Content uploaded by Kaixiong Ye
Author content
All content in this area was uploaded by Kaixiong Ye on Mar 31, 2016
Content may be subject to copyright.
1
Submission Type: ARTICLE
Best Fit Section: DISCOVERIES
Positive selection on a regulatory insertion-deletion polymorphism in FADS2 influences
apparent endogenous synthesis of arachidonic acid
Kumar S.D. Kothapalli
1!
*, Kaixiong Ye
2!
, Maithili S. Gadgil
3
, Susan E. Carlson
4
, Kimberly O.
O’Brien
1
, Ji Yao Zhang
1
, Hui Gyu Park
1
, Kinsley Ojukwu
1
, James Zou
1
, Stephanie S. Hyon
1
,
Kalpana S. Joshi
3
, Zhenglong Gu
1
, Alon Keinan
2*
, J. Thomas Brenna
1*
1
Division of Nutritional Sciences, Cornell University, Ithaca, New York 14853 USA
2
Department of Biological Statistics and Computational Biology, Cornell University, Ithaca, New
York 14853 USA
3
Department of Biotechnology,
Sinhgad College of Engineering, University of Pune, Pune, India
4
Department of Dietetics and Nutrition, The University of Kansas, Kansas City, KS-66160
! Equal Contribution
*Corresponding authors:
J. Thomas Brenna, voice (607) 255-9182, fax (607) 255-1033, jtb4@cornell.edu
Kumar S.D. Kothapalli, voice (607) 255-3831, fax (607) 255-1033, ksk25@cornell.edu
Alon Keinan, voice (607) 254-1328, fax (607) 255-2323, ak735@cornell.edu
Running title: FADS2 indel determines arachidonic acid status
Revision to Molecular Biology and Evolution, February 2016.
Submitted to Molecular Biology and Evolution, September 2015.
© The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License
(http://creativecommons.org/licenses/by-nc/4.0/), which permits non-commercial re-use, distribution, and reproduction in
any medium, provided the original work is properly cited. For commercial re-use, please contact
journals.permissions@oup.com
MBE Advance Access published March 29, 2016
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Abstract
Long chain polyunsaturated fatty acids (LCPUFA) are bioactive components of membrane
phospholipids and serve as substrates for signaling molecules. LCPUFA can be obtained
directly from animal foods or synthesized endogenously from 18 carbon precursors via the
FADS2 coded enzyme. Vegans rely almost exclusively on endogenous synthesis to generate
LCPUFA and we hypothesized that an adaptive genetic polymorphism would confer advantage.
The rs66698963 polymorphism, a 22 bp insertion-deletion within FADS2, is associated with
basal FADS1 expression, and coordinated induction of FADS1 and FADS2 in vitro. Here we
determined rs66698963 genotype frequencies from 234 individuals of a primarily vegetarian
Indian population and 311 individuals from the U.S. A much higher I/I genotype frequency was
found in Indians (68%) than in the U.S. (18%). Analysis using 1000 Genomes Project data
confirmed our observation, revealing a global I/I genotype of 70% in South Asians, 53% in
Africans, 29% in East Asians, and 17% in Europeans. Tests based on population divergence,
site frequency spectrum and long-range haplotype consistently point to positive selection
encompassing rs66698963 in South Asian, African and some East Asian populations. Basal
plasma phospholipid arachidonic acid status was 8% greater in I/I compared to D/D individuals.
The biochemical pathway product-precursor difference, arachidonic acid minus linoleic acid,
was 31% and 13% greater for I/I and I/D compared to D/D, respectively. Our study is consistent
with previous in vitro data suggesting that the insertion allele enhances n-6 LCPUFA synthesis
and may confer an adaptive advantage in South Asians because of the traditional plant-based
diet practice.
Keywords: fatty acid desaturases, indel (insertion-deletion), long chain polyunsaturated fatty
acids, arachidonic acid, positive selection, population divergence
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Introduction
Twenty and twenty two carbon long chain polyunsaturated fatty acids (LCPUFA), especially
arachidonic acid (ARA; 20:4n-6), eicosapentaenoic acid (EPA; 20:5n-3) and docosahexaenoic
acid (DHA; 22:6n-3) are ubiquitous in mammalian tissue, are bioactive components of
membrane phospholipids (PL) and serve as precursors to cell signaling eicosanoids and
docosanoids that are major drug targets (e.g., COX-1, COX-2 inhibitors, leukotriene receptor
antagonists) (Park, Kothapalli, Lawrence, et al. 2009; Park, Kothapalli, Reardon, et al. 2009;
Park, et al. 2011). LCPUFA can be obtained directly from animal foods or endogenously
synthesized from 18 carbon essential fatty acid precursors linoleic acid (LA; 18:2n-6) and alpha-
linolenic acid (ALA; 18:3n-3) and their metabolites by an alternating series of desaturation and
elongation reactions (Park, Kothapalli, Lawrence, et al. 2009). Vegans rely on this biochemical
pathway to generate all LCPUFA from precursors. Classic carnivores (e.g. cats and most
marine fish) have lost the metabolic ability to make LCPUFA and rely on consumption of animal
tissue to supply all their LCPUFA requirements. Traditional human populations have been
described that are analogous to herbivores (vegans) and carnivores (Natives of the Canadian
Arctic) (Gibson and Sinclair 1981). The genomic determinants of the function of this pathway
are therefore candidates for selective pressure based on human diets habitually consumed
through many generations, e.g., by traditional vegan/vegetarian populations as are found in
India. Signals of positive selection surrounding the FADS gene cluster have been reported in
Greenlandic Inuit and in African populations (Ameur, et al. 2012; Mathias, et al. 2012; Fumagalli,
et al. 2015).
The fatty acid desaturase genes (FADS1 [OMIM#606148] and FADS2 [OMIM#606149]) code
for enzymes that catalyze the introduction of double bonds at specific positions in a fatty acid
chain. FADS1 (Δ5-desaturase) and FADS2 (Δ6/Δ8/Δ4-desaturase) have specificity for several
fatty acid substrates (Park, Kothapalli, Lawrence, et al. 2009; Park, et al. 2011; Park, et al.
2015; Park, et al. 2016). In humans, the FADS genes (FADS1, FADS2, and FADS3) evolved
evolutionarily by gene duplication events and are clustered within the 100 kb region on the long
arm of human chromosome 11 (11q12-13.1) (Marquardt, et al. 2000), a genomic cancer hot
spot (Park, et al. 2011). Our previous results show extensive splicing of all three desaturases,
including a novel function of an alternatively spliced isoform (Park, Kothapalli, Reardon, et al.
2009; Park, et al. 2010; Park, et al. 2012; Park, et al. 2015).
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
FADS2 codes for a desaturase [EC 1.14.19.3] catalyzing the rate limiting steps in the
biosynthesis of LCPUFA (Park, Kothapalli, Lawrence, et al. 2009). Supplementary fig. S1 shows
the n-3 and n-6 biochemical LCPUFA pathways. Genetic studies have shown common single
nucleotide polymorphisms (SNPs) within FADS gene cluster are strongly associated with
LCPUFA levels and disease phenotypes (Schaeffer, et al. 2006; Malerba, et al. 2008; Tanaka,
et al. 2009; Illig, et al. 2010). Using lymphoblasts from Japanese HapMap participants, we
identified a 10 SNP-haplotype in FADS2 (rs2727270 to rs2851682) controlling basal FADS1
mRNA expression; minor allele carriers showed lower basal FADS1 mRNA expression in
cultured lymphoblasts (Reardon, et al. 2012). A conserved genomic region within the haplotype
contained predicted binding sites for a sterol regulatory element binding protein (SREBP). By
amplifying a 629 bp portion flanking the sterol response element (SRE), we identified a
polymorphic 22 bp insertion/deletion (indel) genetic variant (rs66698963), of which the deletion
is the minor allele. Minor allele homozygotes (D/D) had significantly lower expression of FADS1
than the I/I major allele homozygotes (Reardon, et al. 2012). Arachidonic acid is the immediate
product of FADS1, leading directly to the hypothesis that individuals carrying D/D genotype
have lower metabolic capacity to produce LCPUFA from precursors than I/I individuals.
Here we present the first experimentally determined allele and genotype frequencies for the
indel rs66698963 using a primarily vegetarian population from Pune, India compared to a U.S.
population drawn broadly from around the country. By using genetic variations data from the
1000 Genomes Project (1000GP), we estimated the global genotype frequency distribution of
rs66698963. By applying a series of tests for recent positive selection based on population
divergence, site frequency spectrum (SFS), and long-range haplotype, we provide strong
evidence that positive selection drove the insertion allele to high frequency not only in Africans,
but also in South and some East Asians. The association of basal arachidonic acid status and
indel genotype was evaluated in a subset of the U.S. population.
