ArticlePDF Available

Therapeutic evaluation of homoeopathic drug Crotalus horridus 200C against Ehrlichiosis-infected dogs in Mizoram

Abstract

Objective: To study, the effect of a homoeopathic medicine Crotalus horridus 200C on ehrlichiosis in dogs in an endemic area of Aizawl district of Mizoram state of India. Materials and Methods: To evaluate the efficacy of Crotalus horridus 200C against ehrlichiosis dogs. 12 positive cases confirmed by polymerase chain reaction (PCR) were divided into two groups comprising six dogs in each group. One group was treated with standard therapy (doxycycline) and other group was treated with Crotalus horridus 200C at 4 pills orally for 20 days. Clinical improvement of affected dogs was recorded after therapy. Important haemato-biochemical parameters before and after therapy such as haemoglobin (Hb), packed cell volume (PCV), total erythrocyte count (TEC), total leukocyte count (TLC), differential leukocyte count (DLC), platelet count, total protein, albumin, globulin, A:G ratio, total bilirubin, serum creatinine, blood urea nitrogen (BUN), and liver-specific enzymes namely alanine aminotransferase (ALT) and alkaline phosphatase (ALP) were assessed following standard protocol. All the parameters were compared with a control healthy group (T3). All experiment dogs were from different age with different breeds and bloods were collected at forenoon only. Results: PCR test yielded 13 dogs positive out of 67 suspected samples screened (19.40%) with an amplification of 387 bp fragment from 16S rRNA gene of E. Canis. Off total positive, only 8 (61.53%) could be detected in peripheral blood smear. Crotalus horridus-treated group of dogs showed clinical recovery from fever and temperature to normalcy by the 14th day posttreatment. Haemato-biochemical profiles of affected dogs such as Hb, PCV, TEC, TLC, DLC, platelet count, total protein, albumin, globulin, A:G ratio, total bilirubin, serum creatinine, BUN, and liver-specific enzymes namely ALT and ALP were turned to normalcy within 21 days of post-treatment. Conclusion: Nested PCR assay had been shown to be sensitive and specific for detection of Ehrlichia canis. Crotalus horridus 200C may be an effective and choice of drug for control of canine ehrlichiosis.
© 2016 Indian Journal of Research in Homoeopathy | Published by Wolters Kluwer ‑ Medknow42
ORIGINAL ARTICLE
Therapeutic evaluation of homoeopathic
drug Crotalus horridus 200C against
Ehrlichiosis‑infected dogs in Mizoram
Isaac B. Tungnunga1, Kalyan Sarma1*, Parimal Roychoudhury2,
Sonjoy Kumar Borthakur3, Gunjan Das1, H. Prasad1, Subendu Kumar Behera1
ABSTRACT
Objective: To study, the effect of a homoeopathic medicine Crotalus horridus 200C
on ehrlichiosis in dogs in an endemic area of Aizawl district of Mizoram state of
India.
Materials and Methods: To evaluate the efficacy of Crotalus horridus 200C
against ehrlichiosis dogs. 12 positive cases confirmed by polymerase chain
reaction (PCR) were divided into two groups comprising six dogs in each
group. One group was treated with standard therapy (doxycycline) and other
group was treated with Crotalus horridus 200C at 4 pills orally for 20 days.
Clinical improvement of affected dogs was recorded after therapy. Important
haemato‑biochemical parameters before and after therapy such as haemoglobin
(Hb), packed cell volume (PCV), total erythrocyte count (TEC), total leukocyte
count (TLC), differential leukocyte count (DLC), platelet count, total protein,
albumin, globulin, A:G ratio, total bilirubin, serum creatinine, blood urea nitrogen
(BUN), and liver‑specific enzymes namely alanine aminotransferase (ALT) and
alkaline phosphatase (ALP) were assessed following standard protocol. All the
parameters were compared with a control healthy group (T3). All experiment
dogs were from different age with different breeds and bloods were collected at
forenoon only.
Results: PCR test yielded 13 dogs positive out of 67 suspected samples screened
(19.40%) with an amplication of 387 bp fragment from 16S rRNA gene of E. Canis.
Off total positive, only 8 (61.53%) could be detected in peripheral blood smear.
Crotalus horridus‑treated group of dogs showed clinical
recovery from fever and temperature to normalcy by the
14th day posttreatment. Haemato‑biochemical proles
of affected dogs such as Hb, PCV, TEC, TLC, DLC,
platelet count, total protein, albumin, globulin, A:G ratio,
total bilirubin, serum creatinine, BUN, and liver‑specic
enzymes namely ALT and ALP were turned to normalcy
within 21 days of post‑treatment.
Conclusion: Nested PCR assay had been shown to be
IHJ R
Departments of 1Veterinary
Medicine, 2Microbiology and
3Veterinary Parasitology, College
of Veterinary Sciences and Animal
Husbandry, Central Agricultural
University, Selesih, Aizawl,
Mizoram, India
*Address for correspondence:
Dr. Kalyan Sarma,
Department of Veterinary Medicine,
College of Veterinary Sciences
and Animal Husbandry, Central
Agricultural University, Selesih,
Aizawl - 796 014, Mizoram, India.
E-mail: kalyan_srm@rediffmail.com
Received: 27-10-2015
Accepted: 29-02-2016
Access this article online
Website:
www.ijrh.org
DOI:
10.4103/0974-7168.179150
Quick Response Code:
How to cite this article: Tungnunga IB, Sarma K, Roychoudhury P,
Borthakur SK, Das G, Prasad H, et al. Therapeutic evaluation of
homoeopathic drug Crotalus horridus 200C against Ehrlichiosis‑
infected dogs in Mizoram. Indian J Res Homoeopathy 2016;10:42‑51.
This is an open access article distributed under the terms of the Creative
Commons Attribution‑NonCommercial‑ShareAlike 3.0 License, which allows
others to remix, tweak, and build upon the work non‑commercially, as long as the
author is credited and the new creations are licensed under the identical terms.
For reprints contact: reprints@medknow.com
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 43
INTRODUCTION
Canine ehrlichiosis is a tick-borne disease caused
by Ehrlichia canis, also known as canine monocytic
ehrlichiosis (CME), canine haemorrhagic fever, tracker
dog disease, canine tick typhus, Nairobi bleeding
disorder, and tropical canine pancytopenia.[1,2] CME
is currently reported throughout the world[3] but
at higher frequencies in tropical and subtropical
regions including Asia, Africa, Europe, America,[4-6]
and India.[7,8] The infection is manifested by fever,
depression, dyspnea, anorexia, weight loss, limping as
well as unwillingness to move due to arthritis, together
with pains in musculoskeletal system.[8] Laboratory
findings include thrombocytopenia, leukopenia,
mild anaemia (normocytic and nonregenerative),
and hypergammaglobulinemia. Serum biochemistry
of the affected dogs reveals hypoproteinemia,
hypoalbuminemia, hyperglobulinemia, increased
activities of the alkaline phosphatase (ALP) and
alanine aminotransferase (ALT) and the rise of the
concentration of creatinine and urea.[9,10]
Diagnosis of ehrlichiosis in dogs is based on the
symptoms along with microscopic, haematological,
biochemical, serological, and molecular
examinations. In infected host, Ehrlichias are
found in three forms in peripheral smears creating
cytoplasmatic inclusion bodies – initial corpuscles,
morulas; formed by aggregation of inclusion
bodies and elementary corpuscles; created after
the morula’s disintegration.[11,12] The most sensitive
diagnostic method of ehrlichiosis is the polymerase
chain reaction (PCR) technique.[13,14]
Regardless of the species of Ehrlichia or the form of
the disease, the choice of drugs to treat ehrlichiosis is
tetracycline group of drugs.[15] High use of antibiotics
can have negative aspects for animal health, human
health, and the environment.[16] This rapid rise in usage
of veterinary antibiotics necessitates the development
of sustainable alternative; antibiotics are partly
replaced by complementary or alternative medicine of
which Homoeopathy is the most frequently applied.[17]
Limited reports have been published in homoeopathic
and alternative medicine journals on veterinary clinical
trials with homoeopathic medicine/drugs where
methodological weakness is noticed. Homoeopathic
remedies have significant benefits since there are no
residues in animal products nor does Homoeopathy
generate resistant microorganisms. Homoeopathy
aims to activate self-healing mechanisms of the body.
