ArticlePDF Available

Withania somnifera Root Extract Enhances Telomerase Activity in the Human HeLa Cell Line

Authors:
  • Sri Ramachandra Institute of Higher Education and Research Porur, Chennai, India

Abstract and Figures

Aging is a decelerating unidirectional process of life. Shortening of telomeric DNA, the (TTAGGG)n hexanucleotide repeats, which form the caps at the chromosome ends, is implicated to determine the aging process, and more importantly the healthy lifespan itself. Telomerase, a ribonucleoprotein having reverse transcriptase activity, arrests telomere loss through addition of the TTAGGG repeats de novo, to the ends of the chromosome. The telomere/telomerase maintenance is an inevitable necessity to delay aging and for a healthy lifespan. Here, we report the potential of full-spectrum, high concentration Ashwagandha (Withania somnifera), an Ayurvedic medicinal herb, root extract to increase telomerase activity. HeLa cells, when treated with various concentrations of Ashwagandha root extract, showed an increase in telomerase activity measured with the established Telomerase Rapid Amplification Protocol (TRAP) assay. Ashwagandha root extract increased telomerase activity with highest enhancement of ~45% at 10 - 50 μg concentration. Thus, Ashwagandha root extract has the anti-aging inducing potential.
Content may be subject to copyright.
Advances in Bioscience and Biotechnology, 2016, 7, 199-204
Published Online April 2016 in SciRes. http://www.scirp.org/journal/abb
http://dx.doi.org/10.4236/abb.2016.74018
How to cite this paper: Raguraman, V. and Subramaniam, J.R. (2016) Withania somnifera Root Extract Enhances Telome-
rase Activity in the Human HeLa Cell Line. Advances in Bioscience and Biotechnology, 7, 199-204.
http://dx.doi.org/10.4236/abb.2016.74018
Withania somnifera Root Extract Enhances
Telomerase Activity in the Human
HeLa Cell Line
Vasantharaja Raguraman, Jamuna R. Subramaniam*
Center for Preclinical and Translational Medicine Research, Central Research Facility,
Sri Ramachandra University, Chennai, India
Received 10 March 2016; accepted 12 April 2016; published 15 April 2016
Copyright © 2016 by authors and Scientific Research Publishing Inc.
This work is licensed under the Creative Commons Attribution International License (CC BY).
http://creativecommons.org/licenses/by/4.0/
Abstract
Aging is a decelerating unidirectional process of life. Shortening of telomeric DNA, the (TTAGGG)n
hexanucleotide repeats, which form the caps at the chromosome ends, is implicated to determine
the aging process, and more importantly the healthy lifespan itself. Telomerase, a ribonucleo-
protein having reverse transcriptase activity, arrests telomere loss through addition of the
TTAGGG repeats de novo, to the ends of the chromosome. The telomere/telomerase maintenance
is an inevitable necessity to delay aging and for a healthy lifespan. Here, we report the potential of
full-spectrum, high concentration Ashwagandha (Withania somnifera), an Ayurvedic medicinal
herb, root extract to increase telomerase activity. HeLa cells, when treated with various concen-
trations of Ashwagandha root extract, showed an increase in telomerase activity measured with
the established Telomerase Rapid Amplification Protocol (TRAP) assay. Ashwagandha root extract
increased telomerase activity with highest enhancement of ~45% at 10 - 50 µg concentration.
Thus, Ashwagandha root extract has the anti-aging inducing potential.
Keywords
Ashwagandha, Telomerase, HeLa Cell Line, TRAP Assay
1. Introduction
Aging, the relentless decelerating phenomenon, is the main cause for wide range of age-associated diseases like
cancer, ischemic heart disease, stroke, type 2 diabetes, neurodegenerative diseases including Alzheimer’s dis-
ease and others [1]. One of the major factors that accelerate aging and cause degeneration of various systems is
*
Corresponding author.
V. Raguraman, J. R. Subramaniam
200
the shortening of “TELOMERES”, the DNA repeat sequences at the end of linear eukaryotic chromosomes, of 2
- 20 kbp length, which act as caps to conserve chromosome integrity and stability [2]. During the process of
DNA replication, telomeres are shortened by 50 - 100 bp with each cell division. The end replication problem
leads to critically short telomeres and ultimately senescence. Hence, telomeres are implicated as one of the fac-
tors that determine aging and lifespan. The enzyme, telomerase, a ribonucleoprotein having reverse transcriptase
activity, carries out telomere replication. Telomerase synthesizes telomeric DNA sequences through the addition
of TTAGGG repeats at the chromosome ends [3]. But, the telomerase activity is extremely low in somatic cells.
Telomerase is shown to be essential for the healthy normal life. Turning off of the telomerase expression in
the conditional knockout mice leads to degeneration of multiple systems, including immune, digestive and
nervous system. When telomerase expression is turned on later in life, these degenerations can be reversed.
More importantly, nervous system, where neurons are thought to be differentiated and stay that way for a life-
time, manifests remarkable improvement from the degeneration [4]. Telomerase activity and short telomeres are
implicated in aging mechanism [5]-[7]. Enhancing telomerase activity is one way to delay aging. A small mole-
cule telomerase activator, TA-65, isolated from the root of the traditional Chinese medicine, Astragalus mem-
branaceus in mice [8] can precisely do the same.
Ashwagandha (Withania somnifera Dunal) root extract, consisting of several withanolides, is an extensively
used ayurvedic medicine with multitude of protective effects on humans such as revitalization, stress tolerance
[9] and anti-inflammation [10]. Further, it enhances longevity in C. elegans [11]. With little or no toxic effect,
Ashwagandha [12] can be considered as supplement in humans [13]. Though Ashwagandha is suggested to in-
crease longevity, so far no evidence has been provided to reinforce this claim except in C. elegans [11] which is
usually a harbinger to the positive outcome in humans.
Here, we address the efficacy of a high concentration, full-spectrum Ashwagandha root extract to provide an-
ti-aging effect through enhanced telomerase activity in an in vitro cell culture model.