Results and Discussion
Experimentally Determined Genotype and Allele Frequencies of rs66698963
In the U.S. sampling, D/D genotype was 43% (n=134), I/D 39% (n=120) and I/I 18% (n=57); in
the Indian samples D/D genotype was 3% (n=7), I/D 29.5% (n=69) and I/I 67.5% (n=158) (fig.
1A). The observed genotype frequencies in the U.S. sampling deviated from the Hardy
Weinberg Equilibrium (HWE) expected frequencies, whereas sampling from India were
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
consistent with HWE. As the U.S. population includes many definable subgroups, the deviation
is likely to be due to stratification (Nussbaum, et al. 2007). In U.S. sampling, the observed allele
frequency was D: 0.62, I: 0.38, whereas in Indian samples it was D: 0.18, I: 0.82. As a large
fraction of our US sampling (n=201) is from the Kansas cohort, we tested allele frequency
separately from this cohort and found similar trends (D: 0.64, I: 0.36).
Global Genotype Frequency of rs66698963 Determined by using 1000GP Data
As our small sampling represents only two populations, we examined the global genotype
frequency distribution of the rs66698963, by using the most recent whole-genome sequencing
data from the 1000GP (Phase 3) (Auton, et al. 2015). The frequency of rs66698963 (indel) was
retrieved from the 1000GP as the frequency of rs373263659 (indel) after we confirmed with
Sanger sequencing that rs373263659 was actually a misannotation of rs66698963
(supplementary fig. S2). 1000GP data catalogs human genetic variation of 26 different global
populations. Among the five populations of South Asian ancestry, D/D was found in 1.8% (n=9),
I/D 28.2% (n=138), and I/I 69.9% (n=342), very consistent with observations from our
experimental data from Pune, India. For the seven populations of African ancestry, D/D was
5.1% (n=34), I/D 41.5% (n=274), and I/I 53.4% (n=353). For the five populations of European
ancestry, D/D was 25.0% (n=126), I/D 58.4% (n=294), and I/I 16.5% (n=83). For the five
populations of East Asian ancestry, D/D was 16.3% (n=82), I/D 54.9% (n=277), and I/I 28.8%
(n=145). Overall, the I/I genotype frequency is highest in African and South Asian populations,
but lower in European and East Asian populations (supplementary table S1 and fig. 1B). Among
the five populations of South Asian ancestry, Gujarati Indian from Houston, Texas (GIH) has the
highest I/I genotype frequency, 80%, followed closely 78% by Indian Telugu from the UK (ITU).
The lowest frequency of 59% is observed in Bengali from Bangladesh (BEB).
Evaluation of Positive Selection on the FADS Region Surrounding rs66698963
Dramatic genotype frequency differences of rs66698963 among continental populations, led us
to check if positive selection on the FADS region surrounding the rs66698963 has taken place
especially in South Asian populations. We assessed rs66698963 genotype frequency
differences among continental populations using the FST statistic, which quantifies the degree of
population differentiation in allele frequencies. A value of 0 indicates no differentiation and
value of 1 indicates complete subdivision. Over the four continental populations (African,
European, East Asian and South Asian), the FST statistic of rs66698963 is 0.121 (empirical p
value = 0.039), suggesting higher population differentiation than expected by chance. To gain
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
insight into which population has undergone unusual frequency change as a result of regional
adaptation, we further calculated pairwise FST among each pair of the four continental
populations, as well as population branch statistics (PBS) for each population. Significantly high
FST values were observed between South Asians and Europeans (FST = 0.276, empirical p =
2.71x10-4), between South Asians and East Asians (FST = 0.168, empirical p = 0.016), and
between Africans and Europeans (FST = 0.157, empirical p = 0.044). No significant divergence
was observed between South Asians and Africans (FST = 0.028) or between Europeans and
East Asians (FST = 0.021). Together with the PBS patterns (supplementary fig. S3), these
results suggest that rs66698963 has been subjected to positive selection in more than one of
the studied populations.
To further test for positive selection signals in the region surrounding rs66698963 and to identify
which populations have experienced positive selection, we applied formal tests of natural
selection of two general types: (i) based on site frequency spectrum (SFS); and (ii) based on
haplotype length and frequency. For SFS-based tests, we calculated genetic diversity as the
average pairwise number of differences in the locus (π), Tajima’s D (Tajima 1989), and Fay and
Wu’s H (Fay and Wu 2000). Positive selection could result in loss of genetic diversity, an excess
of rare variants, which can be detected by Tajima’s D (negative values), and an excess of high-
frequency derived alleles, which can be detected by Fay and Wu’s H (negative values). We
applied these tests in each of the four continental regions, combining populations within the
same continental region, and in each of the five populations of South Asian origin. All tests were
performed across the whole genome using a sliding-window approach with a window size of 5
kilobase (Kb) and a step size of 1 Kb. Statistical significance was assessed with the empirical
genome-wide distribution. Our analysis at the continental level (fig. 2A, supplementary figs. S4-
S7) confirmed a pattern observed in a previous study: positive selection signals on FADS1 was
observed only in African populations, but not in European or East Asian populations (Mathias, et
al. 2012). For this genomic region surrounding FADS1, the three test statistics in the South
Asian populations follow a similar but less significant pattern as in African populations. For the
immediate genomic region surrounding rs66698963, we observed extremely negative Fay and
Wu’s H values, restricted to South Asians (fig. 2A). African populations also had lower H values
in the same region, but the reduction was not significant. For the combined group of five
populations of South Asian origin, three consecutive 5-Kb windows, representing chromosome
11 region 61,601,001 – 61,608,001 bp, had significant Fay and Wu’s H values, with the most
significant value being -12.27 (empirical p = 0.031). For each of the five populations individually,
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
we also observed significant H statistics surrounding rs66698963 (fig. 2B, supplementary figs.
S8-S12). Two of these populations, GIH and ITU, exhibited the most significant signals of
positive selection (supplementary figs. S9 and S10). The most significant H statistic in GIH was
-14.20 (empirical p = 0.015) and in ITU it was -13.80 (empirical p = 0.018). The Tajima’s D
statistic also showed a significant signal of positive selection for these two South Asian
populations: -1.99 in GIH (empirical p = 0.013) and -1.90 in ITU (empirical p = 0.025).
For haplotype-based tests for positive selection, we calculated the integrated Haplotype Score
(iHS) (Voight, et al. 2006), the number of segregating sites by length (nSL) (Ferrer-Admetlla, et
al. 2014), and Cross-population Extended Haplotype Homozygosity (XPEHH) (Sabeti, et al.
2007) for all genome-wide common variants (minor allele frequency > 5%) and statistical
significance of each statistic was assessed with the empirical genome-wide distribution. Among
the four continental regions (fig. 3), the most significant signals of positive selection were
observed in South Asians, which have an iHS value of -2.79 (empirical p = 4.7x10-3) and a nSL
value of -4.38 (empirical p = 8.95x10-5), with the haplotype carrying the insertion allele showing
unusually long length and high frequency (fig. 4). Significant XPEHH of rs66698963 was also
observed between South Asians and Europeans with a value of 3.47 (empirical p = 1.2x10-3, fig.
5A). Taken together, these haplotype-based test results are consistent with the SFS-based tests
and point to a selective sweep on the FADS region in South Asians, with the adaptive allele
being the insertion of rs66698963 or a variant in very strong linkage disequilibrium (LD) with it.
In addition to South Asians, signals of positive selection were also found in Africans and East
Asians (fig. 3, supplementary figs. S13-S19). For continental level analysis with populations in
the same continental region combined into a single group, Africans have iHS value of -1.70
(empirical p = 0.043) and nSL value of -2.30 (empirical p = 0.017) for rs66698963 while East
Asians have iHS value of -2.05 (empirical p = 0.022) and nSL value of -1.80 (empirical p =
0.045). No significant signals of positive selection were detected for Europeans in any of our
tests. Consistent with population divergence results based on FST, XPEHH of rs66698963 is
also significant between Africans and Europeans with a value of 1.64 (empirical p = 0.039, fig.
5B).
Finally, we performed haplotype-based analyses in each of the five East Asian populations
separately because of the frequency difference of rs66698963 across them (fig. 1B) and
because analysis of East Asians combined as a single group produced apparent inconsistent
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
results: significant haplotype-based results but lack of significant divergence from Europeans.
