 randomized the twins by a
simple draw at the beginning of the study to re-
ceive LEDT or placebo. Each therapy was applied
over the quadriceps femoris muscles of each leg
for 15 seconds immediately after each training
session: right leg first and left leg second, with the
order of application alternating each time. Both
TAB LE 1 Parameters of LEDT
No. LEDs: 50 infrared Power density per LED: 500 mW/cm
2
Wavelength: 850 (+/j20) nm Power density of array: 8.1 mW/cm
2
LED spot size: 0.2 cm
2
Treatment time: 15 s
LED array size: 612 cm
2
Total energy per application: 75 J
Pulse frequency: continuous Energy density per LED: 7.5 J/cm
2
Optical output power of each LED: 100 mW Energy density of array: 0.122 J/cm
2
Optical output power of array: 5,000 mW Application mode: in contact with the skin
FIGURE 3 A, Array of LEDs used to LEDT. B, Light-emitting diode therapy or placebo applied immediately on
quadriceps femoris muscles after each training session.
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 5
twins were blinded to these therapies, and in addition,
evaluator 3 was blinded to muscle performance, CK,
and muscle soreness assessments during the study.
Light-emitting diode therapy used a flexible
array of 34 18 cm (612 cm
2
) containing 50 in-
frared LEDs (850 nm) specially built for research by
the University of Sa˜ o Paulo and Federal University
of Sa˜ o Carlos, Brazil (Fig. 3).This device (prototype)
was designed to cover the quadriceps femoris mus-
cles at each session of irradiation, making the
therapy sessions faster and standardized when
compared with using multiple points of irradia-
tion by single probes or circular clusters. Each
LED had a spot area of 0.2 cm
2
and an optical
power of 100 mW, delivering1.5Jduring15sec-
onds. The total power was 5000 mW, and total
energy delivered was 75 J at each application.
Light-emitting diode parameters were measured
and calibrated using an optical energy meter
PM100D Thorlabs (Newton, NJ) fitted with a sen-
sor model S130C. All LEDT parameters are given
in Table 1.
A hidden button in the LED device was
switched on by evaluator 3 during placebo therapy,
causing the device to emit no light (0 mW and 0 J).
Because of the invisible nature of 850-nm light,
neither twin could distinguish placebo therapy from
LEDT. There was no sensation of heat when the
device was applied to the skin.
Biochemical Marker of Muscle Damage
and Score of DOMS Assessments
Creatine kinase, a muscle enzyme related to
muscle damage that can be measured in the
TAB LE 2 Designed pairs of primers used in qPCR
Gene NM Gene Primer Sequence
RPS29 (NM_001032) RPS29_RT_F 5¶GCACTGCTGAGAGCAAGATG 3¶
RPS29_RT_R 5¶ATAGGCAGTGCCAAGGAAGA 3¶
RPS13 (NM_001017) RPS13_RT_F 5¶TCTCCTTTCGTTGCCTGATC 3¶
RPS13_RT_R 5¶AATCTGCTCCTTCACGTCG 3¶
GAPDH (NM_002046) GAPDH_RT_F 5¶ACATCGCTCAGACACCATG 3¶
GAPDH_RT_R 5¶TGTAGTTGAGGTCAATGAAGGG 3¶
HPRT1 (NM_000194) HPRT1_RT_F 5¶TGCTGAGGATTTGGAAAGGG 3¶
HPRT1_RT_R 5¶ACAGAGGGCTACAATGTGATG 3¶
SOD2 (NM_000636) SOD2_RT_F 5¶CCTGGAACCTCACATCAACG 3¶
SOD2_RT_R 5¶GCTATCTGGGCTGTAACATCTC 3¶
mTOR (NM_004958) MTOR_RT_F 5¶CTGAACTGGAGGCTGATGG 3¶
MTOR_RT_R 5¶TGGTCCCCGTTTTCTTATGG 3¶
IL-1A(NM_000576) IL-1A_RT_F 5¶GGTACATCAGCACCTCTCAAG 3¶
IL-1A_RT_R 5¶CACATTCAGCACAGGACTCTC 3¶
MSTN (NM_005259) MST_RT_F 5¶TGATCTTGCTGTAACCTTCCC 3¶
MST_RT_R 5¶TCGTGATTCTGTTGAGTGCTC 3¶
FIGURE 4 Genomic analysis of the 16 loci with short tandem repeats (STRs): amelogenin, D3S1358, D5S818, vWA,
TH01, D13S317, D8S1179, D21S11, D7S820, TPOX, D16S539, D18S51, CSF1PO, FGA, penta E, penta
D. Note that for both twins (twins 1 and 2) all loci have the same position and peaks, attesting their
condition of identical twins (monozygotic).
6Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
bloodstream,
31
was analyzed using 30 KL of blood
collected from the earlobe 5 minutes before and 24
hours after the 1st, 13th, 25th, and 36th training
sessions. Creatine kinase was measured by Reflotron
Plus biochemical analyzer (Roche, Mannheim, DE)
31
following the manufacturer_sguidelines.Briefly,the
CK strip (Roche) was filled with 30 KL of blood and
after exactly 15 seconds was read on the Reflotron
Plus. A VAS with 10 cm was used to measure the
DOMS
4
24 hours after the 1st, 13th, 25th, and 36th
training sessions, because it is known that strength
training exercise promotes microdamage in the
muscles and an inflammatory process that induces
pain with peaks between 24 and 72 hours.
32
Muscle
pain was elicited through a maximum voluntary
isometric contraction at 0 degrees of knee flexion and
without load. These analyses were carried out by
evaluator 2.
Gene Expression Analyses
Gene expression analyses aimed to assess the effects
of the training program combined with phototherapy
on genes known to be related to oxidative stress de-
fenses (mitochondrial superoxide dismutase [SOD2]),
protein synthesis and muscle hypertrophy (mam-
malian target of rapamycin [mTOR]), inflammation
(interleukin 1A[IL-1A]), and muscle weakness and
atrophy (myostatin [MSTN]).
33Y35
Gene expression of
SOD2, mTOR, IL-1A, and MSTN was compared with
RPS13 (ribosomal protein S13). RPS13 was chosen
as the most stable reference gene
36
when compared
with other reference genes, such as GAPDH (glyc-
eraldehyde-3-phosphate dehydrogenase), HPRT1
(hypoxanthine phosphoribosyltransferase), and RPS29
(ribosomal protein S29). Messenger RNA from
muscle samples was extracted using TRIzol (Life
Technologies, Waltham, MA) and reverse transcribed
using High-Capacity cDNA Reverse Transcription
kit (Applied Biosystems, Waltham, MA). Quantitative
real-time PCR reactions used GoTaq qPCR Master
Mix kit (Applied Biosystems, Waltham, MA) with
thermalcyclesof50-C(12 minutes), 95-C
(1 10 minutes), 95-C(4015 seconds), 60-C
(40 1 minute), 95-C(115 seconds), 60-C(1
FIGURE 5 Muscle performance assessing muscle fatigue resistance; 1RM test in leg press (LP) and in leg extension
fitness machine (LE). Values are given in percentage (%).
FIGURE 6 Muscle damage assessed by CK at the 1st, 13th, 25th, and 36th training sessions. Values are
giveninpercentage(%).
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 7
30 seconds), 95-C(115 seconds). Fold change (FC)
of gene expression was calculated using comparative
cycle threshold (2
j$$Ct
).
37
All pairs of primers used
are given in Table 2.
RESULTS
Genomic Analysis
All 16 loci tested confirmed that both brothers
were monozygotic twins (Fig. 4).
Muscle Performance
Light-emitting diode therapy increased the
1RM load in leg press (+53%, from 320 to 490 kg)
and in leg extension machine (+37%, from 60 to
82.5 kg) but basically did not change muscle fatigue
in the isokinetic dynamometer (j3%, from 59% to
56%). On the other hand, placebo therapy increased
muscle fatigue (+15%, from 57% to 66%) and pro-
ducedsmaller increments in 1RM load in leg press
(+28%, from 320 to 410 kg) and leg extension
(+20%, from 62.5 to 75 kg) (Fig. 5).
Muscle Damage and DOMS
Light-emitting diode therapy produced smaller
increases in CK at 1st (+26%, from 225 to 284 UL),
13th (+36%, from 191 to 260 UL), 25th (+1%, from
225 to 229 UL), and 36th (+7%, from 204 to 220 UL)
training sessions compared with placebo at 1st
(+45%, from 259 to 376 UL), 13th (+59%, from
153 to 244 UL), 25th (+24%, from 158 to 196 UL),
and 36th (+23%, from 146 to 181 UL) (Fig. 6).