2. Materials and Methods
2.1. Cell Culture
The human HeLa cell line was used in the present study. The cells were maintained in DMEM (Invitrogen) sup-
plemented with 10% fetal bovine serum in a humidified incubator (37˚C and 5% CO2). Cells (40% - 60% con-
fluency) were treated with various concentrations (10 µg, 50 µg, 100 µg, 500 µg, 5 mg) of Ashwagandha Root
Extract (KSM-66, Shri Kartikeya Pharma, Hyderabad) for 72 hours.
2.2. Preparation of Cell Lysate
Cells were collected and centrifuged at 6000 rpm for 6 min. Pellets of 6 × 105 cells were suspended in ice-cold
NP-40 lysis buffer and incubated 30 min on ice [14]. The cell lysate was aliquoted into separate tubes and stored
at 80˚C until analyzed by TRAP assay.
2.3. Telomerase Assay and Quantification
Detection of telomerase activity in HeLa extracts employed the PCR-based telomeric repeat amplification pro-
tocol (TRAP assay) is a modification of the assay described by [14]. The protein concentration was determined
using Lowry’s method [15]. Briefly, total volume of reaction mixture was 50 µl contained 0.5 µl of dNTP mix
(2.5 mM), 5 µl of 10× TRAP Buffer, 0.15 µg TS [5-AATCCGTCGAGCAGAGTT-3’] primer, 0.15 µg and
ACX [5’GCGCGGCTTACCCTTACCCTTACCCTAACC-3’] primer, 40 µl RNase-free H2O, 0.5 µl of 5 U/µl
Taq DNA polymerase and 2 µl (1000 cells) of cell lysate. The PCR mixture was incubated at 30 min at room
temperature. The PCR was then started at 94˚C for 90 sec followed by a 40-cycle amplification (94˚C for 20 s,
50˚C for 30 s, and 72˚C for 90s). The amplified PCR product will yield a 6-bp incremental ladder was separated
on 12% acrylamide-TBE gels and visualized by ethidium bromide staining in UV light. The images were then
processed and quantified using Image J software. The density/intensity of the amplified 6 bp repeat periodicity
PCR product observed and quantitated by Image J software is represented as densitometric units.
2.4. Statistical Analysis
Statistical analyses on the percentage of telomerase activity in HeLa cell extracts were done using Sigmaplot
V. Raguraman, J. R. Subramaniam
201
(ver.10.0).
3. Results
Aging associated telomere shortening is well documented. More importantly, telomerase, which is needed to
maintain the telomere length through replication, is essential for healthy life. In the terminally differentiated so-
matic tissues, telomerase activity is low. Several factors, including stress aggravate the senescence process
through telomere shortening. Given the importance of telomere/telomerase in aging and health, identification of
a supplement from the natural/plant herb based ancient traditional systems of medicine, which could retain the
telomere length or increase telomerase activity, is a less expensive and faster way with the most important added
benefit of dismal toxicity. We evaluated the Ashwagandha root extract powder (KSM-66) suspended in water to
enhance telomerase activity. Using the human cervical carcinoma cell line, HeLa, reported to have telomerase
activity [16], we determined Ashwagandha’s telomerase activity enhancing effect following published protocols
[14]. First of all, we determined the optimal total protein concentration of the cell extract needed to assess the
telomerase activity (Figure 1). The telomerase activity was highest between 50 ng and 5 µg of total protein of
cell extract. We selected 2 µg as the ideal protein concentration and all further telomerase assays were carried
out under these conditions.
3.1. Identification of Optimal Concentration of Ashwagandha to
Enhance Telomerase Activity
HeLa cells were exposed to different concentrations of full spectrum Ashwagandha root extract as suspension of
the powder in water for 72 hrs following which the cells were processed and telomerase activity determined.
This resulted in dose-dependent increase in telomerase activity upto 50 µg /ml after which the activity started
decreasing as the preparation is a powder suspension (Figure 2).
3.2. Enhancement of Telomerase Activity
Further, HeLa cells were treated with 10 µg and 50 µg of Ashwagandha root extract based on results arrived
from dose response curve. Cells treated with 10 - 50 µg of Ashwagandha root extract enhanced telomerase ac-
tivity by 45% (Figure 3).
Figure 1. Determination of optimal concentration for the telomerase assay. Different concentra-
tions of HeLa cell lysates were assayed for telomerase activity. The activity is measured by
quantifying the density of amplified 6 bp repeats under each concentration with Image J software
and represented as densitometric units in the Y-axis. X-axis represents the amount of total HeLa
cell lysate as protein concentration.
V. Raguraman, J. R. Subramaniam
202
Figure 2. Effect of various concentrations of Ashwagandha root extract on telomerase activity
in HeLa cells. The concentrations of Ashwagandh is given in the X-axis. The telomerase ac-
tivity measured by quantifying the density of amplified 6 bp repeats (resolved in the 12%
TBE-acrylamide gel), under each concentration with Image J software and represented as den-
sitometric units in the Y-axis.
(a) (b)
Figure 3. Results of Quantitative TRAP assays: (a) Gel picture showing 6-bp ladder of telo-
merase activity resolved in 12% TBE-polyacrylamide gels. NC-Negative control—without
Hela cell lysate; C—with HeLa cell lysate; with and without Ashwgandha treatment; The ar-
rows represent the amplified 6-bp periodicity products due to telomerase activity followed by
PCR amplification; (b) Densitometry analyses of percentage of telomerase activity in control
and ashwagandha treated cells (Cumulative of four independent sets). Statistical significance
*P < 0.05.
