Isolation and Characterization of Bacillus thuringiensis Isolated from Soil and their Possible Impact on Culex pipiens Larvae

Abstract

Use of microbial agents is an important tool for insect control because of their virtual specificity and lower environmental impacts. A total of four soil samples were collected from different localities across the black sea region in Turkey to isolate native Bacillus thuringiensis (Bt) strains. Sodium acetate-(0.25 M)-selection heat-pasteurization, and 50% ethanol treatment methods were used for Bt isolation. Characterization of Bt isolates based on their morphological, physiological and biochemical parameters. PCR analysis was performed, using novel general and specific primers for cry genes (cry4A and cry10 genes) that encoding proteins active against mosquitoes. Based on results, the isolate Bt22.19 showed the highest larvicidal effect against 3 rd instar C. pipiens larvae. Bt 22.19 was isolated from soil samples in hazelnut orchards. The isolated strains had cry4A and cry10 genes. Bt isolates displayed highest similarities with the Bacillus thuringiensis subsp. israelensis regarding to the presence of cry genes. Obtained results are a promising introduction for further studies on evaluation of the potential usefulness of isolate Bt22.19 crystals for mosquito's control.

Full text

Egyptian Journal of Biological Pest Control, 25(2), 2015, 439-444
Isolation and Characterization of Bacillus thuringiensis Isolated from Soil
and their Possible Impact on Culex pipiens Larvae
Aksoy*, H. M.; I. Saruhan*; I. Akca*; Y. Kaya**; H. Onder***; M. Ozturk* and O. Aker*
*Ondokuz Mayis University, Agricultural Faculty, Plant Protection Department, Samsun, 55139, Turkey.
**Ondokuz Mayis University, Agricultural Faculty, Plant Biotechnology Department, Samsun, 55139, Turkey.
***Ondokuz Mayis University, Agricultural Faculty, Animal Science Department, Samsun, 55139, Turkey.
(Received: August 16, 2015 and Accepted: September 22, 2015)
ABSTRACT
Use of microbial agents is an important tool for insect control because of their virtual specificity and lower environmental
impacts. A total of four soil samples were collected from different localities across the black sea region in Turkey to
isolate native Bacillus thuringiensis (Bt) strains. Sodium acetate-(0.25 M)-selection heat-pasteurization, and 50% ethanol
treatment methods were used for Bt isolation. Characterization of Bt isolates based on their morphological, physiological
and biochemical parameters. PCR analysis was performed, using novel general and specific primers for cry genes (cry4A
and cry10 genes) that encoding proteins active against mosquitoes. Based on results, the isolate Bt22.19 showed the
highest larvicidal effect against 3rd instar C. pipiens larvae. Bt 22.19 was isolated from soil samples in hazelnut orchards.
The isolated strains had cry4A and cry10 genes. Bt isolates displayed highest similarities with the Bacillus thuringiensis
subsp. israelensis regarding to the presence of cry genes. Obtained results are a promising introduction for further studies
on evaluation of the potential usefulness of isolate Bt22.19 crystals for mosquito’s control.
Key words: Bacillus thuringiensis, Culex pipiens, larvicidal effects.
INTRODUCTION
The desire for mosquito control increased
significantly. Mosquitoes have the potential and
lethal capacity to kill more than 1 million victims a
year around the world. Culex spp. is a common
mosquito species throughout the world including
Turkey (Harbach, 2012). Culex spp. transmits
pathogens causing human diseases throughout the
world that include dengue fever, malaria and yellow
fever (Almeida et al., 2008). Common insecticides
have been applied for mosquitos’ elimination has
given rise to problems for human and environment.
