Appl. Environ. Microbiol.-2014-Jiang-5219-30

Full text

Published Ahead of Print 13 June 2014.
10.1128/AEM.00551-14. 2014, 80(17):5219. DOI:Appl. Environ. Microbiol.
Deming Liu, Sandra M. F. O. Azevedo and Renhui Li
Yongguang Jiang, Peng Xiao, Gongliang Yu, Jihai Shao,
Samples from Chinese Freshwater Bodies
Cyanobacterial Strains and Environmental
Variations of Cylindrospermopsin Genes in
Sporadic Distribution and Distinctive
http://aem.asm.org/content/80/17/5219
Updated information and services can be found at:
These include:
SUPPLEMENTAL MATERIAL Supplemental material
REFERENCES http://aem.asm.org/content/80/17/5219#ref-list-1at:
This article cites 77 articles, 18 of which can be accessed free
CONTENT ALERTS more»articles cite this article),
Receive: RSS Feeds, eTOCs, free email alerts (when new
http://journals.asm.org/site/misc/reprints.xhtmlInformation about commercial reprint orders: http://journals.asm.org/site/subscriptions/To subscribe to to another ASM Journal go to:
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

Sporadic Distribution and Distinctive Variations of
Cylindrospermopsin Genes in Cyanobacterial Strains and
Environmental Samples from Chinese Freshwater Bodies
Yongguang Jiang,
a,b
Peng Xiao,
a,b
Gongliang Yu,
a
Jihai Shao,
c
Deming Liu,
d
Sandra M. F. O. Azevedo,
e
Renhui Li
a
Key Laboratory of Algal Biology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan, People’s Republic of China
a
; University of Chinese Academy of Sciences,
Beijing, People’s Republic of China
b
; Resources and Environment College, Hunan Agricultural University, Changsha, People’s Republic of China
c
; Hunan Provincial Key
Laboratory of Crop Germplasm Innovation and Utilization, Hunan Agricultural University, Changsha, People’s Republic of China
d
; Instituto de Biofísica Carlos Chagas Filho,
Universidade Federal do Rio de Janeiro, Ilha do Fundão, Cidade Universitária, Rio de Janeiro, Brazil
e
Increasing reports of cylindrospermopsins (CYNs) in freshwater ecosystems have promoted the demand for identifying all of the
potential CYN-producing cyanobacterial species. The present study explored the phylogenetic distribution and evolution of cyr
genes in cyanobacterial strains and water samples from China. Four Cylindrospermopsis strains and two Raphidiopsis strains
were confirmed to produce CYNs. Mutant cyrI and cyrK genes were observed in these strains. Cloned cyr gene sequences from
eight water bodies were clustered with cyr genes from Cylindrospermopsis and Raphidiopsis (C/R group) in the phylogenetic
trees with high similarities (99%). Four cyrI sequence types and three cyrJ sequence types were observed to have different se-
quence insertions and repeats. Phylogenetic analysis of the rpoC1 sequences of the C/R group revealed four conserved clades,
namely, clade I, clade II, clade III, and clade V. High sequence similarities (>97%) in each clade and a divergent clade IV were
observed. Therefore, CYN producers were sporadically distributed in congeneric and paraphyletic C/R group species in Chinese
freshwater ecosystems. In the evolution of cyr genes, intragenomic translocations and intergenomic transfer between local Cylin-
drospermopsis and Raphidiopsis were emphasized and probably mediated by transposases. This research confirms the existence
of CYN-producing Cylindrospermopsis in China and reveals the distinctive variations of cyr genes.
Harmful cyanobacterial blooms, along with eutrophication in
freshwater ecosystems, global warming, and worldwide
spread of invasive cyanobacterial species, have drawn great atten-
tion in recent years (1–4). Cyanotoxins, such as saxitoxins, ana-
toxins, microcystins, and cylindrospermopsins (CYNs), are toxic
metabolites produced by cyanobacteria, and their syntheses are
regulated by a series of genetic and environmental factors (5–7).
The outbreak of hepatoenteritis in Palm Island (Queensland, Aus-
tralia) in 1979 led to the discovery of CYN, which was first isolated
from bloom-forming Cylindrospermopsis raciborskii and proved
to be mainly hepatotoxic (8–10). CYN is a sulfate ester with high
solubility in water and comprises a tricyclic guanidine group and a
hydroxymethyluracil moiety (10). Two analogues of CYN have
been described: 7-epi-CYN, an enantiomer of CYN (11), and
7-deoxy-CYN with no hydroxylation on C-7 (12).
CYN can damage the liver, thymus, kidney, and heart (13). The
cytotoxicity of CYN may be mediated by inhibiting the syntheses
of protein (14) and glutathione (15). CYN is also a potential car-
cinogen because of its genotoxic effects by inhibiting pyrimidine
nucleotide synthesis (16) and inducing DNA strand breakage (17,
18). An assay performed in mice revealed that 7-epi-CYN has
severe toxicity similar to CYN and that uracil moiety is required
for their toxicity (19). However, 7-deoxy-CYN shows no toxicity
to mouse, and thus hydroxylation at C-7 is also crucial for the
toxicity of CYNs (12). The bioaccumulation of CYNs in the tissues
of vertebrates and invertebrates has been reported (20,21)asa
great health risk for humans and animals.