4. Discussion
As non communicable diseases are in the rise due to aging, strategies to increase healthspan is rigorously eva-
luated using all possible systems and organisms. Generally, a gene or its absence or specific chemicals like Re-
serpine [17] [18], Aswagandha [11], Rapamycin [19] and Resveratrol [20] can increase lifespan in various or-
ganisms like yeast, C. elegans, drosophila and mice. In addition, they induce stress tolerance. But the exact me-
chanism of their lifespan extension, especially the contribution of telomere/telomerase is not known. One of the
V. Raguraman, J. R. Subramaniam
203
important qualities for health span is stable telomere at the ends of the chromosomes in the differentiated so-
matic tissues. The hallmark of aging is associated with telomere; the progressive attrition of telomere in human
beings contributes to mortality in several age-related diseases [6] [21]. Mouse cells without telomerase activity
have short telomere length [22], emphasizing the essentiality of telomerase for telomere maintenance. Since ag-
ing promotes degenerative pathologies, screening for new drugs is a necessity to develop highly effective thera-
py for the enhancement of telomerase activity in order to avoid critically short telomere length leading to aging
and age-related diseases. Tomás-Loba et al., (2008) [23] demonstrated that enhanced telomerase activity in mice
can delay aging and confer cancer resistance. Recently, Bernardes de Jesus et al., (2011), demonstrated TA-65
[8], the telomerase activator obtained from the Chinese medicine, can elongate short telomeres and increase
health span of mice without increasing cancer incidence. Hence, we evaluated the enhancement of the telome-
rase activity, which is to maintain the telomere by adding the hexanucleotide repeats, by an ancient Ayurvedic
herb Ashwagandha root extract (Figure 1). Indeed, Ashwagandha root extract powder, at a concentration of 10
µg - 50 µg/ml (Figure 2), increased telomerase activity by ~45%, in the Human HeLa cell line upon 72 hrs ex-
posure (Figure 3), as determined by the TRAP assay. Ashwagandha is one of the most widely used ancient
ayurvedic herb and generally non-toxic. Moreover, earlier, we reported that Ashwagandha can increase C. ele-
gans lifespan [11]. Therefore, Ashwagandha deserves to be evaluated as a potential anti-aging ayurvedic herbal
preparation in higher organisms and the potential mechanism needs to be investigated.
5. Conclusion
Thus, Ashwagandha root extract is able to enhance telomerase activity in the HeLa cell line. Given the excep-
tional necessity of the telomeres at the ends of the chromosomes for the maintenance and integrity of the chro-
mosomes, it will be worthwhile to evaluate Ashwagandha under various adult onset disease conditions. This can
provide a holistic protective effect.
Acknowledgements
The authors thank the Center for Stem Cell and Regenerative Medicine and the Center for Indian Systems of
Medicine, Sri Ramachandra University for the infrastructure and Shri Kartikeya Pharma, Hyderabad for the fi-
nancial support.
References
[1] Jin, K., Simpkins, J.W., Ji, X., Leis, M. and Stambler, I. (2015) The Critical Need to Promote Research of Aging and
Aging-Related Diseases to Improve Health and Longevity of the Elderly Population. Aging and Disease, 6, 1-5.
http://dx.doi.org/10.14336/AD.2014.1210
[2] Blackburn, E.H. (2001) Switching and Signaling at the Telomere. Cell, 106, 661-673.
http://dx.doi.org/10.1016/S0092-8674(01)00492-5
[3] Greider, C.W. and Blackburn, E.H. (1985) Identification of a Specific Telomere Terminal Transferase Activity in Te-
trahymena Extracts. Cell, 43, 405-413. http://dx.doi.org/10.1016/0092-8674(85)90170-9
[4] Jaskelioff, M., Muller, F.L., Paik, J.-H., et al. (2011) Telomerase Reactivation Reverses Tissue Degeneration in Aged
Telomerase-Deficient Mice. Nature, 469, 102-126. http://dx.doi.org/10.1038/nature09603
[5] Flores, I., Benetti, R. and Blasco, M.A. (2006) Telomerase Regulation and Stem Cell Behaviour. Current Opinion in
Cell Biology, 18, 254-260. http://dx.doi.org/10.1016/j.ceb.2006.03.003
[6] Harley, C.B., Futcher, A.B. and Greider, C.W. (1990) Telomeres Shorten during Ageing of Human Fibroblasts. Nature,
345, 458-460. http://dx.doi.org/10.1038/345458a0
[7] Mu, J. and Wei, L.X. (2002) Telomere and Telomerase in Oncology. Cell Research, 12, 1-7.
http://dx.doi.org/10.1038/sj.cr.7290104
[8] de Jesus, B.B., Schneeberger, K., Vera, E., Tejera, A., Harley, C.B. and Blasco, M.A. (2011) The Telomerase Activator
TA-65 Elongates Short Telomeres and Increases Health Span of Adult/Old Mice without Increasing Cancer Incidence.
Aging Cell, 10, 604-621. http://dx.doi.org/10.1111/j.1474-9726.2011.00700.x
[9] Bhattacharya, S.K. and Muruganandam, A.V. (2003) Adaptogenic Activity of Withania somnifera: An Experimental
Study Using a Rat Model of Chronic Stress. Pharmacology Biochemistry and Behavior, 75, 547-555.
http://dx.doi.org/10.1016/S0091-3057(03)00110-2
[10] Malik, F., Kumar, A., Bhushan, S., et al. (2009) Immune Modulation and Apoptosis Induction: Two Sides of Antitu-
V. Raguraman, J. R. Subramaniam
204
moural Activity of a Standardised Herbal Formulation of Withania somnifera. European Journal of Cancer, 45, 1494-
1509. http://dx.doi.org/10.1016/j.ejca.2009.01.034
[11] Kumar, R., Gupta, K., Saharia, K., Pradhan, D. and Subramaniam, J.R. (2013) Withania somnifera Root Extract Ex-
tends Lifespan of Caenorhabditis elegans. Annals of Neuorscience, 20, 13-16.
[12] Prabu, P.C., Panchapakesan, S. and Raj, C.D. (2013) Acute and Sub-Acute Oral Toxicity Assessment of the Hydroal-
coholic Extract of Withania somnifera Roots in Wistar Rats. Phytotherapy Research, 27, 1169-1178.
[13] Mishra, L.C., Singh, B.B. and Dagenais, S. (2000) Scientific Basis for the Therapeutic Use of Withania somnifera
(Ashwagandha): A Review. Alternative Medicine Review, 5, 334-346.