The most useful methods for controlling these
diseases based on vector control that is mainly
accomplished by using synthetic insecticides. Use of
entomopathogenic bacteria as biolarvicides is a favor
alternative for insect controls (Regis et al., 2001). It
has been safely used against species of the orders
Lepidoptera, Coleoptera, and Diptera for the last 50
years (Roh et al., 2007). Bacillus thuringiensis (Bt) is
a rod-shaped, aerobic, gram positive and spore-
forming bacterium. It forms a parasporal crystal
during sporulation (Höfte and Whiteley, 1989). These
parasporal crystals consist of insecticidal-endotoxins
with specific toxicity towards a variety of
lepidopteran, dipteran and coleopteran larvae (Gill et
al., 1992) and called Cry proteins, expressed by the
cry genes (Schnef et al., 1998). Number of known Bt
strains active on Diptera is growing (Guerchicoff et
al., 1997). B. thuringiensis subsp. israelensis cry and
cyt genes encode dipteran-active toxins: Cry4A,
Cry4B, Cry10A, and Cry11A, Cyt1A, and Cyt2B
(Guerchicoff et al., 1997 and Salehi et al., 2008). To
date, Bt strains have been isolated from many
bacterial habitats, including plant tissue, soil, insects,
and water (Ichimatsu et al., 2000 and Iriarte et al.,
2000), free-living animals (Swiecicka et al., 2002).
The aim of this study was, to find Bt isolates from
different soils in Samsun Province, Turkey, to
characterize these strains by molecular methods and
to determine their larvicidal activity against C.
pipiens larvae.
MATERIALS AND METHODS
Soil samples
Soil samples were collected in glass tube from
surface to a depth of 10 cm in the hazelnut orchards.
A total of 37 soil samples were collected from the
black sea region of Turkey from April, 2013 to June,
2013. This origin of samples had not been previously
treated with any Bt biopesticides. The collected
samples were kept at about 4°C in an incubator till
been used for bacterial isolation.
Isolation of bacteria
The soil samples of 1 g were suspended each in
10ml 0.85% NaCl and heated with shaking at 70°C
for 10 min. Aliquots of 100μl of suspension were
plated onto nutrient agar (Difco nutrient broth
solidified with agar, 10 g l-1). The plates were then
incubated at 30±2°C for 48h, then the culture stained
with amino black and Ziehl’s carbol fuchsin and
examined under a standard light
microscope. Bt isolates were selected when black
crystals dyed black were noticed (Yu et al., 1991).
Biochemical characteristics
Morphological, physiological and biochemical

440
Table (1): Characteristics of general and specific primers for cry1A, cry2, cry3A, cry4A, cry6A, cry8, cry9,
cry10, cry11, cry19, cry21, cry22, cry30, cry40, cry54, cry62A, and cyt1A genes
Primer Sequence* Positions Gene(s) Product size
recognized (bp)
Cry1A F 5’-GAGGGAATGGCACGGGTTTA-3’ 893-912 cry1A 689
R 5’-CCCGAAAAACCGACAGGAGA-3’ 1.581-1.562
Cry2 F 5’-GTAGTGGACCACAGCAGACC-3’ 836-855 cry2 336
R 5’-TAGAGGTAGCAACGCCCTCT-3’ 1.771-1.152
Cry3A F 5’-GTGGAGCGCTTGTTTCGTTT-3’ 54-273 cry3A 528
R 5’-AAACAACAGATGCCCAGCCT-3’ 781-762
Cry4A F 5’- ACGGGGATTTTGAATCGGCT -3’ 2.276-2.295 cry4A 940
R 5’-CCAGTTACATGCCACCCCAT-3’ 3.215-3.196
Cry6A F 5’-GGGGAAAGTAGTCCAGCTCA-3’ 888-907 cry6A 465
R 5’-CCAAGCATCAGAAGCGTCCT-3’ 1.352-1.333
Cry8 F 5’-GCGTTAATCCAGCTGCGATT-3’ 101-120 cry8 1294
R 5’-GTCCAAGCAAATGAAACCCTGT-3’ 1.394-1.373
Cry9 F 5’-TCTATGGGGCAAGATGGGGA-3’ 656-675 cry9 1656
R 5’-AATTTTCACGTGCGCTTGCT-3’ 2.231-2.392
Cry10 F 5’-ATAAATGGGAGCCAGCACGT-3’ 470-489 cry10 1142
R 5’-GTCTCCACCTGTGTGACCAG-3’ 1.611-1.592
Cry11 F 5’-ATAGGGAAATGGGCGGCAAA-3’ 145-164 cry11 1406
R 5’-TCTGTTGCTTGATCTGGCGT-3’ 1.550-1.531