To date, CYNs have been detected in Nostocales and Oscillato-
riales species, including Cylindrospermopsis,Raphidiopsis (22,23),
Aphanizomenon (24–26), Anabaena (27), Umezakia (28,29), Os-
cillatoria (30), and Lyngbya (31) spp. CYN-producing Cylindro-
spermopsis from Australia and Asia have been reported, whereas
Cylindrospermopsis strains isolated from Europe and America are
incapable of CYN production (32–36). However, no conclusion
can be drawn about the geographic distribution of the CYN-pro-
ducing genotype of Cylindrospermopsis before additional samples
from each continent are investigated by molecular and chemical
methods.
The cyr gene cluster that encodes amidinotransferase, peptide
synthetase (PS), polyketide synthase (PKS), and tailoring enzymes
involved in CYN production has been described in C. raciborskii
(37), R. curvata (38), Aphanizomenon sp. (39), and Oscillatoria sp.
(30). The amidinotransferase CyrA catalyzes a transfer of an
amidino group from arginine to glycine, which results in the first-
product guanidinoacetate (40). Five cyr genes (cyrB through cyrF)
that encode multi-enzymatic PSs and PKSs are probably involved
in the polyketide chain synthesis that incorporates five units of
acetate (41). The uracil moiety results from de novo synthesis pos-
sibly catalyzed by CyrG and CyrH. The sulfate group is incorpo-
rated by a sulfotransferase CyrJ with a suggested adenylylsulfate
Received 16 February 2014 Accepted 5 June 2014
Published ahead of print 13 June 2014
Editor: K. E. Wommack
Address correspondence to Renhui Li, reli@ihb.ac.cn.
Y.J. and P.X. contributed equally to this article.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AEM.00551-14.
Copyright © 2014, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.00551-14
September 2014 Volume 80 Number 17 Applied and Environmental Microbiology p. 5219 –5230 aem.asm.org 5219
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

kinase CyrN providing the phosphoadenylyl sulfate pool (37).
CyrI has been proven to catalyze hydroxylation at the C-7 of 7-de-
oxy-CYN (42), and CyrK has been proposed to be a potential
transporter. Although cyr genes are highly conserved, the rear-
rangements of the cyr gene cluster and the insertion mutation of
the cyrI gene have been reported (38). The cyrN and cyrO genes are
found only in the end of the cyr gene cluster of C. raciborskii and
are suggested to be excluded from the core set of cyr genes (30,38).
An AbrB-like protein has been reported to be involved in the
transcription regulation of cyr genes in Aphanizomenon ovalispo-
rum (43). However, the protein-DNA interaction has not been
verified in other CYN-producing species. The effects of tempera-
ture, light, nitrogen, phosphate, and sulfate on CYN production
are inconclusive because of uncertainties in strain dependence,
the release of CYNs, heterocyst formation, and combined effects
of multiple factors in different experimental conditions (43–51).
Davis et al. (51) highlighted the effects of the genetic diversity of
CYN producers on the concentration and composition of CYNs in
aquatic ecosystems. Moreover, CYN-producing and non-CYN-
producing genotypes often coexist in the same populations.
Therefore, an overview of CYN-producing species in total phyto-
plankton is essential for the risk assessment of CYNs. Further-
more, a systematic investigation of the diversity of cyr genes has
not been performed and is thus necessary.
Cyanobacterial blooms occur perennially in numerous fresh-
water ecosystems, and CYNs have been detected in some urban
reservoirs of China (52). Therefore, a comprehensive understand-
ing of the diversity and distribution of CYN producers is essential.
We illustrate this issue here by investigating the presence of cyr
genes in cyanobacterial strains and environmental samples from
different parts of China. Specifically, phylogenetic analysis was
performed to explore the diversity and evolution of CYN produc-
ers. The conservation and variation of cyr gene sequences were
also characterized.
MATERIALS AND METHODS
Cyanobacterial strains and culture conditions. Cyanobacterial strains
isolated from Chinese freshwater bodies were used for molecular and
chemical analysis of CYNs (see Table S1 in the supplemental material).
Three strains—C. raciborskii AWT205, C. raciborskii cyDB-1, and Apha-
nizomenon ovalisporum ILC-164 —were isolated from Australia, Brazil,
and Israel, respectively. Pure cultures of the cyanobacterial strains were
grown in liquid MA medium (53) at 25°C under a 12-h/12-h light/dark
cycle with constant white light intensity of 30 ␮mol of photons m
⫺2
s
⫺1
.
Cyanobacterial cells were harvested at the exponential phase (optical den-
sity at 680 nm [OD
680
]⫽0.8) by centrifugation (12,000 ⫻g) and stored at
⫺80°C before further processing.