Significant iHS and nSL results of rs66698963 were only found in CHB and JPT (supplementary
fig. S17), the two populations with highest insertion allele frequency (70% and 75% respectively).
Taken together, strong signals of positive selection on the region surrounding rs66698963 were
consistently found in South Asians, Africans and some East Asians. All results point to
rs66698963 as being at the center of the signal of selection, with the adaptive allele being the
insertion allele of rs66698963 or a variant in very strong LD with it.
Challenge in Indel Calling with Low-depth Sequencing Data
While our Sanger sequencing and agarose gel electrophoresis data provided accurate
frequency estimates for the Indian and U.S. samples, the global frequency pattern of
rs66698963 derived from the 1000GP data may be subjected to inaccurate annotation. Indel
calling has been proved challenging with short-read mapping data sets and indel variants
cataloging is still in its infancy (Li, et al. 2014). Due to the low sequencing coverage depth (~6 X)
in the 1000GP, annotation error is possible. Using the Sanger sequencing data of rs66698963
from 16 Japanese (JPT) individuals from our previous study, which were chosen to be
homozygotes at rs66698963 (Reardon, et al. 2012), we assessed the accuracy of frequency
estimates from 1000GP. Based on Sanger sequencing, 11 out of 16 individuals are I/I genotype
and the remaining five are D/D genotype. All eleven I/I individuals were accurately identified in
1000GP, whereas, among the five D/D individuals, only one was correctly identified, with the
other four inaccurately annotated as I/D heterozygotes. This observation suggests that
inaccurate allele calling in 1000GP may result in lower number of D/D individuals and higher
number of I/D individuals (fig. 1B). Better sequencing data are needed in the future for accurate
estimates. It is noteworthy that our above analysis of natural selection based on SFS and long-
range haplotype are unlikely to be affected by the inaccuracy of rs66698963 calling, because
these statistical tests draw information from many genetic variants in the surrounding region.
Interpretation of the Signals of Positive Selection Surrounding rs66698963
Our evolutionary tests based on population divergence, SFS, and long-range haplotype,
demonstrated consistently strong signals of positive selection surrounding rs66698963 in South
Asian, African and some East Asian populations (CHB and JPT). Positive selection on the
FADS gene cluster have been reported in Africans (Ameur, et al. 2012; Mathias, et al. 2012)
and in Greenlandic Inuit (Fumagalli, et al. 2015) populations. Our study is the first to
demonstrate positive selection in South and some East Asian populations. Most importantly, we
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
propose a putatively causal indel, with regulatory effects on FADS1 and FADS2 (Reardon, et al.
2012).
The signatures of positive selection in African populations previously described by Mathias et al.
(Mathias, et al. 2012) were replicated in our study and further confirmed with additional
evidence from haplotype-based tests (fig. 3). This region is upstream of rs66698963 and its
positive selection signatures are unlinked from those immediately surrounding the indel.
However, the possibility could not be ruled out that the same adaptive variant is responsible for
the observed signatures of selection in both clusters. The other study suggesting positive
selection on FADS genes in African populations proposed an adaptive haplotype based on 28
SNPs in the FADS region (Ameur, et al. 2012). Although no positive selection signals were
found in European populations, the adaptive haplotype in Africans, referred to as haplotype D, is
present in 62% of Europeans and associated with greater LCPUFA status in Europeans (Ameur,
et al. 2012). To test the possibility that the adaptive and association signals of this haplotype D
are the same as those of the insertion allele of rs66698963, we examined the proportion of
haplotype D carrying insertion allele at rs66698963. Among all phased haplotypes from the four
continental regions, 2829 carry insertion allele at rs66698963, 72.9% of them also carry the
haplotype D. For 2357 haplotypes carrying haplotype D, 87.5% also carry the insertion allele
(supplementary fig. S20A). To mitigate the effect of annotation error at rs66698963, we further
tested the correspondence between the haplotype D defined with 28 SNPs and the major
haplotype defined with 10 SNPs from our previous study (Reardon, et al. 2012). These two sets
of SNPs have three in common. Based on our previous study in Japanese individuals, all 10-
SNP major haplotype carry insertion allele at rs66698963 (Reardon, et al. 2012). Among 2762
chromosomes carrying the major haplotype, 85.05% also carry haplotype D, while 99.66% of
2357 chromosomes carrying haplotype D also carry the major haplotype (supplementary fig.
S20B). This strong correspondence between haplotype D and our major haplotype was also
observed when stratifying into each of the four continental regions (supplementary fig. S20C-F),
indicating that the association and adaptive signals described in Ameur et al. (Ameur, et al.
2012) are very likely the same as we reported in this study. However, since previous evidence
of positive selection was only drawn from XPEHH and a composite likelihood (CLR) test of the
allele frequency spectrum (Ameur, et al. 2012), our analyses, with a series of SFS-based and
haplotype-based tests, dramatically strengthen the evidence of positive selection in Africans.
Most importantly, our study proposes a putatively causal variant and demonstrates that the
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
adaptive signals are also present in South and some East Asians, with the strongest signals in
South Asians.
Most recently, Fumagalli et al. described signatures of adaptation on the FADS gene cluster in
indigenous people of Greenland, the Inuit, which have subsisted on a marine diet rich in omega-
3 PUFA (Fumagalli, et al. 2015). Two SNPs carrying adaptive signals, rs7115739 and rs174570,
were also associated with reduced LCPUFA status. The derived alleles of these two SNPs are
almost fixed in the Greenlandic Inuit but have much lower frequencies in other populations
(Fumagalli, et al. 2015). We observed that one of the two SNPs, rs174570, also exhibits positive
selection signals in South Asians (nSL = -3.77, p = 0.00048) and East Asians (iHS = -2.41, p =
0.010; nSL = -2.41, p = 0.012). Interestingly, it is the ancestral allele of the SNP that is adaptive
in these populations, in contrast to the derived allele in Greenlandic Inuit (Fumagalli, et al. 2015).
The ancestral allele has strong LD with the insertion allele of rs66698963 in South and East
Asians (D’ = 0.72 and 0.92, respectively). It is plausible that the ancestral allele of rs174570
may be tagging the effect of the insertion allele of rs66698963. If that is the case, our study
might not only report a functional, adaptive allele (the insertion) in South Asians, some East
Asians, and Africans, traditionally residing on plant-based diet, but also an adaptive allele (the
deletion) in Greenlandic Inuit with marine diet rich in omega-3 fatty acids.
Functional Analysis of rs66698963 Genotypes and Fatty Acid Levels
Associations between genotype and PUFA concentration in RBC PL from the Kansas cohort
were used to probe whether the I/I genotype, with putative higher endogenous arachidonic acid
synthetic capacity, follow a pattern of metabolites consistent with the pathway: higher product
and lower precursor in the order I/I, I/D, and D/D. RBC fatty acid levels were measured in 199
Kansas cohort subjects, of them n=89 were D/D genotype, n=76 were I/D genotype and n=34
were I/I genotype. Participant characteristics of the Kansas cohort are presented in
supplementary table S2. n-6 PUFA acids were significantly and consistently related to genotype.
Fig. 6 presents associations between genotype and n-6 PUFA concentration in RBC PL, a long
term (several month) measure of whole body status. Linoleic acid (18:2) was not related to
genotype. In contrast, the LCPUFA 20:3n-6, 20:4n-6 (arachidonic acid) and 22:4n-6 (adrenic
acid) are all strongly related to genotype. All LCPUFA comparisons are significant between the
D/D and I/I genotypes. 20:3n-6 levels are highest in D/D and lowest in I/I, whereas the 20:4n-6
and 22:4n-6 are opposite. The differences in PUFA concentration calculated for various
precursor-product pairs shows the strongest relationship between 20:4n-6 and 18:2n-6, where
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
I/D and I/I are both different from D/D. Other differences are not as strong but consistent with
expectations from the desaturation-elongation pathway. All differences between genotypes
remained significant after controlling for the effect of age.
The metabolic pathway relating these PUFA is 18:2n-620:3n-620:4n-622:4n-6. The
step 20:320:4 is mediated by FADS1, basal expression of which our previous data show is
modulated by the genotype (Reardon, et al. 2012). The three steps between the 18:2n-
620:4n-6 sequentially use FADS2, a usually rapid elongation system, and FADS1. Our
current results are consistent with hypothesis emerging from our work in lymphoblasts that
arachidonic acid would be greater for individuals with the I/I genotype compared to D/D because
of basal FADS1 expression (Reardon, et al. 2012). The immediate precursor 20:3n-6 is lower,
and the immediate product, 20:4n-6, is higher, following the hypothesized FADS1 expression.