In view of the above, the present study was carried
out to detect E. canis by molecular technique and
find out the therapeutic efficacy of a homoeopathic
medicine Crotatus horridus against ehrlichiosis which
was used against other tick-borne diseases such as
babesiosis but not in ehrlichiosis.
MATERIALS AND METHODS
The study was conducted in the Department of
Veterinary Medicine, College of Veterinary Sciences and
Animal Husbandry, Selesih, Aizawl, in between August
2012and July2014.Thestudyarealaybetween25°6’N
and27°4’Nlatitudeand93°20’E to95°15’Elongitude.
Sample Size
Clinical cases of ehrlichiosis in dogs showing
symptoms such as fever, diarrhoea, staggering gait,
anaemia, debilitated condition, and presence of ticks
were recorded during the study period. All-together,
67 dogs were initially suspected for ehrlichiosis.
Confirmation of ehrlichiosis was based on the
presence of E. canis in peripheral blood smear
examination and PCR. 13 cases were confirmed by
Polymerase chain reaction and out of these 8 also
tested positive for E. canis in peripheral blood
smear. For randomisation 12 cases were considered.
One case with positive PCR and blood smear
was excluded from the study for convenience of
randomisation and treated in general OPD [Chart 1].
Collection of Blood
About 5 ml blood samples were collected each
ailing dog with or without anticoagulant for
haemato-biochemical analysis. The blood collected
with anticoagulant ethylene diamine tetra acetic
sensitive and specic for detection of Ehrlichia canis. Crotalus horridus 200C may be an effective and choice of drug
for control of canine ehrlichiosis.
Keywords: Crotalus horridus 200C, Ehrlichiosis, Haemato‑biochemical changes, Homoeopathy, Veterinary medicine
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 44
acid was used for PCR and haematology, and
blood without anticoagulant was used for serum
separation. Collected serum samples were stored
in deep freeze at −20°C until used for biochemical
and enzymatic estimations. Similarly, a few samples
were collected from healthy dogs for comparison.
Giemsa-stained smears prepared from the blood
were examined microscopically for the presence of
E. canis morulae.
Molecular Detection of Ehrlichia canis
Fresh blood samples obtained from dogs were
screened for the detection of E. canis DNA using
PCR as per standard method.[18]
Extraction of genomic DNA from blood
DNA extraction was carried out using the DNA
assay blood and tissue kit (Quiagen® Kit, Catalog
No 69504) as per manufacturer’s protocol. In brief,
about 100 µl anticoagulated blood taken individually
from each of the samples in a 2 ml microcentrifuge
tube was lysed in 20 µl proteinase K and the final
volume adjusted to 220 µl by adding phosphate
buffered saline before adding lysis buffer. The
tubes were then incubated at 56°C in water bath
for 10 min. Samples were then passed through
silica gel based spin column and washed 2 times
and then finally eluted with 100 µl elution buffer
after following all the mid-step protocols, and the
templateswerekeptat−20°C.
Polymerase chain reaction assay for detection of
Ehrlichia canis
Target gene (16S rRNA) amplification was done
using the nested PCR technique following the
method of Murphy et al.[18] with modifications.
The first PCR amplification aimed at amplifying
a 477-bp region of the 16S rRNA gene of
Ehrlichia species. Oligonucleotides ECC
(5AGAACGAACGCTGGCGGCAAGC3) and ECB
(5CGTATTACCGCGGCTGCTGGCA3) were used
as sense and antisense primers, respectively
for outer region. The nested PCR amplification
aimed at amplifying 387-bp internal fragment
specific to E. canis. Oligonucleotides ECA
(5CAATTATTTATAGC CTCTGGCTATAGGA 3) and
HE3 (5 TATAGGTACCGTCATTATCTTCCCTAT 3) were
used as sense and antisense primers, respectively.
Reaction mixture of 25 µl volume contains 2.5 µl
of 10X PCR buffer, 0.5 µl of dNTP (10 mM each),
forward and reverse primer 1 µl (10 pmol) each,
Taq polymerase 0.2 µl (5 U/µl), template DNA 5
µl, and nuclease free water adjusted to 25 µl.
A hot start PCR was used with initial denaturation
of 94°C for 5 min and then 30 cycles of 94°C for
1 min, annealing at 65°C for 2 min, and extension
at 72°C for 2 min. A final extension was kept at
72°C for 7 min for primary amplification. Nested
PCR was performed where 2 µl of primary product
Enrollment Assessed for eligibility (n = 67)
Excluded (n = 55)
Did not test positive for PCR
assay for Ehrlichia canis
1 case treated in general OPD
Randomized (n = 12)
Allocation
Analysis
Allocated to intervention Standard
therapy with doxycycline at 20mg/Kg
body wt. (n = 6)
Allocated to intervention
Crotalus horridus 200C (n = 6)
Analysed (n = 6)
Allocated to intervention Standard
therapy with doxycycline at
20mg/Kg body wt. (T1)
Control group (n = 6)
Apparently healthy dogs
brought for regular check-
ups or vaccination were
taken as control (T3)
Analysed (n = 6)
Allcoated to intervention
Crotalus Horridus 200C (T2)
Chart 1: Participant ow diagram
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 45
was taken as template and annealing temperature
was set at 55°C keeping other conditions as such.
The PCR product was subjected to electrophoresis
in an agarose gel (1.5%) prestained with ethidium
bromide (0.5 µg/ml), and subsequent visualization
was done in gel documentation system (alpha
image system).
Evaluation of Therapeutic Potential of
Homoeopathic Medicine Against Ehrlichiosis
in Dogs
Twelve dogs positive for ehrlichiosis were divided
randomly into two groups (n = 6) namely T1 and
T2. Six apparently healthy dogs brought for regular
check-up or vaccination were taken as control
group (T3).
Dogs of T1 were treated with standard therapy
with doxycycline at 20 mg/kg body weight orally for
20 days along with supportive therapy and T2 was
treated with a Homoeopathy drug Crotalus horridus
200C (Hylands, USA) at 4 pills orally for 20 days.
Therapeutic potency was evaluated by improvement
of clinical signs, haemato-biochemical parameters,
blood smear, and PCR assay for E. canis infection on
days 0, 7, 14, and 21 posttreatment.
Clinical examination of dogs infected with ehrlichiosis
before and after therapy
Each dog was subjected to detailed clinical examination
as per standard procedure.[19] The presence of
symptoms/signs/manifestations and involvement
of different body system and systemic states were
recorded on days 0, 7, 14, and 21 posttreatment.
Blood sample collection
To access the therapeutic efficacy, blood samples
were collected on days 0, 7, 14, and 21 posttreatment
by the same procedure as described elsewhere.
PCR was carried out as described elsewhere on
days 0, 7, 14, and 21 blood samples to confirm
the duration of presence of E. canis in blood and
the efficacy of the drug in trial from the day of the
starting of the treatment in different group.