Collection of environmental samples. Water samples were collected
in lakes and reservoirs of China from 2006 to 2013 (Table 1). These water
bodies were located between 22°N and 47°N in subtropical and temperate
regions (see Fig. S1 and Table S2 in the supplemental material). A volume
of 300 to 500 ml of water was filtered using a membrane filter (MF-
Millipore, 0.22-␮m pore size) in quadruplicate for each water body at
TABLE 1 Gene detection of environmental DNA samples from Chinese freshwater bodies
Geographic origin Abbreviation Date of sample
Gene regions
a
rpoC1 cyrA cyrI cyrJ
Longhu Lake, Daqing, Heilongjiang LH July, 2012 ND ⫺⫺ND
Jinyang Lake, Taiyuan, Shanxi JY Aug., 2010 4 ⫺⫺ND
Fish pond, Qingdao, Shandong FQ Nov., 2013 7 ⫺⫺ND
Taihu Lake, Wuxi, Jiangsu TH Aug., 2011 ND ⫺⫺ND
Nov., 2011 ND ⫺⫺ND
Fish pond, Nanjing, Jiangsu FN Nov., 2007 3 ⫺⫺ND
Qiandao Lake, Hangzhou, Zhejiang QA Oct., 2012 3 3 10 10
Xianghu Lake, Hangzhou, Zhejiang XH Oct., 2012 5 1 7 8
Xihu Lake, Hangzhou, Zhejiang XL Oct., 2012 5 ⫺⫺ND
Dongqian Lake, Ningbo, Zhejiang DQ July, 2009 3 ⫺⫺ND
Donghu Lake, Wuhan, Hubei DH Nov., 2006 3 ⫺⫺ND
Tangxun Lake, Wuhan, Hubei TX Oct., 2012 ND ⫺⫺ND
Liangzi Lake, Ezhou, Hubei LZ Sept., 2011 4 2 2 D
Qiaodun Lake, Daye, Hubei QD Sept., 2011 9 1 5 8
Chidong Lake, Qichun, Hubei CD Aug., 2006 6 1 11 5
Lushui Reservoir, Chibi, Hubei LS May, 2006 5 ⫺⫺ND
Poyang Lake, Nanchang, Jiangxi PO Aug., 2012 ND ⫺⫺ND
Oct., 2012 ND ⫺⫺ND
Erhai Lake, Dali, Yunnan EH Aug., 2010 ND ⫺⫺ND
Sept., 2010 ND ⫺⫺ND
Oct., 2010 ND ⫺⫺ND
Fish pond, Kunming, Yunnan FK Oct., 2006 3 ⫺⫺ND
Dongzhen Reservoir, Putian, Fujian DZ Sept., 2011 2 2 8 6
Fish pond, Panyu, Guangdong FP May, 2012 5 ⫺⫺ND
Shiyan Reservoir, Shenzhen SY June, 2007 5 D 6 3
Qiankeng Reservoir, Shenzhen QK June, 2007 5 ⫺⫺ND
Tiegang Reservoir, Shenzhen TG June, 2007 9 3 10 9
Luotian Reservoir, Shenzhen LT June, 2007 2 ⫺⫺ND
Changliupi Reservoir, Shenzhen CL June, 2007 ND ⫺⫺ND
a
The number of unique sequences is indicated where applicable. D, detected; ND, not detected; ⫺, not tested.
Jiang et al.
5220 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

each collection period. The filters were also stored at ⫺80°C before DNA
extraction.
DNA extraction, PCR, and sequencing. Genomic DNA of cyanobac-
terial cells were extracted by using sodium dodecyl sulfate lysis and a
phenol-chloroform-isoamyl alcohol extraction method described previ-
ously (54). Environmental DNA was extracted from membrane filters
using a water DNA extraction kit according to the manufacturer’s proto-
col (Omega Bio-Tek, USA). The filters were cut into pieces first and then
subjected to the extraction process of the kit. The purified DNA were
dissolved in Tris-EDTA buffer (pH 8.0) and stored at ⫺20°C. The purity
and concentrations of DNA samples were determined by a Nanodrop
2000 spectrophotometer (Thermo Fisher Scientific, USA).
The primer pair PC␤F/PC␣R(
54) with specificity targeting the phy-
cocyanin operon (cpc) of cyanobacteria was used to confirm the validity of
DNA templates for PCRs. Primers specific for cyrA,cyrI, and cyrJ genes of
current known CYN-producing species were designed (see Fig. S2A in the
supplemental material). Another primer set, rpoC1F53/rpoC1R739, was
designed to selectively amplify the rpoC1 genes of Cylindrospermopsis and
Raphidiopsis (see Fig. S2B in the supplemental material). PCR mix were
prepared in 50-␮l volumes containing 5 ␮lof10⫻PCR buffer (TaKaRa,
Japan), 10 nmol of each deoxynucleotide triphosphate, 10 pmol of each
primer,1UofLATaq (TaKaRa), and 100 ng of DNA templates. The
cycling conditions were as follows: 94°C for 3 min; 35 cycles of 94°C for 45
s, 50°C to 60°C for 1 min, and 72°C for 2 min; 72°C for 10 min; and a 4°C
hold. The annealing temperatures depended on the T
m
values of primers
(Table 2).
The positive PCR products were amplified in triplicate and purified
using a gel extraction kit (Omega Bio-Tek, USA). Purified gene fragments
from environmental DNA were cloned into pMD18-T vector (TaKaRa).
Recombinant plasmids of 5 to 15 positive bacterial clones were extracted,
and the gene fragments were sequenced using an ABI 3730 automated
sequencer (Applied Biosystems) in both directions. The primer regions of
obtained sequences were deserted, and duplicated sequences in each water
body were removed. The gene fragments from cyanobacterial strains were
sequenced directly by using PCR primers in double directions.