[14] Herbert, B.-S., Shay, J.W. and Wright, W.E. (2003) Analysis of Telomeres and Telomerase. Current Protocols in Cell
Biology, Chapter 18, Unit 18.6. http://dx.doi.org/10.1002/0471143030.cb1806s20
[15] Lowry, O.H., Rosebrough, N.J., Farr, A.L. and Randall, R.J. (1951) Protein Measurement with the Folin Phenol Rea-
gent. Journal of Biological Chemistry, 193, 265-275.
[16] Hou, M., Xu, D., Bjorkholm, M. and Gruber, A. (2001) Real-Time Quantitative Telomeric Repeat Amplification Pro-
tocol Assay for the Detection of Telomerase Activity. Clinical Chemistry, 47, 519-524.
[17] Srivastava, D., Arya, U., Soundara Rajan, T., Dwivedi, H., Kumar, S. and Subramaniam, J.R. (2008) Reserpine Can
Confer Stress Tolerance and Lifespan Extension in the Nematode C. elegans. Biogerontology, 9, 309-316.
http://dx.doi.org/10.1007/s10522-008-9139-5
[18] Saharia, K., Arya, U., Kumar, R., Sahu, R., Das, C.K., Gupta, K., Dwivedi, H. and Subramaniam, J.R. (2012) Reser-
pine Modulates Neurotransmitter Release to Extend Lifespan and Alleviate Age-Dependent Aβ Proteotoxicity in Cae-
norhabditis elegans. Experimental Gerontology, 47, 188-197. http://dx.doi.org/10.1016/j.exger.2011.12.006
[19] Harrison, D.E., Strong, R., Sharp, Z.D., Nelson, J.F., Astle, C.M., Flurkey, K., Nadon, et al. (2009) Rapamycin Fed
Late in Life Extends Lifespan in Genetically Heterogeneous Mice. Nature, 460, 392-395.
[20] Wood, J.G., Rogina, B., Lavu, S., Howitz, K., et al. (2004) Sirtuin Activators Mimic Caloric Restriction and Delay
Ageing in Metazoans. Nature, 430, 686-689. http://dx.doi.org/10.1038/nature02789
[21] Cawthon, R.M., Smith, K.R., O’Brien, E., Sivatchenko, A. and Kerber, R.A. (2003) Association between Telomere
Length in Blood and Mortality in People Aged 60 Years or Older. The Lancet, 361, 393-395.
http://dx.doi.org/10.1016/S0140-6736(03)12384-7
[22] Blasco, M.A., Lee, H.W., Hande, M.P., et al. (1997) Telomere Shortening and Tumor Formation by Mouse Cells
Lacking Telomerase RNA. Cell, 91, 25-34. http://dx.doi.org/10.1016/S0092-8674(01)80006-4
[23] Tomás-Loba, A., Flores, I., Fernández-Marcos, P.J., et al. (2008) Telomerase Reverse Transcriptase Delays Aging in
Cancer-Resistant Mice. Cell, 135, 609-622. http://dx.doi.org/10.1016/j.cell.2008.09.034
... Telomerase is a ribonucleoprotein enzyme that responsible for adding telomeric repeats to the ends of chromosomes, prevents progressive telomere loss and maintains telomere length (Jafri et al., 2016). Telomeres are the specialized DNA sequences of 2-20 kbp length that are repeated (TTAGGG repeats) at the end of the linear chromosomes which act as caps that serve to maintain the integrity of chromosome stability during replication (Hornsby, 2007 (Raguraman and Subramaniam, 2016). Therefore, the regulation of telomerase activity in aged cells is very important. ...
... Therefore, the regulation of telomerase activity in aged cells is very important. Some previous studies reported the potential of plant extracts such as Withania somnifera and Astragalus membranaceus on increasing telomerase activity in the Hela cell line (Raguraman and Subramaniam, 2016). ...
... Detection of telomerase activity was based on the PCR-based telomeric repeat amplification protocol (TRAP assay) with some modifications (Raguraman and Subramaniam, 2016). Briefly, the total volume of the reaction mixture was 50 µL contained 0.5 µL of dNTP mix (2.5 mM), 5 µL of 10X TRAP Buffer, 0.15 µg TS [5'-AATCCGTCGAGCAGAGTT-3'] primer, 0.15 µg ACX [5'GCGCGGCTTACCCTTACCCTTACCCTAAC C-3'] primer, 40 µL RNase-free H 2 O, 0.5 µL of 5 U/µL Taq DNA polymerase and 2 µL (1000 cells) of cell lysate. ...
Article
Plukenetia volubilis L. leaves were part of the traditional diets in many countries. P. volubilis leaves were used to make tea and sold as local products in Thailand. There is less information on the composition of P. volubilis leaves. Previous study revealed that roasted leaves extract with hot water showed the highest antioxidant activity and the antioxidant property might be due to the presence of flavonoid. The present study was carried out to determine the quercetin content in P. volubilis leaves extract and evaluate the anti-aging potential activities including MMP-2 inhibition activity and telomerase stimulation activity. P. volubilis leaves were roasted in hot air oven and extracted with hot water. The extract was investigated for quercetin content by high-performance liquid chromatography (HPLC). In vitro cytotoxicity, MMP-2 inhibition activity and telomerase stimulation activity were determined for anti-aging properties. The results revealed that P. volubilis leaves contained quercetin 50.50±4.78 mg/g DW. The extract showed no cytotoxicity on human skin fibroblast with cell viability of 96.76-120.83%. It demonstrated the potential of MMP-2 inhibition (8.74±2.84%) activity but lower than ascorbic acid. P. volubilis leave extract did not have telomerase stimulation activity on the human Hela cell line. However, the results from this study have indicated the possibility of anti-aging potential of P. volubilis leaves extract.
... Ashwagandha roots are known for their role in immunomodulation, 6,7 stress reduction, 8 as an antioxidant, cardioprotective function, 9 cardiorespiratory endurance, 10 inflammation prevention, anti-tumor activity, neuroprotection, and anti-cancer activity. 11 The roots promote health and longevity by augmenting defense against diseases, 12 preventing aging, 13 revitalizing the body in debility, 14 improving resistance to adverse environmental factors, and creating a sense of well-being. Ashwagandha extract also showed a better effect on reproductive health. ...