Haemato‑biochemical investigation
Haematological assays were performed within 2 h
of blood collection by using an automated cell
counter (Minos ST; Vet, Montpelier, France) calibrated
for canine blood. The parameters measured were
hematocrit, haemoglobin (Hb) concentration, total
erythrocyte count, total leukocyte count (TLC),
platelet count, and differential leukocytic count.
The total protein and albumin were estimated
by the Biuret method[20] whereas globulin was
estimated by calculation. The concentration of
ALT was determined spectrophotometrically using
the method of Reitman and Frankel.[21] The level
of ALP in the serum was determined as described
by Omotainse et al.,[22] using spectrophotometry
method. Creatinine (alkaline picrate method), blood
urea nitrogen (BUN) (Mod. Berthelot method), total
bilirubin, and direct bilirubin (modified Jendrasik
and Grof method) were also estimated by using
spectrophotometry method.
Haemato-biochemical analyses were carried out on
days 0, 7, 14, and 21 to know the efficacy of the
therapy.
Therapeutic Evaluation
Therapeutic evaluation was done on the basis of
improvement of clinical signs, blood haematology,
and biochemical changes and negative results of PCR.
Statistical Analysis
Data were analyzed by using two-way ANOVA by
Statistical Package SPSS 16 (SPSS, Science, Chicago,
USA). Differences were considered statistically
significant at P < 0.05 level.
RESULTS
During the study period, 67 dogs were suspected
for ehrlichiosis, of which 8 cases were confirmed
by blood smear (11.94%) whereas 13 cases were
confirmed by PCR (19.40%).
Molecular Detection of Ehrlichia canis by
Nested Polymerase Chain Reaction
Nested PCR was performed by using genus-specific
external primer (477 bp) and species-specific nested
internal primer (387 bp) to detect E. canis organism.
Nested PCR positive samples were demonstrated
which yielded an amplification of 387 bp fragment
from 16S rRNA gene of E. canis [Figure 1a and b].
Effect of Therapy on Clinical Signs and
Physical Parameters
Physical parameters improved after 14 days in
both the treatment groups [Table 1]. There was
significant reduction (P < 0.05) of temperature,
pulse, and respiration on day 7 posttherapy in both
the groups. The clinical signs [Table 1a] were also
improved after treatment in both the groups. All
the ailing animals showed alertness and improved
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 46
appetite. PCR assay showed negative result in T2
group on day 21 posttherapy whereas no samples
were detected positive by PCR assay in T1 group on
day 14 posttherapy [Table 1a]. The critical analysis
revealed that the Crotalus Horridus had almost equal
intensity with doxycycline to manage the ehrlichiosis
infection.
Effect of Therapy on Haematological Profile
The haematological profiles of dogs (before
and after therapy) are shown in Table 2. The
Hb, packed cell volume, total erythrocyte
count, TLC, and platelet count was significantly
improved (P < 0.01) on day 21 in both T1 and T2
groups after therapy. The results clearly indicated
that both doxycycline and Crotalus horridus 200C
therapy improved the hematological values in
ehrlichiosis-infected dogs.
Changes in monocyte count are significantly
(P < 0.01) reduced in T1 group of dogs receiving
doxycycline as a standard therapy. However, significant
changes were also found in T2 group of dogs receiving
Crotalus horridus 200C as experimental therapy in
a lesser intensity. Neutrophils, lymphocytes, and
eosinophil counts were also found improved after
21 days therapy in both the groups of dogs.
Effect of Therapy on Serum‑biochemical Profile
Mean ± standard error of serum biochemical
profiles of dogs (before and after therapy) has been
shown in Table 3. Total protein concentration of
T1 and T2 was significantly decreased (P < 0.05)
on day 0 as compared to healthy dogs (T3).
However, protein values were increased in both
the treated groups after therapy. Albumin level was
significantly (P < 0.05) increased in T1 and T2 from
day 0 (1.43 ± 0.35 g/dl and 1.17 ± 0.19 g/dl) to day
21 (3.78 ± 0.19 g/dl and 3.09 ± 0.28 g/dl) and there
was no significant difference in globulin level in both
the T1 and T2 before and after therapy. The levels of
creatinine and BUN did not differ significantly from
healthy group and nonsignificant decrease in both
the parameters by the end of therapy depicted the
therapeutic efficacy.
There was significant increase (P < 0.05) in the value
of ALT and ALP on day 0 of both the treated groups (T1
Table1:Efcacyofdoxycycline (T1) and Crotalus horridus (T2) on physical parameters of
Ehrlichia‑infecteddog
Parameters Group
(n=6)
Days
0 7 14 21
Temperature (°F) T1 103±0.16Aa** 101.3±0.16bA*101±0.21bcBC* 101±0.15bcd*
T2 104±0.20ABa** 102.5±0.23ab 101.5±0.16abc 101.5±0.12abcd
T3#101.28±0.12C101.28±0.12 101.28±0.12 101.28±0.12
Pulse (per/min) T1 88.5±0.82aA** 80.5±1.94ab 74.5±1.86bc* 72.5±0.30cd
T2 86.5±0.70aAB** 83.5±0.65ab 79±0.67bc* 74±0.40cd
T3#72.33±0.98C72.33±0.98 72.33±0.98 72.33±0.98
Respiration (per/min) T1 45.5±0.85 40.5±0.85 35.5±0.50 35.5±0.50
T2 39±0.38 37±0.80 36±0.79 34.5±0.62
T3#33.5±0.88 33.5±0.88 33.5±0.88 33.5±0.88
*Signicant difference (P<0.05); **Signicant difference (P<0.01). Values bearing different superscript small letter in column wise and capital letter in row wise
showed signicant difference. #T3 stands for healthy group
Table1a:Efcacyofdoxycycline (T1) and
Crotalus horridus (T2) on Ehrlichia‑infected
dogs on clinical improvement
Parameters Group
(n=6)
Days
0 7 14 21
Physical parameters T1 + − −
T2 + − −
Clinical signs T1 + + − −
T2 + + − −
Presence (+) or absence (−) of
Ehrlichia canis DNA in blood
T1 + + − −
T2 + + + Figure 1: (a) Gel photo showing amplication of target gene of Ehrlichia
canis. Lane 1–6: Positive for Ehrlichia canis; Lane M: 100bpDNA ladder; Lane
N: Negative sample. (b) Gel picture of Ehrlichia canis nPCR product. M: 100bp
DNA ladder; E: External product (477bp); I: Internal nested product (387bp)
b
a
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 47
and T2) as compared to healthy group (T3). There was
significant (P < 0.05) decrease in the values of ALT
and ALP on day 21 in both the treated groups. Dogs
of both groups are depicting steady improvement in
the ALT and ALP values as compared to healthy one.
Direct bilirubin and total bilirubin also reveal steady
nonsignificant improvement on both the groups of
dogs. Critical analysis of the result on liver enzyme
profile revealed steady improvement on the standard
and experimental therapy.
DISCUSSION
In the present investigation, of 67 suspected dogs
for canine ehrlichiosis, 13 (19.40%) were found
positive by PCR. In the past, various studies have
been carried out regarding the molecular prevalence
of E. canis worldwide and the prevalence rate has
been reported ranging from 3.1% to 88.0%.[23] As
regards to the Indian scenario, the prevalence of
E. canis varied from 19% to 59%.[24-27] The variation
in the prevalence reported by various workers may
be attributed to sample size, geographical area, and
climatic conditions which directly influence the tick
population and time of sample collection.