Two methods were utilized to obtain the whole cyr gene clusters of
cyanobacterial strains. First, the cyr genes and flanking sequences were
amplified and sequenced according to the PCR methods described earlier
(38). Second, genome sequencing was performed using a Hiseq 2000 (Il-
lumina, USA) according to the manufacturer’s instructions. A sequence
library of 300 bp was constructed, and paired-end sequencing was carried
out. After removing the low-quality reads, genome sequences were assembled
by two software programs, including SOAPdenovo (v1.05) and Velvet
(v1.0.09). The conservation of gene and protein sequences was verified by
homologous search using BLAST on the website of the National Center for
Biotechnology Information (NCBI). Open reading frames (ORFs) were de-
termined by the ORF Finder tool implemented on the NCBI website.
Transcription detection. Cyanobacterial cells from 2 ml of culture at the
exponential phase were harvested by centrifugation. RNA extraction, DNase
digestion and cDNA synthesis were performed as described previously (38).
The DNase-digested RNA extracts and cDNA were used as the templates for
transcription detection. The cyrI and cyrK genes were amplified by using the
primer sets cyrIF/cyrIR813 and RTcyrKF991/RTcyrKR1379 (Table 2), re-
spectively. A negative control without cyanobacterial cells was also subjected
to the extraction and detection procedures. The genomic DNA of C. racibor-
skii AWT205 was used for positive PCR templates.
Phylogenetic assignment. Four data sets, namely, cyrA,cyrI,cyrJ, and
rpoC1, were constructed, including environmental sequences and refer-
ence gene sequences from cyanobacterial strains. Multiple sequence align-
ments were created by using the CLUSTAL W (v1.4) option in Bioedit
v7.0.9.0 software and manually corrected. The best substitution models
for gene evolution were selected by Modeltest v3.7 (55) and used for the
inference of phylogenetic trees. Maximum-likelihood (ML) algorithm
was used to carry out phylogenetic analysis by PHYML v3.0 (56) and
PAUP v4.0b10 with 1,000 bootstrap replicates. Bayesian phylogenetic in-
ference was performed using MrBayes v3.1.2 (57), and the parameters
were set as described earlier (38). Neighbor-joining (NJ) trees were con-
structed by MEGA v4 (58) using Kimura two-parameter model with 1,000
bootstrap replicates. The GenBank accession numbers of reference gene
sequences were displayed in Table S3 in the supplemental material. Selec-
tion analysis of environmental cyrA,cyrI, and cyrJ sequences were also
performed as described previously (38). The secondary structures of pro-
tein sequences were predicted by PSIPRED v3.3 available online (59).
Toxin extraction and analysis. Intracellular CYNs were extracted
from lyophilized cyanobacterial cells by a modification of a method re-
ported previously (60). Briefly, 30 mg of dry cells were mixed with 1 ml of
Millipore water, sonicated for 20 min in an ice bath and shaken for1hat
room temperature, followed by centrifugation. A total of 2-ml superna-
tants were collected after the extraction step was repeated. The superna-
tants were further subjected to solid-phase extraction (SPE) as described
previously (61). Carbograph SPE cartridges (6.0 ml, 250 mg) were pre-
treated with 10 ml of elution solvent (dichloromethane-methanol, 1:4
[vol/vol]) acidified with 5% formic acid (vol/vol) and washed with 10 ml
of water. The extracts were acidified with formic acid (1% [vol/vol]), and
the ionic strength was adjusted with 0.1% sodium chloride (wt/vol) before
application to the cartridges. The cartridges were then washed with 10 ml
of water, followed by air to remove excess liquid. The absorbed toxins
were eluted by 10 ml of elution solvent, and the solvent was removed by
rotary evaporation thereafter. The precipitate was redissolved in 2 ml of
water, and the solution was filtered through a Millipore ultracentrifugal
filter (100 kDa). Extracellular CYNs were also extracted from cell-free
spent culture medium by the SPE method. A volume of 100 ml of acidified
medium was applied with a flow rate of 5 ml min
⫺1
, and the toxins were
eluted by 20 ml of elution solvent.
CYNs were analyzed using two methods. First, CYNs were detected by
liquid chromatography-tandem mass spectrometry (LC-MS/MS) using
an ESI-Q-TOF 6530 coupled with Infinity UHPLC 1290 (Agilent, USA).
For LC conditions, a C
18
column (4.6 mm by 250 mm, 5 ␮m) was applied
with a temperature of 35°C. Compounds were separated by two linear
gradient stages, 5 to 15% methanol in water during 0 min to 10 min, and
15 to 50% methanol in water during 10 min to 20 min with a flow rate of
0.25 ml min
⫺1
. The injection volume was 20 ␮l. The parameters of the
mass spectrometer were set as follows: gas temperature, 300°C; flow rate,
11 liters min
⫺1
; nebulizer pressure, 45 lb/in
2
; capillary voltage, 3,500 V;
nozzle voltage, 1,000 V; and fragmentor voltage, 175 V. Positive ions of
m/z 100 to m/z 2,500 were monitored, and toxin analogues were deter-
TABLE 2 Characteristics of primer pairs used for gene detection
Gene Primer Sequence (5=-3=)
T
m
(°C)
cpcBA-IGS PC␤F GGCTGCTTGTTTACGCGACA 50
PC␣R CCAGTACCACCAGCAACTAA 50
cyrA cyrAF51
a
GATGGTTGTCGGGATTGCAGAT 57
cyrAR1167 GAAGCGAGAAACGCCATTGGT 57
cyrI cyrIF
b
CAGGCTTATCTGCAACAACATTTCT 56
cyrIR813 CGGTTTATCAGTTCCAGAGTATCCA 56
cyrJ cyrJF13 CGAATCGCAATGTGGTCTGTGC 59
cyrJR720 GACAAGATATAGCGGCAACGACTCA 59
cyrK RTcyrKF991 GGAGCGTGTTGGCTATTTC 55
RTcyrKR1379 TGAGTCAAGGCACGAGAAG 55
rpoC1 rpoC1F53 CACCAGAACGTATCCGCGCT 60
rpoC1R739 GGTGGAATGACTGGAATGGCTGA 60
a
C. raciborskii CS-505 numbering.
b
Targeting flanking sequence upstream cyrI gene.