Cry19 F 5’-CCACAAATGCCCATGCGAAA-3’ 103-122 cry19 1422
R 5’-TCCGTGTGTGCCTATTCCAC-3’ 1.524-1.505
Cry21 F 5’-ACACCCTGCTGAACGATCTG-3’ 83-102 cry21 287
R 5’-GGTGGTATACATCGGCAGGG-3’ 369-350
Cry22 F 5’-CAAGCAGGAGCAATTGCAGG-3’ 151-170 cry22 364
R 5’-TTCGCTGCATCTGAGCTAGG -3’ 514-595
Cry30 F 5’-TCCAGGAGCAGCTGTAGGAT-3’ 252-271 cry30 1394
R 5’-GGCCAGGACCTGCAATTACT-3’ 1.645-1.626
Cry40 F 5’-TGTGGGAATCAACCTCGAGC-3’ 149-168 cry40 946
R 5’-CCTACCCAGCCGGCAAAATA-3’ 1.094-1.075
Cry54 F 5’-CCGGAGTTAGTGCAGGTGTT-3’ 197-216 cry54 1488
R 5’-CTGTATGACCAGGACCAGGC-3’ 1.684-1.665
Cry62A F 5’-GGACCCTGCCACGATTAACA-3’ 687-706 cry62A 1301
R 5’-TCACGAACCAGTGATTCGCA-3’ 1.987-1.968
Cyt1A F 5’-CCCTCAATCAACAGCAAGGG-3’ 57-76 cyt1A 593
R 5’-AGCTCGCAGAATCTTGAATTGTG-3’ 649-627
* Position at 5’ end of direct and reverse primers for each PCR primer pair. F and R forward and reverse primers, respectively.
characteristics of the Bt isolates were determined
according to the standard methods recommended in
Bergey’s Manual of Systematic Bacteriology (Sneath
et al., 1984).
Determination of specific cry genes
To identify the larvicidal genotypes of Bt isolates,
seventeen pairs of primers were designed to detect the
presence of the cry and cyt genes through PCR of their
conserved regions. All primers were designed using
Geneious 7 software (Biomatters, Auckland, New
Zealand) based on manual identification of specific
cry and cyt genes regions of the sequence alignment.
BLAST analysis was also performed among chosen
cry and cyt genes sequences in NCBI database to
confirm the specificities of the primer sets. The full
list of primers is provided in table (1). The PCR
mixture contained 1 μl of DNA in a total volume of
10 μl containing 200 nM concentrations of each
primer constituted in 1x BioMix Red (Bioline,
Boston,F Massachusetts, United States) PCR reaction
buffer. The PCR mixture contained 1 μl of DNA in a
total volume of 20 μl containing 200 nM of each
primer in 1× reaction buffer. PCR amplifications
were performed in a T100 thermal cycler (Bio-
Rad) with the following touchdown cycling
conditions: 4 min at 94C, 24 cycles of 0.30 min at
94C, 0.30 min at 65C with a 1C decrease per cycle,
and 1.30 min at 72C, followed by 10 cycles of 0.30
min at 94C, 0.30 min at 56C, and 1.30 min at 72C,
ending with a 16C hold. PCR products were
monitored on a 1.0% agarose gel in 1x TAE buffer at
100V for about 60 min and checked their quality, size
and yield.

441
Bioassays for mosquito larvae
The treatments consisted of:
(i) B. thuringiensis isolates 22.19;
(ii) B. thuringiensis isolates hma 5;
(iii) B. thuringiensis isolate hma7;
(iv) B. thuringiensis isolates bmeg;
(v) Positive control - commercial biopesticide of B.
thuringiensis (VectoBac) WG; and
(vii) Negative control.
Bt isolates were grown onto nutrient agar (Difco)
at 30±2°C for 24 h. The cells were then harvested and
suspended in sterile distilled water at concentrations
of [101, 103, 106 and 109 cfu/ml, colony-forming
units/ml] and heat shocked (10 min, 70C). Different
doses of 8,000; 16,000; and 32,000 international toxic
units (ITU)/mg of commercial biopesticide VectoBac
WG was used as positive control. Untreated box was
negative control. Third-instar larvae were used for all
bioassays in 50ml of tap water in plastic cups
according to the standard bioassay procedure (WHO,
2005). Each bioassay was independently performed
three times in duplicate. C. pipiens larvae were
provided by Ondokuz Mayis University, Agricultural
Faculty, Plant Protection Department, Entomology
Lab. (Samsun, Turkey). Mortality was recorded after
6, 12, 24 and 48h.