FIGURE 7 Delayed-onset muscle soreness assessed by VAS at the 1st, 13th, 25th, and 36th training sessions.
Values are given in centimeters.
FIGURE 8 Magnetic resonance imaging of thigh muscles before (baseline) and after (final) the training program.
Twelve slices and gaps were used to calculate muscle volume. Images from level 5 (slice 5) for both
twins are representing the whole difference between therapies, taking into account all 12 slices and
gaps. Results are presented in percentage.
8Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
Light-emitting diode therapy decreased pain score
on VAS compared with placebo at 1st (5.5 vs 8.2),
13th (1.4 vs 3.2), 25th (0.4 vs 1.8), and 36th (0.3 vs
1.0) training sessions (Fig. 7).
Muscle Hypertrophy (Volume)
There was an increase in the volume in thigh
muscles measured by MRI when LEDT was com-
bined with the training program (+20%, from 2937
to 3523 cm
3
), whereas placebo therapy gave a
smaller increase in muscle volume (+5%, from 3152
to 3316 cm
3
) (Fig. 8).
Gene Expression
Expressions of IL-1Aand MSTN were decreased
with LEDT (FC = j11.5 and j4.0, respectively) com-
pared with placebo (FC = +2.3 and j1.4). Moreover,
mTOR and SOD2 expression were increased with
LEDT (FC = +1.4 and +1.4, respectively) compared
with placebo (FC = +1.1 and +1.0) (Table 3). Figure 9
illustrates possible cell signaling mechanisms in
human skeletal muscle mediated by phototherapy.
DISCUSSION
The present study shows for the first time the
beneficial effects of phototherapy by LEDT on skeletal
muscles of genetically identical humans (monozygotic
twins) subjected to a strength training program.
Light-emitting diode therapy compared with pla-
cebo therapy promoted a resistance to muscle fatigue,
reduced a biochemical marker of muscle damage (CK),
lessened the score of delayed onset muscle soreness
(VAS), and reduced expression of genes related to
inflammation (IL-1A) and atrophy (MSTN). More-
over, LEDT increased the maximal load achievable
in exercise, the expression of genes related to oxi-
dative stress defense (SOD2), and protein synthesis
(mTOR) and produced thigh muscle hypertrophy
shown by MRI.
The results regarding gene expression of IL-1A,
a known gene marker of inflammation, strongly
suggest that LEDT produced an anti-inflammatory
effect, as reported by previous studies.
6,38,39
Likewise,
gene expression of MSTN, a gene marker of muscle
wasting and weakness,
33
was also decreased with
LEDT applied after the training program, suggest-
ing an important reduction in the signaling seen in
muscle atrophy.
20,21
Genes related to a marker of
TAB LE 3 Fold change of gene expression
following placebo or LEDT
Gene Placebo LEDT
IL-1A2.3 j11.5
MSTN j1.4 j4.0
mTOR 1.1 1.4
SOD2 1.0 1.4
FIGURE 9 Supposed effect of phototherapy by LEDT and low-level las er therapy (LLLT) in human skeletal muscle
cell signaling. Colored genes were modulated with LEDT. ETC indicates mitochondrial electron
transport chain.
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 9
cell proliferation and protein synthesis (mTOR)
34
and
oxidative stress defense (SOD2)
35
were also in-
creased by LEDT, confirming the molecular effects
of phototherapy
39
in humans. To our best knowl-
edge, there is no previous study reporting these ef-
fects of phototherapy on gene expression in human
skeletal muscles.
The effects of phototherapy on RNA synthesis
in conjunction with the greater increase in muscle
volume (MRI analysis) and performance (load in 1RM
tests and fatigue resistance), combined with reduc-
tion of muscle damage (CK levels) and DOMS (pain
assessed by VAS score), strongly suggest that several
signaling pathways involved in cell proliferation and
protein synthesis, energy metabolism, cytoprotection,
inflammation, and oxidative stress
39
were modulated
by phototherapy resulting in macroscopic and func-
tional benefits for human skeletal muscles.