Distribution and Variations of CYN Genes
September 2014 Volume 80 Number 17 aem.asm.org 5221
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

mined by parent ions (m/z 416.1 for CYN and m/z 400.1 for 7-deoxy-
CYN) and corresponding fragments (m/z 336.1, 274.1, and 194.1 for CYN
and m/z 320.1, 274.1, and 194.1 for 7-deoxy-CYN). CYN and 7-epi-CYN
could not be discriminated in the present study and therefore CYN rep-
resented these two analogues.
An efficient high-pressure liquid chromatography (HPLC) method
was established by optimization of the HPLC-PDA method reported by
Welker et al. (60). In brief, the SSI 1500 series system (SSI, USA) and a
Synergi Polar-RP column (4.6 mm by 250 mm, 4 ␮m) maintained at 30°C
was used. The elution conditions were as follows: a linear gradient of 10 to
30% solution B (0.05% trifluoroacetic acid [vol/vol] in 50% aqueous
methanol [vol/vol]) in solution A (0.05% aqueous trifluoroacetic acid
[vol/vol]) for 0 to 10 min, an isocratic stage of 30% solution B for 5 min,
ramping to 100% solution B in 5 min, and final equilibration for 15 min.
An injection volume of 20 ␮l and a flow rate of 0.8 ml min
⫺1
were applied.
UV absorption was detected at 262 nm. Standard CYNs were prepared by
manual collection from elution fractions and then confirmed by LC-MS/
MS. The standards were used for the identification of potential analogues
in samples. In addition, commercial standard CYN (Enzo Life Sciences,
USA) was used for quantification analysis, and the concentration of 7-de-
oxy-CYN was calculated as CYN equivalents.
Detection of toxin production in growth cultures. CYN-producing
cyanobacterial strains were first cultured to obtain original biomass
(OD
680
⫽0.2 to 0.4). The cyanobacterial cells were harvested onto a glass
fiber filter (Whatman, GF/C) by gentle filtration (⬍5 lb/in
2
) at sterile
conditions and washed three times using MA medium. Afterward, the
cells were resuspended and diluted into six parallel cultures (100 ml of MA
for each) in 500-ml Erlenmeyer flasks with a cell density of OD
680
⫽0.13.
The cultures were shaken manually three times every day. After inocula-
tion, random cultures of each strain were used for toxin detection in
triplicate at day 3 and 7, respectively. The cells and spent medium were
separated by gentle filtration (⬍5 lb/in
2
) using membrane filters (MF-
Millipore, 0.22-␮m pore size) and used for toxin extraction and detection
as described above. Statistical analyses were performed by independent-
sample ttest with SPSS 21.0 for Windows, and the differences were taken
as significant at a Pof ⬍0.05.
Nucleotide sequence accession numbers. The nucleotide sequences
obtained in the present study are available under GenBank accession
numbers KJ139686 to KJ139955.
RESULTS
Phylogenetic and geographic distribution of CYN genes. All
DNA templates from cyanobacterial strains and the environmen-
tal samples were confirmed to be efficient for cpc gene amplifica-
tion. A total of 362 cyanobacterial strains, belonging to 10 genera
of three orders, namely, Chroococcales,Nostocales, and Oscillato-
riales, were examined for the presence of cyrJ gene. Positive strains
were then detected for cyrA and cyrI genes. These strains were
collected from 38 freshwater bodies across China, except for sev-
eral Lyngbya strains obtained from swards and hot springs. Four
Cylindrospermopsis strains and two Raphidiopsis strains were con-
firmed to contain cyr genes. CYNs were detected in the cell extracts
of these strains by LC-MS/MS (Table 3). C. raciborskii CHAB3438
and C. raciborskii CHAB3440 contained both CYN and 7-deoxy-
CYN, but the other four strains produced only 7-deoxy-CYN. C.
raciborskii CHAB357, C. raciborskii CHAB3440, and R. curvata
CHAB114 were isolated from the same cyanobacterial popula-
tions as and shared highly similar cyr sequences and toxin produc-
tion to C. raciborskii CHAB358, C. raciborskii CHAB3438, and R.
curvata CHAB1150, respectively. In addition, cyr genes, CYN, and
7-deoxy-CYN were also detected in C. raciborskii cyDB-1.