Data analysis
Kolmogorov-Smirnov one sample test used to
examine normal distribution and Levene test for equal
variance (homosceasticity) assumption (Onder,
2007).
RESULTS AND DISCUSSION
Biochemical characteristics
Four of gram-positive and spore forming bacilli
were isolated from soil. Morphological, physiological
and biochemical characteristics of isolates are shown
in table (2). All isolates showed a positive reaction in
aerobic growth and gelatin liquefaction tests.
Biochemical data revealed that a negative reaction in
arabinose and mannitol. The isolates of Bt22.19 and
Btbmeg could grow in sodium chloride solutions at
concentrations ranged 5-10%, while the isolates of
Bthma5 and Bthma7 that couldn't grow in NaCl
solution at concentration of 10%.
Determination of specific cry genes
The mosquitocidal genotypes of Bt were
determined through PCR designed primers by using
Geneious 7 software (Biomatters, Auckland, New
Zealand) for the cry1A, cry2, cry3A, cry4A, cry6A,
cry8, cry9, cry10, cry11, cry19, cry21, cry22, cry30,
cry40, cry54, cry62A, and cyt1A genes. Four Bt
isolates obtained from soil samples carried cry4A, and
cry10 genes. The isolates exhibited the 940 bp and
1142 bp fragments of the cry4A and cry10 genes,
Table (2): Morphological, physiological and
biochemical characteristics of Bt isolates
Parameters
Bacillus thuringiensis isolates
Bt2219
Bthma5
Bthma7
Btbmeg
Shape
rod
rod
rod
Rod
Gram staining
G+
G+
G+
G+
Aerobic growth
+
+
+
+
Gelatin liquefaction
-
-
-
-
Acid from Arabinose
-
-
-
-
Mannitol
-
-
-
-
Growth at 5%
+
+
+
+
10%
+
-
-
+
Growth at 30C
+
+
+
+
40C
+
+
+
+
50C
-
-
-
-
*(-) negative reaction, (+) positive reaction, (G+) Gram positive.
respectively, that encode the crystal protein toxic to
mosquitoes. None of the isolates had cry5, cry6A,
cry8, cry9, cry19, cry21, cry22, cry30, cry40, cry54,
cry 62A and cyt1 genes. BLAST analysis indicated
that it corresponded to the cry4A and cry10 genes
(100% identity). The Bt serovar strain BRC-LLP29
was used as a control for cry4A, and cry10 genes (data
not shown).
Bioassays
Bioassay results indicated that the Bt isolates were
toxic against the 3rd instar larvae of C. pipiens.
Percentage mortality of Bt isolates are shown in table
(3). At bacterial concentration of 106 cfu/ml within
48h, percentages of mortality ranged 26.67 - 98.33%,
where they were 98.33, 36.67, 31.67 and 26.67% for
the isolates Bt22.19, Btbmeg, Bthma7 and Bthma5,
respectively (Figure 1). Insignificant differences were
recorded among mortality rates in the isolates of
Btbmeg, Bthma7 and Bthma5. At concentration of
109 cfu/ml, the mortality percentage ranged between
33.33 - 100.0%, where the highest mortality (100.0%)
was recorded at the isolate Bt22.19. Btbmeg, Bthma7
and Bthma5 isolates caused the least larval death,
where the percentage mortality ranged of 33.33 -
40.0% (Figure 2). Highest mortality % were 100,
88.33, 78.33, and 50.0%, obtained at the treatment of
Bt22.19 isolates at the concentrations of 109 cfu/ml,
while treatment with the commercial biopesticide
Wertobag gave highest mortality by 100, 100, 93.33
and 66.67% at the concentration of 32000, ITU/mg
within 48, 24, 12 and 6h, respectively (Figure 3).