The precursor 18:2n-6 is not different among genotypes, pointing to the FADS1 step as the
driver for the observed altered levels. Future studies with larger and more diverse samples are
warranted to further evaluate the functional implications of this novel indel polymorphism.
Linoleic acid (18:2n-6) is the most prevalent PUFA in the U.S. diet, with mean intake exceeding
13 grams per day (Brenna and Lapillonne 2009; Naqvi, et al. 2012). While it is a precursor of
ARA, LA lowering does not reduce circulating ARA because the overwhelming amount of diet
LA delivered by seed oils, principally soy oil in the US (Blasbalg, et al. 2011), causes ARA levels
to reach a plateau (Gibson, et al. 2013). For instance, reduction of LA intake from 8.5 to 4.2 g/d
over 4 weeks resulted in no significant change in plasma PL ARA (9.7 to 9.9%,w/w), though
DHA rose 8% (3.47 to 3.77%,w/w) (Wood, et al. 2014). Dietary preformed ARA is required to
overcome the maximum and increase circulating ARA (O'Dea and Sinclair 1985). Increasing
ARA is accompanied by increasing ARA-derived eicosanoid synthesis including vasoactive
species (Ferretti, et al. 1997; Nelson, et al. 1997), though oral ARA consumption at least in the
short term do not produce acute clinical effects. How sustained basal ARA levels influence
chronic disease progression is not well understood as an isolated factor. The 8% difference in
basal ARA probably reflects differences in maximal levels for any particular individual.
However, GWAS evidence suggests that the FADS gene cluster is associated with diseases
that may be of the complex inflammatory type, such as colorectal cancer risk (Zhang, Jia, et al.
2014) and cardiovascular disease (Zhang, Johnson, et al. 2014). The FADS gene cluster was
found in association with asthma pathogenesis using eQTL mapping (Sharma, et al. 2014), and
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
a FADS SNP was found to influence synthesis of arachidonic acid (ARA) and synthesis of pro-
inflammatory lipoxygenase products (Hester, et al. 2014).
Dietary Practices and LCPUFA
Over many generations in India, approximately 35% of the population follows the traditional
lacto-vegetarian diet practice (Raheja, et al. 1993; Key, et al. 2006); our Indian cohort followed
this trend with responses to dietary pattern questions indicating 38% vegetarian (unpublished),
congruent with our dietary instruments applied to research participants in other studies that
consistently show a vegetarian dietary pattern and generally low meat consumption in this
region (Gadgil, et al. 2014). As plant sources contain only the LCPUFA precursors LA and ALA,
individuals on plant based diets must biosynthesize LCPUFA endogenously. The higher
frequency of I/I alleles (67.5%) among Indians supports the hypothesis that insertion genotype
and its associated haplotype is under selective pressure due to its higher metabolic capacity to
convert precursors (LA and ALA) to LCPUFA. This I/I genotype may be favored in populations
depending on vegetarian diets and possibly populations having limited access to diets rich in
LCPUFA, especially fatty fish.
Homo sapiens evolved eating a diet characterized by 4:1 to 1:1 ratio of n-6/n-3 PUFA (Eaton, et
al. 1998). Based on the diet of evolutionary adaptedness (DEA), the overall n-6/n-3 estimate
was found to be about 0.79 (Eaton, et al. 1998), whereas, the modern Western diet has
undergone an extraordinary increase in n-6 linoleic acid resulting in a ratio above 10/1, and is
likely to be even higher in Indian diet, estimate to be 20-50 (Raheja, et al. 1993; Simopoulos
2002). Substantial evidence has accumulated that this dramatic shift is a risk factor for lifestyle-
related diseases, such as cardiovascular, diabetes, cancer, and inflammation-related diseases
(Raheja, et al. 1993; Simopoulos 2002). Most commercially produced seed oils, sunflower,
safflower, peanut, grapeseed, cottonseed and corn, contain very high levels of n-6 LA;
individuals with I/I genotype having higher metabolic capacity to convert precursors to longer
chain PUFA may be at increased risk for proinflammatory disease states as they efficiently
convert LA to ARA. Put another way, individuals with the I/I genotype may be vulnerable to ill-
health when adopting a diet rich in n-6 LA which severely reduce synthesis of anti-inflammatory
n-3 LCPUFA because n-6 competes with n-3 to access the Δ-6 desaturase enzyme. Moreover,
n-6 PUFA compete with and antagonize against incorporation of n-3 PUFA into tissue (Alvheim,
et al. 2012), challenging the metabolic requirement for structural n-3 PUFA that are especially
concentrated in neural tissue (Diau, et al. 2005).
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Role of Genetic Factors in the Conversion of PUFA Precursors to Products
Metabolism studied using stable isotope labeling, candidate gene SNP, GWAS and
metabolomics show interindividual variation in the conversion of PUFA precursors to LCPUFA
products depends on genetic factors (Emken, et al. 1994; Schaeffer, et al. 2006; Tanaka, et al.
2009; Illig, et al. 2010). An early FADS gene cluster association study found an inherited
component accounting for 28% of the variance in ARA levels among minor allele carriers of a 11
SNP haplotype (Schaeffer, et al. 2006). Minor allele carriers showed lower serum phospholipid
ARA. Several independent association studies replicated these findings, showed PUFA levels to
be associated with genotypes (Malerba, et al. 2008; Martinelli, et al. 2008; Xie and Innis 2008;
Bokor, et al. 2010; Rzehak, et al. 2010; Lattka, et al. 2011; Sergeant, et al. 2012). Our present
results show product-precursor differences, arachidonic acid to linoleic acid, to be 13% and 31%
greater for I/D and I/I compared to D/D, respectively. Converging data from genetic studies
show SNP variants within intron 1 of FADS2 to be associated with human phenotypes such as
IQ scores, blood fatty acid levels and complex diseases (Caspi, et al. 2007; Aulchenko, et al.
2009; Standl, et al. 2011; Steer, et al. 2012; Groen-Blokhuis, et al. 2013; Zhang, Jia, et al.
2014). For instance, commonly reported SNP variants (rs174575, and rs1535) which are
associated with increased IQ scores, blood fatty acid levels and complex diseases are <600 bp
and <5000 bp upstream from the FADS2 indel, respectively. In humans, common SNP variants
are often found to follow indels (Lu, et al. 2012), suggesting the hypothesis that rs174575 and/or
rs1535 are tags for the functional genomic indel that directly modulates binding at the nearby
SRE.
Putative Hypothesis rs66698963 Locus Control Bidirectional Regulation
Our previous cell culture data indicating that FADS1 and FADS2 expression (mRNA) is
upregulated in response to SREBP modulators suggests that this intronic region is a master
switch controlling bidirectional regulation of FADS1 and FADS2, as illustrated in supplementary
fig. S21. This hypothesis is analogous to regulatory control elsewhere in the human genome: a
genome-wide survey of gene organization estimates 11.6% of human genes are bidirectionally
oriented (Liu, et al. 2011). For instance, LXR regulated ABC transporters (ABCG5 and ABCG8),
which arose by gene duplication events, are arranged in a head-to-head orientation on HSA
2p21. They are transcribed in divergent directions and share common regulatory elements
(Remaley, et al. 2002). Similarly, COL4A1 and COL4A2 oriented head-to-head on HSA 13q34
also contain a bidirectional transcription unit (Pollner, et al. 1997).
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Conclusions
Collectively our data suggest that FADS2 indel genotypes contribute to individual variability in
response to PUFA consumption. In the vegan or vegetarian scenario in which only, or primarily,
precursors would be consumed, tissue LCPUFA would depend on the relative proportions of
18:2n-6 and 18:3n-3. In a food system dominated by linoleic acid, I/I genotype carriers would
maintain higher basal arachidonic acid and presumably greater inflammatory potential and
attendant higher rates of chronic disease related to inflammation. Balanced consumption of
precursors would be particularly important for I/I genotype carriers. I/I carriers consuming
excess 18:2n-6 may particularly benefit from consumption of EPA and DHA which bypass the
desaturation steps, as a direct balance to ARA. Further, D/D individuals may also benefit from
EPA and DHA consumption in pregnancy and in development when neural and other tissue
dependent on omega-3 LCPUFA are rapidly develop. For chronic diseases exacerbated by
inflammation, D/D carriers maintain lower ARA levels and thus lower inflammatory potential.
They are predicted to be less vulnerable to excess 18:2n-6 intake. Future studies should
incorporate FADS2 indel screening as a potential genetic marker for studying LCPUFA
regulation.