... 14 Moreover, Ashwagandha enhances telomerase activity in the HeLa cell line which established the anti-aging impact of the plant components. 13 Safety assessment in any clinical study is considered as one of the most important aspects. Any pharmaceutical formulation and substance used either as medication or as a supplement are subject to safety and tolerability assessments, followed by efficacy assessments. ...
Article
Full-text available
Background Ashwagandha (Withania somnifera) is a well-established and reputed herb in Ayurvedic medicine. It has been used as a “Rasayana” (rejuvenator), nootropic, and as a powerful natural adaptogen. The herb extract is extensively used for general wellbeing and in specific ailments. However, only a few studies have investigated the safety and tolerability of Ashwagandha in humans. This study evaluated the safety of Ashwagandha root extract consumption in healthy adults. Methods : In this randomized, double-blind, placebo-controlled, and parallel-group study, 80 healthy participants (40 males, 40 females) were randomized in a 1:1 ratio to receive either Ashwagandha 300 mg or a starch placebo of the same dosage, twice daily, orally for 8 weeks. The study was conducted at MV Hospital, and King George Medical University, Lucknow, India. The primary safety outcomes considered were laboratory assessment of hematological parameters, serum biochemistry analysis including hepatotoxicity evaluation, and thyroid function parameters. The secondary outcomes of this study were the clinical adverse events and the vital parameters. The within and between the groups' datasets were compared using the Wilcoxon signed-rank test and the Mann Whitney U test, respectively. Results A detailed evaluation of the vital signs such as body weight, body temperature, pulse rate, respiratory rate, systolic and diastolic blood pressure, and Body Mass Index (BMI) were conducted for each participant at the baseline and the end of the study for treatment and placebo groups. Similarly, hematological and biochemical parameters were evaluated at the baseline and the study termination. The outcome did not indicate any untoward effects in any of the treated volunteers. No statistically significant change or abnormality was observed in the considered parameters including thyroid hormonal profile in both the groups. No adverse events were reported by any of the participants in this study. Conclusions Ashwagandha is being consumed since time immemorial following the Ayurvedic medicine practices. Modern science requires evidence of the safety and efficacy of the Ashwagandha extract before mass consumption for various health issues and as a supplement. The present study revealed that the consumption of Ashwagandha root extract for 8 weeks was safe in both males and females volunteers. However, long term study and varying dosage ranges should be investigated in the future.
... telomerase activity by ~45% at 10-50 μg (assessed by the Telomerase Rapid Amplification Protocol (TRAP) assay) [12]. Ashwagandha extract also exhibited anti-genotoxic effects against H2O2-induced DNA damage in human peripheral blood lymphocytes [13]. ...
... Withanolide, a bioactive constituent of Ashwagandha showed a 29.7% extension in the mean lifespan and regulated the insulin/IGF-1 signaling (IIS) pathway and neural activity in C. elegans [11]. In human HeLa cell lines, Ashwagandha root extract, tested at various concentrations, led to an enhancement in telomerase activity by~45% at 10-50 µg (assessed by the Telomerase Rapid Amplification Protocol (TRAP) assay) [12]. Ashwagandha extract also exhibited anti-genotoxic effects against H 2 O 2 -induced DNA damage in human peripheral blood lymphocytes [13]. ...
Article
Full-text available
Ageing, while a relentless, unidirectional and pleiotropic phenomenon of life, is a key trigger for several age-related disorders, such as cancer, cataract, osteoporosis, hypertension, cardiovascular (CV), metabolic and even neurodegenerative ailments, including Alzheimer’s (AD) and Parkinson’s (PD) disease [1] [...]
... Enhancing telomerase activity is one way to delay aging for a health lifespan [56]. W. somnifera enhanced telomerase activity by~45% in human HeLa cell lines [57]. The antioxidant property of W. somnifera and its effect on telomerase activity enhancement may explain the lifespan extension in both Drosophila para bss1 mutant and Oregon-R strains. ...
Article
Full-text available
Background Seizure disorders are considered a serious health issue because of the vast number of people affected globally and the limited treatment options. Approximately 15 million epileptic patients worldwide do not respond to any of the currently available medications. Carbamazepine (CBZ) is one of the most widely used antiepileptic drugs (AEDs) for the treatment of epilepsy, which is discontinued in less than 5% of epileptic patients due to its side effects. In traditional medicine, to establish the foundation of health care, plant extracts are utilized to a great extent to treat different pathologies. Withania somnifera (W. somnifera) is an herbal component with anticonvulsant properties. Objectives To compare the medicinal effects of W. somnifera on lifespan, fecundity, fertility and epileptic phenotype in Drosophila paralytic mutant (parabss1) model system with CBZ, a commonly used AED. Material and methods Flies were exposed to three different doses of W. somnifera or CBZ in standard wheat flour-agar media for six days. Drosophila Oregon-R strain was used as a control. Results Results indicate that a high dose of W. somnifera increased the lifespan in Drosophila parabss1 while remaining safe for fecundity and fertility. CBZ decreased the lifespan of parabss1 mutant at higher dose (40 μg/ml), as expected, and also reduced the fecundity and fertility of the flies. Our findings indicate that W. somnifera was more effective than CBZ to control epileptic phenotype. Conclusion W. somnifera is an effective medication with no side effects for treating epilepsy in Drosophila paralytic mutant.
... A recent study on C. elegans successfully demonstrated the enhanced longevity of the worm using Ashwagandha root extract [7]. Another study used Ashwagandha root extract on HeLa cells and showed increased telomerase activity, representing an anti-aging effect [8]. ...