The 16S rRNA gene fragment that was amplified
in this study was also explored by Iqbal et al.,[28]
McBride et al.,[29] Inokuma et al.,[30] and Unver
et al. [6] with reasonably reliable results. To date,
the epidemiological studies of canine ehrlichiosis
in India have been based on blood smear results,
as well as on serological evidence of circulating
antibodies. The enhanced sensitivity of nested PCR
for the detection of canine ehrlichiosis was earlier
reported by Warner and Dawson[31] and Egenvall
Table 2: Evaluation of hematological values on clinical trial between doxycycline (T1) and Crotalus
horridus (T2) on Ehrlichia‑infecteddogs
Parameters Group
(n=6)
Mean±SE
Days
0 7 14 21
Hb (g/dl) T1 7.28±1.71Aa** 7.95±1.20Aab** 9.81±0.98Abc** 10.25±0.29Ac*
T2 7.15±01.41Aba** 7.76±3.11ABab** 9.15±0.88ABb** 10.01±0.29ABb*
T3 11.7±0.31C10.7±0.30C11.9±0.24ABC 10.8±0.33ABC
PCV (%) T1 22.5±4.32Aa** 24.33±4.22Aab** 30.33±1.0Abc** 33.66±1.36Acd**
T2 22.16±3.31Aba** 23.46±3.38ABab** 25.90±3.85ABabc** 27.87±1.19ABcd**
T3 34.16±0.60C** 34.06±0.61C** 33.16±0.67C** 32.16±0.64ABC**
TEC (×106/µl) T1 3.25±0.92Aa** 4.15±0.79Aab** 4.75±0.52Aabc* 5.27±0.59cd
T2 3.13±0.48Aba** 3.43±0.43ABab** 3.89±0.56ABbc* 4.34±0.25cd
T3 4.96±0.13C** 4.56±0.12ABC** 4.36±0.15ABC* 4.66±0.10
TLC (×103/µl) T1 58.83±21.95Aa* 67.16±2.27Aab 83.00±13.20abc 101.98±14.17cd
T2 82.50±16.69AB* 83.25±16.71AB 85.63±34.99 88.56±20.09
T3 103.8±0.45BC* 102.8±0.47BC* 105.8±0.47 101.8±0.49
Platelets (×103/µl) T1 85.96±16.44Aa** 105.37±44.13Aab** 110.16±44.36Abc** 121.50±46.18Acd**
T2 88.77±77ABa** 91.25±13.01ABab** 98.25±19.64ABabc** 119.84±20.19ABbcd**
T3 267.57±16.64C** 260.57±15.64C** 257.57±11.64C** 247.57±13.64C**
Neutrophil (%) T1 67.33±2.62 68.33±2.40 67.5±2.51A* 67.33±2.62A**
T2 74.33±1.49 74.66±1.20 77±0.81B* 79.33±0.80B**
T3 76.5±1.47 77.5±1.42 79.5±1.40BC* 72.5±1.49BC**
Lymphocyte (%) T1 21.5±2.17 22.16±1.92 21.66±2.31 21.5±2.17
T2 15.66±1.64 15.50±1.62 11.56±1.44 14.5±0.71
T3 21.33±1.74 21.03±1.77 22.30±1.72 21.63±1.74
Monocyte (%) T1 7.66±0.96Aa** 5.33±0.80Aab** 2.33±0.33Ac* 1.5±0.22cd
T2 6.66±0.42AB** 5.16±0.65AB** 4.83±0.60B* 3.50±0.61
T3 2.16±0.47C** 2.06±0.45C** 2.00±0.47AC* 2.076±0.46
Eosinophil (%) T1 1.5±0.22A** 1.66±0.33A** 1.50±0.22A** 1.50±0.22A
T2 3.3±0.42AB** 3.33±0.43AB** 3.5±0.56AB** 1.83±0.30AB
T3 0.66±0.21C** 0.69±0.22C** 0.77±0.20C** 0.76±0.22C
*Signicant difference (P<0.05); **Signicant difference (P<0.01). Values bearing different superscript small letter in column wise and capital letter in row wise showed
signicant difference. SE: Standard error; PCV: Packed cell volume; TLC: Total leukocyte count; TEC: Transluminal endarterectomy catheter; Hb: Haemoglobin
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 48
et al.[32] Many authors already described the superior
sensitivity and specificity of PCR in diagnosing
ehrlichiosis when compared to serology.[28,33] In the
present study, dogs were found to be positive for
E. canis by nested PCR after 7 days of doxycycline
as well as Crotalus horridus treatment, indicating the
persistence of infection. It may also be an indicator
of the short duration of treatment, especially
in immune-compromised dogs. Hence, it is a
highly effective tool for assessing the clearance of
organisms after therapy.
Oral doxycycline has long been the drug of choice for
treatment of CME. Failure to clear infections from
hosts that respond to treatments for ehrlichial diseases
can result in asymptomatic carriers that remain
sources of infection for vectors and naive vertebrate
hosts, so an alternative treatment regimen should
be evaluated. Moreover, prolonged use of antibiotic
therapy is associated with greater risk and likelihood
of developing drug resistance. This phenomenon
is a huge global concern and is mostly the result of
history of indiscriminate overuse of these agents in
both medicine and agriculture. The issue of resistance,
with the subsequent development of recurrent
infections, chronic infections, and the proliferation of
progressively stronger strains of microorganisms has
been the focus of extensive investigation and concern.
There is definite evidence that this agent actually
Table 3: Evaluation of serum biochemical parameters on clinical trial between doxycycline (T1) and
Crotalus horridus (T2) on Ehrlichiainfected dogs
Parameters Group
(n=6)
Mean±SE
Days
0 7 14 21
Total protein (g/dl) T1 5.09±0.27A** 5.34±0.24A** 6.09±0.32A** 6.72±0.43
T2 5.43±0.36AB** 5.47±0.37AB** 5.73±0.41B** 6.32±0.48
T3 7.19±0.11C** 7.09±0.12C** 7.11±0.11AC** 7.31±0.11
Albumin (g/dl) T1 1.43±0.35Aa** 2.33±0.19Ab** 2.65±0.08Abc** 3.78±0.19Ad*
T2 1.17±0.19ABa** 1.26±0.20ABab** 1.88±0.20ABabc** 3.09±0.28ABd*
T3 4.10±0.25C** 4.22±0.27C** 4.15±0.22C** 4.07±0.25C*
Globulin (g/dl) T1 1.10±0.11A* 3.01±0.27A** 3.45±0.38 3.99±0.26
T2 4.26±0.31B** 4.07±0.26B** 3.87±0.24 3.25±0.37
T3 3.09±0.22BC** 3.11±0.24AC** 3.19±0.25 3.22±0.20
A: G T1 0.42±3.79Aa** 0.82±0.12Aab** 0.83±0.11Aabc*0.96±0.0.07bcd
T2 0.28±0.06ABa** 0.31±0.06ABab** 0.48±0.04ABabc* 1.03±0.19cd
T3 1.40±0.20C** 1.42±0.22C** 1.39±0.20C* 1.45±0.21
BUN (g/dl) T1 25.83±0.16 25.17±4.25 24.67±4.35 23.17±3.70
T2 26.67±4.64 25.50±4.74 24.67±3.83 26.67±4.64
T3 34.45±8.35 34.45±8.35 34.45±8.35 34.45±8.35
Creatinine (mg/dl) T1 1.16±0.18 0.95±0.08 0.92±0.08 0.76±0.22
T2 1.10±0.18 1.08±0.11 0.98±0.07 0.82±0.08
T3 0.62±0.15 0.66±0.15 0.67±0.15 0.62±0.15
ALT (µ/L) T1 141.10±50.65 129.17±36.30 105.83±21.18 77.17±4.43A*
T2 157.81±50.65 140.91±41.93 125.83±18.07 92±3.28AB*
T3 43.79±8.77 43.99±8.73 42.79±7.73 44.79±8.76C*
ALP (µ/L) T1 205.81±29.34 138.50±15.25 128.50±15.25 93.17±6.88
T2 195.01±32.14 141.50±14.16 132.67±15.25 111.33±12.61
T3 42.48±9.40 42.58±9.40 43.48±8.40 42.08±8.45
Total bilirubin (mg/dl) T1 1.81±0.39 1.33±0.28 0.98±0.15 0.75±0.04
T2 1.84±0.39 1.53±0.28 1.09±0.19 0.96±0.04
T3 0.67±0.21 0.63±0.25 0.69±0.21 0.62±0.24
Direct bilirubin (mg/dl) T1 0.88±0.10 0.78±0.08 0.63±0.07 0.64±0.07
T2 1.33±0.04 0.81±0.10 0.60±0.07 0.58±0.08
T3 0.55±0.22 0.58±0.21 0.65±0.22 0.52±0.25
*Signicant difference (P<0.05); **Signicant difference (P<0.01). Values bearing different superscript small letter in column wise and capital letter in row wise
showed signicant difference. SE: Standard error; ALT: Alanine aminotransferase; ALP: Alkaline phosphatase; BUN: Blood urea nitrogen
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 49
delays the development of host immunity while
promoting a state of perpetual illness due to multiple
factors associated with their use.[34] Homoeopathy has
been used in animals to treat a multitude of conditions.