The presence of cyr genes was also examined in environmental
DNA samples from 25 freshwater bodies. Finally, 13 cyrA,59cyrI,
and 49 cyrJ sequences were obtained from samples collected from
eight lakes and reservoirs (Table 1). A BLAST search revealed high
similarities between environmental cyr sequences and corre-
sponding cyr genes from Cylindrospermopsis and Raphidiopsis
(C/R group, 99%). The environmental cyrA and cyrJ sequences
were also found to be highly similar to the cyr genes of Aphani-
zomenon sp. strain 10E6 (99%). In contrast, the cyrI sequences
were found to have low similarities to the cyrI gene of Aphanizom-
enon sp. strain 10E6 (97%). The environmental cyr sequences and
cyr genes from the C/R group and Aphanizomenon sp. strain 10E6
were clustered into an independent clade in phylogenetic trees
(data not shown). This clade was separated from the cyr genes of
other species by high bootstrap values in the trees of the cyrI and
cyrJ genes (97 to 100%).
Sequence analysis. The cyr genes of C. raciborskii CHAB358
and R. curvata HB1 were sequenced and assembled into two com-
plete gene clusters (Fig. 1). The genome of C. raciborskii
CHAB3438 was assembled using high-quality data with an aver-
age coverage of 220, and the cyr gene cluster was found to be
located in two contigs. The gap was closed by PCR amplification
and Sanger sequencing. The final contig had a length of 50,355 bp
and contained the whole cyr gene cluster (Fig. 1). The cyr genes in
these three gene clusters showed high similarities to those of R.
curvata CHAB1150 (⬎99%). The gene arrangement patterns of
the cyr gene clusters of the C/R group strains from China were
conserved and divergent from that of C. raciborskii AWT205 from
Australia. The cyrN and cyrO genes were absent in the cyr gene
clusters of Chinese strains (Fig. 1).
The CyrI of C. raciborskii CHAB358 was found to be truncated
because of an intragenic stop codon caused by a base transition
from cytosine to thymine at bp 529 (according to C. raciborskii
AWT205 numbering, used here and below). Single-base muta-
tions were also observed within cyrI sequences from TG and SY
reservoirs (see Fig. S3 in the supplemental material). Six sequences
had similar mutations to the cyrI gene of C. raciborskii CHAB358.
Base transversions from guanine to thymine at bp 304 of two
sequences were observed and also formed stop codons. In addi-
tion, four types of cyrI sequences were recognized according to
TABLE 3 CYN-producing cyanobacterial strains isolated from Chinese
freshwater bodies
Strain
Geographic
origin
Result
a
Source or
referencecyrI cyrK CYN
7-Deoxy-
CYN
C. raciborskii
CHAB357 Wenshan Lake M M ND D This study
CHAB358 Wenshan Lake M M ND D This study
CHAB3438 Xianghu Lake H M D D This study
CHAB3440 Xianghu Lake H M D D This study
R. curvata
CHAB114 Chidong Lake M H ND D This study
CHAB1150 Chidong Lake M H ND D Jiang et al.
(38)
CHAB3416 Qiaodun Lake M H ND D This study
HB1 Guanqiao Pond M H D D Li et al.
(22)
a
M, mutant sequences compared to cyr genes of C. raciborskii AWT205; H,
homologous to cyr genes of C. raciborskii AWT205; D, detected; ND, not detected.
Jiang et al.
5222 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

intragenic sequence insertions compared to the cyrI gene of C.
raciborskii AWT205, as depicted in Fig. 2. Itype1 contained no
insertion sequence, but an insertion of a 6-nucleotide fragment,
which is a repeat copy of its upstream sequence, was observed in
Itype2 and Itype3 after bp 622. In addition, another insertion of a
30-nucleotide fragment, which is also a repeat copy of its up-
stream sequence, was observed in Itype3 after bp 494. Moreover,
Itype4a included two kinds of sequences (i.e., Itype4a
f
and
Itype4a
r
) that contained reverse complementary insertion se-
quences of a 92-nucleotide fragment after bp 85, and the insertion
sequences contained identical inverted terminal repeats (ITRs).
The cyrI genes of R. curvata strains and those of other strains were
classified into Itype4 and Itype1, respectively. In particular, both
R. curvata CHAB1150 and R. curvata CHAB3416 contained the
cyrI genes of Itype4a
f
, and the cyrI gene of R. curvata HB1 was
denominated as Itype4b with a long sequence insertion. Com-
pared to Itype1, the deduced protein sequences of Itype2 and
Itype3 were extended with repeated amino acids. The sequence
insertions in Itype4 caused stop codons within the gene sequences
and resulted in truncated protein sequences (see Fig. S4 in the
supplemental material).
A 48-nucleotide fragment was found to be repeated within the
cyrJ sequences. Three cyrJ sequence types—Jtype1, Jtype2, and
Jtype3—were identified based on copy numbers 1, 2, and 3 of this
sequence repeat, respectively (Fig. 3). Jtype2 contained two sub-
types, namely, Jtype2a with two intact repeats and Jtype2b with a
6-nucleotide deletion in the first repeat. Most cyrJ genes from
CYN-producing strains belong to Jtype2a, and those of three C.
raciborskii strains (i.e., AWT205, CS-505, and cyDB-1) and R.
mediterranea FSS-150 belong to a third subtype Jtype2c with a
different 6-nucleotide deletion in the second repeat (Fig. 3). As
displayed in Fig. S5 in the supplemental material, the sequence
repeats within the cyrJ genes of the C/R group and Aphanizomenon
sp. 10E6 were conserved. The second repeats in these species were
divided into two groups based on nucleotide variations. One
group contained the C/R group from Australia and Brazil, and the
other contained the C/R group from China and Aphanizomenon
sp. 10E6. Compared to Jtype1, the deduced protein sequences of
Jtype2 and Jtype3 were extended and contained peptide repeats.