Materials and Methods
Biological Sampling Details
A total of 311 human samples (blood, breastmilk, and placenta) were obtained from Kansas City,
Rochester NY, and seven breast milk banks around the U.S. and Canada. Similarly, a total of
234 human blood samples were obtained from Pune City, India. All were used for genotyping.
Only RBC (Red Blood Cells) samples from Kansas City were used for fatty acid profiling.
Study Approvals and Baseline Characteristics
The study was approved by the institutional review boards on human subjects research from all
participating institutions, as follows. The University of Kansas Medical Center Human Subjects
Committee, University of Rochester Research Subjects Review Board, KEM Hospital Ethics
Committee and Institutional Review Board of Sinhgad Institute, India, all approved human
sample collection and written informed consent was obtained from all donors. The Cornell
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
University Institutional Review Board approved collection of samples and waived consent
because the samples were collected and anonymized at human milk banks (exemption 4), as
follows: Mothers’ Milk Bank, San Jose, CA; Bronson Mothers’ Milk Bank, Kalamazoo, MI;
Mothers’ Milk Bank, a program of Rocky Mountain Children’s Health Foundation, Denver, CO;
Ohio Health Mothers’ Milk Bank, Columbus, OH; Mothers’ Milk Bank at Austin, Austin, TX;
Mothers’ Milk Bank of Northeast, Newton Upper Falls, MA; British Columbia Women’s Milk Bank,
Vancouver, BC, Canada. Subjects (n=234) from Indian cohort were all Asian Indians, among
them n=122 were women (ages 18 to 43 years) and n=112 were men (ages 23 to 36 years).
Dietary patterns from surveys (not presented) indicated that n=89 (38.03%) were vegetarians
and n=145 (61.97%) were omnivores. The US cohort (311 participants) were all females.
Breastmilk (n=69) samples from US cohort are banked samples. Placental (n=41) samples are
from pregnant adolescents (ages ≤18 years) who were recruited from the Rochester Adolescent
Maternity Program in Rochester, NY (Cao, et al. 2014). Detailed demographic characteristics of
Kansas cohort (n=201) are provided elsewhere (Carlson, et al. 2013). All participants were
English speaking and are between ages 16 to 36 years. RBC fatty acid analysis were available
only for the Kansas City participants (n=199). Fatty acid data is not available from the Indian
cohort.
Genotyping rs66698963
Genomic DNA was extracted and was used to amplify a 629 base pair fragment flanking the
SRE within intron 1 of FADS2 (GenBank Accession# NT_167190.1) by PCR as previously
described (Reardon, et al. 2012). The following primer pairs were used to amplify 629 bp
fragment: FADS2 forward primer 5′ TTTCTCAAAGGCCGTGGTGT 3′, FADS2 reverse primer 5′
AGTGCTAACCACTCCTGGAA 3′. The amplified products were run on 2% agarose gels until
the two alleles, if present, were well separated. The gels were stained with ethidium bromide
and visualized under UV to identify indel genotypes. A gel demonstrating detection of the three
possible genotypes for the 22 bp indel is presented in Figure 1. Samples were assigned pairs
of genotypes of I (insertion) or D (deletion) as I/I, I/D, or D/D.
Genotype Frequency of rs66698963 in 1000GP
VCF files of genetic variations data from the 1000GP (phase 3) were downloaded from the
official FTT site (ftp://ftp.1000genomes.ebi.ac.uk/vol1/ftp/release/20130502/). The indel
rs66698963 was not directly annotated in the VCF file while another indel rs373263659 with the
same length of insertion was present at the same region. Using Sanger sequencing results from
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
our previous study (Reardon, et al. 2012), we determined that rs373263659 is a misannotation
of rs66698963. To confirm this observation and to further test the accuracy of indel calling in
1000GP, we examined the read mapping results for 16 Japanese individuals, for whom we have
Sanger sequencing results. BAM files for these 16 individuals were downloaded from each
individual’s directory on the FTP site and visualized with SAMtools (Li, et al. 2009). After
confirming that rs373263659 is a misannotation of rs66698963 and the 1000GP has acceptable
calling accuracy for this indel, we used directly the frequency of rs373263659 as that of
rs66698963.
In the 1000GP, there are in total 2504 individuals from five continental regions and 26 global
populations. Four admixed American populations were excluded from our analysis because of
their admixture history. After the exclusion, there are seven populations of African ancestry
(AFR): Yoruba in Ibadan, Nigeria (YRI), Luhya in Webuye, Kenya (LWK), Gambian in Western
Divisions in the Gambia (GWD), Mende in Sierra Leone (MSL), Esan in Nigeria (ESN),
Americans of African Ancestry in SW USA (ASW), African Caribbeans in Barbados (ACB); five
populations of European ancestry (EUR): Utah Residents with Northern and Western European
Ancestry (CEU), Toscani in Italia (TSI), Finnish in Finland (FIN), British in England and Scotland
(GBR), Iberian Population in Spain (IBS); five populations of East Asian ancestry (EAS): Han
Chinese in Beijing, China (CHB), Japanese in Tokyo, Japan (JPT), Southern Han Chinese
(CHS), Chinese Dai in Xishuangbanna, China (CDX), Kinh in Ho Chi Minh City, Vietnam (KHV);
and five populations of South Asian ancestry (SAS): Gujarati Indian from Houston, Texas (GIH),
Punjabi from Lahore, Pakistan (PJL), Bengali from Bangladesh (BEB), Sri Lankan Tamil from
the UK (STU), Indian Telugu from the UK (ITU).
Testing for Positive Selection on the FADS Region
SFS-based statistics, including genetic diversity (TT) Tajima’s D (Tajima 1989), and Fay and
Wu’s H (Fay and Wu 2000), and population differentiation-based statistics, FST (Weir and
Cockerham 1984) and population branch statistics (PBS) (Yi, et al. 2010) were calculated using
in-house Perl scripts, which are available upon request. FST and PBS were calculated for each
genetic variant. Genetic diversity, Tajima’s D, and Fay and Wu’s H were calculated using a
sliding-window approach with window size of 5 Kb and moving step of 1 Kb. Statistical
significance for these statistics were assessed using the ranking of genome-wide variants or
windows, respectively. For example, if the Tajima’s D value for a specific 5-Kb window is among
the top 5% of all genome-wide windows, then it is considered as statistically significant with an
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
empirical p value <0.05. PBS was estimated based on pair-wise FST values among three
continental regions (Yi, et al. 2010). For a specific locus, the PBS value for a population
represents the amount of allele frequency change in the history of this population since its
divergence from the other two populations. The PBS estimate for a population depends on the
choice of the other two populations. Therefore, to calculate PBS for South Asians, we chose
three combinations of continental regions: AFR, EUR and SAS; AFR, EAS and SAS; EUR, EAS
and SAS.
Haplotype-based tests for positive selection, including the Integrated Haplotype Score (iHS)
(Voight, et al. 2006), the number of segregating sites by length (nSL) (Ferrer-Admetlla, et al.
2014), and Cross-population Extended Haplotype Homozygosity (XPEHH) (Sabeti, et al. 2007),
were calculated using the software selscan v 1.1.0a (Szpiech and Hernandez 2014). All SNPs
with minor allele frequency greater than 5% in at least one of the four continental regions were
included in our calculation. Genetic variants without information on their ancestral allele were
excluded from analyses. Information on ancestral allele was retrieved directly from the VCF file
with an exception for the indel under study, rs66698963, whose ancestral allele was not defined
in the VCF file. Alignment of homologous sequences from human, Chimpanzee and Orangutan
showed that neither the insertion nor the deletion allele of rs66698963 is present in Chimpanzee
or Orangutan (supplementary fig. S22A). By examining the mapping results of short sequencing
reads from a Neanderthal from the Altai Mountains (Prufer, et al. 2014) and an archaic
Denisovan individual (Meyer, et al. 2012) to the human genome, we found that the insertion
allele is present in both Neanderthal and Denisovan genomes and it is therefore considered as
the ancestral allele. Empirical p values were inferred based on the genome-wide distribution of
the statistics. The haplotype bifurcation diagrams and EHH plots were drawn using an R
package, rehh (Gautier and Vitalis 2012).