Article
Full-text available
Background: Perimenopause is the period during which many physiological changes mark the transition into the final menstrual period of a woman and these changes are associated with climacteric symptoms. Objectives: This study aimed to assess the efficacy and tolerability of an Ashwagandha root extract on the climacteric symptoms, quality of life (QoL), and hormonal parameters in perimenopausal women. Materials and methods: In this 8-week, randomized, double-blind, placebo-controlled study, 100 women with climacteric symptoms were randomly allocated to take either a placebo or 300 mg of an Ashwagandha root extract twice daily. Outcomes were measured using the menopause rating scale (MRS), menopause-specific QoL (MENQoL), hot flash score, and hormonal changes in estradiol, follicle-stimulating hormone (FSH), luteinizing hormone (LH), and testosterone. Results: Among 100 participants enrolled, 91 participants completed the study. In comparison with the placebo, ashwagandha supplementation was associated with a statistically significant reduction in total MRS score (p < 0.0001), reflected by significant reductions in the psychological (p = 0.0003), somato-vegetative (p = 0.0152), and urogenital (p < 0.0001) domains. Ashwagandha intake demonstrated a statistically significant reduction in total MENQoL scores (p < 0.0001) and was also associated with a statistically significant increase in serum estradiol (p < 0.0001) and a significant reduction in serum FSH (p < 0.0001) and serum LH (p < 0.05) compared with the placebo. There was no significant between the group differences in the serum testosterone level. Conclusion: These findings suggest that ashwagandha root extract can be a safe and effective option to relieve mild to moderate climacteric symptoms during perimenopause in women.
... However, some polysaccharides have also been reported to impair the telomere region or inhibit telomerase activity to exert an antitumor effect [168], but their action depends on specific disease contexts [167,169,170]. [182,183] Basil oil Ocimum basilicum L. ...
Article
Full-text available
Proper functioning of cells—their ability to divide, differentiate, and regenerate—is dictated by genomic stability. The main factors contributing to this stability are the telomeric ends that cap chromosomes. Telomere biology and telomerase activity have been of interest to scientists in various medical science fields for years, including the study of both cancer and of senescence and aging. All these processes are accompanied by telomere-length modulation. Maintaining the key levels of telomerase component (hTERT) expression and telomerase activity that provide optimal telomere length as well as some nontelomeric functions represents a promising step in advanced anti-aging strategies, especially in dermocosmetics. Some known naturally derived compounds contribute significantly to telomere and telomerase metabolism. However, before they can be safely used, it is necessary to assess their mechanisms of action and potential side effects. This paper focuses on the metabolic potential of natural compounds to modulate telomerase and telomere biology and thus prevent senescence and skin aging.
... A recent study on C. elegans successfully demonstrated the enhanced longevity of the worm using Ashwagandha root extract [7]. Another study used Ashwagandha root extract on HeLa cells and showed increased telomerase activity, representing an anti-aging effect [8]. ...
Article
Full-text available
Background Ashwagandha is an excellent adaptogen that is being used since ancient times in Ayurvedic medicine. Traditionally, it is used for various ailments and general well-being, including the treatment of geriatric patients. Managing quality of life (QoL) remains a challenge for the elderly population, especially joint pain management, sleep, and general well-being. With a growing global elderly population, QoL management with efficient medication and supplementation is the major healthcare requirement. Objective The objective of this study was to assess the safety, efficacy, and tolerability of Ashwagandha (Withania somnifera (L.) Dunal.) root extract on the improvement of general health and sleep in elderly people. Methods This 12-week, prospective, randomized, double-blind, placebo-controlled study was conducted on individuals of either gender aged between 65-80 years. Participants were randomized to receive Ashwagandha root extract at a dose of 600 mg/day (n = 25) orally, or identical placebo capsules with the same dose (n = 25) for 12 weeks. Efficacy was assessed using the WHOQOL-BREF questionnaire, sleep quality, mental alertness on rising, and Physician's Global Assessment of Efficacy to Therapy (PGAET). The safety and tolerability were assessed using the clinical adverse events reporting and Patient's Global Assessment of Tolerability to Therapy (PGATT). Results Statistically significant (P<0.0001) improvement was observed in the Ashwagandha treatment group compared to the placebo. The mean (SD) total score of WHOQOL-BREF improved from 140.53 (8.25) at the baseline to 161.84(9.32) at the end of the study. The individual domain scores were also improved. At baseline, the sleep quality and the mental alertness on rising were comparatively low in both the groups. However, upon intervention, a significant increase in the quality of sleep (P<0.0001) and mental alertness (P<0.034) was observed in the Ashwagandha treatment group when compared to the placebo group. Overall improvement was observed for the general wellbeing, sleep quality, and mental alertness in the study population. The experimental group population displayed good tolerability to the test product and it was reported as safe and beneficial by the study participants. Conclusion The study outcomes suggest that Ashwagandha root extract was efficient in improving the QoL, sleep quality, and mental alertness as self-assessed by the elderly participants. The recommended dose used in this study could be effective for the elderly population.
... Apoptotic cell death is considered a protective mechanism to clear cytotoxic debris and to protect surrounding healthy cells. Interestingly, the effects observed on TL in the flies treated with Wse perfectly match with the observation that Wse enhances telomerase activity in the human HeLa cell line (48). It should be noted that TART, along with human telomerase, is one of the Dm telomeric retrotransposons encoding also a polymerase protein with reverse transcriptase activity (18). ...
Article
Oxidative stress is commonly observed in both idiopathic and genetic cases of Parkinson's disease (PD). It plays an important role in the degeneration of dopaminergic neurons, and it has been associated with altered telomere length (TL). There is currently no cure for PD, and extracts of antioxidative plant, such as Mucuna pruriens and Withania somnifera, are commonly used in Ayurveda to treat patients with PD. In this study, we evaluated 2 enzymatic markers of oxidative stress, glutathione (GSH) system and superoxide dismutase (SOD), and TL in a Drosophila melanogaster model for PD [phosphatase and tensin homolog-induced putative kinase 1 (PINK1) B9 ]. This evaluation was also performed after treatment with the phytoextracts. PINK1B9 mutants showed a decrease in GSH amount and SOD activity and unexpected longer telomeres compared with wild-type flies. M. pruriens treatment seemed to have a beneficial effect on the oxidative stress conditions. On the other hand, W. somnifera treatment did not show any improvements in the studied oxidative stress mechanisms and even seemed to favor the selection of flies with longer telomeres. In summary, our study suggests the importance of testing antioxidant phytoextracts in a PINK1B9 model to identify beneficial effects for PD.-Baroli, B., Loi, E., Solari, P., Kasture, A., Moi, L., Muroni, P., Kasture, S., Setzu, M. D., Liscia, A., Zavattari, P. Evaluation of oxidative stress mechanisms and the effects of phytotherapic extracts on Parkinson's disease Drosophila PINK1B9 model.