Previous clinical trials
11,13,14,16
as well as in
vitro
8
and preclinical animal studies
7,40
have shown
decreased levels of CK (muscle damage) and DOMS,
an increased load, resistance to muscle fatigue, more
muscle ATP and glycogen synthesis, better oxidative
stress defense, improved mitochondrial activity (Cox),
and proliferation of muscle cells with the use of pho-
totherapy that has generally been applied after exer-
cises. Moreover, increases in ATP content in muscle
cells and tissue, fatigue resistance, strength, oxi-
dative stress defense, prevention of muscle dam-
age, and improvement of the kinetics of oxygen
consumption
7,8,10,12,17,41Y43
can also be elicited
when phototherapy is applied to muscles before a
single bout of exercise (muscular preconditioning).
However, it seems there is an optimum time to apply
phototherapy when used in a muscular precondi-
tioning regimen as judged by increases in ATP syn-
thesis in muscles, mitochondrial metabolism, and
fatigue resistance that are maximal at some hours
after light application.
8,17
The results reported in the present study can
give better direction for the use of phototherapy in
clinical practice in the sports medicine and reha-
bilitation fields. Regarding sports medicine, athletes
and sportsmen could be benefited by phototherapy
with a fast muscle recovery, a better gain in hyper-
trophy (muscle mass), and improvement of mus-
cle performance, without the use of any forbidden
performance-enhancing drugs.
44
Moreover, there
would be the added benefit of reduction in muscle
damage and atrophy and less inflammation and
pain.
4
On the other hand, patients suffering from
inflammation, pain, loss of muscle mass and strength,
and muscle atrophy as result of orthopedic surgical
procedures,
15
for example, could possibly be benefited
with the use of phototherapy combined with exer-
cise training programs during their rehabilitation.
Therefore, the return of the subjects to sports or
functional activities could be accelerated.
It is important to note that LEDT parameters
used in this study were based on previous stud-
ies,
11,13
applying a small energy per LED (1.5 J) and
a total of 75 J distributed over the entire area of the
quadriceps femoris muscles, and there were no
adverse cumulative effects of the light. Previous
studies have already reported that phototherapy can
produce effects for 24 hours (in vitro and in vivo)
8,17
and possibly as long as 48 hours in human skeletal
muscles.
16
It could be envisaged that cumulative
exposure or excessive light doses could produce an
inhibition or a lack of positive effects on human
skeletal muscles based on the biphasic dose response
3
typical of phototherapy as previously reported in the
literature, but no evidence of this adverse effect was
found in the present study.
There are several mechanisms of action that
have been proposed to account for the effects of
phototherapy on cells.
39
All of these mechanisms
are based on the light absorption by chromophores
in the cells, especially by Cox inside the mitochon-
dria, triggering improvements in muscle recovery
and performance.
12
The absorption of the light
(from low-level lasers and LEDs) by Cox promotes
modulations in cell metabolism altering the ener-
getic state of the cells via increased mitochondrial
membrane potential and increased synthesis of
ATP and cyclic adenosine monophosphate,
6Y9,39
which in turn possibly modulate the synthesis
rate of DNA and RNA via mitochondrial retro-
grade signaling.
39
Although this study enrolled a pair of identical
twins, living together and having the same diet and
habits, to remove any genetic bias related to intrinsic
individual responses to the exercises and/or the
LEDT, future studies should enroll more volunteers
to deeply investigate the molecular responses of
muscles to exercise combined with phototherapy.
In summary, the present study should encourage
physical therapists to use LEDT as an adjuvant ther-
apy in rehabilitation programs involving treatment
of damaged skeletal muscles, as well as an adjuvant
therapy for training programs to improve strength,
fatigue resistance, and muscle mass.
ACKNOWLEDGMENTS
The authors thank Vilmar Baldissera, PhD,
for his contribution to set up the strength training
program. CF thanks FAPESP for his PhD scholar-
ships (no. 2010/07194-7 and 2012/05919-0).
10 Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
REFERENCES
1. Huikeshoven M, Koster PH, de Borgie CA, et al:
Redarkening of port-wine stains 10 years after pulsed-
dye-laser treatment. N Engl J Med 2007;356:1235Y40
2. Ibrahimi OA, Sakamoto FH, Anderson RR: Picosec-
ond laser pulses for tattoo removal: a good, old idea.