Synthetic insecticides have been associated with
human health problems such as cancer, liver damage
and birth defects beside environmental problems.
Some of the microorganisms like, Bacillus spp. in
controlling insects that transmit human diseases, is
well established. Accordingly, the present work was
proposed to isolate and characterize Bt isolates from
black sea region habitat and to test their effect against

442
Table (3): Effects of Bacillus thuringiensis isolates on mean percentage mortality of the 3rd instar larvae
Isolates
CFU/ml
Mean percentage mortality rate (%) ± SD
Time (h)
6
12
24
48
Bt2219
101
0.00 ± 0.00g*
28,33 ± 1,67e
63,33 ± 4,41d
78,33 ± 1,67c
103
0.00 ± 0.00g
46,67 ± 1,67d
83,33 ± 6,01bc
88,33 ± 6,01bc
106
41,67 ± 4,41c
65.00 ± 5,77c
86,67 ± 1,67b
98,33 ± 1,67ab
109
50.00 ± 5,77b
78,33 ± 1,67b
88,33 ± 1,67b
100.00 ± 0.00a
Bthma5
101
0.00 ± 0.00g
5.00 ± 0.00ij
5.00 ± 0.00gh
10.00 ± 2,89hi
103
0.00 ± 0.00g
8,33 ± 3,33hij
10.00 ± 2,89fgh
16,67 ± 4,41gh
106
8,33 ± 1,67def
15.00 ± 0.00fg
21,67 ± 4,41ef
26,67 ± 4,41efg
109
13,33 ± 1,67d
20.00 ± 5,77ef
28,33 ± 6,01e
33,33 ± 1,67def
Bthma7
101
0.00 ± 0.00g
6,67 ± 1,67hij
11,67 ± 1,67fg
16,67 ± 1,67gh
103
0.00 ± 0.00g
13,33 ± 3,33fgh
16,67 ± 6,67efg
20.00 ± 7,64gh
106
5.00 ± 2,89fg
13,33 ± 1,67fgh
25.00 ± 2,89e
31,67 ± 4,41def
109
6,67 ± 1,67efg
26,67 ± 1,67e
28,33 ± 1,67e
40.00 ± 2,89d
Btbmeg
101
0.00 ± 0.00g
6,67 ± 1,67hij
10.00 ± 2,89fgh
10.00 ± 2,89hi
103
0.00 ± 0.00g
10.00 ± 2,89hij
16,67 ± 4,41efg
23,33 ± 6,01fg
106
5.00 ± 0.00fg
15.00 ± 2,89fg
25.00 ± 2,89e
36,67 ± 3,33de
109
11,67 ± 1,67de
25.00 ± 2,89e
28,33 ± 6,01e
38,33 ± 4,41d
Wertobag
(International
toxic unit-ITU)
8000
38,33 ± 1,67c
63,33 ± 1,67c
75.00 ± 2,89c
96,67 ± 1,67ab
16000
53,33 ± 1,67b
81,67 ± 1,67b
91,67 ± 1,67ab
100.00 ± 0.00a
32000
66,67 ± 1,67a
93,33 ± 1,67a
100.00 ± 0.00a
100.00 ± 0.00a
Control
0
0.00 ± 0.00g
3,33 ± 1,67j
0.00 ± 0.00h
0.00 ± 0.00i
P
1.000
<0.001
<0.001
<0.001
<0.001
(*) Mean followed by the same letters in each column are not significant.
Fig. (1): Mortality of Culex pipiens 3rd instar larvae
treated with Bacillus thuringiensis isolates for
different times at the concentration of 106 cfu/ml.
Fig. (2): Mortality of Culex pipiens 3rd instar larvae
treated with Bacillus thuringiensis isolates for
different times at the concentration of 109 cfu/ml.
Fig. (3): Mortality of Culex pipiens 3rd instar larvae treated with Bacillus thuringiensis isolates and the
commercial biopesticide Wertobag for different times at the concentrations of 109 cfu/ml and 32000,
ITU/mg.