Fatty Acid Analysis
RBC phospholipids (PL) fatty acids were analyzed for 199 samples from Kansas according to
methods reported elsewhere (Carlson, et al. 2013) and all fatty acids were correlated with
genotype. Briefly, lipids from RBC were extracted according to the modified Folch method
(Folch, et al. 1957). Extracted RBC lipids were fractionated by loading on to the TLC plate (Zail
and Pickering 1979). Fatty acid methyl esters (FAME) from RBC PL were prepared using boron
trifluoride-methanol (Morrison and Smith 1964), and were separated by using an SP-2560
capillary column (100 m; Sigma Aldrich) (Smuts, et al. 2003). Peak integration and analysis was
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
carried out by using a Star 6.41 Chromatography Workstation. Individual peaks were identified
by comparing their retention times with those of known standards (PUFA 1 and PUFA 2; Sigma
Aldrich), and an equal weight FAME mixture (Supelco 37 Component FAME mix; Sigma Aldrich)
was used to adjust fatty acids for area/weight to calculate a final percentage weight of total fatty
acids (Carlson, et al. 2013). Fatty acids are expressed as percent weight-for-weight (%,w/w).
Percent changes are expressed as Ax/x/AD/D, where A denotes a fatty acid, x = I or D, and D/D
is the deletion/deletion genotype. Pairwise statistical analysis was conducted using Student's t-
test at P<0.05 and data are presented as mean ± 95% confidence interval. Secondarily, the
non-parametric Wilcoxon method was also performed to verify significance in case of skewed
fatty acid distributions.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Acknowledgements
This work was supported by NIH grant R01 AT007003 from the National Center for
Complementary and Integrative Health (NCCIH) (formerly the National Center for
Complementary and Alternative Medicine (NCCAM)) and the Office of Dietary Supplements
(ODS), NIH grant R01 HD047315, USDA-NIFA National Research Initiative 2005-35200-15218,
and NIH grant R01 GM108805. Its contents are solely the responsibility of the authors and do
not necessarily represent the official views of the NIH, USDA, or any of their units. The authors
thank Dr. R.R. Ran-Ressler, Cornell University, for assistance with breast milk samples.
Conflict of interest
The authors declare no conflict of interest.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Figure Legends.
Figure 1. A) Top: Agarose gel image of PCR products from 3 individual DNA samples to
establish genotype of the 22 bp rs66698963 polymorphism. Lanes from left to right: 100 bp
ladder marker (arrow pointing at 600 bp), insertion/deletion (I/D); deletion/deletion (D/D);
insertion/insertion (I/I). Botton: Distribution of rs66698963 allele frequencies in U.S and Indian
subjects. B) Global genotype frequency distribution of rs66698963. Data was retrieved from the
1000 Genome Project (Materials and Methods).
Figure 2. Patterns of genetic diversity ( ), Tajima’s D, and Fay and Wu’s H across a 300 Kb
genomic region around FADS genes in A) four continental regions, each combining multiple
populations from the same regions; and B) five populations of South Asian origin. The three
statistics were calculated using a sliding window method with window size of 5 Kb and moving
step of 1 Kb. The left shaded box indicates the region that have been found (and confirmed in
this study) to be under positive selection in African populations. The right shaded box indicates
the genomic region that has significant SFS-based test results in South Asians, but not in others.
The pink dashed lines in A) represent an empirical p value of 0.05 based on statistics from all
genome-wide windows in the South Asian (SAS) continental region. Note that the statistical
cutoffs vary slightly in different continental regions. The pink dashed lines in B) represent the
lowest 5% cutoff among the five populations, that is, all genomic regions below the pink dashed
line reach statistical significance regardless of the population. Note that some genomic regions
above the pink dashed line could still be significant in some populations because the 5% cutoffs
in these populations are higher (less extreme).
Figure 3. Patterns of normalized iHS and nSL (y-axes) across a 300 Kb genomic region (x-axis)
around the FADS gene cluster in four continental regions, each combining multiple populations
in the same region. The two statistics were calculated for each of the common SNPs (minor
allele frequency > 5%) in the genomic region, as well as for the rs66698963 indel. The position
of rs66698963 is indicated as a vertical black dashed line. The values for rs66698963 in each
continental region are highlighted as diamonds filled with region-specific colors. The red dashed
lines represent empirical p values of 0.05, while the blue dashed lines represent empirical p
values of 0.01 based on estimates in the South Asian (SAS) continental region. Note that the
statistical cutoffs vary slightly in different continental regions. Detailed representations for each
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
continental region with their specific significant cutoffs are presented in supplementary figs.
S13-S16.
Figure 4. The insertion allele of rs66698963 is associated with signals of positive selection in
the South Asian continental region. A) Haplotype bifurcation diagrams for the insertion allele at
rs66698963; B) Haplotype bifurcation diagrams for the deletion allele at rs66698963; C)
expanded haplotype homozygosity (EHH; y-axis) for rs66698963 (denoted by vertical dashed
line). The EHH values are plotted against the physical distance extending both upstream and
downstream of the target indel. The ancestral allele, also the insertion allele, shows much
extended haplotype homozygosity than the derived allele, which is the deletion allele. Similar
figures for AFR and EAS are presented in supplementary figs. S18 and S19.
Figure 5. Patterns of normalized XPEHH (y-axes) across a 300 Kb genomic region around
FADS genes A) between SAS and EUR, and B) between AFR and EUR. The normalized
XPEHH statistic was calculated for each common SNP in the region, as well as for the
rs66698963 indel. The value for rs66698963 is highlighted as a red diamond. The red dashed
line and the blue dashed line represent empirical p values of 0.05 and 0.01, respectively.
Figure 6. RBC n-6 PUFA as a function of genotype. PUFA in the biochemical pathway 18:2
(FADS2+Elongation) 20:3 (FADS1) 20:4 22:4 (FADS2) 22:5 where FADS2 and
FADS1 proteins mediate the indicated transformations. Percent changes relative to the D/D
genotype are calculated as Ax/x/AD/D, where A is a 18:2, 20:3, 20:4, 22:4, and the units
are %,w/w. A) 18:2 (linoleic acid) consumed exclusively by diet is not related to genotype.
20:3n-6 is lower but 20:4n-6 higher, consistent with a direct influence on 20:320:4 by FADS1.
All comparisons are significant, except 18:2 (NA). B) Differences in concentration between
upstream-downstream PUFA normalized to the D/D values. All genotype-dependent
differences involving FADS1 or FADS2 mediated step(s). Percent differences calculated as [(B-
A)x/x)]/[(B-A)D/D], where B is a downstream product and A is the precursor, and the units
are %,w/w. By t-test, *I/I vs D/D p<0.05; ** I/I or I/D vs D/D p<0.05. By the non-parametric
Wilcoxon method, all comparisons correspond to t-test results except: (A) 22:4 I/I vs D/D,
p=0.09; (B) 20:3-18:2, p=0.07; 22:5-22:4, p=0.11; 20:3-20:2, p<0.05 for all pairwise
comparisons.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
References
Alvheim AR, Malde MK, Osei-Hyiaman D, Lin YH, Pawlosky RJ, Madsen L, Kristiansen K,
Froyland L, Hibbeln JR. 2012. Dietary linoleic acid elevates endogenous 2-AG and anandamide
and induces obesity. Obesity (Silver Spring) 20:1984-1994.
Ameur A, Enroth S, Johansson A, Zaboli G, Igl W, Johansson AC, Rivas MA, Daly MJ, Schmitz
G, Hicks AA, et al. 2012. Genetic adaptation of fatty-acid metabolism: a human-specific
haplotype increasing the biosynthesis of long-chain omega-3 and omega-6 fatty acids. Am J
Hum Genet 90:809-820.
Aulchenko YS, Ripatti S, Lindqvist I, Boomsma D, Heid IM, Pramstaller PP, Penninx BW,
Janssens AC, Wilson JF, Spector T, et al. 2009. Loci influencing lipid levels and coronary heart
disease risk in 16 European population cohorts. Nat Genet 41:47-55.
Auton A, Brooks LD, Durbin RM, Garrison EP, Kang HM, Korbel JO, Marchini JL, McCarthy S,
McVean GA, Abecasis GR. 2015. A global reference for human genetic variation. Nature
526:68-74.
Blasbalg TL, Hibbeln JR, Ramsden CE, Majchrzak SF, Rawlings RR. 2011. Changes in
consumption of omega-3 and omega-6 fatty acids in the United States during the 20th century.
Am J Clin Nutr 93:950-962.
Bokor S, Dumont J, Spinneker A, Gonzalez-Gross M, Nova E, Widhalm K, Moschonis G, Stehle
P, Amouyel P, De Henauw S, et al. 2010. Single nucleotide polymorphisms in the FADS gene
cluster are associated with delta-5 and delta-6 desaturase activities estimated by serum fatty
acid ratios. J Lipid Res 51:2325-2333.
Brenna JT, Lapillonne A. 2009. Background paper on fat and fatty acid requirements during
pregnancy and lactation. Ann Nutr Metab 55:97-122.