[35] Our findings regarding clinical recovery of the dogs
from ehrlichiosis with Crotalus horridus is encouraging.
On the clinical score, Crotalus horridus and doxycycline
showed progressive and significant regression in
clinical signs on days 7, 14, and 21 posttherapy and
improvement of haemato-biochemical values of
infected dogs and there was no significant difference
between the groups. Similarly, there was progressive
decline in the parasitized erythrocytes in both the
groups. However, reduction in parasitized erythrocytes
in case of Crotalus horridus was evident only on day
21, but parasitized erythrocytes reduced significantly
from the 7th day onward in case of doxycycline. The
effectiveness of Crotalus horridus has been described in
babesiosis of cattle and dog,[35,36] on fever, hemorrhagic
diathesis, yellow color of conjunctiva, jaundice,
purpura hemorrhagica, profound anaemia;[37] however,
it has never been evaluated in canine ehrlichiosis. The
results showed an encouraging response of Crotalus
horridus in the management of canine ehrlichiosis.
The clinical efficacy of the homoeopathic drug was
comparable with modern allopathic drug doxycycline.
Moreover, the use of homoeopathic drugs in the
management of ehrlichiosis in dogs has not previously
been reported.
Our findings regarding clinical recovery of the
dogs with ehrlichiosis with Crotalus horridus
are encouraging. There was a significant
reduction (P < 0.05) of temperature, pulse, and
respiration on the 7th-day posttherapy. The clinical
signs were also improved after treatment. All the
ailing animals showed alertness and improved
appetite. Haemato-biochemical changes due to
ehrlichiosis-infected dogs returned to normalcy after
Crotalus horridus treatment. From the present study,
it seems that Crotalus horridus can be an effective
and alternative in case of ehrlichiosis.
Acknowledgment
Authors were thankful to Dean, College of Veterinary
Sciences and Animal Husbandry, Central Agricultural
University, Selesih, Aizawl, Mizoram, India, for
providing all the necessary facilities to do this
research work.
Financial Support and Sponsorship
This article is a part of M.V.Sc thesis and for this
research, financial support was got from Dean, College
of Veterinary Sciences and Animal Husbandry, Central
Agricultural University, Selesih, Aizawl, Mizoram, India.
Conflicts of Interest
There are no conflicts of interest.
REFERENCES
1. Frank JR, Breitschwerdt EB. A retrospective study of ehrlichiosis
in 62 dogs from North Carolina and Virginia. J Vet Intern Med
1999;13:194‑201.
2. Stiles J. Canine rickettsial infections. Vet Clin North Am Small Anim
Pract 2000;30:1135‑49.
3. Ewing SA. Geographic distribution and tick transmission of Ehrlichia
canis. J Med Entomol 1972;9:597‑8.
4. Baneth G, Waner T, Koplah A, Weinstein S, Keysary A. Survey
of Ehrlichia canis antibodies among dogs in Israel. Vet Rec
1996;138:257‑9.
5. Hua P, Yuhai M, Shide T, Yang S, Bohai W, Xiangrui C. Canine
ehrlichiosis caused simultaneously by Ehrlichia canis and Ehrlichia
platys. Microbiol Immunol 2000;44:737‑9.
6. Unver A, Perez M, Orellana N, Huang H, Rikihisa Y. Molecular and
antigenic comparison of Ehrlichia canis isolates from dogs, ticks, and
a human in Venezuela. J Clin Microbiol 2001;39:2788‑93.
7. Singla LD, Singh H, Kaur P, Singh ND, Singh NK, Juyal PD.
Serodetection of Ehrlichia canis infection in dogs from Ludhiana
district of Punjab, India. J Parasit Dis 2011;35:195‑8.
8. Sarma K. Studies on Hepatopathies Due to Tick Born Intracellular
Diseases in Dog to Evolve Integrated Therapeutic Approach. PhD
Thesis, Submitted to Indian Veterinary Research Institute, Izatnagar,
Bareilly, UP; 2012.
9. Harrus S, Waner T, Bark T. Canine monocytic ehrlichiosis – An
update. Compend Contin Educ Pract Vet 1997;19:431‑44.
10. Egenvall A, Bjöersdorff A, Lilliehöök I, Olsson Engvall E, Karlstam E,
Artursson K, et al. Early manifestations of granulocytic ehrlichiosis
in dogs inoculated experimentally with a Swedish Ehrlichia species
isolate. Vet Rec 1998;143:412‑7.
11. Greene CE, Harvey JW. Canine ehrlichiosis. In: Greene CE, editor.
Clinical Microbiology and Infectious Diseases of the Dog and Cat.
Philadelphia: Saunders WB Co.; 1990.
12. Platt‑Samoraj A, Szweda W, Ciecierski H. Ehrlichiosis in the latest
research. Med Weter 1998;54:363‑7.
13. Pusterla N, Leutenegger CM, Sigrist B, Chae JS, Lutz H, Madigan JE.
Detection and quantitation of Ehrlichia risticii genomic DNA in infected
horses and snails by real‑time PCR. Vet Parasitol 2000;90:129‑35.
14. Peleg O, Baneth G, Eyal O, Inbar J, Harrus S. Multiplex real‑time
qPCR for the detection of Ehrlichia canis and Babesia canis vogeli.
Vet Parasitol 2010;173:292‑9.
15. Sainz A, Tesouro MA, Amusategui I, Rodríguez F, Mazzucchelli F,
Rodríguez M. Prospective comparative study of 3 treatment protocols
using doxycycline or imidocarb dipropionate in dogs with naturally
occurring ehrlichiosis. J Vet Intern Med 2000;14:134‑9.
16. Sarmah AK, Meyer MT, Boxall AB. A global perspective on the use,
sales, exposure pathways, occurrence, fate and effects of veterinary
antibiotics (VAs) in the environment. Chemosphere 2006;65:725‑59.
17. Viksveen P. Antibiotics and the development of resistant
microorganisms. Can homeopathy be an alternative? Homeopathy
2003;92:99‑107.
