ArticlePDF Available

A new species of Oeneis from Alaska, United States, with notes on the Oeneis chryxus complex (Lepidoptera: Nymphalidae: Satyrinae)

Authors:

Abstract and Figures

Oeneis tanana A. Warren & Nakahara is described from the Tanana River Basin in southeastern Alaska, USA. This new taxon belongs to the bore group of Oeneis Hübner, [1819] and is apparently closest to O. chryxus (E. Doubleday, [1849]) by morphology, including its larger size and similarity of the female genitalia. In wing patterns and COI mitochondrial DNA barcode sequences, it is reminiscent of O. bore (Esper, 1789). A review of O. chryxus subspecies suggest that some may be better treated as species-level taxa. Evolutionary scenarios within the chryxus complex of taxa are discussed. While we hypothesize that O. tanana is best considered a species-level taxon, we have not identified any single character that unambiguously separates it from O. chryxus. Further study is needed to elucidate the species- or subspecies-level status of O. tanana, and to determine if it may have evolved through hybridization between O. chryxus and O. bore.
Content may be subject to copyright.
Volume 49: 1-20
ISSN 0022-4324 (p r I N t )
ISSN 2156-5457 (o N l I N e )
The Journal
of Research
on the Lepidoptera
tHe lepIDop terA r eSeArCH FoUNDAtIoN, 15 MA r C H 2016
Received: 21 December 2015
Accepted: 18 January 2016
Copyright: This work is licensed under the Creative Commons
Attribution-NonCommercial-NoDerivs 3.0 Unported License. To
view a copy of this license, visit http://creativecommons.org/
licenses/by-nc-nd/3.0/ or send a letter to Creative Commons,
171 Second Street, Suite 300, San Francisco, California, 94105,
USA.
A new species of Oeneis from Alaska, United States, with notes on the Oeneis
chryxus complex (Lepidoptera: Nymphalidae: Satyrinae)
AN D r e w D. wA r r e N 1, SH I N I C H I NA k A H A r A 1, Vl A D I M I r A. lU k H t A N o V 2,3, kA t H r y N M. DA l y 4, Cl I F F o r D D.
Fe r r I S 5, NI C k V. Gr I S H I N 6, MA r t I N Ce S A N e k 7 A N D Jo N A t H A N p. pe l H A M 8
1McGuire Center for Lepidoptera and Biodiversity, Florida Museum of Natural History, University of Florida, 3215 Hull Rd., UF
Cultural Plaza, PO Box 112710, Gainesville, Florida, 32611-2710 USA
2Department of Karyosystematics, Zoological Inst itute of the Russian Academy of Sciences, Universitetskaya nab. 1, 199034
St. Petersburg, Russia
3Department of Entomology, St. Petersburg State University, Universitetskaya nab 7 9, St. Petersburg 199034, Russia
4Department of Entomolog y, University of A laska Museum, 907 Yukon Dr., Fairbanks, Alaska 99775- 6960 USA
55405 Bill Nye Ave., R.R. 3, Laramie, W Y 82070 USA; Research Associate, McGuire Center for Lepidoptera and Biodiversity
6Howard Hughes Medical Institute and Departments of Biophysics and Biochemistry, University of Texas Southwestern Medical
Center, 5323 Harry Hines Blvd., Dallas, Texas 75390-9050 USA
7Bodrocká 30, 821 07 Bratislava, Slovakia
8Burke Museum of Natural History and Culture, Box 353010, University of Washington, Seattle, Washington 98195-3010 USA
hesperioidea@yahoo.com, snakahara@ufl.edu, lukhtanov@mail.ru, kmdaly@alaska.edu, cdferris@uwyo.edu, grishin@chop.swmed.edu,
martin.cesanek@gmail.com, zapjammer@comcast.net
Abstract. Oeneis tanana A. Warren & Nakahara is described from the Tanana River Basin in
southeastern Alaska, USA. This new taxon belongs to the bore group of Oeneis Hübner, [1819] and is
apparently closest to O. chryxus (E. Doubleday, [1849]) by morphology, including its larger size and
similarity of the female genitalia. In wing patterns and COI mitochondrial DNA barcode sequences,
it is reminiscent of O. bore (Esper, 1789). A review of O. chryxus subspecies suggest that some may
be better treated as species-level taxa. Evolutionary scenarios within the chryxus complex of taxa
are discussed. While we hypothesize that O. tanana is best considered a species-level taxon, we have
not identified any single character that unambiguously separates it from O. chryxus. Further study
is needed to elucidate the species- or subspecies-level status of O. tanana, and to determine if it may
have evolved through hybridization between O. chryxus and O. bore.
Key words: Beringia, butterflies, cryptic species, hybrid species, Nearctic, speciation, taxonomy,
Yukon Territory.
In t r o d u c t I o n
Butterflies of the genus Oeneis Hübner, [1819] are
Holarctic in distribution, and occupy a wide range of
habitat types, including montane and boreal forests,
taiga, grasslands and steppe, alpine and arctic tundra,
with several species occurring in sparsely vegetated,
rocky terrain (e.g., Ferris 1980; Troubridge et al.
1982). While the nomenclature of Nearctic members
of Oeneis can be considered relatively stable (e.g.,
dos Passos 1961, 1964; Miller & Brown 1981; Ferris
1989; Pelham 2008, 2015), new taxa continue to be
described (Troubridge et al. 1982; Troubridge &
Parshall 1988; Guppy & Shepard 2001; Scott 2006;
Holland 2010), and some unresolved taxonomic issues
remain (e.g., Hassler & Feil 2002). However, a large
number of unresolved taxonomic questions persist
among the much richer fauna of Palaearctic Oeneis,
where species-level boundaries in some groups remain
poorly defined (e.g., Murayama 1973; Lukhtanov
1983; Korshunov & Gorbunov 1995; Bogdanov et al.
1997; Gorbunov 2001; Korshunov 2002; Korshunov
& Nikolaev 2003; Korb 2005; Chernov & Tatarinov
2006). Progress in improving our knowledge of
relationships in Oeneis is nonetheless being made;
a recent molecular study (Kleckova et al. 2015) has
J. Res.Lepid.2
helped resolve many of the issues related to the
composition of species groups in the genus, a
process initiated over 120 years ago.
Elwes & Edwards (1893) were the first to investigate
the morphology of the male genitalia of Oeneis. They
noted that O. chryxu s (E. Doubleday, [1849]), O. alberta
Elwes, 1893, O . bo re (Esper, 1789) and O. taygete Geyer,
[1830] (now often considered conspecific with O. b ore )
all shared the presence of a similar “toothon the
valvae, not found in other Oeneis species. Dos Passos
(1949) referred to Nearctic taxa with this character
as members of the taygete group.” Based on this
character, Gross (1970) united O. bore, O. taygete, O.
nevadensis (C. Felder & R. Felder, 1867), O. macounii
(W. H. Edwards, 1885), O. chryxus, O. ivallda (Mead,
1878), and O. alberta under “Gruppe C” in his review of
the genus; this group of taxa was subsequently called
the “bore group” by Lukhtanov (1984), Gorbunov
(2001), Lukhtanov & Eitschberger (2001), Pelham
(2008, 2015) and Kleckova et al. (2015). With the
exception of various Palaearctic taxa associated with
O. bore, O. pansa Cristoph, 1893 and O. ammon Elwes,
1899 (e.g., Korb 1998; Korshunov 2002; Korshunov &
Nikolaev 2003; Tsvetkov 2006; Yakovlev 2011), the bore
group is Nearctic in distribution.
The Oeneis chryxus complex currently includes nine
taxa, which are usually considered to be subspecies
of O. chryxus (e.g., Ferris 1989; Pelham 2008, 2015).
These include O. c. strigulosa McDunnough, 1934
[Type Locality in Ontario], O. c . ca lais (Scudder, 1865)
[Type Locality in Quebec], O. c. ca ry i Dyar, 1904 [Type
Locality in NE Alberta], O. c. chryxus [Type Locality
in W Alberta], O. c. altacordillera Scott, 2006 (Type
Locality in Colorado], O. c. socorro R. Holland, 2010
[Type Locality in New Mexico], O. c. valerata Burdick,
1958 [Type Locality in the Olympic Peninsula,
Washington], O. c. ivallda [Type Locality in Placer
County, California] and O. c. stanislaus Hovanitz, 1937
[Type Locality in Alpine County, California]. Since
2006, however, some authors have recognized more
than one species-level taxon in the chryxus complex,
as detailed below (see Discussion).
While curating the genus Oeneis in 2010 at the
McGuire Center for Lepidoptera and Biodiversity,
Florida Museum of Natural History, ADW encountered
a series of distinctive Alaskan specimens, collected
near the town of Tok in the southeastern part of
the state, which had previously been determined as
O. chryxus. The large size and overall dark aspect
of these specimens contrasted sharply with other
populations of O. chryxus. A brief review of the
male genitalia by JPP and ADW in 2011 confirmed
the placement of these Oeneis in the bore group. A
subsequent search of the Kenelm Philip collection
(currently housed at the Universit y of Alaska
Museum, Fairbanks) by ADW and KMD in 2015
revealed a large number of additional specimens
from multiple localities bordering the Tanana River
in southeastern Alaska. Further searches revealed
many additional specimens in private collections,
especially those of CDF and Jack Harry, the latter
recently donated to the McGuire Center.
In an effort to determine the taxonomic status
of these Alaskan specimens, genitalia of males and
females were compared to those of O. chryxus from
Yukon Territory and O. bo re from Alaska. In addition,
legs were sampled from all North American taxa in
the bore group (except O. c. socorro) by VL in 2011
and NVG in 2015, from which sequence data from
the “barcode” region of COI were obtained. Herein
we present the results of these studies, and describe
the distinctive Alaskan Oeneis as a new species, yet
note that further elucidation of its taxonomic status
is needed (see Discussion).
Ma t e r I a l s a n d M e t h o d s
Specimens examined are deposited in the
following collections: private collection of Clifford
D. Ferris, Laramie, Wyoming, USA (CDF); Private
collection of Jim P. Brock, Tucson, Arizona, USA
(JPB); Kenelm W. Philip collection, currently housed
at the University of Alaska Museum, Fairbanks, Alaska,
USA (as of January, 2016) (KWP); private collection of
Martin Cesanek, Bratislava, Slovakia (MC); McGuire
Center for Lepidoptera and Biodiversity, Florida
Museum of Natural History, University of Florida,
Gainesville, Florida, USA (MGCL); Triplehorn Insect
Collection, Ohio State University, Columbus, Ohio,
USA; material recently acquired from David Parshall,
photos examined (OSUC).
Full data are provided for all specimens examined
of the new species (see Types section, below), as
well as for all specimens of O. chryxus from Alaska
(6), British Columbia (103), and Yukon Territory
(466), more-or-less as presented on specimen labels
(see Additional Material Examined). Information
between brackets “[ ]” in the listing of specimen data
represents additional or corrected information. We
also examined 3,670 additional specimens of the O.
chryxus complex (as defined above) in the MGCL, as
follows: Michigan (215), Wisconsin (24), Quebec (7),
Ontario (391), Manitoba (177), Saskatchewan (2),
Northwest Territories (5), Alberta (183), Montana
(111), Wyoming (461), Colorado (862 chryxus +
altacordillera), New Mexico (44), Utah (159), Nevada
(65 chryxus, 93 ivallda), Idaho (119), Washington (142
valerata, 48 chryxus), California (562).
3
49: 1-20, 2016
The distribution map (Fig. 7) was generated
using SimpleMappr (<http://www.simplemappr.
ne t>) based on existing locality information and
additional data. When not provided on specimen
labels, coordinates were estimated using Google
Earth, often in combination with details provided
in The Milepo st (Morri s 2015). All known
localities from Alaska are included on the map, as
are most localities in Yukon Territor y, although a
few localities from Yukon Territory that we have
thus far been unable to pinpoint have not been
mapped.
Wing lengths were mea sured with a digital
Vernier caliper, from base to greatest length at the
apex of the right forewing. Adult abdomens, legs,
and palpi were soaked in hot KOH for 3-10 min
prior to dissection, dissected, and subsequently
stored in glycerine. Chlorazol black was used to
stain female genitalia. Dissected specimens are
indicated by “SN” numbers in the list of specimen
data. External and genit alic morphology was
studied using a Leica MZ 16 stereomicroscope
and drawings were produced with a camera lucida
attached to the Leica MZ 16 stereomicroscope. The
terminology for wing venation follows the Comstock-
Needham system described in Miller (1970), and
the terminology for wing pattern elements follows
Peña & Lamas (2005). Nomenclature of the
genitalia mostly follows Klots (1956), but we follow
Peña & Lamas (2005) in using the term aedeagus,
and Muschamp (1915) in using the term ‘brachia’
for structures often called the ‘gnathos’. Finally,
we follow Austin & Mielke (2008) in referring
to the part of the genitalia typically termed the
‘vinculum’ as ‘combined ventral arms of tegumen
and dorsal arms of saccus’.
Standard COI barcodes (658-bp 5’ segment of
mitochondrial cytochrome oxidase subunit I) were
studied. COI sequences were obtained from 53
specimens representing the following species: O.
bore, O. chryxus, O. macounii, O. nevadensis, O. am-
mon and the new species described below. We did
not include O. alberta in the final COI analysis as
this species is very distinct from both O. bore and
the O. chryxus complex with respect to morphol-
ogy and ecology, though it shares its barcodes with
other members of the O. bore group (most likely
due to a mitochondrial introgression). Legs from
the samples labeled by letters BPAL and CCDB (43
specimens) were processed at the Canadian Centre
for DNA Barcoding (CCDB, Biodiversity Institute of
Ontario, University of Guelph) using the standard
high-throughput protocol described in deWaard
et al. (2008). DNA was extracted from a single leg
removed from each voucher specimen employing a
standard DNA barcode glass fiber protocol (Ivanova et
al. 2006). All polymerase chain reactions (PCR) and
DNA sequencing were carried out following standard
DNA barcoding procedures for Lepidoptera as de-
scribed by Hajibabaei et al. (2005). This set of voucher
specimens is housed at MGCL, and can be identified
by the corresponding unique BOLD Process IDs that
were automatically generated by BOLD (Barcode of
Life Data System). Photographs of these specimens
are available in BOLD at <http:// www.barcodinglife.
org/>. Legs from the samples labeled with the letters
NVG and OSUC were processed in the Grishin lab us-
ing Macherey-Nagel (MN) NucleoSpin® tissue kit ac-
cording to the protocol described in Cong & Grishin
(2014). The following pairs of primers were used to
amplify the barcode in two overlapping segments:
sCOIF (forward, 5’ - ATTCAACCAATCATAAAGATAT-
TGG-3’) -Ven-m2COIR (reverse, 5’- GGTAAACTGT-
TCATCCTGTTC3’), and Meg-mCOIF2 (forward, 5’-
CCTCGWATAAATAAYATAAGATTTTG - 3’) -sCOIR
(reverse, 5’ -TAAACTTCTGGATGTCCAAAAAAT-
CA-3’). NVG voucher specimens are housed at MGCL,
except OSUC vouchers are at OSUC. Newly generated
sequences and accompanying data were submitted to
GenBank and received accession numbers KU552034-
KU552042 and KU570409-KU570424.