The cyrK genes of C. raciborskii CHAB358 and C. raciborskii
CHAB3438 lacked a thymine nucleotide at bp 1347 unlike those of
C. raciborskii AWT205 (1,398-bp length). This lack of thymine
nucleotide led to the truncation of the C-terminal sequence of
CyrK (Fig. 4). Thus, the CyrK mutant (451 amino acids) was
shorter than the original CyrK (465 amino acids).
Transcription analysis. The transcriptions of cyrI and cyrK
genes were examined for C. raciborskii CHAB358 and C. racibor-
skii CHAB3438. C. raciborskii AWT205 was used as a positive
strain. Pure RNA extracts were not contaminated by genomic
DNA, and cyr gene fragments were obtained from all cDNA sam-
ples. In addition, the amplicons covered the gene regions with
nucleotide mutation and deletions.
Assessment of toxin release. As depicted in Table S4 in the
supplemental material, the cultures of four CYN-producing cya-
nobacterial strains maintained exponential growth from a low
(OD
680
⫽0.13) to a high (OD
680
⫽0.34 to 0.61) cell density. The
concentrations and extracellular percentages of CYNs were ana-
lyzed (Table 4; see also Table S4 in the supplemental material).
FIG 1 Schematic structure of cyr gene clusters from CYN-producing cyanobacterial strains. Gray and white bars, cyr genes; black bar, transposase sequences or
vestiges thereof; open triangles, base mutation in this position; solid triangles, nucleotide deletion in this position.
Distribution and Variations of CYN Genes
September 2014 Volume 80 Number 17 aem.asm.org 5223
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

Only 7-deoxy-CYN was detected in C. raciborskii CHAB358 and
R. curvata CHAB1150, and a high percentage of CYN was ob-
served in both extracellular (92 to 96%) and intracellular (95 to
98%) CYNs of C. raciborskii AWT205 and C. raciborskii
CHAB3438. The extracellular percentages of CYN (30 to 39%),
7-deoxy-CYN (24 to 51%), and total CYNs (24 to 40%) on day 7
were significantly higher than the corresponding percentages on
day 3 for all strains except C. raciborskii CHAB3438. The extracel-
lular percentages of CYN and 7-deoxy-CYN between C. raciborskii
AWT205 and C. raciborskii CHAB3438 were not significantly dif-
ferent except those of 7-deoxy-CYN on day 3. The extracellular
percentages of 7-deoxy-CYN in C. raciborskii CHAB358 and R.
curvata CHAB1150 were similar and significantly lower than
those of other two strains, except between C. raciborskii AWT205
and C. raciborskii CHAB358 on day 3. For the extracellular per-
centages of the total CYNs, C. raciborskii CHAB358 and R. curvata
CHAB1150 had lower values, with the significantly lowest per-
centage for R. curvata CHAB1150 on day 3 (15% ⫾1.0%) and the
significantly highest percentage for C. raciborskii AWT205 on day
7 (40% ⫾3.0%).
Phylogenetics of potential CYN producers based on rpoC1
sequences. As displayed in Table 1,rpoC1 genes were detected in
19 lakes and reservoirs by C/R group specific primers, and 88
rpoC1 sequences were obtained. All of these sequences were con-
firmed to be derived from the C/R group by best BLASTn hits. Five
independent clades were observed in the phylogenetic tree of
rpoC1 sequences, and high support values were obtained for the
divergence of clade I and clade II (Fig. 5). High sequence similar-
ities were displayed within four clades: clade I (⬎97%), clade II
(⬎99%), clade III (⬎98%), and clade V (⬎98%). However, clade
IV comprised sequences with low to high similarities (95% to
100%), which is consistent with the long branches of this clade in
the tree. Sequence similarities among clades were also calculated.
The values between clade I and clade II (96 to 98%) were higher
FIG 2 Illustration of four sequence types of the cyrI gene. (A) Schematic structures of cyrI sequence types. White bar, cyrI sequences; black and gray bars, repeat
sequences; slash and backslash bar, insertion sequences; C. raciborskii AWT205, reference strain. (B) Partial alignment of representative cyrI gene sequences.
Repeat sequences and insertion sequences were italicized. Dashed line, gaps introduced into the alignment; bold line, ITRs; arrow, beginning of the repeat
sequences.
Jiang et al.
5224 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

than those between these two and other clades (93 to 97%). In addi-
tion, median values were found between clade III and clade IV (95 to
96%). Also, clade V was the most divergent of all clades with lowest
similarities (93 to 96%). Both clade I and clade V contained reference
sequences from Raphidiopsis. However, the former was a Raphidiop-
sis-mix clade related to both R. mediterranea and R. curvata, whereas
the latter was related to R. curvata only and thus was a R. curvata-like
clade. Clade II contained reference sequences from Cylindrospermop-
sis and was denominated as a Cylindrospermopsis-like clade. For the
closely related clade III and clade IV, no reference sequence was ob-
tained for the former, but the latter included two reference sequences
from C. raciborskii CHAB3409 and R. brookii D9. In addition, CYN-
producing strains, along with non-CYN-producing strains, clustered
together in clade II and clade V.