JAMA dermatology 2013;149:241
3. Huang YY, Chen AC, Carroll JD, et al: Biphasic dose
response in low level light therapy. Dose Response
2009;7:358Y83
4. Chow RT, Johnson MI, Lopes-Martins RA, et al: Effi-
cacy of low-level laser therapy in the management of
neck pain: a systematic review and meta-analysis of
randomised placebo or active-treatment controlled
trials. Lancet 2009;374:1897Y908
5. Enwemeka CS, Parker JC, Dowdy DS, et al: The effi-
cacy of low-power lasers in tissue repair and pain
control: a meta-analysis study. Photomed Laser Surg
2004;22:323Y9
6. Karu T: Primary and secondary mechanisms of action
of visible to near-IR radiation on cells. J Photochem
Photobiol B 1999;49:1Y17
7. Ferraresi C, Parizotto NA, Pires de Sousa MV, et al:
Light-emitting diode therapy in exercise-trained mice
increases muscle performance, cytochrome c oxidase
activity, ATP and cell proliferation. J Biophotonics
2015;8:740Y54
8. Ferraresi C, Kaippert B, Avci P, et al: Low-level laser
(light) therapy increases mitochondrial membrane
potential and ATP synthesis in C2C12 myotubes with
a peak response at 3Y6h.Photochem Photobiol
2015;91:411Y6
9. Masha RT, Houreld NN, Abrahamse H: Low-intensity
laser irradiation at 660 nm stimulates transcription
of genes involved in the electron transport chain.
Photomed Laser Surg 2013;31:47Y53
10. Borsa PA, Larkin KA, True JM: Does phototherapy
enhance skeletal muscle contractile function and
postexercise recovery? A systematic review. J Athl
Train 2013;48:57Y67
11. Ferraresi C, de Brito Oliveira T, de Oliveira Zafalon L,
et al: Effects of low level laser therapy (808 nm) on
physical strength training in humans. Lasers Med Sci
2011;26:349Y58
12. Ferraresi C, Hamblin MR, Parizotto NA: Low-level
laser (light) therapy (LLLT) on muscle tissue: per-
formance, fatigue and repair benefited by the power
of light. Photonics Lasers Med 2012;1:267Y86
13. Vieira WH, Ferraresi C, Perez SE, et al: Effects of low-
level laser therapy (808 nm) on isokinetic muscle per-
formance of young women submitted to endurance
training: a randomized controlled clinical trial. Lasers
Med Sci 2012;27:497Y504
14. Douris P, Southard V, Ferrigi R, et al: Effect of pho-
totherapy on delayed onset muscle soreness. Photomed
Laser Surg 2006;24:377Y82
15. Delfino GB, Peviani SM, Durigan JL, et al: Quadriceps
muscle atrophy after anterior cruciate ligament
transection involves increased mRNA levels of
atrogin-1, muscle ring finger 1, and myostatin. Am J
Phys Med Rehabil 2013;92:411Y9
16. de Brito Vieira WH, Bezerra RM, Queiroz RA, et al:
Use of low-level laser therapy (808 nm) to muscle
fatigue resistance: a randomized double-blind cross-
over trial. Photomed Laser Surg 2014;32:678Y85
17. Ferraresi C, de Sousa MV, Huang YY, et al: Time
response of increases in ATP and muscle resistance to
fatigue after low-level laser (light) therapy (LLLT) in
mice. Lasers Med Sci 2015;30:1259Y67
18. Pe´russe L, Rankinen T, Hagberg JM, et al: Advances
in exercise, fitness, and performance genomics in
2012. Med Sci Sports Exerc 2013;45:824Y31
19. van Dongen J, Slagboom PE, Draisma HH, et al: The
continuing value of twin studies in the omics era.
Nat Rev Genet 2012;13:640Y53
20. Coffey VG, Hawley JA: The molecular bases of train-
ing adaptation. Sports Med 2007;37:737Y63
21. Toigo M, Boutellier U: New fundamental resistance
exercise determinants of molecular and cellular
muscle adaptations. Eur J Appl Physiol 2006;97:
643Y63
22. Tracy BL, Ivey FM, Jeffrey Metter E, et al: A more
efficient magnetic resonance imaging-based strategy
for measuring quadriceps muscle volume. Med Sci
Sports Exerc 2003;35:425Y33
23. Ross R, Rissanen J, Pedwell H, et al: Influence of
diet and exercise on skeletal muscle and visceral
adipose tissue in men. J Appl Physiol (1985) 1996;
81:2445Y55
24. Schilling BK, Fry AC, Chiu LZ, et al: Myosin heavy
chain isoform expression and in vivo isometric per-
formance: a regression model. J Strength Cond Res
2005;19:270Y5
25. Wernbom M, Augustsson J, Thomee´ R: The influence
of frequency, intensity, volume and mode of strength
training on whole muscle cross-sectional area in
humans. Sports Med 2007;37:225Y64
26. Ferraresi C, Baldissera V, Perez SEA, et al: One-
repetition maximum test and isokinetic leg exten-
sion and flexion: correlations and predicted values.