443
to the larvae of the C. pipiens. Bt can be isolated from
soil, leaves, dead larvae or water (Armengol et al.,
2007; Hernández-Soto et al., 2009; Liang et al., 2011
and Valicente et al., 2010). The Bt strain produces
crystal proteins that have been successfully used for
controlling the mosquito population (Liang et al.,
2011).
Bacillus was confirmed morphologically and
biochemically accordingly to Sneath (1986). The
isolates were subjected to further biochemical
characterization test according to Claus and Berkeley
(1986) and resulted in four isolates closely
resembling B. thuringiensis 22.19. Wild strains
isolated form environmental samples can synthesize
crystals that display higher activity against insect
pests in comparison to Bt strains already used in
pesticide production. Previous workers were not able
to isolate this entomopathogenic bacterium from
different habitats in black sea region including
hazelnut orchards. Results showed that Bt22.19 is an
important strain that produces secondary metabolites
and active compounds. The strain plays an important
role in biological control of C. pipiens larvae.
It is well known that the characteristic shape of the
mosquitocidal crystals is the spherical-shaped
crystals. Bt produces this type of crystals (Charles and
de Barjac, 1982), to which Culex larvae are more
susceptible (Boisvert, 2005). In the present study, the
highest mortality percentage recorded was 100%,
obtained by the isolate Bt22.19, as compared to other
strains in the untreated control. Present results
reported that successful pupation of Culex spp. was
significantly delayed when exposed to Bt22.19. In
addition, Lacy et al. (2004) confirmed that Bt strains
affected C. quinquefasciatus.
Larvicidal effects of Bt isolates and its commercial
biopesticide Wertobag were compared using
percentages of mortality of C. pipiens larvae at 6, 12,
24 and 48h post treatment. The results showed a good
performance for the isolate of Bt22.19 (100%
mortality at a concentration of 109 cfu/ml within 48h)
and the commercial biopesticide Wertobag (100%
mortality at concentrations of 16000 and 32000
ITU/mg within 48h). Isolate Bt22.19 that had higher
activity than the other isolates (Btbmeg, Bthma7 and
Bthma5) against C. pipiens larvae were identified in
spite of their high similarity cry genes. These data
support the idea that although a great variability in cry
genes codifying for different mosquitocidal toxins
that exist in the natural strains of B. thuringiensis
(Schnepf et al., 1998). Similarly, the results suggest
that insecticidal potency of the isolates was not
directly related with their cry gene content as stated
by Padidam (1992). In addition, Seifinejad et al.
(2008) confirmed that presence of specific genes was
not an accurate indicator of toxicity, because the
genes could be inactive, under the control of an
inefficient promoter or be expressed in a
concentration too low to affect toxicity. However, the
detection of these genes in most Bt isolates collected
locally indicated that they can be effectively used to
produce spore-crystal mixture for controlling
mosquitoes. Similarly, many studies stated that Cry4
and Cry10 play a major role in mosquitocidal activity
of Bt strains (Delecluse et al., 1988; Guerchicoff et
al., 1997; Ben-Dov et al., 1999; Armengol et al.,
2007; Hernández-Soto et al., 2009 and Baig and
Mehnaz, 2010). Misztel et al. (1996) reported that
differences in potency, in general, could be attributed
to the differences in susceptibility of the treated
insects, where explained the connection between
insect mortality and exposure time. This study
reported that highly susceptible insects stopped
feeding within 1 hour and died within 12-48h after
ingestion of the toxin, less susceptible ones ceased
feeding after 6 h and died after 2 days. While the
slightly susceptible insects stopped feeding after 24 h
and died after 2 weeks.
In conclusion, larvicidal potency of the two novel
crystal protein genes, cry4A and cry10, was encoded
at highly mosquitocidal Bt isolate Bt22.19. It is
essential to perform additional bioassays with these
Cry toxins against resistant mosquito colonies
selected ith B.thuringiensis subsp. israelensis toxins.
Bt22.19 exhibited an effect effortlessly against
C. pipiens larvae. So, it can be used as an alternative
insecticide because it is safe for the environment.
Further studies are needed to identify the active
compounds that can be used in broad spectrum for
controlling insects and also to determine the mode of
action of these compounds.
ACKNOWLEDGMENTS
Thanks are due to TUBITAK, the scientific and
technological research council of Turkey that funded
this research.