18. Murphy GL, Ewing SA, Whitworth LC, Fox JC, Kocan AA.
A molecular and serologic survey of Ehrlichia canis, E. chaffeensis,
and E. Ewingii in dogs and ticks from Oklahoma. Vet Parasitol
1998;79:325‑39.
19. Jones M. Clinical reasoning process in manipulative therapy. In:
Boyling J, Palastanga N, editors. Grieve’s Modern Manual Therapy.
2nd ed. Edinburgh: Churchill Livingstone; 1994. p. 577.
20. Reinhold JG. Manual determination of serum total protein albumin
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 50
fetksje esa bgjfyfd;ksfll laØfer dqÙkksa es gksE;ksiSfFkd nok ØksVSyl g‚fjM~l 200lh dk fpfdRldh; ewY;kadu
lkj &
mÌs”;& çLrqr v/;;u Hkkjr ds fetksje çkUr esa fLFkr vkbtksy ftys ds LFkkfud {ks= esa bgjfyfd;ksfll laØfer dqÙkksa es gksE;ksiSfFkd nok
ØksVSyl g‚fjM~l 200lh ds çHkko dk v/;;u djukA
vko';d lkefxz;k¡ vkSj fof/k;ka& bgjfyfd;ksfll laØfer dqÙkksa esa gksE;ksiSfFkd nok ØksVSyl g‚fjM~l 200lh ds fpfdRlh; çHkko dk ewY;kadu
djus gsrq] ihlhvkj fof/k ls iqf"V fd;s x;s ckjg /kukRed çdj.kksa dks nks lewgksa esa çfr lewg 06 ¼Ng½ dqÙkksa ds fglkc ls ckaVk x;kA ,d lewg
ekud fpfdRlk ¼MkDlhlkbZfDyu½ vkSj nwljs lewg dks 20 fnuksa ds fy, gksE;ksiSfFkd nok ØksVSyl g‚fjM~l 200lh dh 4 xksfy;ka çfrfnu ekSf[kd
:i ls nsus ds ckn çHkkfor~ dqÙkksa esa uSnkfud lq/kkj vafdr fd;k x;kA fpfdRlk ds iwoZ rFkk i'pkr egRoiw.kZ jä&tSo jklk;fud ekinaMksa
tSls & gheksXyksfcu] ihlhoh] VhbZlh] Vh,ylh] Mh,ylh] IysVysV dkmaV] VksVy çksVhu] ,Ycqfeu] XyksC;qfyu] ,:th vuqikr] VksVy fcyh:fcu]
lhje fØ,fVfuu]ch ;w ,u vkSj fyoj ds fo'ks"k ,UtkbEl tSls&,yfuu vehuks VªkalQsjst ¼,,yVh½ vkSj {kkjh; Q‚LQsV ¼,ih½ dk ekiu ekud
Lrjksa ds çksVksd‚y }kjk fd;k x;kA lHkh ekinaMksa dh rqyuk fu;af=r LoLFk lewg ¼Vh 3½ ls dh xbZA lHkh ijh{k.kksa esa dqÙks fHkUu vk;q oxZ ,oe~
fHkUu&fHkUu çtkfr;ksa ds FksA jäijh{k.k gsrq jä dk ladyu flQZ e/;kUg iwoZ fd;k x;k FkkA
bZ- dkfuZl ls thu ds 16 rRN 387 bap fgLls ds vko/kZu ls 67 lfUnX/k uewus ftUgsa tk¡p gsrq fy;k x;k ¼19-40 izfr”kr½ esa ls ihlhvkj ijh{k.k esa
13 dqÙkksa dks çHkkfor ik;k x;kA iwjs çHkkfor çdj.kksa esa ls] flQZ 8 ¼61-53 izfr”kr½ ds ifjlapj.kh; jä esa budh mifLFkfr ik;h x;hA fpfdRlk
ds 14osa fnu gksrs&gksrs lh gkjhM~l }kjk fpfdfRlr dqÙkksa ds lewg esa cq[kkj uSnkfud :i ls Bhd gks x;k vkSj 'kjhj dk rkieku lkekU; voLFkk
esa vk x;kA fpfdRlk ds 21osa fnu çHkkfor dqÙkksa ds jä&tSo jlk;u ?kVd tSls& ,pch] ihlhoh] VhbZlh] Vh,ylh] Mh,ylh] IysVysV dkmaV]
VksVy çksVhu] ,Ycqfeu] XyksC;qfyu] ,:th vuqikr] VksVy fcyh:fcu] lhje fØ,fVfuu]ch ;w ,u vkSj fyoj ds fo'ks"k ,UtkbEl tSls& ,yfuu
vehuks VªkalQsjst ¼,,yVh½ vkSj {kkjh; Q‚LQsV lkekU; Lrj ij igq¡p x;sA
fu"d"kZ& usLVsM ihlhvkj ij[k }kjk ;g fn[kk;k x;k gS fd ;g bZ dsful ds çfr laosnu'khy gS vkSj bldk irk yxkus ds fy;s fof'k"V gSA lh
g‚fjM~l 200 dsukbu bgjfyfd;ksfll ds fu;a=.k gsrq çHkkoh ,oe~ ilanhnk nok gks ldrh gSA
and globulin fractions by buiret method. In: Reiner M. editor.
Standard Method of Clinical Chemistry. New York: Academic Press;
1953. p. 88.
21. Reitman S, Frankel S. A colorimetric method for the determination of
serum glutamic oxalacetic and glutamic pyruvic transaminases. Am
J Clin Pathol 1957;28:56‑63.
22. Omotainse SO, Anosa VO, Falaye C. Clinical and biochemical
changes in experimental Trypanosoma brucei infection in dogs. Isr
J Vet Med 1994;49:36‑9.
23. da Silva GC, Benitez Ado N, Girotto A, Taroda A, Vidotto MC,
Garcia JL, et al. Occurrence of Ehrlichia canis and Anaplasma platys
in household dogs from northern Parana. Rev Bras Parasitol Vet
2012;21:379‑85.
24. Lakshmanan B, John L, Gornathinayagam S, Dhinakarraj G.
Molecular detection of Ehrlichia canis from blood of naturally infected
dogs in India. Vet Arch 2007;77:307‑12.
25. Abd Rani PA, Irwin PJ, Coleman GT, Gatne M, Traub RJ. A survey of
canine tick‑borne diseases in India. Parasit Vectors 2011;4:141.
26. Wise AE, Tarlinton RE. Seroprevalence of vectorborne diseases in
free‑roaming dogs in Goa, India. Vet Rec 2012;170:76.
27. Borthakur SK, Deka DK, Bhattacharjee K, Sarmah PC.
Seroprevalence of canine dirolariosis, granulocytic anaplasmosis
and lyme borreliosis of public health importance in dogs from India’s
North East. Vet World 2014;7:665‑7.
28. Iqbal Z, Chaichanasiriwithaya W, Rikihisa Y. Comparison of PCR
with other tests for early diagnosis of canine ehrlichiosis. J Clin
Microbiol 1994;32:1658‑62.
29. McBride JW, Corstvet RE, Gaunt SD, Chinsangaram J, Akita GY,
Osburn BI. PCR detection of acute Ehrlichia canis infection in dogs.
J Vet Diagn Invest 1996;8:441‑7.
30. Inokuma H, Raoult D, Brouqui P. Detection of Ehrlichia platys DNA
in brown dog ticks (Rhipicephalus sanguineus) in Okinawa Island,
Japan. J Clin Microbiol 2000;38:4219‑21.
31. Warner CK, Dawson JE. Genus and species‑level identication of
Ehrlichia species by PCR and sequencing. In: Pershey DH, editor.