Cao C, Pressman EK, Cooper EM, Guillet R, Westerman M, O'Brien KO. 2014. Placental heme
receptor LRP1 correlates with the heme exporter FLVCR1 and neonatal iron status.
Reproduction 148:295-302.
Carlson SE, Colombo J, Gajewski BJ, Gustafson KM, Mundy D, Yeast J, Georgieff MK, Markley
LA, Kerling EH, Shaddy DJ. 2013. DHA supplementation and pregnancy outcomes. Am J Clin
Nutr 97:808-815.
Caspi A, Williams B, Kim-Cohen J, Craig IW, Milne BJ, Poulton R, Schalkwyk LC, Taylor A,
Werts H, Moffitt TE. 2007. Moderation of breastfeeding effects on the IQ by genetic variation in
fatty acid metabolism. Proc Natl Acad Sci U S A 104:18860-18865.
Diau GY, Hsieh AT, Sarkadi-Nagy EA, Wijendran V, Nathanielsz PW, Brenna JT. 2005. The
influence of long chain polyunsaturate supplementation on docosahexaenoic acid and
arachidonic acid in baboon neonate central nervous system. BMC Med 3:11.
Eaton SB, Eaton SB, 3rd, Sinclair AJ, Cordain L, Mann NJ. 1998. Dietary intake of long-chain
polyunsaturated fatty acids during the paleolithic. World Rev Nutr Diet 83:12-23.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Emken EA, Adlof RO, Gulley RM. 1994. Dietary linoleic acid influences desaturation and
acylation of deuterium-labeled linoleic and linolenic acids in young adult males. Biochim Biophys
Acta 1213:277-288.
Fay JC, Wu CI. 2000. Hitchhiking under positive Darwinian selection. Genetics 155:1405-1413.
Ferrer-Admetlla A, Liang M, Korneliussen T, Nielsen R. 2014. On detecting incomplete soft or
hard selective sweeps using haplotype structure. Mol Biol Evol 31:1275-1291.
Ferretti A, Nelson GJ, Schmidt PC, Kelley DS, Bartolini G, Flanagan VP. 1997. Increased
dietary arachidonic acid enhances the synthesis of vasoactive eicosanoids in humans. Lipids
32:435-439.
Folch J, Lees M, Sloane Stanley GH. 1957. A simple method for the isolation and purification of
total lipides from animal tissues. J Biol Chem 226:497-509.
Fumagalli M, Moltke I, Grarup N, Racimo F, Bjerregaard P, Jorgensen ME, Korneliussen TS,
Gerbault P, Skotte L, Linneberg A, et al. 2015. Greenlandic Inuit show genetic signatures of diet
and climate adaptation. Science 349:1343-1347.
Gadgil M, Joshi K, Pandit A, Otiv S, Joshi R, Brenna JT, Patwardhan B. 2014. Imbalance of folic
acid and vitamin B12 is associated with birth outcome: an Indian pregnant women study. Eur J
Clin Nutr 68:726-729.
Gautier M, Vitalis R. 2012. rehh: an R package to detect footprints of selection in genome-wide
SNP data from haplotype structure. Bioinformatics 28:1176-1177.
Gibson RA, Neumann MA, Lien EL, Boyd KA, Tu WC. 2013. Docosahexaenoic acid synthesis
from alpha-linolenic acid is inhibited by diets high in polyunsaturated fatty acids. Prostaglandins
Leukot Essent Fatty Acids 88:139-146.
Gibson RA, Sinclair AJ. 1981. Are Eskimos obligate carnivores? Lancet 1:1100.
Groen-Blokhuis MM, Franic S, van Beijsterveldt CE, de Geus E, Bartels M, Davies GE, Ehli EA,
Xiao X, Scheet PA, Althoff R, et al. 2013. A prospective study of the effects of breastfeeding and
FADS2 polymorphisms on cognition and hyperactivity/attention problems. Am J Med Genet B
Neuropsychiatr Genet 162B:457-465.
Hester AG, Murphy RC, Uhlson CJ, Ivester P, Lee TC, Sergeant S, Miller LR, Howard TD,
Mathias RA, Chilton FH. 2014. Relationship between a common variant in the fatty acid
desaturase (FADS) cluster and eicosanoid generation in humans. J Biol Chem 289:22482-
22489.
Illig T, Gieger C, Zhai G, Romisch-Margl W, Wang-Sattler R, Prehn C, Altmaier E, Kastenmuller
G, Kato BS, Mewes HW, et al. 2010. A genome-wide perspective of genetic variation in human
metabolism. Nat Genet 42:137-141.
Key TJ, Appleby PN, Rosell MS. 2006. Health effects of vegetarian and vegan diets. Proc Nutr
Soc 65:35-41.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Lattka E, Rzehak P, Szabo E, Jakobik V, Weck M, Weyermann M, Grallert H, Rothenbacher D,
Heinrich J, Brenner H, et al. 2011. Genetic variants in the FADS gene cluster are associated
with arachidonic acid concentrations of human breast milk at 1.5 and 6 mo postpartum and
influence the course of milk dodecanoic, tetracosenoic, and trans-9-octadecenoic acid
concentrations over the duration of lactation. Am J Clin Nutr 93:382-391.
Li H, Handsaker B, Wysoker A, Fennell T, Ruan J, Homer N, Marth G, Abecasis G, Durbin R.
2009. The Sequence Alignment/Map format and SAMtools. Bioinformatics 25:2078-2079.
Li Z, Wu X, He B, Zhang L. 2014. Vindel: a simple pipeline for checking indel redundancy. BMC
Bioinformatics 15:359.
Liu B, Chen J, Shen B. 2011. Genome-wide analysis of the transcription factor binding
preference of human bi-directional promoters and functional annotation of related gene pairs.
BMC Syst Biol 5 Suppl 1:S2.
Lu JT, Wang Y, Gibbs RA, Yu F. 2012. Characterizing linkage disequilibrium and evaluating
imputation power of human genomic insertion-deletion polymorphisms. Genome Biol 13:R15.
Malerba G, Schaeffer L, Xumerle L, Klopp N, Trabetti E, Biscuola M, Cavallari U, Galavotti R,
Martinelli N, Guarini P, et al. 2008. SNPs of the FADS gene cluster are associated with
polyunsaturated fatty acids in a cohort of patients with cardiovascular disease. Lipids 43:289-
299.
Marquardt A, Stohr H, White K, Weber BH. 2000. cDNA cloning, genomic structure, and
chromosomal localization of three members of the human fatty acid desaturase family.
Genomics 66:175-183.
Martinelli N, Girelli D, Malerba G, Guarini P, Illig T, Trabetti E, Sandri M, Friso S, Pizzolo F,
Schaeffer L, et al. 2008. FADS genotypes and desaturase activity estimated by the ratio of
arachidonic acid to linoleic acid are associated with inflammation and coronary artery disease.
Am J Clin Nutr 88:941-949.
Mathias RA, Fu W, Akey JM, Ainsworth HC, Torgerson DG, Ruczinski I, Sergeant S, Barnes KC,
Chilton FH. 2012. Adaptive evolution of the FADS gene cluster within Africa. PLoS One
7:e44926.
Meyer M, Kircher M, Gansauge MT, Li H, Racimo F, Mallick S, Schraiber JG, Jay F, Prufer K,
de Filippo C, et al. 2012. A high-coverage genome sequence from an archaic Denisovan
individual. Science 338:222-226.
Morrison WR, Smith LM. 1964. Preparation of Fatty Acid Methyl Esters and Dimethylacetals
from Lipids with Boron Fluoride--Methanol. J Lipid Res 5:600-608.
Naqvi AZ, Davis RB, Mukamal KJ. 2012. Dietary fatty acids and peripheral artery disease in
adults. Atherosclerosis 222:545-550.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Nelson GJ, Kelley DS, Emken EA, Phinney SD, Kyle D, Ferretti A. 1997. A human dietary
arachidonic acid supplementation study conducted in a metabolic research unit: rationale and
design. Lipids 32:415-420.
Nussbaum RL, McInnes RR, Willard HF, Hamosh A, Thompson MW. 2007. Thompson &
Thompson genetics in medicine. Philadelphia: Saunders/Elsevier.
O'Dea K, Sinclair AJ. 1985. The effects of low-fat diets rich in arachidonic acid on the
composition of plasma fatty acids and bleeding time in Australian aborigines. J Nutr Sci
Vitaminol (Tokyo) 31:441-453.
Park HG, Kothapalli KS, Park WJ, DeAllie C, Liu L, Liang A, Lawrence P, Brenna JT. 2016.