Article
Withania somnifera, commonly known as "Ashwagandha" or "Indian ginseng" is an essential therapeutic plant of Indian subcontinent regions. It is regularly used, alone or in combination with other plants for the treatment of various illnesses in Indian Systems of Medicine over the period of 3,000 years. Ashwagandha (W. somnifera) belongs to the genus Withania and family Solanaceae. It comprises a broad spectrum of phytochemicals having wide range of biological effects. W. somnifera has demonstrated various biological actions such as anti-cancer, anti-inflammatory, anti-diabetic, anti-microbial, anti-arthritic, anti-stress/adaptogenic, neuro-protective, cardio-protective, hepato-protective, immunomodulatory properties. Furthermore, W. somnifera has revealed the capability to decrease reactive oxygen species and inflammation, modulation of mitochondrial function, apoptosis regulation and improve endothelial function. Withaferin-A is an important phytoconstituents of W. somnifera belonging to the category of withanolides been used in the traditional system of medicine for the treatment of various disorders. In this review, we have summarized the active phytoconstituents, pharmacologic activities (preclinical and clinical), mechanisms of action, potential beneficial applications, marketed formulations and safety and toxicity profile of W. somnifera.
Article
Full-text available
Due to the aging of the global population and the derivative increase in aging-related non-communicable diseases and their economic burden, there is an urgent need to promote research on aging and aging-related diseases as a way to improve healthy and productive longevity for the elderly population. To accomplish this goal, we advocate the following policies: 1) Increasing funding for research and development specifically directed to ameliorate degenerative aging processes and to extend healthy and productive lifespan for the population; 2) Providing a set of incentives for commercial, academic, public and governmental organizations to foster engagement in such research and development; and 3) Establishing and expanding coordination and consultation structures, programs and institutions involved in aging-related research, development and education in academia, industry, public policy agencies and at governmental and supra-governmental levels.
Article
Full-text available
An ageing world population has fueled interest in regenerative remedies that may stem declining organ function and maintain fitness. Unanswered is whether elimination of intrinsic instigators driving age-associated degeneration can reverse, as opposed to simply arrest, various afflictions of the aged. Such instigators include progressively damaged genomes. Telomerase deficient mice have served as a model system to study the adverse cellular and organismal consequences of wide- spread endogenous DNA damage signaling activation provokes progressive tissue atrophy, stem cell depletion, organ system failure, and impaired tissue in vivo 1. Telomere loss and uncapping injury responses1. Here, we sought to determine whether entrenched multi-system degeneration in adult mice with severe telomere dysfunction can be halted or possibly reversed by reactivation of endogenous telomerase activity. To this end, we engineered a knock-in allele encoding a 4- hydroxytamoxifen (4-OHT)-inducible telomerase reverse transcriptase-Estrogen Receptor (TERT- ER) under transcriptional control of the endogenous TERT promoter. Homozygous TERT-ER mice display short dysfunctional telomeres and sustain increased DNA damage signaling and classical degenerative phenotypes upon successive generational matings and advancing age. Telomerase reactivation in such late generation TERT-ER mice extends telomeres, reduces DNA damage signaling and associated cellular checkpoint responses, allows resumption of proliferation in quiescent cultures, and eliminates degenerative phenotypes across multiple organs including testes, spleens and intestines. Notably, somatic telomerase reactivation reversed neurodegeneration with restoration of proliferating Sox2+ neural progenitors, DCX+ newborn neurons, and Olig2+ oligodendrocyte populations. Consistent with the integral role of SVZ neural progenitors in generation and maintenance of olfactory bulb interneurons2, this wave of telomerase-dependent neurogenesis resulted in alleviation of hyposmia and recovery of innate olfactory avoidance responses. Accumulating evidence implicating telomere damage as a driver of age-associated organ decline and disease risk1,3 and the dramatic reversal of systemic degenerative phenotypes in adult mice observed here support the development of regenerative strategies designed to restore telomere integrity.
Article
Full-text available
Background: In the ancient Indian herbal medicine system several ayurvedic preparations are claimed to have longevity enhancing effects. But, so far, no clear scientific evidence has been provided. One among them, is the roots of the plant, commonly known as Ashwagandha (Withania somnifera Dunal- WSD), which is supposed to have myriad of beneficial effects including long life. Purpose: Here, we evaluated both the root extract (RE) and its purified ingredients (PI-RE) with a similar composition as in RE obtained from the roots of WSD for lifespan extension in the well established model system, C. elegans. PI-RE could extend the lifespan of C. elegans. Methods: We used wild type C. elegans (N2) or RB918: acr-16 (ok789); andNL2099: rrf-3 (pk1426) mutant worms and analysed their lifespan assay in Ashwagandha extract spreaded on plates containing Bacterial Lawns. Results: Strangely, while there was no effect on the wild type worms, the mutant for the human nicotinic acetylcholine receptor, nAchR, α7 equivalent, acr-16, showed around ~20% lifespan extension when treated with PI-RE. Conclusion: Thus, we are able to show that one of the age old healthy longlife supplements, Ashwagandha does extend lifespan of C. elegans.