The barcode analysis involved 74 COI sequences
(including eight O. norna samples that were
selected as an outgroup). Among them there
were 21 published sequences (Lukhtanov et al.
2009; Pohl et al. 2009; Dewaard et al. 2014a,b;
Kleckova et al. 2015) downloaded from GenBank.
Sequences were aligned using BioEdit software
(Hall 1999) and edited manually. Phylogenetic
hypotheses were inferred using Bayesian methods
as described previously (Vershinina & Lukhtanov
2010; Talavera et al. 2013). Briefly, Bayesian
analyses were per formed using the program
MrBayes 3.2 (Ronquist et al. 2012) with default
settings as suggested by Mesquite (Maddison &
Maddison 2015): burn-in= 0.25, nst=6 (GTR + I
+ G). Two runs of 10,000,000 generations with
four chains (one cold and three heated) were
performed. Chains were sampled every 10,000
generations. The average value of the Potential
Scale Reduction Factor (PSRF) was 1.000 and the
average standard deviation of split frequencies
was 0.009516 to the end of the analysis, indicating
that convergence was achieved, and a good sample
from the posterior probability distribution was
obtained. The consensus of the obtained trees
was visualized using software FigTree v 1.3.1
(Rambaut 2009).
J. Res.Lepid.4
re s u l t s
Oeneis tanana A. Warren & Nakahara, sp. nov.
(Figs. 1, 3-4, 6a-c)
Zoobank LSID: urn:lsid:zoobank.org:act:AC40896F-1D0B-4090-
A52F-94EBD739D62F
M AL E . Head: Eyes brownish, naked; labial palpi (Figs. 3d,e) first
segment short, covered with long dark-brown hair-like modified scales
ventrally, 3-4 times as long as segment width, white scales laterally,
longer white hair-like scales dorsally; second segment similar to first
in scale orientation, about three times longer than first segment; third
segment similar to first and second segments in scale orientation,
shorter than first segment in male, same length in female; antennae
approximately two-fifths length of forewing costa, 40 segments
(n=1), pedicel about half as long as scape, with distal 15-16 segments
comprising club. Thorax: Dorsally black, covered with golden hair-
like modified scales; ventrally black, golden hair-like modified scales
sparse. Legs (Figs. 3b,c): Foreleg tarsus slightly longer than tibia,
femur slightly shorter than tibia; midleg and hindleg similar in length;
femur black, adorned with long dark-brown hair-like modified scales
ventrally, greyish scales scattered dorsally; tarsus and tibia of midleg
and hindleg covered with greyish scales, dark brown hair-like modified
scales present on distal half of tibia, tibia and tarsus adorned with
spines, pair of relatively short tibial spurs located at ventral side of distal
end of tibia. Abdomen: Eighth tergite elongated, approximately 1.5
times longer than seventh tergite, dorsal surface apparently weakly
sclerotized; eighth sternite small, approximately two-thirds length of
seventh sternite, apparently uniformly sclerotized.
Genitalia (Figs. 4a-e): Tegumen shaped somewhat like a
‘megaphone’ in lateral view, dorsal margin of tegumen slightly
concave; uncus tapered towards end, slightly curved in lateral
view, curved posterior end of uncus rounded in lateral view,
slightly longer than dorsal margin of tegumen in lateral view,
dorsally seteous; brachia almost pararell to uncus in dorsal view,
apex slightly hooked, roughly half length of uncus; ventral arms
of tegumen partially fused to anterior margin of tegumen, thus
form of anterior edge of tegumen somewhat like a plate in dorsal or
posterior view; appendix angularis present; saccus relatively short,
similar in length to brachia, dorsal arms of saccus combined with
ventral arms of tegumen; juxta present; valva with scattered setae,
positioned at approximately 30º angle to horizontal, distal half of
valva roughly trapezoidal in lateral view with angular apex, ‘tooth’
present at middle section of dorsal margin of valva in lateral view,
mi dd le se ct ion of ven tr al ma rg in of va lv a co nv ex i n l at er al vi ew, ba sa l
one third of dorsal margin concave; aedeagus similar in length to
tegumen plus uncus, almost straight in lateral view, adorned with
a variable number of short spins, open anterodorsally.
Wing venation and shape (Fig. 3a): Mean forewing length =
26.7 mm (n = 20). Forewing recurrent vein absent; basal swelling of
forewing cubital vein absent; hindwing humeral vein developed; shape
typical of other members of the O. chryxus complex. Wing pattern
(Figs. 1a-l): Dorsal forewing ground color dark brown; androconial dark
scales approximately 1mm in width, present at distal end of discal cell
along cubital vein, base of cells M3, Cu1 and Cu2; color and density
of androconial scales highly variable; black submarginal ocellus in
cell M1 often with indistinct creamy pupil in center; submarginal
ocelli variably present in cells M3, Cu1, with or without pale pupils;
submargin and margin of forewing variably overscaled with reddish or
pale ochre, sparse or absent over and adjacent to wing veins, creating
a series of irregularly-shaped patches separated by dark wing veins;
f ri ng e sc a les wh it e a nd gr ey is h. Dorsal hindwing ground colour same as
forewing, with variable intensity of reddish or pale ochre overscaling;
bl ac k o cel lu s i n c el l Cu 1 variable in development, from bold to absent,
often with indistinct creamy pupil in center; fringe scales white and
greyish. Ventral forewing ground colour greyish-ochre; costal region
(area basal to subcostal vein) mosaic of black and white, extending
to apex, then along margin to cell R5, and variably to cells M2 or M3;
numerous dark brown fragmented markings in discal cell, dark brown
streak along M2-M3; dark brown undulating band extending from
costa, distal to discal cell, fading distally in cell M2, curved inwards
bel ow M3 and ex tendi ng to c ell Cu 2; bla ck ocellu s in cell M1 generally
with creamy pupil in center; ocelli in cells M3 and Cu1 va r iab ly pr es ent ,
smallest in M3, with or without pale pupil; outer margin of forewing
darker; fringe as described for upperside. Ventral hindwing ground
colour indiscernible; wing veins highlighted with a variable amount
of whitish scaling; costal region (area above subcostal vein) mosaic of
black and white, extending along length of costa; pattern elements as
follows, from base to distal margin: basal area mosaic of dark brown
irregular markings with dark ochre background, followed by a whitish
area with sparse dark brown irregular markings; dark brown sinuate
band extending from costa to outer margin, approximately 1mm in
width, roughly traversing in an outward direction until cubital vein,
then roughly inward below cubital vein; area distal to this band mosaic
of dark brown irregular fragmented markings with dark ochre and/
or greyish white ground colour; second dark brown sinuate band
extending from costa to outer margin, similar in width to previous
band, roughly traversing in outward direction until origin of M3,
then roughly inward below this point; area distal to this band broadly
white, wider than previous band; area distal to this (submargin and
margin) mosaic of dark brown irregular fragmented markings with
dark ochre and/or greyish ground color, darkest along margin; trace
of pale submarginal ocelli variably present in cells Rs, M1, M2 a nd M3,
black ocellus in cell Cu1 variably present, often with creamy pupil in
center; fringe as described above.
FEMALE. Similar to male, except as follows: foretarsus not
segmented although adorned with spines; mean forewing length =
26.9 mm (n = 10); wing shape rounder and broader, lacking forewing
androconia and surrounding darkened area. Genitalia (Figs.
4f-h): Lamella antevaginalis well developed, vertical projection
under ostium bursae present and sclerotized, anterior portion of
lamella antevaginallis forming a plate below this vertical projection;
weakly sclerotised ventral region present in seventh and eighth
intersegmental membrane, apparently fused with anterior portion
of lamella antevaginalis; most of ductus bursae sclerotised; ductus
seminalis located at base (posterior end) of corpus bursae; corpus
bursae roughly oval, extending to third abdominal segment;
two brown signa located at ventral side of corpus bursae, signa
prominent and parallel to each other, spines of signa developed.
COI ‘Barcode’ sequence: voucher s CCDB -0578 6 D08 ,
KWP:Ento:29760, NVG-5202, NVG -5203, 658 base pairs:
AACTTTATATTTTATTTTAGGAATTTGAGCAG
GTATAGTAGGAACATCTCTTAGTCTTATTATTC
GAACAGAATTAGGTAACCCAGGATCTTTAATTG
GAAATGACCAAATTTATAATACTATTGTTACAGCT
CATGCTTTTATTATAATTTTTTTTATAGTTATAC
CAATTATAATTGGGGGATTTGGAAATTGACTAAT
TCCTCTAATACTTGGAGCCCCTGATATAGCCTTC
CCCCGAATAAATAATATAAGATTTTGACTTTTAC
CCCCTTCTTTGATACTTTTAATTTCAAGCAATAT
TGTTGAAAATGGAGTAGGAACAGGATGAACAATT
TACCCCCCTCTCTCATCTAATATTGCCCATAGAG
GATCTTCTGTTGATTTAGCAATTTTTTCTTTA
CATTTAGCTGGAATTTCTTCTATTTTAGGAGCT
ATTAATTTTATTACAACAATTATTAATATACGAAT
TAATAATATAACTTATGATCAAATACCTTTATTT
GTTTGAGCTGTAGGAATTACAGCTTTATTATT
ATTACTCTCTCTTCCTGTATTAGCTGGGGCAAT
CACTATACTTCTTACAGATCGAAATTTAAATACT
TCATTTTTTGATCCAGCAGGAGGGGGAGACCCT
A T T TT AT AT C A A CA TT TA TT T
5
49: 1-20, 2016
Figure 1. Males (a-f) and females (g-l) of Oeneis tanana from the type locality, 5 mi. S of Tok, Alaska, showing individual variation
observed in the population. Each specimen is gured in dorsal (left) and ventral (right) views. HT = holotype. Specimens
collected by M. Douglas (a-e, g-k, 17-18 June 1999) and J. Harry (f, 10 June 1999; l, 17 June 1999), in MGCL.
Type s. Holotype male (Fig. 1c) with the following labels: white,
printed: AK: TANANA VALLEY / 5 MI. S. OF TOK, TOK / CUT-
OFF AT BUTCH / KUTH RD. VI-17-18-99 / LEG. M.G.Douglas /;
white printed: J. D. Turner ex / Malcolm Douglas / colln. / MGCL
Accession # 2009-26 /; red, printed: HOLOTYPE / Oeneis tanana
/ A. Warren & Nakahara /. The holotype is deposited in the
McGuire Center for Lepidoptera and Biodiversity, Florida Museum
of Natural History, University of Florida (MGCL). Paratypes
(326, 79) from: USA: ALASK A: Alaska Hwy., mi. 1270, 2000’,
11-VI-1999, J. L. Harry (9, 1MGCL); Alaska Hwy. (Hwy. 2),
mi. 1289.55, 63°13,9’N 142°17.9’W, 1800’, 15-VI-1997, C. D. Ferris
(13, 1 CDF); Alaska Hwy., mi. 1289.55, Midway Lake, gravel
fla ts on h il ls ide abov e ro ad , 15 -V I- 199 7, K . W. Ph il ip ( 7, 2 KWP;
UAM100190535-UAM100190543); Alaska Hw y., mi. 1316, 20-VI-
19 55, J. & F. P re sto n (1 MGCL); Alaska Hwy. (Hwy. 2), mi. 1354.2,
1800’, 63°35’N 143°55’W, 15-VI-1995, C. D. Ferris (2 CDF); Alaska
Hw y., mi . 1371 , 28 -V I- 197 0 (1 MGCL); Alaska Hwy. (Hwy. 2), mi.
1410, 1250’, 61°56.7’N 145°23.7’W, 15-VI-1995, C. D. Ferris (1,
1 CDF); Alaska Hwy., mi. 1410, Spruce Road, powerline cut in
taiga, grass and flowers, 1240’, 17-VI-1997, K. W. Philip (2 KWP;
UAM100060877, UAM100060878); Alaska Hwy., mi. 1410, 12 mi.
SE De lta Jct ., 120 0’, 15-V I- 20 01, J. L . H ar ry (1 MGCL); Anderson,
1 mi. E, 500’, 4-VI-1999, J. L. Harry (1, MGCL); Hwy. 1, 5 mi. S
Tok, 1700’, 10-VI-1999, J. L. Harry (18, 2 MGCL); 12-VI-1999,
J. L. Harr y (21 MGCL); 13-VI-1999, J. L. Harry (13 MGCL);
17-VI-1999, J. L. Harry (26, 6 MGCL); 18-VI-1999, J. L. Harry
(1, 1 MGCL); Hwy. 1, 5 mi. S of Tok, 1700’, 63°16’N 143°02’W,
13 -V I- 199 5, C . D. Fer ri s (2 , 1 MGC L S N- 15- 145 -, SN-15-155-,
SN-15 -149-); 1 4- VI -19 95, C . D . Fer r is ( 8 MGCL; incl. SN-15-147,
SN-15 -154, SN-15-156, SN-15-157); 14-15-VI-1995, C. D. Ferris (46,
17 CDF); 6-VII-1995 C. D. Ferris (1 MGCL, SN-15-151); Hwy. 1,
5.0 ± 0.5 mi. S of Tok, [1700’], 63°16.04’N 143°01.9’W, 5-VI-1997, C.