Palmitic acid (16:0) competes with omega-6 linoleic and omega-3 a-linolenic acids for FADS2
mediated Delta6-desaturation. Biochim Biophys Acta 1861:91-97.
Park HG, Park WJ, Kothapalli KS, Brenna JT. 2015. The fatty acid desaturase 2 (FADS2) gene
product catalyzes Delta4 desaturation to yield n-3 docosahexaenoic acid and n-6
docosapentaenoic acid in human cells. FASEB J 29:3911-3919.
Park WJ, Kothapalli KS, Lawrence P, Brenna JT. 2011. FADS2 function loss at the cancer
hotspot 11q13 locus diverts lipid signaling precursor synthesis to unusual eicosanoid fatty acids.
PLoS One 6:e28186.
Park WJ, Kothapalli KS, Lawrence P, Tyburczy C, Brenna JT. 2009. An alternate pathway to
long-chain polyunsaturates: the FADS2 gene product Delta8-desaturates 20:2n-6 and 20:3n-3.
J Lipid Res 50:1195-1202.
Park WJ, Kothapalli KS, Reardon HT, Kim LY, Brenna JT. 2009. Novel fatty acid desaturase 3
(FADS3) transcripts generated by alternative splicing. Gene 446:28-34.
Park WJ, Kothapalli KS, Reardon HT, Lawrence P, Qian SB, Brenna JT. 2012. A novel FADS1
isoform potentiates FADS2-mediated production of eicosanoid precursor fatty acids. J Lipid Res
53:1502-1512.
Park WJ, Reardon HT, Tyburczy C, Kothapalli KS, Brenna JT. 2010. Alternative splicing
generates a novel FADS2 alternative transcript in baboons. Mol Biol Rep 37:2403-2406.
Pollner R, Schmidt C, Fischer G, Kuhn K, Poschl E. 1997. Cooperative and competitive
interactions of regulatory elements are involved in the control of divergent transcription of
human Col4A1 and Col4A2 genes. FEBS Lett 405:31-36.
Prufer K, Racimo F, Patterson N, Jay F, Sankararaman S, Sawyer S, Heinze A, Renaud G,
Sudmant PH, de Filippo C, et al. 2014. The complete genome sequence of a Neanderthal from
the Altai Mountains. Nature 505:43-49.
Raheja BS, Sadikot SM, Phatak RB, Rao MB. 1993. Significance of the N-6/N-3 ratio for insulin
action in diabetes. Ann N Y Acad Sci 683:258-271.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Reardon HT, Zhang J, Kothapalli KS, Kim AJ, Park WJ, Brenna JT. 2012. Insertion-deletions in
a FADS2 intron 1 conserved regulatory locus control expression of fatty acid desaturases 1 and
2 and modulate response to simvastatin. Prostaglandins Leukot Essent Fatty Acids 87:25-33.
Remaley AT, Bark S, Walts AD, Freeman L, Shulenin S, Annilo T, Elgin E, Rhodes HE, Joyce C,
Dean M, et al. 2002. Comparative genome analysis of potential regulatory elements in the
ABCG5-ABCG8 gene cluster. Biochem Biophys Res Commun 295:276-282.
Rzehak P, Thijs C, Standl M, Mommers M, Glaser C, Jansen E, Klopp N, Koppelman GH,
Singmann P, Postma DS, et al. 2010. Variants of the FADS1 FADS2 gene cluster, blood levels
of polyunsaturated fatty acids and eczema in children within the first 2 years of life. PLoS One
5:e13261.
Sabeti PC, Varilly P, Fry B, Lohmueller J, Hostetter E, Cotsapas C, Xie X, Byrne EH, McCarroll
SA, Gaudet R, et al. 2007. Genome-wide detection and characterization of positive selection in
human populations. Nature 449:913-918.
Schaeffer L, Gohlke H, Muller M, Heid IM, Palmer LJ, Kompauer I, Demmelmair H, Illig T,
Koletzko B, Heinrich J. 2006. Common genetic variants of the FADS1 FADS2 gene cluster and
their reconstructed haplotypes are associated with the fatty acid composition in phospholipids.
Hum Mol Genet 15:1745-1756.
Sergeant S, Hugenschmidt CE, Rudock ME, Ziegler JT, Ivester P, Ainsworth HC, Vaidya D,
Case LD, Langefeld CD, Freedman BI, et al. 2012. Differences in arachidonic acid levels and
fatty acid desaturase (FADS) gene variants in African Americans and European Americans with
diabetes or the metabolic syndrome. Br J Nutr 107:547-555.
Sharma S, Zhou X, Thibault DM, Himes BE, Liu A, Szefler SJ, Strunk R, Castro M, Hansel NN,
Diette GB, et al. 2014. A genome-wide survey of CD4(+) lymphocyte regulatory genetic variants
identifies novel asthma genes. J Allergy Clin Immunol 134:1153-1162.
Simopoulos AP. 2002. The importance of the ratio of omega-6/omega-3 essential fatty acids.
Biomed Pharmacother 56:365-379.
Smuts CM, Huang M, Mundy D, Plasse T, Major S, Carlson SE. 2003. A randomized trial of
docosahexaenoic acid supplementation during the third trimester of pregnancy. Obstet Gynecol
101:469-479.
Standl M, Sausenthaler S, Lattka E, Koletzko S, Bauer CP, Wichmann HE, von Berg A, Berdel
D, Kramer U, Schaaf B, et al. 2011. FADS gene variants modulate the effect of dietary fatty acid
intake on allergic diseases in children. Clin Exp Allergy 41:1757-1766.
Steer CD, Hibbeln JR, Golding J, Davey Smith G. 2012. Polyunsaturated fatty acid levels in
blood during pregnancy, at birth and at 7 years: their associations with two common FADS2
polymorphisms. Hum Mol Genet 21:1504-1512.
Szpiech ZA, Hernandez RD. 2014. selscan: an efficient multithreaded program to perform EHH-
based scans for positive selection. Mol Biol Evol 31:2824-2827.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
Tajima F. 1989. Statistical method for testing the neutral mutation hypothesis by DNA
polymorphism. Genetics 123:585-595.
Tanaka T, Shen J, Abecasis GR, Kisialiou A, Ordovas JM, Guralnik JM, Singleton A, Bandinelli
S, Cherubini A, Arnett D, et al. 2009. Genome-wide association study of plasma
polyunsaturated fatty acids in the InCHIANTI Study. PLoS Genet 5:e1000338.
Voight BF, Kudaravalli S, Wen X, Pritchard JK. 2006. A map of recent positive selection in the
human genome. PLoS Biol 4:e72.
Weir BS, Cockerham CC. 1984. Estimating F-Statistics for the Analysis of Population Structure.
Evolution 38:1358-1370.
Wood KE, Lau A, Mantzioris E, Gibson RA, Ramsden CE, Muhlhausler BS. 2014. A low omega-
6 polyunsaturated fatty acid (n-6 PUFA) diet increases omega-3 (n-3) long chain PUFA status in
plasma phospholipids in humans. Prostaglandins Leukot Essent Fatty Acids 90:133-138.
Xie L, Innis SM. 2008. Genetic variants of the FADS1 FADS2 gene cluster are associated with
altered (n-6) and (n-3) essential fatty acids in plasma and erythrocyte phospholipids in women
during pregnancy and in breast milk during lactation. J Nutr 138:2222-2228.
Yi X, Liang Y, Huerta-Sanchez E, Jin X, Cuo ZX, Pool JE, Xu X, Jiang H, Vinckenbosch N,
Korneliussen TS, et al. 2010. Sequencing of 50 human exomes reveals adaptation to high
altitude. Science 329:75-78.
Zail SS, Pickering A. 1979. Fatty acid composition of erythrocytes in hereditary spherocytosis.
Br J Haematol 42:399-402.
Zhang B, Jia WH, Matsuda K, Kweon SS, Matsuo K, Xiang YB, Shin A, Jee SH, Kim DH, Cai Q,
et al. 2014. Large-scale genetic study in East Asians identifies six new loci associated with
colorectal cancer risk. Nat Genet 46:533-542.
Zhang X, Johnson AD, Hendricks AE, Hwang SJ, Tanriverdi K, Ganesh SK, Smith NL, Peyser
PA, Freedman JE, O'Donnell CJ. 2014. Genetic associations with expression for genes
implicated in GWAS studies for atherosclerotic cardiovascular disease and blood phenotypes.
Hum Mol Genet 23:782-795.
by Kaixiong Ye on March 29, 2016http://mbe.oxfordjournals.org/Downloaded from