Isokinet Exerc Sci 2013;21:69Y76
27. Papadopoulos C, Kalapotharakos VI, Chimonidis E,
et al: Effects of knee angle on lower extremity exten-
sion force and activation time characteristics of
selected thigh muscles. Isokinet Exerc Sci 2008;
16:41Y6
28. Dvir: Isokinetics: Muscle Testing, Interpretation
and Clinical Applications.2nded.NewYork,NY:
Churchill Livingstone; 2004
29. Pincivero DM, Gear WS, Sterner RL: Assessment of
the reliability of high-intensity quadriceps femoris
muscle fatigue. Med Sci Sports Exerc 2001;33(2):
334Y8
30. Pincivero DM, Gandaio CM, Ito Y: Gender-specific
knee extensor torque, flexor torque, and muscle fatigue
www.ajpmr.com LEDT Improves Muscle Recovery and Performance 11
responses during maximal effort contractions. Eur J
Appl Physiol 2003;89:134Y41
31. Hornery DJ, Farrow D, Mujika I, et al: An inte-
grated physiological and performance profile of
professional tennis. Br J Sports Med 2007;41:531Y6
discussion 536
32. Cheung K, Hume P, Maxwell L: Delayed onset muscle
soreness: treatment strategies and performance fac-
tors. Sports Med 2003;33(2):145Y64
33. Schuelke M, Wagner KR, Stolz LE, et al: Myostatin
mutation associated with gross muscle hypertrophy
in a child. N Engl J Med 2004;350:2682Y8
34. Glass DJ: Signalling pathways that mediate skeletal
muscle hypertrophy and atrophy. Nat Cell Biol
2003;5:87Y90
35. Powers SK, Jackson MJ: Exercise-induced oxida-
tive stress: cellular mechanisms and impact on
muscle force production. Physiol Rev 2008;88:
1243Y76
36. Vandesompele J, de Preter K, Pattyn F, et al: Ac-
curate normalization of real-time quantitative
RT-PCR data by geometric averaging of multi-
ple internal control genes. Genome Biol 2002;3:
RESEARCH0034
37. Schmittgen TD, Livak KJ: Analyzing real-time PCR
data by the comparative C(T) method. Nat Protocols
2008;3:1101Y8
38. Mantineo M, Pinheiro JP, Morgado AM: Low-level
laser therapy on skeletal muscle inflammation:
evaluation of irradiation parameters. JBiomedOpt
2014;19:98002
39. Gao X, Xing D: Molecular mechanisms of cell prolif-
eration induced by low power laser irradiation. J
Biomed Sci 2009;16:4
40. Sussai DA, Carvalho Pde T, Dourado DM, et al: Low-
level laser therapy attenuates creatine kinase levels
and apoptosis during forced swimming in rats. Lasers
Med Sci 2010;25:115Y20
41. Ferraresi C, Dos Santos RV, Marques G, et al: Light-
emitting diode therapy (LEDT) before matches prevents
increase in creatine kinase with a light dose response in
volleyball players. Lasers Med Sci 2015;30:1281Y7
42. Ferraresi C, Beltrame T, Fabrizzi F, et al: Muscular pre-
conditioning using light-emitting diode therapy (LEDT)
for high-intensity exercise: a randomized double-blind
placebo-controlled trial with a single elite runner.
Physiother Theory Pract 2015;31:354Y61
43. Lopes-Martins RA, Marcos RL, Leonardo PS, et al:
Effect of low-level laser (Ga-Al-As 655 nm) on skeletal
muscle fatigue induced by electrical stimulation in
rats. J Appl Physiol (1985) 2006;101:283Y8
44. Hoffman JR, Kraemer WJ, Bhasin S, et al: Position
stand on androgen and human growth hormone use.
J Strength Cond Res 2009;23(5 suppl):S1Y59
12 Ferraresi et al. Am. J. Phys. Med. Rehabil. &Vol. 00, No. 00, Month 2016