D. Ferris (1, 1 CDF); 14-VI-1997, C. D. Ferris (52, 21 CDF);
1-VII-1997, C. D. Ferris (3, 4 CDF); Nenana, 400’ [351’], 4-VI-
1999, J. L. Harry (6 MGCL); 6-VI-1999, J. L. Harry (1 MGCL);
Northway Airport, 1700’, 11-VI-1999, J. L. Harry (1 MGCL);
J. Res.Lepid.6
Northway Airport, 7 mi. off Alaska Hwy., flower-filled lawns and
fields, 1700’, 15-VI-1997, K. W. Philip (1 KWP UAM100190552);
Old Alaska Hwy., 3 mi. NE Tok, 1600’, 12-VI-1999, J. L. Harry (2
MGCL); Richardson Hwy., mi. 229 [vic. Black Rapids], [2083’],
26-VI-1971, C. D. Ferris (1 CDF); Tanana River, 21 mi. SW
Fairbanks, 400’ [Bonanza Creek Experimental Forest], 18-V-1997,
J. L. Harry (1 MGCL); Tanana Valley, 5 mi. S of Tok, Tok Cutoff
at Butch Kuth Rd., 17-18-VI-1999, M. Douglas (53, 7 MGCL);
Tok, 17-VI-1971, L. Jennings (1 KWP; UAM100379347); 9-VI-
2005, Szymczyk (1 JPB); Tok Cutoff, 5 mi. S of Tok, Butch Kuth
Ave., roadside flowers in open aspen/spruce forest, 13-VI-1995,
K. W. Philip (11, 3 KWP; UAM100379326-UAM100379329,
UAM100379344-UAM100379346, UAM100379367-
UAM100379369, UAM100379384 -UAM100379387); 14-VI-1995,
K. W. Philip (25, 3 KWP; UAM100379330-UAM100379343,
UAM100379370-UAM100379383).
Additional material examined
Oeneis tanana : “nr. Nome, Alaska”, no date, no collector
indicated (1 MGCL). This specimen was not included in the type
series, since it is the only known specimen of O. tanana labeled
from outside the Tanana River drainage, and it lacks the collection
date and name of the collector; we suspect it is mislabeled.
Considerable collecting efforts have been made in the Nome area,
yet no material of O. tanana has been reported.
Oeneis chryxus : CANADA: BRITISH COLUMBIA (74, 29):
Alaska Hwy. km. 600, 11-VII-1984, J. & F. Preston (1 MGCL);
Alaska Hwy., mi. 392, mountain S of Summit Pass, 4000-7000’,
22-VII-1948, W. Hovanitz (1 MGCL); Alaska Hwy., mi. 400,
Summit Lake, 4200-5000’, W. Hovanitz (2, 2 MGCL); Alaska
Hwy., mi. 409, McDonald Ck., 6-VII-1948, W. Hovanitz (2
MGCL); Alaska Hwy. mi. 415, Racing R., 6-VII-1948, W. Hovanitz
(4 MGCL); Alaska Hw y., MP 417, 18-VI-1970, A. O. Detmar (1
MGCL); Atlin, 600-900m, 22-VI-1991, J. Reichel (1, 1MGCL);
Atlin, 800m, 26 -VI-1991 (1 MGCL); 23-VI-1991 (1 MGCL);
Atlin Rd., 3 mi. N of Atlin, 2300’, 30-VI-1985, C. D. Ferris (4,
CDF); Atlin Rd., 3 mi. N of Atlin to Snafu Creek, 30-VI-1985, C.
D. Ferris (1 CDF); Coalmount, 5-VII-1968, S. Shigematsu (4
MGCL); Crater Mtn., W of Keremos, 1-VII-1981, C. D. Ferris (2
CDF); Creston, Thompson Pk., 15-VII-1976 (3 MGCL); Gibson
Pass, Manning Park, 5000’, 16-VII-1979, C. Guppy (2 MGCL);
23-VII-1983 (1 MGCL); Haines Hwy., mi. 78, 4 -VII-1971, C. D.
Ferris (7, 1CDF); Jct. of Cassiar Hwy. & Boya Lake Rd., 2200’,
10-VI-1986, C. D. Ferris (12, 4 CDF); Kelly Lake – Canoe Creek
Rd., nr. Jesmond, 3100- 4400’, 23-VII-1984, J. & F. Preston (2
MGCL); 24-VII-1984, J. & F. Preston (1, 1 MGCL); [Manning]
Pa rk , 50 00 ’, Va ll ey V ie w, 7- VI I- 196 1, H. K im mi ch ( 1 MGCL); Mt.
Princeton, 29-30-V-1964, H. Kimmich (1 MGCL); Otter Lake
C.G., nr. Princeton, 9-VII-1976 (2, 1 MGCL); Pavilion – Kelly
Lake Rd. at Diamond S Ranch, N of Lillooet, 3900’, 24-VII-1984,
J. & F. Preston (1 MGCL); Pavilion – Kelly Lake Rd., 8.5 mi. N
Pavilion, 4300’, 24-VII-1984, J. & F. Preston (2, 3 MGCL); Pink
Mtn., halfway up, on road to lookout, 4-VII-1985, C. D. Ferris (2
CDF); Pink Mtn., mi. 147, Alcan Hwy., 9-VII-1978 (2 MGCL):
Pink Mtn., mi. 147, Hwy. 97, 5000’, VI-VII-1980, N. Tremblay (1
MGCL); Princeton, 27-VI-1966 (1 MGCL); Princeton, Cardinal
Ranch, 27-VI-1966, B. Weber (1 MGCL); Stagleap Cyn., Kootenay
Dist., 27-VII-1987, D. L. Bauer (1 MGCL); Summerland area,
Okanagan Valley, 25-VI-1983, J. Reichel (1 MGCL); Tompson
Mt., Kootenay Dist., 25-VII-1981, D. L. Bauer (2 MGCL); 5 mi. S
Clinton, 26-VI-1964 (14, 5 MGCL).
YUKON TERRITORY ( 317, 149): Alaska Hwy., bog nr.
Johnson’s Crossing, 22-VI-1948 (1, 1 MGCL); Alaska Hwy.,
mi. 825, 15-VI-1957, J. & F. Preston (1 MGCL); Alaska Hwy.,
mi. 895-900, nr. Whitehorse, 22-VI-1948 (1 MGCL; SN-15-152);
Alaska Hwy., mi. 976, nr. Mendenhall, 23-VI-1948 (2 MGCL);
Campbell Hwy., km. 521, 1800’, 12-VI-1979, J. & F. Preston (1
MGCL); Campbell Hwy., km. 533, 1700’, 12-VI-1979, J. & F. Preston
(13, 10 MGCL); Campbell Hwy., km. 563, 1400’, 12-VI-1979,
J. & F. Preston (1 MGCL); Campbell Hwy., km. 564 -568, nr.
Carmacks, 62°03’54.24’’N 135°57’00.94”W, 560- 650m, 11-VI-
2008, M. Cesanek (15, 5 MC); Carcross Desert area, Hwy. 2
(Klondike Hwy.), in open woods at desert edge, 2170’, 60°14’14’’N
134°41’41’’W, 29-VI-1985, C. D. Ferris (10, 2 CDF ); Daw so n, 13 -
VI-1911, ex Barnes coll., “holotype” of “yukonensis” (1 MGCL);
14-VI-1911, ex Barnes coll., “allotype” of “yukonensis” (1 MGCL);
10 -V I- 1981, N. Tr emb la y (3 0, 8 MGCL); Dawson Hwy., mi. 12.6,
16-VI-1962, J. Legge (1 MGCL); Dawson-Mayo Loop, mi. 69, W
of Whitehorse, 21-VI-1970, D. Eff (2 MGCL); Dempster Hwy.,
mi. 10, 10-VI-1981, J. Johnstone (1 MGCL; 1 OSUC 618404);
10-VI-1981, N. Tremblay (22, 4MGCL; 3, 9 OSUC 618391-
618 39 9, 6 184 01- 618 40 3); 10 -1 1-V I- 1981 , N. Tre mbl ay ( 2 MGCL);
11-VI-1981, N. Tremblay (4, 2 MGCL; 1 OSUC 618379);
19-VI-1981, N. Tremblay (1 MGCL); VI-VII-1981, N. Tremblay
(3 MGCL); 10-VI-1982, N. Tremblay (1 OSUC 618428); no
date, N. Tremblay (1OSUC 618405); Dempster Hwy., mi. 45-
97, 14-VI-1981, N. Tremblay (1 MGCL); Dempster Hwy., mi.
84, 11-VI-1981, N. Tremblay (18, 4 MGCL); Dempster Hwy.,
mi. 96, 23-VI-1981, N. Tremblay (2 MGCL); Dempster Hwy.,
mi. 97, 14-VI-1981, N. Tremblay (1 MGCL); Dempster Hwy., mi.
?, 18-VI-1981, N. Tremblay (1 MGCL); 6-VI-1984, N. Tremblay
(1 MGCL); Haines Jct., 6-VI-1966 (1 MGCL); 9 -VI-1966 (4
MGCL; incl. SN-15-158); 10-VI-1966 (1 MGCL); 12-VI-1966 (3
MGCL; incl. SN-15-161); 13-VI-1966 (1 MGCL); 16-VI-1966 (1,
1 MGCL); 17-VI-1966 (1MGCL); 21-VI-1966 (2 MGCL); 22-
VI-1966 (1 MGCL); 24-VI-1966 (1, 1MGCL); 25-VI-1966 (4,
1 MGCL; incl. 3 SN-15-160, SN-15-159, SN-15-146); 28-VI-1966
(1 MGCL); 29-VI-1966 (9, 4 MGCL; incl. 1 SN-15-148);
1-VII-1966 (1, 1 SN -15 -16 9 M GC L); 12 -V I-1 967 (2, 1 MGCL);
14-VI-1967 (1 MGCL); 18-VI-1967, obtained from J. Ebner (1,
CDF); 19-VI-1967, J. A. Ebner (1 MGCL); 21-VI-1967, J. A. Ebner
(1 MGCL); 23-VI-1967, J. A. Ebner (1 MGCL); 24-VI-1967, J.
A. Ebner (1 MGCL); 27-VI-1967, obtained from J. A. Ebner (2
CDF); 9-VI-1968 (1 MGCL); Haines Rd., mi. 87, 30-VI-1966 (1
MGCL); Horse Creek, mi. 12.6 Dawson-Mayo Loop, 24-VI-1964,
A. H. Legge (2, 1 MGCL); 24-VI-1964, D. Eff (5, 4 MGCL);
Hwy. 7, Atlin Rd., 2100’, 29-VI-1985, C. D. Ferris (1 CDF); Hwy. 11
(Silver Trail), km. 31.5 (SW of Mayo), 27-28-VI-1985, C. D. Ferris
(9, 3CDF); 4-VI-1987, C. D. Ferris (2, CDF); 6-VI-1991, C. D.
Ferris (10, 3CDF); Jubilee Mtn., 1000 -1500m, 5-VII-1977, A.
Reif (1, 1 MGCL); Klondike Hwy., mi. 132, N of Yukon River,
20-VI-1975, D. K. Parshall (1 OSUC 618388); Lake Laberge, 30
mi. N Whitehorse, 10-VI-1985, J. & L. Troubridge (4 MGCL);
14-VI-1985, T. Kral (4 MGCL); 15-VI-1985 (2 MGCL); 18-
VI-1985, T. Kral (2 MGCL); Lake Laberge, Hwy. 2, 46.4 km.
N Whitehorse, 11-VI-1981, D. K. Parshall (1OSUC 618439);
1-VII-1981, D. K. Parshall (1 OSUC 618442); 1-VII-1982, D. K.
Parshall (2 OSUC 618390, 618441); 11-VII-1982, D. K. Parshall
(1m O SUC 618 44 0) ; 14 -V I-1 983 , D. K. Pa rsha ll (9 OSUC 618327,
618408-618415); 15-VI-1983, D. K. Parshall (1 OSUC 618322);
23-VI-1983, D. K. Parshall (3 OSUC 618378, 618446 -618447);
25-VI-1983, D. K. Parshall (3 OSUC 618443-618445); 14-VII-
1983, D. K. Parshall (3, 2OSUC 618455-618459); 6-VI-1984,
J. P. Ross (2 OSUC 618406 -618407); 12-VI-1985 (4♂, 1 OSUC
618339, 618448-618451); 13-VI-1985, D. K. Parshall (12, 5
OSUC 618324, 618331-618338, 618430-618437); 14-VI-1985, D.
K. Parshall (3 MGCL; 13, 14 OSUC 618323, 618325, 618340-
618354, 618418 -618 427) ; 15 -V I- 198 5, D. K . P ar sha ll (5, 5OSUC
618321, 618326, 618328, 618355-618359, 618453-618454); 16-VI-
1985, D. K. Parshall (4 OSUC 618360- 618363); 18-VI-1985, D.
K. Parshall (6 OSUC 618364 -618368, 618452); 19-VI-1985, D.
K. Parshall (1, 4 618369-618373); 20-VI-1985, D. K. Parshall
7
49: 1-20, 2016
Figure 2. Males (a-e) and females (f-j) of Oeneis chryxus from Yukon Territory, Canada, and males (k-l) and females (m-n) of
O. bore from Alaska (f-g) and Yukon Territory (m-n), in MGCL. Each specimen is gured in dorsal (left) and ventral (right) views.
Oeneis chryxus from Yukon Territory: a, nr. Snafu Lake on Atlin Rd., 2600’, 7 June 1991, J. & F. Preston; b, Dempster Hwy., mi.
97, 14 June 1981, N. Tremblay; c, Dempster Hwy., mi. 10, 10 June 1981, N. Tremblay; d,i,k,l, Campbell Hwy., km. 533, 12 June
1979, J. & F. Preston; e,j, 0.8 mi. N of Lewes Lake Rd. on Hwy. 2, 6 June 1991, J. & F. Preston; h, Whitehorse, 11 June 1966.
Oeneis bore from: f, Murphy Dome, 17 June 1972, J. & F. Preston; g, Murphy Dome, 16 June 1999, M. Douglas; m, Dempster
Hwy., mi. 97, 17 June 1981, N. Tremblay; n, Dempster Hwy., mi. 96, 24 June 1981, N. Tremblay.