REFERENCES
Almeida, A. P., R. P. Galão, C. A. Sousa, M. T. Novo,
R. Parreira, and J. Pinto 2008. Potential mosquito
vectors of arbo-viruses in Portugal: species,
distribution, abundance and West Nile infection.
Trans. R. Soc. Trop. Med. Hyg. 102(8):823-32.
Armengol, G., M. C. Escobar, M. E. Maldonado, and
S. Orduz 2007. Diversity of Colombian strains of
Bacillus thuringiensis with insecticidal activity
against dipteran and lepidopteran insects. J. Appl.
Microbiol. 102(1): 77-88.
Baig, D. N. and S. Mehnaz 2010. Determination
and distribution of cry-type genes in
halophilc Bacillus thuringiensis isolates of
Arabian Sea sedimentary rocks. Microbiol. Res.
165(5): 376-383.
Ben-Dov, E., G. Nissan, N. Pelleg, R. Manasherob, S.
Boussiba, and A. Zaritsky 1999. Refined, circular

444
restriction map of the Bacillus thuringiensis
subsp. israelensis plasmid carrying the mosquito
larvicidal genes. Plasmid 42:186–191.
Boisvert, M. 2005. Utilization of Bacillus
thuringiensis var. israelensis (Bti)-based
formulation for the biological control of mosquito
in Canada. Pp. 87-93 In: J. L. Cote, I. S. Otvos, J.
I. Schwartz, and C. Vincent (eds). 6th Pacific Rim
Con. Biotech. of Bacillus thuringiensis and its
Environmental Impacts. Fairmont Empress Hotel,
Victoria, BC, Canada, Oct. 30- Nov. 3, 2005.
Charles, J. F., and H. de Barjac 1982. Sporulation et
cristallogénèse de Bacillus thuringiensis var.
israelensis en microscopie électronique. Ann. Inst.
Pasteur Mic. 133:425-442.
Claus, D., and C. W. Berkeley 1986. The genus
Bacillus. In: Bergey’s Manual of Systematic
Bacteriology. Vol 2. Sneath, P.H.A. (Ed).
Williams, Wilkins, Baltimore. 34: 1105-1139.
Delecluse, A., C. Bourgouin, A. Klier and G.
Rapoport 1988. Specificity of action on mosquito
larvae of Bacillus thuringiensis var. israelensis
toxins encoded by two different genes. Mol. Gen.
Genet. 214:42-47.
Gill, S. S., E. A. Cowles, and P. V. Pietrantonio 1992.
The mode of action of Bacillus thuringiensis
endotoxins. Annu. Rev. Entomol. 37:615-636.
Guerchicoff, A., R. A. Ugalde, and C. P. Rubinstein
1997. Identification and characterization of a
previously undescribed cyt gene in Bacillus
thuringiensis subsp. israelensis. Appl. Environ.
Microbiol. 63:2716–2721.
Harbach, R. E., C. Dahl, and G. B. White 1985. Culex
(Culex) pipiens Linnaeus (Diptera: Culicidae):
concepts, type designations and descriptions.
Proc. Entomol. Soc. Wash. 87: 1–24.
Harbach, R. E. 2012. Culex pipiens: species versus
species complex taxonomic history and
perspective. J. Am. Mosq. Contr. Assoc. 28:10-23.
Hernández-Soto, A., M. C. Del Rincon-Castro, A. M.
Espinoza, J. E. Ibarra 2009. Parasporal body
formation via over expression of the Cry10Aa
toxin of Bacillus thuringiensis subsp. israelensis,
and Cry10Aa-Cyt1Aa synergism. Appl. Environ.
Microbiol. 75:4661-4667.
Höfte, H. and H. R. Whiteley 1989. Insecticidal
crystal protein of Bacillus thuringiensis.
Microbiol. Rev. 53(2):242-255.
Ichimatsu, T., E. Mizuki, K. Nishimura, T. Akao, H.
Saitoh, and K. Higuchi 2000. Occurrence of
Bacillus thuringiensis in fresh waters of Japan.
Curr. Microbiol. 40(4): 217-220.