PCR Protocols for Emerging Infectious diseases. Washington, DC:
ASM Press; 1996, p. 100‑11.
32. Egenvall A, Lilliehöök I, Bjöersdorff A, Engvall EO, Karlstam E,
Artursson K, et al. Detection of granulocytic Ehrlichia species DNA
by PCR in persistently infected dogs. Vet Rec 2000;146:186‑90.
33. Wen B, Rikihisa Y, Mott JM, Greene R, Kim HY, Zhi N, et al.
Comparison of nested PCR with immunouorescent‑antibody
assay for detection of Ehrlichia canis infection in dogs treated with
doxycycline. J Clin Microbiol 1997;35:1852‑5.
34. Kilkkinen A, Rissanen H, Klaukka T, Pukkala E, Heliövaara M,
Huovinen P, et al. Antibiotic use predicts an increased risk of cancer.
Int J Cancer 2008;123:2152‑5.
35. Macleod G. The Treatment of Cattle by Homeopathy. Saffron
Walden, England: The C. W. Daniel Company Ltd.; 1981.
36. Chaudhuri S, Varshney JP. Clinical management of babesiosis
in dogs with homeopathic Crotalus horridus 200C. Homeopathy
2007;96:90‑4.
37. Murphy R. Lotus Materia Medica 2nd revised Edition. . New Delhi: B.
Jain Publishers Pvt. Ltd.; 2002.
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
Tungnunga, et al.: Therapeutic evaluation of Crotalus horridus 200C against ehrlichiosis
Indian Journal of Research in Homoeopathy / Vol. 10 / Issue 1 / Jan-Mar 2016 51
Evaluación terapéuca del medicamento homeopáco, Crotalus horridus 200C en perros con ehrlichiosis en
Mizoram
RESUMEN
Objevos: Estudiar el efecto de un medicamento homeopáco Crotalus horridus 200C en la ehrlichiosis en perros
en un área endémica de distrito del estado de Mizoram Aizawl de la India. Las terapias alternavas basadas en
homeopaa pueden ser ecaces en mejorar estas enfermedades caninas, causadas por garrapatas. En este estudio,
se ha invesgdo el efecto del medicamento homeopáco Crotalus horridus 200c en la ehrlichiosis canina en una
región endémica del distrito de Aizawl del estado Mizoram de la India.
Materiales y métodos: Para evaluar la ecacia de Crotalus Horridus 200c en perros con ehrlichiosis, 12 casos
posivos (conrmados por PCR) fueron divididos en dos grupos de 6 perros cada uno. Un grupo fue tratado con
la terapia estándar (doxiciclina), mientras que el otro recibió Crotalus Horridus 200c, 4 píldoras orales durante
20 días. Después del tratamiento, se registró una mejoría clínica de los perros afectados. Conforme al protocolo
estándar, se evaluaron los parámetros hematobioquímicos importantes antes y después del tratamiento, como
Hb, hematocrito, recuento total de glóbulos rojos, recuento total y diferencial de leucocitos, recuento plaquetario,
proteínas totales, albúmina, globulina, relación A:G, bilirrubina total, creanina sérica, BUN y enzimas hepácas
especícas (alaninoaminotransferasa (ALT) y fosfatasa alcalina (FA)). Todos los parámetros se compararon con un
grupo de control sano (T3) Todos los perros del experimento eran de diferentes edades y razas diferentes y se
recogieron muestras de sangre a media mañana solamente.
Resultados: De las 67 muestras sospechosas examinadas, la prueba de la PCR dio lugar a 13 perros posivos
(19,40%) con una ampliación del fragmento 387bp del gen 16S rRNA de E. canis. Únicamente en 8 (61,53%) del total
de posivos se pudo detectar en el fros de sangre periférica. El grupo de perros tratados con Crotalus horridus
mostró una recuperación clínica de la ebre, y la temperatura se normalizó a los 14 días postratamiento. Los perles
hemato-bioquímicos de los perros afectados como Hb, hematocrito, recuento total de glóbulos rojos, recuento total
y diferencial de leucocitos, recuento plaquetario, proteínas totales, albúmina, globulina, relación A:G, bilirrubina
total, creanina sérica, BUN y enzimas hepácas especícas (alaninoaminotransferasa (ALT) y fosfatasa alcalina
(FA) mostraron valores normales en 21 días después del tratamiento.
Conclusiones: El presente estudio ha reestablecido que la ehrlichiosis es endémica en Mizoram. El ensayo de la PCR
anidada ha mostrado ser sensible y especíco para la detección de E.canis.El medicamento homeopáco Crotalus
horridus 200 puede ser un remedio de elección ecaz en el control de la ehrlichiosis canina.
[Downloaded free from http://www.ijrh.org on Sunday, December 24, 2017, IP: 42.110.151.103]
... Minocycline is widely available and may be remarkably much less expensive (Jenkins et al., 2018) [6] . Homeopathic drug Crotalus horridus 200C at 4 pills orally for 20 days has almost equal intensity with doxycycline to manage the ehrlichiosis infection (Tungnunga et al., 2016) [31] . Blood transfusion is necessary in severely anaemic dogs to save their life. ...
... Minocycline is widely available and may be remarkably much less expensive (Jenkins et al., 2018) [6] . Homeopathic drug Crotalus horridus 200C at 4 pills orally for 20 days has almost equal intensity with doxycycline to manage the ehrlichiosis infection (Tungnunga et al., 2016) [31] . Blood transfusion is necessary in severely anaemic dogs to save their life. ...
Research
Full-text available
Canine ehrlichiosis is a tick borne disease of canines caused by the intracellular, gram-negative bacteria and clinically characterized by pyrexia, anorexia, lymphadenopathy, splenomegaly, anaemia, peripheral edema, haemorrhagic tendencies, ocular and neurological signs. It affects dogs, other domestic, wild animal species and humans. E. canis and E. ewingii are commonly found in dogs and E. chaffeensis is commonly known as human monocytic ehrlichiosis. With global warming, expanding tick habitats and increasing international travel the spread of disease to former non-endemic areas is of great concern. Diagnosis is performed on the basis of history of tick infestation, clinical manifestations, parasitological examination, haematobiochemical examination, serological and molecular diagnosis. The drug of choice is doxycycline and other effective drugs like imidocarb dipropionate, Crotalus horridus, rifampicin etc. may be used along with symptomatic and supportive therapy. Prevention involves avoidance of tick exposure and use of tick preventive measures as there is no successful vaccine currently available.
... It possesses antiretroviral action and is potent against Ehrlichiosis infections in different homoeopathic preparations. [10] In this context, the health benefits of Eupatorium perfoliatum and Crotalus horridus in preventing cancers and infectious diseases [11] have been widely focused. However, very few studies have targeted the eventual benefit of Eupatorium perfoliatum and Crotalus horridus in attenuation of inflammation. ...