(4 618374-618377); Lake Laberge, Hwy. 2, mi. 29, 3-VI-1985,
J. Zeligs (1 MGCL); 18-VI-1985, J. Zeligs (1 MGCL); Mts. SW
of Haines Jct. (5-18 mi.), 3-4000’, 22-VI-1967 (1 MGCL); N of
Stewart Crossing, Hwy. 2, 22-VI-1983, [D. K. Parshall] (3, 5
OSUC 618330 [*this specimen with O. tanana barcode, Fig. 10c
-d], 618380-618386); N of Stewart Crossing, Klondike Hwy., mi. 24,
20 -V I -197 5, D . K . Pa rs ha ll (2 OSUC 618329 [*this specimen with
O. tanana barcode, Fig. 10a -b], 618389); nr. Snafu Lake on Atlin
Rd., 2600’, 7-VI-1991, J. & F. Preston (4 MGCL); St. Elias Mts.,
Nickel Ck., 14-VI-1985, B. Grooms (1 MGCL); Stewart Crossing,
Klondike Loop Rd., 1600’, 13-VI-1979, J. & F. Preston (1, 2
MGCL); Twin Lakes, Hwy. 2, km. 115, 14-VI-1983, D. K. Parshall
(2 OSUC 618416-618417); 28-VI-1983, D. K. Parshall (1 OSUC
618438); Whitehorse, 10-VII-1919, “paratype” of “yukonensis” (1
MG CL ); 6 - 9- VI -1 923 (1 MG CL) ; 8 -V I- 192 3 (1 MGCL); 9-VI-1923
(2 MGCL); 17-VI-1923, J. Kusche (2 MGCL); 8-VI-1966 (1
MG CL ); 9 -V I -19 66 , H. Ebn er ( 1 M GC L); 10 -V I-1 96 6 (1 MGCL);
11-VI-1966 (1 MGCL); 13-VI-1966 (1 MGCL); 2-VI-1982 (1
OSUC 618429); 1-VII-1982, B. Grooms (1 MGCL); Whitehorse,
2500’, 24-VI-1981, G. Anweiler (1 CDF); 8-10-VI-1982, J. P. Ross
(3, 5 CDF); Whitehorse, Baxter coll. (1 MGCL); Yukon Hwy.
2 (from Skagway, AK), km. 126, 2550’, 6-VI-1991, J. & F. Preston
(5 MGCL); 0.8 mi. N of Lewes Lake Rd. on Hwy. 2, 2700’, 6-VI-
1991, J. & F. Preston (6, 1 MGCL); 1.4 mi. S of Lewes Lake Rd.,
J. Res.Lepid.8
W of Hwy. 2, 2550’, 6-VI-1991, J. & F. Preston (1, 1MGCL);
20 m i. S Bur wash Landing, 1-VII -1948 (1 MG CL SN-15-150);
“A lask a” [ old sp ecime n, m ost likely f rom Wh ite hor se a rea] (1
MGC L). Note: Much of the material from the Haines area,
including that attr ibuted to J. Ebner, was likely collected by
Dr. A. M. Pearson, who collected for Ebner in the Haines area
for several years in the 1960’s.
USA: ALASKA: Eagle, 2-VII-1901, S. Hall Young (1
MGCL); 27-VI-1903, Reed Heilig, “paratype” of “yukonensis”
(1 MGCL); Kathul Mtn., N side Yukon River, 6 mi above mouth
Kandik R., 29-VI-1975, E. Holsten (3 KWP; UA M100379423-
UAM100379425); 5-VIII[sic!?]-1975, E. Holsten (1K WP;
UAM100379422).
Etymology. This butterfly is named for the Tanana River,
which flows through southeastern and central Alaska. Tanana
is a Koy ukon (At habascan) word meaning “trail river”, though
the term is also applied to an Athabaskan indigenous group
(Bright 2004).
Diagnosis. A dult s of O. tanana average larger than those of
Yukon O. chr yxus. The mean forewing length of male O. tanana
is 26.7 mm (range 24.6 to 29.4 mm, n = 20), vs. 24.8 mm (range
19.6 to 27.4 mm, n = 20) in Yukon O. chryxus. Females of O.
tanana also average larger, with a mean forewing length of 26.9
mm (range 24.9 to 31.3 mm, n = 10), vs. 26.1 mm (range 21.0
to 29.1 mm, n = 10) in Yukon O. chryxus. Adults of O. tanana
can usually be identif ied by the following trait s, compared to
Yukon O. chryxus: 1) larger size, 2) darker overall upperside
colorat ion, wit h paler areas dark ochre or reddish, 3) darker
ventral forewing coloration, 4) bolder dark ventral hindwing
transverse bands, 5) expanded whitish areas on the ventral
hindwing, 6) valvae average more robust. While none of these
individual characters are strictly diagnostic, when considered
together, essentially all specimens can be reliably identified to
t axo n. I n a ddi ti on, adu lt s of O. tanana are separated from those
of Yukon O. chryxus by their unique COI barcode sequences
(but see below), which are identical to those found in adjacent
populations of O. bor e, wit h the exception of a single base-pair
substitution at site 300: G ->A (site number corresponds to the
sequence given above).
Distribution. All localities where O. tanana is confirmed
to occur are within the Tanana R iver Basin, in southeastern
and central Alaska, including the lower north slope of the
Alaska Range (Fig. 7). Available records suggest that O.
tanana is widely distributed in appropriate habitat s throughout
the Tanana River drainage, at least from the Northway area
(Nor thway Airport and Alaska Hwy. mi. 1270), northwest to
Nenana, a roughly 400 km. (250 mi.) range centered along the
Tanana River. Altitudinal records range from 107 m (351’) at
Nena na to 635 m (2083’) along the Richardson Highway (mi.
229) and Delta River, which drains into the Tanana River to the
north. A very small part of the Tanana River Basin extends into
Yukon Territory (Moran 2007), but it is unknown if O. tanana
occurs there. Likewise, it remains unknown how far dow n the
Tanana River Basin O. tanana may occur, or if it occurs along
the Yukon River Basin downstream or upstream of its junction
wit h t he Tanana River at Tanana. Most of this region has not
been surveyed for butterflies. All specimens we have examined
of O. tanana were collected in odd-numbered year s, w ith the
exception of a single female from Alaska Highway mile 1371,
labeled from 1970. No collectors name is provided on the
Figure 3. Morphology of Oeneis tanana from 5 mi. S of Tok, Alaska: a, male wing venation; b, male foreleg; c, female foreleg;
d, male labial palpus; e, female labial palpus. Illustrations by Shinichi Nakahara. Scale bar = 10 mm for a, otherwise 1 mm.
9
label, and the possibilit y of a labeling error cannot be ru led
out. The earliest specimen of O. tanana we have seen is from
18 May (1997, 21 mi. SW Fairbanks), and the latest is from 6
July (1995, 5 mi. S of Tok), w ith most records from the second
and third weeks of June.
Habitat. Adults of O. tanana fly in open, dr y, grassy areas
and clearings in boreal forest. In disturbed areas, they tend to
frequent abandoned roads and trails, undeveloped dirt/gravel
roads (Fig. 8), and power line cuts. They are fairly sedentary and
in response to a disturbance fly short distances, usually in straight
lines, to settle again. The butterflies generally sit on the ground
or perch on rocks, or on low vegetation, with wings folded over
the back unless basking. While colonies are isolated, numerous
individuals are frequently present at occupied sites. Aside from
grasses, sedges and various arctic forbs, the principal vegetation
at the type locality includes black spruce (Picea mariana (Mill.)
B. S. P.), wh ite spr uc e (Picea glauca (Moench) Voss), quaking aspen
(Populus tremuloides Michx.), occasional birch (Betula sp.), and
willows (Salix sp.). Oeneis tanana flies in sympatry with O. jutta
(Hübner, [1806]) at Nenana, Alaska Hwy. mi. 1410, and in the
vicinity of Tok (including at the type locality), and it flies with both
O jutta and O. philipi Troubridge, 1988 at Northway Airport. No
information on the early stages or larval foodplants of O. tanana
is known to date, although grasses and/or sedges presumably
serve as the larval foodplants, as reported for other taxa in the
O. chryxus complex (James & Nunnallee 2011).
dI s c u s s I o n
Like O. chryxus, the genitalia of O. tanana possess
a tooth-like projection of the dorsal margin of the
valva, denticles on the valva in a single series, a
strongly sclerotized ventral swelling of the lamella
antevaginalis, and a left-skewed vertical plate of the
lamella antevaginalis. Lukhtanov & Eitschberger
(2001) noted the rst three of these characters as
diagnostic of the bore group. Based on the presence
of these characters, Oeneis tanana is clearly a member
of the bore group. Despite the phenotypic differences
(adult size and wing color and pattern) between O.
tanana and O. chryxus, the genitalia of these two
species are very similar. Subtle differences in genitalia
of both sexes indicated in Figs. 4-5 apparently reflect
individual variation. To date, we have not identified
any diagnostic characters in the genitalia that serve
to unambiguously separate these two taxa, although
the valvae of O. tanana average somewhat more robust
than those of O. chryxus (Fig. 6), and are generally
49: 1-20, 2016
Figure 4. Male and female genitalia of Oeneis tanana from 5 mi. S of Tok, Alaska: a, male genitalia (SN-15-156) in left lateral
view; b, aedeagus in left lateral view; c, aedeagus in dorsal view; d, eighth tergite in dorsal view; e, juxta in dorsal view; f,
female genitalia (SN-15-151) in dorsal view; g, lamella antevaginalis in front view; h, signa. Illustrations by Shinichi Nakahara.
Scale bar = 1 mm.
J. Res.Lepid.10
slightly larger than those of O. bore. This result is not
surprising, considering the lack of consistent genitalic
differences reported among other North American
members of the bore group. On the other hand, female
genitalia of O. tanana a nd O. chr yxus differ from those
of O. bore by the position of the vertical projection of
the lamella antevaginalis, which is skewed to the left
in O. tanana and O. c hr yxu s. Thus, genitalic characters
suggest that O. tanana is morphologically closer to
O. chryxus than O. bore, although the molecular data
discussed below indicate the opposite.
Very little information on O. tanana is available
in the literature. We are not aware of any previously
published images of adult or immature O. tanana,
other than the very recent images of adults of both
sexes (as O. chryxus caryi) by Philip & Ferris (2015).
Distributional records for O. chryxus in Alaska
provided by Philip (1996, 1998, 2006) and Magoun &
Dean (2000) all refer to O. tanana; we have examined
specimens from all but one of these sites. The only
molecular study that has focused on the chryxus
complex is that by Nice & Shapiro (2001), who studied
haplotype variation in 440 base pairs of mitochondrial
COII among various western USA populations. Many
samples were analyzed from California (O. c. ivallda
and O. c. stanislaus), with others from Idaho, Nevada,
Montana, Utah, Colorado, and New Mexico, as well
as two specimens from Tok, Alaska (all considered
to be O. c. chryxus). The specimens from Tok (now
recognized as O. tanana) were found to possess a
unique haplotype (type ‘E’) not shared with any other
populations in the analysis, but no discussion of this
population or haplotype was provided.
COI barcode analysis and morphology of the chryxus
complex
The dendrogram resulting from our analysis of
COI barcode sequences (Fig. 9) is complex, yet largely
corroborates traditional treatments of the bore group
based on morphology. Oeneis alberta, which was
included in initial analyses, was omitted from our
Figure 5. Male and female genitalia of Oeneis chryxus from Haines Junction, Yukon Territory, Canada: a, male genitalia (SN-
15-158) in left lateral view; b, aedeagus in left lateral view; c, aedeagus in dorsal view; d, eighth tergite in dorsal view; e, juxta
in dorsal view; f, female genitalia (SN-15-169) in dorsal view; g, lamella antevaginalis in front view; h, signa. Illustrations by
Shinichi Nakahara. Scale bar = 1 mm.
11
final tree since it appears polyphyletic, invariably
sharing bore group haplotypes, yet its status as a
species-level taxon, closely related to O. chryxus, has
not been challenged. The close relationship between
O. bore and O. chryxus, as suggested by many authors
based on similarities in the male genitalia (e.g.,
Elwes & Edwards 1893; Gross 1970; Gorbunov 2001;
Lukhtanov & Eitschberger 2001), is corroborated by
our analysis, in that the taxa don’t appear reciprocally
monophyletic. These irregularities in barcodes are
likely a reflection of evolutionary closeness of taxa
within the bore group and are possibly the result of
mitochondrial introgression. This scenario would
presumably explain the placement of O. nevadensis
barcodes as derived within the chryxus complex,
while O. macounii sequences are basal to all of
these. All indications from morphology suggest that
O. nevadensis and O. macounii are sister taxa, and
their close relationship has not been questioned.
Despite being obscured by apparent introgression,
groupings on the dendrogram do appear to be highly
informative, and may be indicative of cryptic diversity
within the chryxus complex.
Oeneis chryxus is di s tribut ed am ong f ive
barcode clusters, which closely correspond with
morphological and biogeographical attributes. The
first group includes the Rocky Mountain O. chryxus
populations, comprising O. c. chryxus, with samples
included from Colorado, Montana, Alberta, British
Columbia, and Yukon Territory (see discussion
below regarding Yu kon mater ial). These s equences
are the least derived of the chryxus complex, as
also indicated for COII by Nice & Shapiro (2001).
Across this range, O. c . ch ryxus shows v ar iou s de grees
of localized morphological diversification, but
barcodes suggest that all of these populations are
very closely related. While not included in this study,
the southernmost Rocky Mountain population, O.
c. socorro, described from Mt. Withington, Socorro
County, New Mexico, appears to be closely related
to typical O. c. chryxus to the north (Holland 2010),
based on morphology, habitat, and distribution,
although an affiliation with O. c. altacordillera (see
below) cannot yet be ruled out.
The second barcode group of the chryxus complex
includes just O. c. valerata. This taxon is endemic
to alpine habitats in the Olympic Mountains of
Washington. While Burdick (1958) cited similar
material from Vancouver Island, we know of no valid
records from there. The presence of this taxon in its
own barcode group suggests it is genetically rather
distinct from other groups in the chryxus complex,
presumably as a result of a long history of isolation
on the Olympic Peninsula.
The third barcode cluster includes the Sierra
Nevadan taxa O. c. ivallda and O. c. stanislaus, together
with a single specimen of O. c. chryxus from Utah.
Many authors have treated the pallid O. c. ivallda as
a species-level taxon while considering O. c. stanislaus
to be a subspecies of O. chryxus, based on its similar
tawny coloration (e.g., dos Passos 1961, 1964; Gross
1970; Murayama 1973; Emmel 1975; Miller & Brown
1981; Pyle 1981; Garth & Tilden 1986; Tilden & Smith
1986). These taxa were studied in detail by Porter &
Shapiro (1991) and Nice & Shapiro (2001), who found
that they are very closely related, clearly conspecific as
treated by Hovanitz (1937, 1940), and likely resulted
from Pleistocene colonization of the Sierra Nevada via
dispersal from the Rocky Mountains across the Great
Basin. Our results corroborate these conclusions, as
O. c. ivallda and O. c . sta nisl aus are not separable based
on barcode sequences. In addition, the inclusion of
a single Utah specimen in this group is consistent
with the notion that Sierra Nevadan populations
originated through cross-Great Basin dispersal, and
some haplotypes are apparently still shared (Nice &
Shapiro 2001).