Iriarte, J., M. Porcar, M. Lecadet, and P. Caballero
2000. Isolation and characterization of Bacillus
thuringiensis strains from aquatic environments in
Spain. Curr. Microbiol. 40:402-408.
Lacy, L. A., J. Day, and M. Heitzman 2004. Long
term effects of Bacillus sphaericus on Culex
quinfasciatus. J. Inverteb. Pathol. 49(1):116-123.
Liang, H., Y. Liu, J. Zhu, P. Guan, and S. Li 2011.
Characterization of cry2-type genes of Bacillus
thuringiensis strains from soil-isolated of Sichuan
basin, China. Braz. J. Microbiol. 42, 140-146.
Misztel, L., W. G. Musial, and J. Augustyniak 1996.
Insecticidal toxins of Bacillus thuringiensis. Post
Mikrobiol. 25: 193-211.
Onder, H. 2007. Using permutation tests to reduce
type I and II errors for small ruminant research. J.
Appl. Anim. Res. 32(1):69-72.
Padidam, M. 1992. The insecticidal crystal protein
CryIA(c) from Bacillus thuringiensis is highly
toxic for Heliothis armigera. J. Invertebr. Pathol.
59:109-111.
Regis, L., M. H. Silva-Filha, C. Nielsen-Leroux, and
J. F. Charles 2001. Bacterial larvicides of dipteran
disease vectors. Trends. Parasitol. 17:377-380.
Roh, J. Y., J. Y. Choi, M. S. Li, B. R. Jin, and Y. H.
Je 2007. Bacillus thuringiensis as a specific, safe,
and effective tool for insect pest control. J.
Microbiol. Biotechnol. 17(4):547–559.
Salehi, J. G., A. A. Pourjan, A. Seifinejad, R.
Marzban, K. Kariman, and B. Maleki 2008.
Distribution and diversity of Dipteran-specific cry
and cyt genes in native Bacillus thuringiensis
strains obtained from different ecosystems of Iran.
J. Ind. Microbiol. Biotechnol. 35(2):83-94.
Schnepf, E., N. Crickmore, J. Van Rie, D. Lereclus,
J. Baum, J. Feitelson, D. R. Zeigler, and D. H.
Dean 1998. Bacillus thuringiensis and its
pesticidal crystal proteins. Microbiol. Mol. Biol.
Rev. 62(3):775-806.
Seifinejad, A., G. R. S. Jouzani, A. Hosseinzadeh, and
C. Abdmishani 2008. Characterization of
Lepidoptera-active cry and vip genes in Iranian
Bacillus thuringiensis strain collection. Biol.
Control. 44:216-226
Sneath, P. A., N. S. Mair, M. E. Sharpe, and J. G.
Holt. 1984. Bergey’s manual of systematic
bacteriology, (2):1123, Williams & Wilkins,
Baltimore.
Sneath, P. H. A. 1986. Endospore-forming gram
positive Rods and Cocci. p. 1104-1105 In: Sneath,
P.H.A., N.S. Mour, M.E. Sharpe, and J.G. Holt
(eds). Bergy's Manual of Systematic Bacteriology,
8th edition. Vol. 2, William & Wilkins. Baltimore.
Swiecicka, I., K. Fiedoruk, and G. H. Bednarz 2002.
The occurrence and properties of Bacillus
thuringiensis isolated from free- living animals.
Lett. Appl. Microbiol. 34:194-8.
Valicente, F. H., A. T. P. Edgard, J. V. V. Maria, P.
C. Newton, A. C. Andréia, T. G. Cláudia, and G.
L. Ubiraci 2010. Molecular characterization and
distribution of Bacillus thuringiensis cry1 genes
from Brazilian strains effective against the fall
armyworm, Spodoptera frugiperda. Biol. Control.
53: 360-366.
WHO. 2005. Guidelines for laboratory and field
testing of mosquito larvicides.World Health
Organization, Geneva, Switzerland.
Yu, Y. M., M. Ohba, and S. S. Gill
1991. Characterization of mosquitocidal activity
of Bacillus thuringiensis subsp. fukuokaensis
crystal proteins. Appl. Environ. Microbiol.
57:1075–1081.