Article
Full-text available
Objective: The aim of this study was to investigate, the inhibitory effect of the homoeopathic drugs – Eupatorium perfoliatum and Crotalus horridus in experimental models of inflammation and Complete Freund's Adjuvant (CFA)-induced arthritis with evaluation of their safety aspects by acute and subacute toxicity studies. Materials and Methods: Animals were divided into eight groups (n = 6). Eupatorium perfoliatum and Crotalus horridus in different dilutions (6CH, 12CH, 30CH and 200CH) were administered orally, daily during the study period of 21 days, and their effect on joint dysfunction was evaluated by measuring joint diameter in CFA-induced arthritis model. In addition, inflammatory profiles of these homoeopathic drugs were screened in carrageenan-induced paw oedema model. Acute and subacute studies were carried out according to Organization for Economic Cooperation and Development 425, 407 guidelines. The subacute toxicity study was carried out for a duration of 28 days, and all the animals were observed for behavioural abnormalities. At the end of 28th day, animals were sacrificed to carry out the biochemical, haematological and histopathological estimations. Results: Findings of the study revealed that on CFA administration, there is a significant (P < 0.01) increase in joint diameter in all the tested animals. Maximum increase in joint diameter was observed on day 3 in all the treatment groups. Eupatorium perfoliatum 200CH showed significant decrease in joint diameter on day 21. In carrageenan study, the homoeopathic drugs produced a significant reduction in paw oedema at 5-h post-carrageenan administration. Study noted that the anti-inflammatory activity of Eupatorium perfoliatum was found to be superior to Crotalus horridus. Conclusion: Study inferred that Eupatorium perfoliatum and Crotalus horridus are safe at dilutions 6CH, 12CH, 30CH and 200CH and effective in minimising inflammation and arthritis in CFA-induced model.
Article
Full-text available
Aim: Vector-borne infections namely dirofilariosis, ehrlichiosis, anaplasmosis and lyme borreliosis are being recognized as emerging and/or re-emerging problems in dogs and man due to rapid extension of zoogeographical ranges of many causative agents through international tourism and increase mobility of dogs at national and international level towards meeting the demand for companion animals in the present day society. Anticipating such situation, a serological study was conducted in dogs from North East India to estimate the prevalence of zoonotically important Dirofilaria immitis, Anaplasma phagocytophilum and Borrelia burgdorferi along with Ehrlichia canis. Materials and Methods: Serological study was carried out using enzyme immunoassay in commercial SNAP 4DX® test kit (Idexx Laboratories, USA). The study was conducted in 191 dogs comprising 82 pets, 57 stray and 52 working dogs owned by defence organizations. Results: The study revealed seroprevalence of mosquito-borne D. immitis (17.80%), tick-borne E. canis (22.51%) and A. phagocytophilum (4.71%) with an overall 41.88% prevalence of pathogens in single or co-infection. Serological evidence of tick-borne lyme borreliosis due to B. burgdorferi could not be established in dogs in the present study. Of the zoonotic species, highest prevalence of D. immitis was found in the stray dogs (22.80%) and that of A. phagocytophilum in pet dogs (6.09%). Conclusion: The results of the present serological study serve as baseline information on the prevalence of A. phagocytophilum in dogs reported for the first time in India and reaffirmation on the high prevalence of D. immitis and E. canis in the North East India.
Article
Full-text available
Canine monocytic ehrlichiosis caused primarily by Ehrlichia canis and canine thrombocytic anaplasmosis induced by Anaplasma platys are important emerging zoonotic tick-borne diseases of dogs. There is evidence that these pathogens can also affect humans. This study evaluated the presence of E. canis and A. platys in blood samples collected from 256 domiciled dogs in the municipality of Jataizinho, located in north region of the State of Parana, Brazil, by PCR assay. The occurrence of E. canis and A. platys was 16.4% (42/256) and 19.4% (49/256), respectively; while 5.47% (14/256) of the dogs evaluated were co-infected by these two organisms. The presence of E. canis and A. platys was not significantly associated with the variables evaluated (sex, age, outdoor access, and presence of ticks during blood collection). Infection of dogs by E. canis was associated with anemia and thrombocytopenia, while infection induced by A. platys was related only to thrombocytopenia. Canine monocytic ehrlichiosis and canine thrombocytic anaplasmosis should be included in the differential diagnoses when these hematological alterations are observed during routine laboratory evaluation of dogs.
Article
Full-text available
Dot-ELISA (enzyme-linked immunosorbent assay) Immunocomb(®) assay was conducted to detect the presence of antibodies against Ehrlichia canis in blood samples of 60 privately owned dogs suspected to be infected with E. canis from the Small Animal Clinics, College of Veterinary Science, Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, Punjab (India). Antibodies reactive to E. canis were detected in plasma in 48 samples out of 60 samples by Immunocomb(®) Dot-ELISA. Out of these 39.58% samples were low positive (Titre 1:20-1:40), 31.25% were medium positive (Titre 1:80-1:640) and 29.16% were high positive (Titre >1,280), for the infection. When examined by microscopy, only two samples revealed typical E. canis morulae. Haemato-cellular examination revealed thrombocytopenia along with anaemia and leucopenia. Results suggest that E. canis infection circulates in dogs in India in low non-detectable numbers by microscopy and is transmitted by the brown dog tick Rhipicephalus sanguineus.
Article
Full-text available
Molecular detection of Ehrlichia canis from blood of naturally infected dogs in India. Vet. arhiv 77, 307-312, 2007. aBStraCt The nested PCR assay for the detection of 16S rRNA gene fragment of ehrlichia canis from the blood of dogs was standardized for the first time in India. The genus-specific primers amplified a 477 bp band of Ehrlichia sp. in the first PCR. The nested PCR assay using species-specific primers produced a 387 bp band of e. canis. The nested PCR detected e. canis organisms in 50% of samples as against the routine blood smear examination, which revealed morulae in only 19.38% of samples. This protocol could detect the presence of e. canis, even one month after specific antibiotic therapy.
Article
Canine monocytic ehrlichiosis, an important tick-borne disease of dogs and other canids, is reported in many parts of the world. This article considers the disease in light of its background and history, cause, epidemiology, pathogenesis, signalment, clinical findings, hematologic findings, biochemical findings, diagnosis, treatment, prognosis, and prevention. Canine monocytic ehrlichiosis can be manifested by a wide variety of clinical signs; the predominant signs are depression, lethargy, mild weight loss, anorexia, pyrexia, lymphadenomegaly, splenomegaly, and bleeding tendencies. Thrombocytopenia is the most common and consistent hematologic finding in all stages of canine monocytic ehrlichiosis. Anemia and leukopenia may occur during the acute and chronic phases. Pronounced pancytopenia is the hall-mark of the severe chronic phase and results from hypocellular bone marrow. The principal biochemical abnormalities include hypoalbuminemia, hyperglobulinemia, and hypergammaglobulinemia. Long-term treatment with doxycycline and imidocarb dipropionate is recommended. Clinicians should be aware of the possibility of coinfections with other tick-borne parasites; such coinfections are common.
Article
The biuret reaction for the estimation of protein in urine was first introduced by Riegler (1). Autenrieth (2, 3), Hiller (4), and Fine (5) modified and improved the method. All agreed that the biuret reaction was reliable, the error usually not exceeding 5 per cent in experienced hands. It was also found that equal quantities of albumin and globulin yielded violet colors of practically the same intensity. However, these investigators found it difficult to ob-tain a satisfactory standard. Biuret was generally abandoned because of impurities and because when treated its color tint differed from that of proteins. Gavrilov and Ginzburg (6) who employed a peptone standard believed that the biuret reaction was suitable only for the estimation of total peptide linkages and not protein. Fine (5) used serum protein preserved in chloro-form as a standard which was said to be stable for 6 months. This is quest,ionable, since a deposit often separates from protein solutions on standing. The older methods have been simplified and made more accurate by the elimination of the preliminary precipitation of protein. The procedure has been further shortened by the use of copper su1fat.e and sodium hydroxide in such proportion that precipitate formation is avoided. The need for a standard was eliminated in the method herein described by use of a photoelectric calorimeter.' Standardization was accomplished by diluting pooled blood serum with 0.85 per cent sodium chloride to give solutions of various f The Mass photoelectric calorimeter was used, but any other reliable instrument can be adapted to the method.