The fourth barcode cluster includes the boreal
North American taxa O. c. calais and O. c. strigulosa,
with samples included from Michigan, Ontario and
49: 1-20, 2016
Figure 6. Variation in valvae of Oeneis tanana and O.
chryxus: a-c, Oeneis tanana (SN-15-145; SN-15-155;
SN-15-157); d-f, Oeneis chryxus (SN-15-158; SN-15-159;
SN-15-160). Illustrations by Shinichi Nakahara. Scale
bar = 1 mm.
J. Res.Lepid.12
Manitoba. These two taxa are very closely related; it
is often not possible to separate them in collections
other than by locality, and barcodes failed to clearly
distinguish them. This group occupies the central
and northeastern North American boreal forests,
from Quebec and Ontario, westward into Northwest
Territories and northern Alberta, and it appears to
be allopatric with respect to the distribution of O. c.
chryxus in Alberta and British Columbia (Bird et al.
19 95 ; Gup py & She pa rd 2 001), altho ugh acce ss to mo st
regions of potential sympatry or parapatry is extremely
limited. As discussed below, the holotype specimen
of O. c. caryi is fairly typical of specimens found in the
western populations of this group. Oeneis. c. calais
(including O. c. strigulosa and/or O. c. caryi) has been
considered a species-level taxon by various authors
(Scudder 1865; Cary 1906; Scott 2006; Kondla 2010).
The fifth cluster of the chryxus complex is the recently
described O. c. altacordillera. This ta xon inhab its hig h-
elevations in the southern Rocky Mountains, generally
above 3048 m (10,000’) elevation, and is frequently
found at or just above treeline. While its overall
Figure 7. Distribution of Oeneis tanana (stars) and O. chryxus (squares) in Alaska and northwestern Canada. Red arrow
indicates the Stewart Crossing area, Yukon Territory, where a few individuals with O. tanana-type COI sequences have been
found (see discussion in text).
distribution remains to be determined, it appears
to be endemic to Colorado and perhaps northern
New Mexico (Warren 2011), yet adults from some
populations in Colorado are not easily assignable to
either taxon based on wing morphology (Scott 2006;
pers. obs. ADW 2015). Given the marked difference in
barcode haplotypes between typical O. c. altacordillera
and O. c. chryxus from lower elevations in Colorado
and elsewhere in the Rocky Mountains (also see Nice
& Shapiro 2001), an extensive barcode survey will likely
resolve questions about the overall distribution of O. c.
altacordillera, as well as the identity of the lectotype of
O. c. chryxus (Shepard 1984; Scott 2010). While Scott
(2006) described O. c. altacordillera as a subspecies of
O. c. calais (which was treated as a species-level taxon),
an arrangement followed but questioned by Kondla
(2010), our results suggest the two taxa are not very
closely related, and that O. c. altacordillera may best be
considered a species-level taxon.
Oeneis tanana is positioned in our dendrogram
(Fig. 9) as the most derived grouping within a clade
of Arctic American O. bore . All five barcode sequences
13
49: 1-20, 2016
Figure 8. Habitat of Oeneis tanana, 8 miles south of Tok,
Alaska, 25 June 2007. Photo by David Shaw.
obtained from Alaskan O. tanana, from three sites in
the Tanana River Valley, were identical, and differ
from those of nearby populations of O . bo re by a single
base-pair at site 300: G->A. This is a non-synonymous
substitution, which translates to a S->N substitution in
protein. The significance of this is not yet known.
Upon searching the BOLD database (Ratnasingham
& Heber t 2007), we found a single sequence
(HBNK245-07) of Oeneis from Yukon Territory that
is a perfect match to those of O. tanana, from along
the Stewart River (and Silver Trail) near Mayo. We
therefore obtained barcodes from five additional
specimens taken nearby, from the vicinity of Stewart
Crossing, approximately 40 km. (24 mi.) southwest
of Mayo, also along the Stewart River. Two of these
specimens, from N of Stewart Crossing” (Fig. 10,
from OSUC) also possess barcodes typical of O.
tanana, while three others, from “Stewart Crossing”
(MGCL) have barcodes like those of other O. chryxus
in Yukon Territory. The two specimens (Fig. 10) with
barcodes typical of O. tanana are fairly dark above,
compared to other O. chryxus from the province (Fig.
2), and have a ventral hindwing banding pattern
reminiscent of Alaskan O. tanana, yet they are smaller
and somewhat tawnier above than most Alaskan O.
tanana. The three specimens with barcodes of O.
chryxus are tawnier above and have a less contrasting
ventral hindwing pattern; they appear typical of other
O. chryxus specimens from the region. A much larger
sampling of barcodes from populations in the area
will be needed to determine if variation in phenotypes
correspond to differences in barcode haplotypes.
The significance of the presence of barcode
haplotypes typical of O. tanana among specimens
from along the Stewart River in Yukon Territory
remains unknown. It could indicate that O. tanana
occurs disjunctly in Yukon Territory, perhaps as a
somewhat smaller and tawnier form, at least along
the Stewart River, in exact or near sympatry with O.
chryxus. It could also indicate that haplotypes of O.
tanana have introgressed into some Yukon populations
of O. c hr yxu s, but that only one phenotypically variable
species actually occurs in the Stewart River area.
Extensive study of populations along the Stewart River
and nearby regions of central Yukon Territory will be
needed to resolve this issue.
Taxonomic status and distribution of Yukon-Alaska
Oeneis chryxus
Oeneis chryxus is widely distributed in Yukon
Territory, with records from even and odd-numbered
years, where it inhabits dry, open barrens and subarctic
steppe (Ferris et al. 1983; Lafontaine & Wood 1997).
Various authors have considered Yukon populations of
O. chr yxus to represent O. c. caryi (Layberry et al. 1998;
Guppy & Shepard 2001), although Burdick (1958)
noted that this is incorrect. The type specimen of
O. c. caryi, as figured by Burdick (1958) and Warren
et al. (2015), is markedly different than any material
we have examined from Yukon Territory, and, other
than the enlarged forewing ocelli, appears to fall
within the normal range of variation seen in the
western populations of O. c. calais. Further studies
are needed to confirm the taxonomic status of O. c.
caryi, although we believe O. c. ca ryi should probably be
considered synonymous with O. c. ca lais ; alternatively,
if O. c. calais is considered to be a species-level taxon,
O. c caryi might be considered its western subspecies,
as implied by McDunnough (1934) and treated by
Kondla (2010).
Thus, the name O. c. caryi does not apply to
populations of O. chryxus in northern British
Columbia, Yukon Territory, or those barely entering
eastern Alaska (see below). While the erection
of a new subspecies name might be justifiable for
these populations, we feel they are close enough to
nominotypical O. chryxus in phenotype to tentatively
associate them with that taxon. The similarity of
COI sequences between Yukon and Rocky Mountain
material to the south (British Columbia, Alberta,
Montana, Colorado) also supports this arrangement,
given that barcodes from Yukon specimens are
extremely similar or identical to those from further
south in the Rocky Mountains.
Oeneis chryxus was first reported from Alaska by
Holland (1900), based on a single female taken at
J. Res.Lepid.14
Figure 9. Dendrogram generated from Bayesian analysis of COI barcode sequences from taxa in the bore group of Oeneis,
with O. norna as the outgroup. See text for details of the analysis. Colored groupings identify taxa and populations discussed
in the text.
15
Eagle City, on 10 July 1899, by Reverend S. Hall Young.
We have examined two male specimens from Eagle,
one collected by Young in 1901, and another collected
by Reed Heilig in 1903, both of which are typical of O.
chryxus found to the east in Yukon Territory. One of
the specimens bears a blue “paratype” label reading
“klondikensis FC”, affixed by Frank Chermock. This
name was never formally proposed, but was apparently
intended to represent O. c. “caryi” of recent authors
(e.g., Layberry et al. 1998; Guppy & Shepard 2001).
The holotype” and “allotype” of “klondikensis”,
which we also examined, are from Dawson, Yukon
Territory, and a second “paratype” we examined is
from Whitehorse. More recently, Guppy & Shepard
(2001) indicated the presence of O. chryxus in the
Alaska Panhandle, in the vicinity of Skagway. While
we have not examined specimens from this area, this
material is likely to be morphologically like adjacent
O. chryxus populations in southern Yukon Territory
and far northwestern British Columbia.
Thus, with the delimitation of O. tanana, it
appears that O. chryxus just barely penetrates into
Alaska from Yukon Territory, along the Yukon River
corridor, where it is known from two sites just 9.5
km. (5.9 mi.- at Eagle) and 60 km. (37 mi.- at Kathul
Mtn.) west of the Canadian border (Fig. 7). Despite
considerable collecting efforts by various researchers
along the Taylor and Steese highways, which traverse
the Yukon-Tanana uplands separating the Yukon and
Tanana rivers, O. chryxus remains unreported from
the region (the record from the central Yukon-Tanana
highlands indicated by Philip and Ferris (2015)
represents a misplaced Kathul Mountain record).
Likewise, O. chryxus appears to barely extend into
the Alaska Panhandle near Skagway, presumably
from widespread populations just to the north in
northwestern British Columbia.
Oeneis tanana appears to be allopatric with respect
to O. chryxus in Alaska, and it might be endemic to
Alaska (but see above). Available records suggest
that Alaskan O. tanana populations are separated
from the nearest known population of O. chryxus in
Alaska (at Eagle) by about 185 air km. (115 mi.), and
are separated from the nearest known population
of O. chryxus in Yukon Territory (at Nickel Creek) by
about 210 air km. (130 mi.).
Hypothesized evolutionary history of Oeneis tanana
The confirmed distribution of Oeneis tanana lies
within the Tanana River Basin in Alaska, most or
all of which was apparently never glaciated during
the last glacial maximum in the late Pleistocene,
roughly 28,000 to 14,000 years ago (Dyke 1999;
Goetcheus & Birks 2001; Harrington 2005). During
this time, the Tanana River Basin, together with the
larger and contiguous Yukon River Basin (including
lower elevations along the Yukon River drainage in
northern and central Yukon Territory) formed the
southeastern limits of eastern Beringia (sensu Elias &
Brigham-Grette 2007), a region widely recognized as
a refugium for many plants and animals during the
glacial cycles of the Pleistocene (e.g., Guthrie 2001;
Pruett & Winker 2005; Geml et al. 2006; Zazula et
al. 2006; Elias & Brigham-Grette 2007; Fritz et al.
2012; DeChaine et al. 2013; Edwards et al. 2014).
The Tanana and Yukon River basins were identified
as distinct sub-refugia during the Pleistocene for two
fish taxa (Stamford & Taylor 2004; Campbell et al.
2015), and four species of trees (Roberts & Hamann
2015), and we believe the region likely served as a
refugium for O. tanana as well.
We hypothesize that during the last glacial
maximum, O. tanana persisted in the Yukon-Tanana
basins, while O. chryxus was isolated in a southern
Rocky Mountain refugium, similar to what has
been documented for Rhodiola integrifolia Raf.
(Crassulaceae) (DeChaine et al. 2013). Under this
scenario, O. chryxus dispersed northward along
the Rocky Mountain cordillera as the ice sheets
retreated, while O. tanana remained within the
Yukon-Tanana basins. This scenario is supported
by the close similarity of COI barcode haplotypes
among cordilleran O. chryxus from Colorado to
Yukon Territory (also see Nice & Shapiro 2001),
and uniqueness of O. tanana haplotypes, although
the possibility of isolated refugia for O. chryxus in
the northern Rocky Mountains cannot be ruled out
(Marr et al. 2008; Savidge 2012). We hope that this
hypothesis will be investigated in the future in a
detailed phylogeographic study.
Given the similarity of COI haplotypes between
O. tanana and Arctic American populations of O.
bore, introgression between the two taxa has likely
occurred, perhaps during the Pleistocene. Although
adults of O. tanana average consistently larger than
those of nearby O. bore, the ventral hindwing pattern
of O. tanana is often inseparable from that of O. bore,
due to the bold transverse bands and broad whitish
areas bordering them. The dark dorsal coloration of
O. tanana is also suggestive of O. bore. While overall,
the morphology of O. tanana is seemingly closer
to that of O. chryxus than to O. bore, these traits, as
well as the COI haplotypes, suggest some degree of
influence from O. bore. While much additional study
is required, we feel it is possible that O. tanana could
have evolved through hybridization between O. bore
and O. chryxus; this highly speculative hypothesis
49: 1-20, 2016
J. Res.Lepid.16
should be tested through molecular studies. While
such a mode of speciation is widely accepted in plants
(e.g., Soltis 2013), it has only recently been seriously
investigated in animals, including butterflies (Gompert
et al. 2006; Mavárez et al. 2006; Mallet 2007; Kunte et
al. 2011; Abbott et al. 2013; Dupuis & Sperling 2015;
Lukhtanov et al. 2015).
Taxonomic rank for Oeneis tanana: species or
subspecies?
The last two new “species” of Oeneis described from
North America (Troubridge et al. 1982; Troubridge &
Parshall 1988) have proven to be very closely related to
or conspecific with described taxa in the northeastern
Palearctic region. Oeneis excubitor Troubridge,
Philip, Scott & J. Shepard, 1982 has been treated as
a subspecies of O. alpina Kurentsov, 1970 by most
subsequent authors (Scott 1986; Lafontaine & Wood
1997; Layberry et al. 1998; Warren et al. 2015). Oeneis
philipi has apparently close relatives in the northeastern
Palaearctic, sometimes called O. rosovi Kurentsov, 1970,
a name that has been applied as a senior synonym of
O. philipi (Lafontaine & Wood 1997; Lafontaine &
Troubridge 1998; Layberry et al. 1998). However, as
noted by Lukhtanov (1989), the two syntypes of O.
rosovi appear to represent two different species, so until
a lectotype is designated, the application of this name
to any populations remains problematical (Pelham
2008). Oeneis tanana, in contrast, does not appear to
have any close relatives in the Palaearctic; its overall
morphology and COI haplotypes clearly place it within
the bore group, apparently most closely related to the
entirely Nearctic chryxus complex.