Article
Full-text available
An ageing world population has fuelled interest in regenerative remedies that may stem declining organ function and maintain fitness. Unanswered is whether elimination of intrinsic instigators driving age-associated degeneration can reverse, as opposed to simply arrest, various afflictions of the aged. Such instigators include progressively damaged genomes. Telomerase-deficient mice have served as a model system to study the adverse cellular and organismal consequences of wide-spread endogenous DNA damage signalling activation in vivo. Telomere loss and uncapping provokes progressive tissue atrophy, stem cell depletion, organ system failure and impaired tissue injury responses. Here, we sought to determine whether entrenched multi-system degeneration in adult mice with severe telomere dysfunction can be halted or possibly reversed by reactivation of endogenous telomerase activity. To this end, we engineered a knock-in allele encoding a 4-hydroxytamoxifen (4-OHT)-inducible telomerase reverse transcriptase-oestrogen receptor (TERT-ER) under transcriptional control of the endogenous TERT promoter. Homozygous TERT-ER mice have short dysfunctional telomeres and sustain increased DNA damage signalling and classical degenerative phenotypes upon successive generational matings and advancing age. Telomerase reactivation in such late generation TERT-ER mice extends telomeres, reduces DNA damage signalling and associated cellular checkpoint responses, allows resumption of proliferation in quiescent cultures, and eliminates degenerative phenotypes across multiple organs including testes, spleens and intestines. Notably, somatic telomerase reactivation reversed neurodegeneration with restoration of proliferating Sox2(+) neural progenitors, Dcx(+) newborn neurons, and Olig2(+) oligodendrocyte populations. Consistent with the integral role of subventricular zone neural progenitors in generation and maintenance of olfactory bulb interneurons, this wave of telomerase-dependent neurogenesis resulted in alleviation of hyposmia and recovery of innate olfactory avoidance responses. Accumulating evidence implicating telomere damage as a driver of age-associated organ decline and disease risk and the marked reversal of systemic degenerative phenotypes in adult mice observed here support the development of regenerative strategies designed to restore telomere integrity.
Article
Full-text available
Inhibition of the TOR signalling pathway by genetic or pharmacological intervention extends lifespan in invertebrates, including yeast, nematodes and fruitflies; however, whether inhibition of mTOR signalling can extend lifespan in a mammalian species was unknown. Here we report that rapamycin, an inhibitor of the mTOR pathway, extends median and maximal lifespan of both male and female mice when fed beginning at 600 days of age. On the basis of age at 90% mortality, rapamycin led to an increase of 14% for females and 9% for males. The effect was seen at three independent test sites in genetically heterogeneous mice, chosen to avoid genotype-specific effects on disease susceptibility. Disease patterns of rapamycin-treated mice did not differ from those of control mice. In a separate study, rapamycin fed to mice beginning at 270 days of age also increased survival in both males and females, based on an interim analysis conducted near the median survival point. Rapamycin may extend lifespan by postponing death from cancer, by retarding mechanisms of ageing, or both. To our knowledge, these are the first results to demonstrate a role for mTOR signalling in the regulation of mammalian lifespan, as well as pharmacological extension of lifespan in both genders. These findings have implications for further development of interventions targeting mTOR for the treatment and prevention of age-related diseases.
Article
Withania somnifera is a widely used medicinal plant for several disorders. Toxicity studies on Withania somnifera are not available. Acute and sub-acute oral toxicities of Withania somnifera root extract in Wistar rats were evaluated in the present study. In the acute toxicity study, WSR extract was administered to five rats at 2000 mg/kg, once orally and were observed for 14 days. No toxic signs/mortality were observed. In the sub-acute study, WSR extract was administered once daily for 28 days to rats at 500, 1000 and 2000 mg/kg, orally. No toxic signs/mortality were observed. There were no significant changes (P < 0.05) in the body weights, organ weights and haemato-biochemical parameters in any of the dose levels. No treatment related gross/histopathological lesions were observed. The present investigation demonstrated that the no observed adverse effect level was 2000 mg/kg body weight per day of hydroalcoholic extract of W. somnifera in rats and hence may be considered as non-toxic. Copyright © 2012 John Wiley & Sons, Ltd.
Article
Aging is a debilitating process often associated with chronic diseases such as diabetes, cardiovascular and neurodegenerative diseases like Alzheimer's disease (AD). AD occurs at a very high incidence posing a huge burden to the society. Model organisms such as C. elegans become essential to understand aging or lifespan extension - the etiology, molecular mechanism and identification of new drugs against age associated diseases. The AD model, manifesting Aβ proteotoxicity, in C. elegans is well established and has provided valuable insights. Earlier, we have reported that Reserpine, an FDA-approved antihypertensive drug, increases C. elegans lifespan with a high quality of life and ameliorates Aβ toxicity in C. elegans. But reserpine does not seem to act through the known lifespan extension pathways or inhibition of its known target, vesicular monoamine transporter, VMAT. Reserpine's mode of action and the pathways it activates are not known. Here, we have evaluated the presynaptic neurotransmitter(s) release pathway and identified acetylcholine (ACh) as the crucial player for reserpine's action. The corroborating evidences are: i) lack of lifespan extension in the ACh loss of function (hypomorphic) - synthesis (cha-1) and transport (unc-17) mutants; ii) mitigation of chronic aldicarb effect; iii) lifespan extension in dopamine (cat-2) and dopamine and serotonin (bas-1) biosynthetic mutants; iv) no rescue from exogenous serotonin induced paralysis in the AD model worms; upon reserpine treatment. Thus, modulation of acetylcholine is essential for reserpine's action.
Article
Here, we show that a small-molecule activator of telomerase (TA-65) purified from the root of Astragalus membranaceus is capable of increasing average telomere length and decreasing the percentage of critically short telomeres and of DNA damage in haploinsufficient mouse embryonic fibroblasts (MEFs) that harbor critically short telomeres and a single copy of the telomerase RNA Terc gene (G3 Terc(+/-) MEFs). Importantly, TA-65 does not cause telomere elongation or rescue DNA damage in similarly treated telomerase-deficient G3 Terc(-/-) littermate MEFs. These results indicate that TA-65 treatment results in telomerase-dependent elongation of short telomeres and rescue of associated DNA damage, thus demonstrating that TA-65 mechanism of action is through the telomerase pathway. In addition, we demonstrate that TA-65 is capable of increasing mouse telomerase reverse transcriptase levels in some mouse tissues and elongating critically short telomeres when supplemented as part of a standard diet in mice. Finally, TA-65 dietary supplementation in female mice leads to an improvement of certain health-span indicators including glucose tolerance, osteoporosis and skin fitness, without significantly increasing global cancer incidence.