When we init iated this project, we held no
preconceived notions about the taxonomic rank of O.
tanana. All we knew, based on overall morphology of
large series of adults, is that they were different from
O. chryxus in Yukon Territory. As our investigation
progressed, and molecular and biogeographic
information was analyzed from other members of the
chryxus complex, we eventually determined that, based
on currently available information, O. tanana is best
considered a species-level taxon. The apparent lack
of discrete genitalic characters to separate O. tanana
from other members of the chryxus complex is not
surprising in the genus Oeneis, since closely related
species frequently cannot be reliably distinguished
via genitalic morphology (e.g., Troubridge & Parshall
1988). While O. tanana is apparently allopatric with
respect to O. chryxus in Alaska, its barcode haplotype
is quite distinct from those found in cordilleran O.
chryxus, and almost all adults examined from Alaska
are easily separated from Yukon-Alaska O. chryxus
based on their wing morphology. Only the very
smallest and tawniest Alaskan individuals of O. tanana
(e.g., Fig. 1e,k) can pot ent ially be m ista ken fo r Yu kon -
Alaska O. chryxus. Yet in these situations, O. tanana
tends to have bolder ventral hindwing markings than
what is normally seen in Yukon-Alaska O. chryxus.
However, many q ues tion s rem ai n ab out the ov erall
distribution of O. tanana with respect to O. chryxus.
The apparent gap of 210 km. in distributions of the two
taxa along the Alaska Highway centered on the Yukon
Alaska border should be carefully studied for the
possible occurrence of either species or intermediate
forms. Likewise, additional surveys along the lower
Tanana River, and along the Yukon River downstream
of the Kathul Mountain area in Alaska should be
conducted to detect the possible occurrence of
members of the complex. In addition, populations
along the Yukon River and its tributaries in Yukon
Territory should be carefully studied and barcoded to
determine the significance of O. tanana barcodes in
the region. Thus, future studies could reinforce our
hypothesis that O. tanana represents a species-level
taxon, or they could indicate that subspecies-level
status for O. tanana may be more appropriate.
While much additional study of the O. chryxus
complex, employing multiple genetic markers and
additional surveys in remote regions, will be required
to fully understand relationships within the group, our
Figure 10. Male Oeneis from north of Stewart Crossing,
Yukon Territory, Canada, possessing COI barcode
sequences typical of Alaskan O. tanana: a-b, 20 June
1975, D. K. Parshall, OSUC 618329; c-d, 22 June 1983,
D. K. Parshall, OSUC 618330. Photos courtesy of Luciana
Musetti.
17
results suggest that O. chryxus of most contemporary
authors may comprise five species-level taxa: O. chryxus
(including O. c. ivallda, O. c stanislaus, O. c. chryxus,
and presumably O. c. socorro), O. calais (including O.
c. strigulosa and O. c. caryi), O. valerata, O. altacordillera
and O. tanana, with O. tanana apparently being the
most distinctive of them all, morphologically. It is also
possible, based on available data, to argue that the Sierra
Ne va da n t ax a (O. c . i val lda and O. c s tani slaus) represent
a sixth species-level taxon, closely related to O. chryxus.
On the other hand, the main groupings in the
chryxus complex can be interpreted as subspecies-level
taxa, depending on one’s species concept; indeed,
none of them appear to be sympatric in distribution,
with the possible exceptions of O. c. chryxus and O. c.
altacordillera in Colorado, O. c. chryxus and O. c. calais
in Alberta, and O. chryxus and O. tanana in Yukon
Territory. Under this scenario, O. chryxus would
be considered a diverse array of mainly allopatric
populations, each of which possessing unique genetic
attributes and sometimes highly divergent wing
morphologies, distributed across a broad range of
habitat types and biogeographical regions in North
America. However, as noted above, recent authors
have treated O. c. calais (including O. c. strigulosa and
O. c. caryi) as a species-level taxon, which our results
suggest is a reasonable interpretation. Based on
our current knowledge, if O. c. calais is considered a
species-level taxon, distinct from O. chr yxus, the other
main groupings within the chryxus complex should also
be treated at the species-level, at least including O. c.
valerata, O. c. altacordillera and O. tanana, which appear
to be the most divergent members of the complex.
Regardless of its taxonomic status as a species or
subspecies, O. tanana represents a unique entity within
the genus Oeneis which deserves much additional
study. A better understanding of its evolutionary
history may be helpful in understanding mechanisms
of diversification within the genus, both in the
Nearctic and Palaearctic regions, and may further
elucidate the geological history of eastern Beringia.
Placing a name on this entity, as we have done herein,
is the first step in this process.
ac k n o w l e d g e M e n t s
We are extremely grateful to everyone who has helped make
this study possible. Derek Sikes facilitated access to the University
of Alaska Museum (Fairbanks, Alaska) where the Kenelm Philip
(KWP) collection is currently housed. Derek also provided DNA
sequences and assistance with the compilation of distributional
data. Luciana Musetti and Riley Gott generously loaned legs for
DNA extraction and provided images and data from specimens
in the Triplehorn Insect Collection at Ohio State University
(Columbus, Ohio). Jim Brock (Tucson, Arizona) provided images
and specimen data from his collection. David Shaw (Issaquah,
Washington) provided continuous encouragement and habitat
photos from near the type locality of O. tanana. We also thank
Jackie Miller, Debbie Matthews-Lott, Tom Emmel, Jim Schlatcha
(MGCL) and John Douglass (Toledo, Ohio) for logistical support
and discussions, and Katie Lane and Elena Ortiz (MGCL) for
preparing specimens. Thanks to John Calhoun for reviewing an
early version of the manuscript, Zdenek Fric for discussions, and
Konrad Fiedler and an anonymous reviewer for helpful comments
and corrections. Finally, we thank the late Malcolm Douglas, Jack
Harry and Kenelm Philip for their decades of fieldwork in western
and arctic North America, and for providing the majority of known
specimens of O. tanana. V. Lukhtanov was supported by state
research project no. 01201351193 and RFBR grants 15-29-02533 and
15-04-01581. Funding for the DNA barcoding of the UAM specimens
was provided by the United States Fish and Wildlife Service’s Alaska
Region NWRS Inventory and Monitoring Initiative.
ed I t o r s n o t e
The electronic edition of this article has been registered
in ZooBank to comply with the requirements of the amended
International Code of Zoological Nomenclature (ICZN). This
registration makes this work available from its electronic edition.
ZooBank is the official registr y of Zoological Nomenclature
according to the ICZN and works with Life Science Identifiers
(LSIDs). The LSID for this article is: urn:lsid:zoobank.
org: pub : C3 C0 04 C6 -9D3 8 -4 B 99 -A F4 F- 813B16 89 F CD3.
Registration date: March 13, 2016. This record can be viewed
using any standard web browser by clicking on the LSID above.
lI t e r a t u r e c I t e d
Ab b o t t , r., D. Al b A C H , S. AN S e l l , J. w. Ar N t z e N , S. J. e. bA I r D , N.
bIerNe, J. boUGHMAN, A. br e l S F o r D , C. A. bU e r k l e , r. bU G G S ,
r. k. bU t l I N , U. DI e C k M A N N , F. er o U k H A M A N o F F , A. Gr I l l , S. H.
CA H A N , J. S. He r M A N S e N , G. He w I t t , A. G. HU D S o N , C. JI G G I N S , J.
Jo N e S , b. ke l l e r , t. M A r C z e w S k I , J. MA l l e t , p. MA r t I N e z -ro D r I G U e z ,
M. Mö S t , S. MU l l e N , r. NI C H o l S , A. w. No l t e , C. pA r I S o D , k.
pF e N N I G , A. M. rI C e , M. G. rI t C H I e , b. Se I F e r t , C. M. SM A D J A , r.
St e l k e N S , J. M. Sz y M U r A , r. Vä I N ö l ä , J. b. w. wo l F & D. zI N N e r .
2013. Hybridization and speciation. Journal of Evolutionary
Biology 26(2): 229-246.
AU S t I N , G. t. & o. H. H. MI e l k e . 2008. Hesperiidae of Rondônia,
Brazil: Porphyrogenes Watson (Lepidoptera: Pyrginae: Eudamini),
with descriptions of new species from Central and South
America. Insecta Mundi 44: 1-56.
bI r D , C. D., G. J. HIl C H I e , N. G. ko N D l A , e. M. pI k e & F. A. H. Sp e r l I N G .
1995. Alberta butterflies. Provincial Museum of Alberta,
Edmonton. viii + 349 pp.
bo G D A N o V , p. V., G. D. SA M o D U r o V & V. k. tU z o V . 1997. Family
Satyridae Boisduval, [1833], pp. 183-260. In: Tuzov et al., Guide
to the butterflies of Russia and adjacent territories (Lepidoptera,
Rhopalocera). Volume 1: Hesperiidae, Papilionidae, Pieridae,
Satyridae. Pensoft Publishers (Pensoft series faunistica no. 7),
Sofia. 480 pp., 79 pls.
br I G H t , w. 2004. Native American Placenames of the United States.
University of Oklahoma Press, Norman. 607 pp.
bU r D I C k , w. N. 1958. A new race of Oeneis chryxus from the Olympic
Mountains of Washington (Satyridae). Lepidopterists’ News
11(1-3): 22-26.
CA M p b e l l , M. A., N. tA k e b A y A S H I & J. A. ló p e z . 2015. Beringian
sub-refugia revealed in blackfish (Dallia): implications for
understanding the effects of Pleistocene glaciations on Beringian
taxa and other Arctic aquatic fauna. BMC Evolutionary Biology
15: 144. doi:10.1186/s12862-015-0413-2
49: 1-20, 2016
J. Res.Lepid.18
CA r y , M. 1906. On the diurnal Lepidoptera of the Athabaska and
Mackenzie Region, British America. Proceedings of the United
States National Museum 31(1488): 425-457.
CH e r N o V , y. I. & A. G. tA t A r I N o V . 2006. Butterflies (Lepidoptera,
Rhopalocera) in the Arctic fauna. Zoologicheskii Zhurnal
85(10): 1205-1229; translated in Entomological Review 86(7):
760-786.
Co N G , Q. & N. V. Gr I S H I N . 2014. A new Hermeuptychia (Lepidoptera,
Nymphalidae, Satyrinae) is sympatric and synchronic with
H. sosybius in southeast US coastal plains, while another new
Hermeuptychia species – not hermesinhabits south Texas and
northeast Mexico. ZooKeys 379: 43-91.
DeCHAINe, e. G., b. r. ForeSter, H. SCHAeFer & C. C. DA V I S .
2013. Deep genetic divergence between disjunct refugia
in the Arctic-Alpine King’s Crown, Rhodiola integrifolia
(Crassulaceae). PLoS ONE 8(11): e79451. doi:10.1371/
journal.pone.0079451
D e wA A r D , J. r., N .V. IV A N o V A , M. HA J I b A b A e I & p. D. N. He b e r t . 2008.
Assembling DNA barcodes: analytical protocols, pp. 275-294.
In: Martin, C. C. (Ed.). Environmental Genomics. Methods in
Molecular Biology Vol. 410. Humana Press, Totowa, New Jersey.
doi:10.1007/978-1-59745-548-0_15
DewAArD, J. r., A. telFer & M. r. yoUNG. 2014a. Barcoding
Canada Data Release. http://www.ncbi.nlm.nih.gov/nuccore/
KM543425
D e wAArD, J. r., A. telFer & M. r. yoUNG. 2014b. Barcoding
Canada Data Release. http://www.ncbi.nlm.nih.gov/nuccore/
KM554564
D o S pA S S o S , C. F. 1949. The distribution of Oeneis taygete in North
America with descriptions of new subspecies (Lepidoptera,
Satyridae). American Museum Novitates (1399): 1-21.
D o S pA S S o S , C. F. 1961. The genus Oeneis, pp. 100-105. In: Ehrlich,
P. R. & A. H. Ehrlich. How to Know the Butterflies. W. C. Brown
Company, Dubuque, Iowa. [8] + 262 pp.
D o S pA S S o S , C. F. 1964. A synonymic list of the Nearctic Rhopalocera.
Memoirs of The Lepidopterists’ Society No. 1: v + 145 pp.
DUpUIS, J. r. & F. A. H. SperlING. 2015. Repeated reticulate
evolution in North American Papilio machaon group swallowtail
butterflies. PLoS ONE 10(10): e0141882. doi:10.1371/journal.
pone.0141882
Dy k e , A. S. 1999. Last glacial maximum and deglaciation of Devon
Island, Arctic Canada: Support for an Innuitian ice sheet.
Quaternary Science Reviews 18(1999): 393-420.
eD w A r D S , M. e., w. S. Ar M b r U S t e r & S. e. el I A S . 2014. Constraints on
post-glacial boreal tree expansion out of far-northern refugia.
Global Ecology and Biogeography 23(11): 1198-1208.
el I A S , S. & J. br I G H A M -Gr e t t e . 2007. Late Pleistocene glacial events
in Beringia, pp. 1057-1066. In: Elias, S. (Ed.). Encyclopedia of
Quaternary Science. Vol. 2. Elsevier Science Publishers B.V.,
Amsterdam. xlv + 853-1722 pp.
el w e S , H. J. & J. eD w A r D S . 1893. A revision of the genus Oeneis.
Transactions of the Entomological Society of London
(4)1893[41](4): 457-481.
eM M e l , t. C. 1975. Family Satyridae, pp. 79-111. In: Howe, W. W.
(Ed.). The Butterflies of North America. Doubleday & Co.,
Garden City, New York. xiii + 633 pp.
Fe r r I S , C. D. 1980. Superfamily Nymphaloidea Swainson, 1827
(satyrs, monarchs, long wings, brush-footed butterflies), pp.
267-360. In: Ferris, C. D. & F. M. Brown (Eds.). Butterflies
of the Rocky Mountain States. University of Oklahoma Press,
Norman. xx + 442 pp.
FerrIS, C. D. 1989. Supplement to: A catalogue/ checklist of
the butterflies of America north of Mexico. Memoirs of the
Lepidopterists’ Society (3): viii + 103 pp.
FerrIS, C. D., C. F. DoS pASSoS, J. A. ebNer & J. D. lAFoNtAINe. 1983.
An annotated list of the butterflies (Lepidoptera) of the Yukon
Territory, Canada. Canadian Entomologist 115(7): 823-840.
Fr I t z , M., U. He r z S C H U H , S. we t t e r I C H , H. lA N t U I t , G. p. De pA S C A l e ,
w. H. pollArD & l. SCHIrrMeISter. 2012. Late glacial and
Holocene vegetation and climate history from easternmost
Beringia (northern Yukon Territory, Canada). Quaternary
Research 78(3): 549-560.
GA r t H , J. S. & J. w. tI l D e N . 1986. California butterflies. University
of California Press, Berkeley. xvi + 246 pp.
Ge M l , J., G. A. lA U r S e N , k. o’Ne I l l , H. C NU S b A U M & D. l. tA y l o r .
2006. Beringian origins and cryptic speciation events in the fly
agaric (Amanita muscaria). Molecular Ecology 15(1): 225-239.
Go e t C H e U S , V. G. & H. H. bI r k S . 2001. Full-glacial upland tundra
vegetation preserved under tephra in the Beringia National
Park, Seward Peninsula, Alaska. Quaternary Science Reviews
20(2000): 135-147.
Go M p e r t , z., J. A. Fo r D y C e , M. l. Fo r I S t e r , A. M. SH A p I r o & C. C. NI C e .
2006. Homoploid hybrid speciation in an extreme habitat.
Science 314: 1923-1925.
GorbUNoV, p. y. 2001. The butterflies of Russia: Classification,
genitalia, keys for determination (Lepidoptera: Hesperioidea
and Papilionoidea). “Thesis” Russ. Acad. of Sci., Inst. Plant &
Anim. Ecol., Ekaterinburg. 320 pp., 41 pls.
GU p p y , C. S. & J. H. SH e pA r D . 2001. Butterflies of British Columbia.
Including western Alberta, southern Yukon, the Alaska
Panhandle, Washington, northern Oregon, northern Idaho,
northwestern Montana. Royal British Columbia Museum,
University of British Columbia Press, Vancouver. 414 pp.
Gr o S S , F. J. 1970. Zur Systematik und Verbreitung der Arten der
Gattung Oeneis Hübner (Lep. Satyridae). Mitteilungen der
Münchner entomologischen Gesellschaft 58: 1-25.
GU t H r I e , r. D. 2001. Origin and causes of the mammoth steppe:
a story of cloud cover, wolly mammal tooth pits, buckles, and
inside-out Beringia. Quaternary Science Reviews 20: 549-574.
HAJIbAbAeI, M., J. r. D e wA A r D , V. N. IV A N o V A , S. rA t N A S I N G H A M , r.
t. Do o p H , S. l. kI r k , p. M. MA C k I e , & p. D. N. He b e rt . 2005.
Critical factors for assembling a high volume of DNA barcodes.
Phil osophical Transactions of the Royal Society of London.
Series B, Biological Sciences 360: 1959–1967. doi:10.1098/
rstb.2005.1727
HAll, t. A. 1999. BioEdit: A user-friendly biological sequence
alignment editor and analysis program for Windows 95/98/
NT. Nucleic Acids Symposium Series 41: 95-98.
HA r r I N G t o N , C. r. 2005. The eastern limit of Beringia: Mammoth
remains from Banks and Melville Islands, Northwest Territories.
Arctic 58(4): 361-369.
HA S S l e r , M. & H. Fe I l . 2002. A Siberian butterfly species recorded for
the first time on the American continent: Oeneis nanna kluanensis
ssp. n. (Lepidoptera: Nymphalidae, Satyrinae). Nachrichten des
Entomologischen Vereins Apollo, n. f. 22(4): 197-205.
HollAND, r. w. 2010. A new subspecies of Oeneis chryxus
(Nymphalidae: Satyrinae) from south central New Mexico.
Journal of the Lepidopterists’ Society 64(3): 161-165.
Ho l l A N D , w. J. 1900. Alaska insects, part I. Entomological News
11(3): 381-389.
Ho V A N I t z , w. 1937. A new race of Oeneis chryxus (Dbld. & Hew.)
(Lepidoptera: Satyridae). Entomological News 48(8): 228-230.
Ho V A N I t z , w. 1940. Ecological color variation in a butterfly and the
problem of “protective coloration.” Ecology 21(2): 371-380.
IV A N o V A N. V., J. r. D e wA A r D & p. D. N. He b e r t . 2006. An inexpensive,
automation-friendly proto col for recovering high quality DNA.
Molecular Ecology Resources 6: 998–1002. doi:10.1111/j.1471-
8286.2006.01428.x
JAMeS, D. G. & D. NUNNAllee. 2011. Life histories of Cascadia
butterflies. Oregon State University Press, Corvallis. 447 pp.
kl e C k o V A , I., M. Ce S A N e k , z. Fr I C & l. p e l l I S S I e r . 2015. Diversification
of the cold-adapted butterfly genus Oeneis related to Holarctic
biogeography and climatic niche shifts. Molecular Phylogenetics
and Evolution 92(2015): 255-265.
19
kl o t S , A. b. 1956. Lepidoptera, pp. 97-111. In: Tuxen, S. L. (Ed.).
Taxonomist’s glossary of genitalia in insects. Munksgaard,
Copenhagen. 284 pp.
ko N D l A , N. G. 2010. Butterflies, pp. 163-192, notes, pp. 351-374,
excluded taxa, pp. 427-429. In: Pohl, G., G. Anweiler, B. C.
Schmidt & N. Kondla. An annotated list of the Lepidoptera of
Alberta, Canada. ZooKeys 38(special issue): 1-549.
ko r b , S. k. 1998. Le complexe d’Oeneis bore (Schneider, 1792) en
region paléarctique. Description d’une nouvelle sous-espèce
d’O. ammon (Lepidoptera Nymphalidae Satyrinae). Alexanor
20(5): 305-309.
ko r b , S. k. 2005. A catalogue of butterflies of the ex-USSR, with
remarks on systematics and nomenclature. S. K. Korb, Nizhny
Novgorod. 158 pp.
ko r S H U N o V , y. p. 2002. [Butterflies of north Asia. Association of
Scientific Publications, Moscow.] 425 pp.
ko r S H U N o V , y. p. & p. y. Go r b U N o V . 1995. [Butterflies of the Asian
part of Russia. Handbook.] Publishing House of the Ural State
University, Ekaterinburg. 202 pp.
ko r S H U N o V , y. p. & S. l. NI k o l A e V . 2003. Toward the knowledge
of the genus Oeneis Hübner, 1819 (Lepidoptera: Satyridae) of
North Asia. Euroasian Entomological Journal 1(2): 147-172.
kU N t e , k., C. SH e A , M. l. AA r D e M A , J. M. SC r I b e r , t. e. JU e N G e r , l. e.
GI l b e r t & M. r. kr o N F r o S t . 2011. Sex chromosome mosaicism
and hybrid speciation among tiger swallowtail butterflies. PLoS
Genet 7(9): e1002274. doi:10.1371/journal.pgen.1002274
lA F o N t A I N e , J. D. & J. t. tr o U b r I D G e . 1998. Moths and butterflies
(Lepidoptera), 34 pp. In: Smith, I. M. & G. G. E. Scudder (Eds.).
Assessment of Species Diversity in the Montane Cordillera Ecozone.
Ecological Monitoring and Assessment Network, Burlington.
lAFoNtAINe, J. D. & D. M. wooD. 1997. Butterflies and moths
(Lepidoptera) of the Yukon, pp. 723-785. In: H. V. Danks & J.
A. Downes (Eds.). Insects of the Yukon. Biological Survey of
Canada, Ottawa. 1034 pp.
lA y b e r r y , r. A., p. w. HA l l & J. D. lA F o N t A I N e . 1998. The Butterflies of
Canada. University of Toronto Press, Toronto. 280 pp., 32 pls.
lUkHtANoV. V. 1983. A review of the satyrid genus Oeneis
Hübner, 1816 (Lepidoptera, Satyridae) of the Polar Ural.
Entomologicheskoe Obozrenie 62(4): 763-772; translated in
Entomological Review 62(4): 93-102.
lU k H t A N o V . V. 1984. Review of the Palaearctic satyrid genus Oeneis
Hübner, 1816 (Lepidoptera, Satyridae). 1. The hora group.
Entomologicheskoe Obozrenie 63(4): 776-789; translated in
Entomological Review 64(3): 101-114.
lU k H t A N o V , V. 1989. Review of the Palaearctic satyrid group Oeneis
norna (Lepidoptera, Satyridae). Communication I. Vestnik
Zoologii 1989(2): 29-36.
lU k H t A N o V , V. & U. eI t S C H b e r G e r . 2001. Catalogue of the genera Oeneis
and Davidina. Supplement 4 of Bauer, E. & T. Frankenbach (Eds.).
Butterflies of the World. Goecke & Evers, Keltern. 37 pp.
lU k H t A N o V , V. A., N. A. SH A p o V A l , b. A. AN o k H I N , A. F. SA I F I t D I N o VA
& V. G. kU z N e t S o V A . 2015. Homoploid hybrid speciation and
genone evolution via chromosome sorting. Proceedings of the
Royal Society B 282: 20150157.
lU k H t A N o V V.A., A. So U r A k o V , e. V. zA k H A r o V & p. D. N. He b e rt .
2009. DNA barcoding Central Asian butterflies: increasing
geographical dimension does not significantly reduce the
success of species identification. Molecular Ecology Resources
9: 1302–1310. doi:10.1111/j.1755-0998.2009.02577.x
MADDISoN, w.p. & D. r. MADDISoN. 2015. Mesquite: a modular
system for evolutionary analysis. Version 3.04. http://
mesquiteproject.org
MA G o U N , A. & F. C. De A N . 2000. Floodplain forests along the Tanana River,
Interior Alaska. Terrestrial ecosystem dynamics and management
considerations. AFES Miscellaneous Publication 2000-3/ Alaska
Boreal Forest Council Miscellaneous Publication No. 3: 140 pp.
MA l l e t , J. 2007. Hybrid speciation. Nature 446: 279-283.
MArr, k. l., G. A. AlleN & r. J. HebDA. 2008. Refugia in the
cordilleran ice sheet of western North America: chloroplast
DNA diversity in the Arctic-Alpine plant Oxyria digyna. Journal
of Biogeography 35(7): 1323-1334.
MA V á r e z , J., C. A. SA l A z A r , e. be r M I N G H A M , C. SA l C e D o , C. D. JI G G I N S
& M. lI N A r e S . 2006. Speciation by hybridization in Heliconius
butterflies. Nature 441: 868-871.
MCDU N N o U G H , J. H. 1934. Notes on Canadian diurnal Lepidoptera.
Canadian Entomologist 66(4): 81-87.
MI l l e r , l. D. 1970. Nomenclature of wing veins and cells. Journal
of Research on the Lepidoptera 8(2): 37-48.
MIller, l. D. & F. M. br o w N . 1981. A catalogue/checklist of
the butterflies of America north of Mexico. Memoirs of the
Lepidopterists’ Society (2): vii + 280 pp.
Mo r A N , e. H. 2007. Water quality in the Tanana River Basin,
Alaska, water years 2004-06. Open-File Report 2007-1390. U.S.
Geological Survey, Reston, Virginia. 6 pp. http://pubs.usgs.
gov/of/2007/1390/pdf/ofr20071390.pdf
Mo r r I S , w. S., III (pU b l I S H e r ). 2015. The Milepost 2015. 67th Edition.
Morris Communications Company LLC, Augusta, Georgia. 720 pp.
MU r A y A M A , S. 1973. Classification and distribution of the genus
Oeneis in the world. Gekkan Mushi 29: 17-26.
MUSCHAMp, p. A. H. 1915. The ci-devant genus Epinephele.
Entomologist’s Record and Journal of Variation 27: 152-156.
NI C e , C. C. & A. M. SH A p I r o . 2001. Patterns of morphological,
biochemical, and molecular evolution in the Oeneis chryxus
complex (Lepidoptera: Satyridae): A test of historical
biogeographical hypotheses. Molecular Phylogenetics and
Evolution 20(1): 111-123.
pe l H A M , J. p. 2008. A catalogue of the butterflies of the United States
and Canada, with a complete bibliography of the descriptive and
systematic literature. Journal of Research on the Lepidoptera 40:
xiv + 658 pp.
pe l H A M , J. p. 2015. A catalogue of the butterflies of the United States
and Canada: With a complete bibliography of the descriptive
and systematic literature. http://www.butterfliesofamerica.
com/US-Can-Cat.htm
peñA, C. & G. lAMAS. 2005. Revision of the butterfly genus
Forsterinaria Gray, 1973 (Lepidoptera: Nymphalidae, Satyrinae).
Revista Peruana de Biología 12: 5-48.
pH I l I p , k. 1996. Zone 1 Far North: Alaska, Yukon, and Northwest
Territories, pp. 3-10. In: [1995] Season Summary. News of the
Lepidopterists’ Society 38(2): 64 pp.
pH I l I p , k. 1998. Zone 1 Far North: Alaska, Yukon and Northwest
Territories, pp. 3-10. In: 1997 Season Summary. News of the
Lepidopterists’ Society 40(2): 64 pp.
pH I l I p , k. 2006. Zone 1 Far North: Alaska, Yukon, Nunavut, and
Northwest Territories, pp. 3-5. In: 2005 Season Summary. News
of the Lepidopterists’ Society 48(supplement S1): 108 pp.
pH I l I p , k. w. (po S t H U M o U S ) & C. D. Fe r r I S . 2015. Butterflies of
Alaska. A Field Guide. Alaska Entomological Society, Fairbanks.
vi + 100 pp.
po H l , N., M. p. SI S o N -MA N G U S , e. N. ye e , S. w. lI S w I & A. D. br I S C o e .
2009. Impact of duplicate gene copies on phylogenetic analysis
and divergence time estimates in butterflies. BMC Evolutionary
Biology 9: 99.
po r t e r , A. H. & A. M. SH A p I r o . 1991. Genetics and biogeography
of the Oeneis chryxus complex (Satyridae) in California. Journal
of Research on the Lepidoptera 28(4): 263-276.
prUett, C. l. & k. wINker. 2005. Biological implications of
climatic change on a Beringian endemic: Cryptic refugia in
the establishment and differentiation of the Rock Sandpiper
(Calidris ptilocnemis). Climatic Change 68(1): 219-240.
py l e , r. M. 1981. The Audubon Society field guide to North American
butterflies. Chanticleer Press, Inc., New York. 924 pp.
rA M b A U t , A. 2009. FigTree, ver. 1.3.1. [Online]. Available: FigTree
v 1.3.1. http:// tree.bio.ed.ac.uk/software/figtree/
49: 1-20, 2016
J. Res.Lepid.20
rA t N A S I N G H A M , S. & p. D. N. He b e r t . 2007. BOLD: The Barcode of
Life Data System (www.barcodinglife.org). Molecular Ecology
Notes 7: 355–364.
ro b e r t S , D. r. & A. HA M A N N . 2015. Glacial refugia and modern genetic
diversity of 22 western North American tree species. Proceedings
of the Royal Society of London (B) 282(1804): 20142903.
ro N Q U I S t , F., M. te S l e N k o , p. V A N D e r MA r k , D. l. Ay r e S , A. DA r l I N G ,
S. Hö H N A , b. lA r G e t , l. lIU , M. A. SU C H A r D & J. p. HU e l S e N b e C k .
2012. MrBayes 3.2: efficient Bayesian phylogenetic inference
and model choice across a large model space. Systematic
Biology 61(3): 539-542.
SA V I D G e , r. A. 2012. Yukon taiga – past, present and future., pp. 63-92.
In: Ishwaran, N. (Ed). The Biosphere. InTech, Rijeka, Croatia.
SC o t t , J. A. 1986. Butterflies of North America, a natural history
and field guide. Stanford University Press, Stanford, California.
xiii + 583 pp.
SC o t t , J. A. 2006. Oeneis calais altacordillera, new subspecies, pp.
14-22, pl. 4. In: J. Scott (Ed.). Taxonomic studies and new taxa
of North American butterflies. Papilio (new series) 12.
SC o t t , J. A. 2010. Case 3495 Chionobas chryxus Doubleday, 1849
(currently Oeneis chryxus; Insecta, Lepidoptera, NYMPHALIDAE):
proposed conservation of usage by designation of a neotype.
Bulletin of Zoological Nomenclature 67(2): 121-128.
SC U D D e r , S. H. 1865. Revision of the hitherto known species of
the genus Chionobas in North America. Proceedings of the
Entomological Society of Philadelphia 5(1): 1-28.
SHepArD, J. H. 1984. Type locality restrictions and lectotype
designations for the “Rocky Mountain” butterflies described
by Edward Doubleday in “The Genera of Diurnal Lepidoptera”
1847-1849. Quaestiones Entomologicae 20(1): 35-44.
So l t I S , p. S. 2013. Hybridization, speciation and novelty. Journal
of Evolutionary Biology 26(2): 291-293.
St A M F o r D , M. D. & e. b. tA y l o r . 2004. Phylogeographical lineages
of Arctic grayling (Thymallus arcticus) in North America:
divergence, origins and affinities with Eurasian Thymallus.
Molecular Ecology 13: 1533-1549.
tA l A V e r A G., V. lUkHtANoV, l. rIeppel, N. e. pIerCe & r. VIlA.
2013. In the shadow of phylogenetic uncertainty: the recent
diversification of Lysandra butterflies through chromosomal
change. Molecular Phylogenetics and Evolution 69: 469–478.
doi:10.1016/j.ympev.2013.08.004
tIlDeN, J. w. & A. C. SMItH. 1986. A Field Guide to Western
Butterflies. Houghton Mifflin Co., Boston. xiv + 370 pp.
tr o U b r I D G e , J. t. & D. k. pA r S H A l l . 1988. A review of the Oeneis
polixenes (Fabricius) (Lepidoptera: Satyrinae) complex in North
America. Canadian Entomologist 120(7): 679-696.
tr o U b r I D G e , J. t., k. w. pH I l I p , J. A. SC o t t & J. H. SH e p A r D . 1982.
A new species of Oeneis (Satyridae) from the North American
Arctic. Canadian Entomologist 114(10): 881-889.
tS V e t k o V , e. V. 2006. [On two species of genus Oeneis Hübner, 1819
(Lepidoptera, Satyridae) from the Polar Urals.] Eversmannia
5: 11-14.
Ve r S H I N I N A , A.o. & V. A. lUkHtANoV. 2010. Geographical
distribution of the cryptic species Agrodiaetus alcestis alcestis, A.
alcestis karacetinae and A. demavendi (Lepidoptera, Lycaenidae)
revealed by cytogenetic analysis. Comparative Cytogenetics
4(1): 1–11. doi:10.3897/ compcytogen.v4i1.21
wArreN, A. D. 2011. Comments on the proposed designation
of a neotype for the nominal species Chionobas chryxus
Doubleday, 1849 (currently Oeneis chryxus; Insecta, Lepidoptera,
Nymphalidae) 2. Bulletin of Zoological Nomenclature 68(2):
137-138.
wA r r e N , A. D., k. J. DA V I S , e. M. St A N G e l A N D , J. p. pe l H A M & N. V.
Gr I S H I N . 2015. Illustrated Lists of American Butterflies. [16-
XI-2015] www.butterfliesofamerica.com
yAkoVleV, r. V. 2011. New taxa of Rhopalocera from Siberia
and Kazakhstan (Lepidoptera, Satyridae and Nymphalidae).
Atalanta (München) 42(1-4): 225-230.
zA z U l A , G. D., A. M. te l k A , C. r. HA r I N G t o N , C. e. SC H w e G e r & r.
w. M At H e w e S . 2006. New spruce (Picea spp.) macrofossils from
Yukon Territory: Implications for Late Pleistocene refugia in
eastern Beringia. Arctic 59(4): 391-400.
... There are over 30 species in the genus Oeneis (Kleckova et al. 2015) and about one-third of them can be found in Northern China (Lukhtanov and Eitschberger 2000;Wu and Hsu 2017). The species in Oeneis share similar appearance and ecological environments (Kleckova et al. 2015) although the species boundaries and evolutionary relationships among closely related species remain poorly defined (Kim et al. 2013;Warren et al. 2016). Compared with the limited number of short mitochondrial or nuclear markers, whole mitogenomes possess relatively rich genetic information and have provided further resolution for phylogenetic relationships especially within closely related species (Qin et al. 2015;Sullivan et al. 2017). ...
Article
Full-text available
Oeneis urda (Eversmann, 1847) is a butterfly of the Satyrinae (Lepidoptera: Nymphalidae) and a member of the Arctics, which are distributed in the arctic, subarctic, or high-altitude alpine regions. Here, we present the complete mitochondrial genome of O. urda assembled from next-generation sequencing data. The mitochondrial DNA (mtDNA) of O. urda is a circular molecule of 15,248 bp and contains 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes, and one control region. Phylogenetic analysis using whole mitogenomic data of 23 satyrid butterflies strongly supports that the genus Oeneis has a close relationship with Davidina.
... As in other insect groups, the state of taxonomic knowledge of Canada's Lepidoptera fauna varies according to group. Butterflies are the best-known insect group taxonomically, and the few recent discoveries involve previously overlooked cryptic species (e.g., Verhulst 2009, Warren et al. 2016. Most faunal additions result from better resolution of species-groups that have traditionally been difficult to delineate, such as Coenonympha nipisiquit McDunnough (Sei and Porter 2007). ...
Article
Full-text available
The known Lepidoptera (moths and butterflies) of the provinces and territories of Canada are summarised, and current knowledge is compared to the state of knowledge in 1979. A total of 5405 species are known to occur in Canada in 81 families, and a further 50 species have been reported but are unconfirmed. This represents an increase of 1348 species since 1979. The DNA barcodes available for Canadian Lepidoptera are also tabulated, based on a dataset of 148,314 specimens corresponding to 5842 distinct clusters. A further yet-undiscovered 1400 species of Lepidoptera are estimated to occur in Canada. The Gelechioidea are the most poorly known major lineage of Lepidoptera in Canada. Nunavut, Prince Edward Island, and British Columbia are thought to show the greatest deficit in our knowledge of Lepidoptera. The unglaciated portions of the Yukon (Beringia), and the Pacific Maritime, Montane Cordillera, and Western Interior Basin ecozones of British Columbia are also identified as hotbeds of undescribed biodiversity.
Book
Full-text available
A definitive species list is the foundation of biodiversity and conservation work. As we deal with massive climatic changes in the Anthropocene, knowing which species make up our diverse ecosystems will be critically important if we wish to protect and restore them. The Lepidoptera, moths and butterflies, are the fourth-largest insect order in terms of global diversity, with approximately 158,000 described species. Here we report the distributions of 5431 species that occur in Canada and Alaska, as well as 53 species that have been reported from the region but not yet verified. Additionally, 19 species are listed as interceptions or unsuccessful introductions, and 52 species are listed as probably occurring in the region. The list is based on records from taxonomic papers, historical regional checklists, and specimen data from collections and online databases. All valid species and their synonyms, and all Nearctic subspecies and synonyms are included, except for butterfly subspecies (and their synonyms) that have never been reported from the region. The list is presented in taxonomic order, with the author, date of description, and original genus provided for each name.
Article
Full-text available
Hybridization between distinct populations or species is increasingly recognized as an important process for generating biodiversity. However, the interaction between hybridization and speciation is complex, and the diverse evolutionary outcomes of hybridization are difficult to differentiate. Here we characterize potential hybridization in a species group of swallowtail butterflies using microsatellites, DNA sequences, and morphology, and assess whether adaptive introgression or homoploid hybrid speciation was the primary process leading to each putative hybrid lineage. Four geographically separated hybrid populations were identified in the Papilio machaon species group. One distinct mitochondrial DNA clade from P. machaon was fixed in three hybrid taxa (P. brevicauda, P. joanae, and P. m. kahli), while one hybrid swarm (P. zelicaon x machaon) exhibited this hybrid mtDNA clade as well as widespread parental mtDNA haplotypes from both parental species. Microsatellite markers and morphology showed variable admixture and intermediacy, ranging from signatures of prolonged differential introgression from the paternal species (P. polyxenes/P. zelicaon) to current gene flow with both parental species. Divergences of the hybrid lineages dated to early- to mid-Pleistocene, suggesting that repeated glaciations and subsequent range shifts of parental species, particularly P. machaon hudsonianus, facilitated initial hybridization. Although each lineage is distinct, P. joanae is the only taxon with sufficient evidence (ecological separation from parental species) to define it as a homoploid hybrid species. The repetition of hybridization in this group provides a valuable foundation for future research on hybridization, and these results emphasize the potential for hybridization to drive speciation in diverse ways.
Article
Full-text available
Pleistocene climatic instability had profound and diverse effects on the distribution and abundance of Arctic organisms revealed by variation in phylogeographic patterns documented in extant Arctic populations. To better understand the effects of geography and paleoclimate on Beringian freshwater fishes, we examined genetic variability in the genus Dallia (blackfish: Esociformes: Esocidae). The genus Dallia groups between one and three nominal species of small, cold- and hypoxia-tolerant freshwater fishes restricted entirely in distribution to Beringia from the Yukon River basin near Fairbanks, Alaska westward including the Kuskokwim River basin and low-lying areas of Western Alaska to the Amguema River on the north side of the Chukotka Peninsula and Mechigmen Bay on the south side of the Chukotka Peninsula. The genus has a non-continuous distribution divided by the Bering Strait and the Brooks Range. We examined the distribution of genetic variation across this range to determine the number and location of potential sub-refugia within the greater Beringian refugium as well as the roles of the Bering land bridge, Brooks Range, and large rivers within Beringia in shaping the current distribution of populations of Dallia. Our analyses were based on DNA sequence data from two nuclear gene introns (S7 and RAG1) and two mitochondrial genome fragments from nineteen sampling locations. These data were examined under genetic clustering and coalescent frameworks to identify sub-refugia within the greater Beringia refugium and to infer the demographic history of different populations of Dallia. We identified up to five distinct genetic clusters of Dallia. Four of these genetic clusters are present in Alaska: (1) Arctic Coastal Plain genetic cluster found north of the Brooks Range, (2) interior Alaska genetic cluster placed in upstream locations in the Kuskokwim and Yukon river basins, (3) a genetic cluster found on the Seward Peninsula, and (4) a coastal Alaska genetic cluster encompassing downstream Kuskokwim River and Yukon River basin sample locations and samples from Southwest Alaska not in either of these drainages. The Chukotka samples are assigned to their own genetic cluster (5) similar to the coastal Alaska genetic cluster. The clustering and ordination analyses implemented in Discriminant Analysis of Principal Components (DAPC) and STRUCTURE showed mostly concordant groupings and a high degree of differentiation among groups. The groups of sampling locations identified as genetic clusters correspond to geographic areas divided by likely biogeographic barriers including the Brooks Range and the Bering Strait. Estimates of sequence diversity (θ) are highest in the Yukon River and Kuskokwim River drainages near the Bering Sea. We also infer asymmetric migration rates between genetic clusters. The isolation of Dallia on the Arctic Coastal Plain of Alaska is associated with very low estimated migration rates between the coastal Alaska genetic cluster and the Arctic Coastal Plain genetic cluster. Our results support a scenario with multiple aquatic sub-refugia in Beringia during the Pleistocene and the preservation of that structure in extant populations of Dallia. An inferred historical presence of Dallia across the Bering land bridge explains the similarities in the genetic composition of Dallia in West Beringia and western coastal Alaska. In contrast, historic and contemporary isolation across the Brooks Range shaped the distinctiveness of present day Arctic Coastal Plain Dallia. Overall this study uncovered a high degree of genetic structuring among populations of Dallia supporting the idea of multiple Beringian sub-refugia during the Pleistocene and which appears to be maintained to the present due to the strictly freshwater nature and low dispersal ability of this genus.
Article
Full-text available
North American tree species, subspecies and genetic varieties have primarily evolved in a landscape of extensive continental ice and restricted temperate climate environments. Here, we reconstruct the refugial history of western North American trees since the last glacial maximum using species distribution models, validated against 3571 palaeoecological records. We investigate how modern subspecies structure and genetic diversity corresponds to modelled glacial refugia, based on a meta-analysis of allelic richness and expected heterozygosity for 473 populations of 22 tree species. We find that species with strong genetic differentiation into subspecies had widespread and large glacial refugia, whereas species with restricted refugia show no differentiation among populations and little genetic diversity, despite being common over a wide range of environments today. In addition, a strong relationship between allelic richness and the size of modelled glacial refugia (r(2) = 0.55) suggest that population bottlenecks during glacial periods had a pronounced effect on the presence of rare alleles. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Article
The widely reported isolate population of Oeneis chrysus from Mt. Withington, Socorro County, New Mexico, is formally described as Oeneis chryxus socorro.
Article
The Montane Cordillera Ecozone of British Columbia and southwestern Alberta supports a diverse fauna with over 2,000 species of butterflies and moths (Order Lepidoptera) recorded to date. By far the best known group of Lepidoptera is the butterflies with 173 species in the Ecozone; the approximately 15,000 species locations of butterflies in the Ecozone makes it one of the best groups of insects to examine distribution patterns within the Ecozone. The Lepidoptera fauna of the Ecozone is reviewed in terms of diversity, state of knowledge of the major groups, origins of the fauna, post-glacial and relict patterns, recent changes in distribution, and endangered and threatened species.