DISCUSSION
As displayed in Table 3, four C. raciborskii strains and four R.
curvata strains from Chinese freshwater bodies were confirmed to
FIG 3 Illustration of three sequence types of the cyrJ gene. (A) Schematic structures of cyrJ sequence types. White bar, cyrJ sequence; gray bar, repeat sequences;
triangle, nucleotide deletions; C. raciborskii AWT205, reference strain. (B) Partial alignment of representative cyrJ gene sequences and deduced protein se-
quences. Repeat sequences were italicized. Dashed line, gaps introduced into the alignment; arrow, beginning of the repeat sequences.
FIG 4 Partial alignment of mutant cyrK gene sequences and deduced protein sequences. Rectangle, nucleotide deletion; asterisk, stop codon.
Distribution and Variations of CYN Genes
September 2014 Volume 80 Number 17 aem.asm.org 5225
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

contain both cyr genes and CYNs. However, CYN-producing
strains constituted only a small percentage of the total cyanobac-
terial strains in the present study (1.7%). The cyr genes were also
detected in eight freshwater bodies from which five CYN-produc-
ing strains were isolated. All of these aquatic ecosystems were lo-
cated in the subtropical region.
Homologous and phylogenetic analyses revealed that the cloned
cyr sequences from environmental samples were most likely to be
derived from the C/R group. The mixed clade of cyr genes from the
C/R group and Aphanizomenon sp. 10E6 was due to highly conserved
sequences and few information sites (38,39,62).
The deduced protein sequences of Itype1 to Itype3 were con-
served. The 6-nucleotide insertion in Itype2 and Itype3 formed
two additional amino acids that belong to ␣-helix in the predicted
secondary structures of CyrI proteins (see Fig. S6 in the supple-
mental material), and the 30-nucleotide insertion in Itype3
formed a duplicate peptide, including two residues involved in
Fe
2⫹
binding (42). The reverse complementary insertion se-
quences in Itype4a
f
and Itype4a
r
provided more evidence for the
transposon origin of these insertions. Similarly, the insertions of
transposable elements within microcystin genes have also been
reported (63,64). The cyrI genes of two C. raciborskii strains con-
tained base mutations, and those of four R. curvata strains denom-
inated as Itype4 contained insertion mutations (Table 3). All of
these mutations caused truncated protein sequences of CyrI, and
therefore five strains synthesized only 7-deoxy-CYN due to the
lack of CyrI function, as discussed earlier (38). Likewise, the cyrI
gene variations may explain the high concentrations of 7-deoxy-
CYN rather than CYN in L.wollei (31), C. raciborskii ISG9 (65),
and the field populations of C. raciborskii (49).
The 48-nucleotide repeats in Jtype2 and Jtype3 caused dupli-
cate peptides that belong to ␣-helix in the predicted secondary
structures of CyrJ proteins (see Fig. S7 in the supplemental mate-
rial). CYNs have been detected in cyanobacterial strains with the
cyrJ genes of Jtype2a and Jtype2c. Therefore, nucleotide deletion
in one repeat of Jtype2 does not lead to the deficiency of CyrJ
function. The conservation of sequence repeats within cyrJ genes
among the C/R group and Aphanizomenon sp. emphasized the
horizontal gene transfer (HGT) among these species as described
by Jiang et al. (38). According to the second repeat, the C/R group
strains differed between China and Australia/Brazil, a finding
which coincided with different arrangement patterns of the cyr
gene clusters. Therefore, HGT events were hypothesized to have
occurred between local Cylindrospermopsis and Raphidiopsis spe-
cies.
Neutral evolution has been demonstrated for most cyr genes
with low frequency of negatively selected codons (38), but purify-
ing selection has also been found for the adenylation domain of
Aphanizomenon ovalisporum-like cyrB sequences (66). Selection
analysis of a large data set of environmental cyr sequences revealed
evidence for neither recombination nor positive selection. Fur-
ther, both cyrI and cyrJ sequences were not under neutral evolu-
tion (Tajima’s test, P⬍0.01) with 1 to 11 negatively selected
codons. Thus, these two cyr genes from the C/R group may be
under weak purifying selection. The sequence variations may be
anciently created during the formation of these genes.
The CyrK sequences of four C. raciborskii strains were trun-
cated at the C-terminal ends due to single-nucleotide deletions
within the cyrK genes. However, the transcription of mutant cyrK
and cyrI genes could still be detected. The transcription of cyrI
genes may be ascribed to the cotranscription of polycistron (38),
but cyrK gene was transcribed in the direction opposite to that of
other cyr genes (Fig. 2). The release of CYNs in four strains with
the CyrK of different lengths was investigated during a short cul-
ture period. A minor proportion of the total CYNs were extracel-
lular for each strain (15 to 40%), but the accumulation of extra-
cellular CYNs during the exponential growth phase must result
from active release as proposed by Preussel et al. (47). The release
was probably mediated by the transporter protein CyrK (37). The
extracellular percentages of CYNs were strain dependent and did
not correlate with CyrK lengths. Therefore, the mutant CyrK may
function as the original CyrK.
Stucken et al. (67) found that the cyr gene cluster of Australian
Cylindrospermopsis strains is inserted into a hydrogenase gene
cluster (hyp). The genome sequencing of C. raciborskii CHAB3438
also revealed a hyp gene cluster (see Fig. S8 in the supplemental
material). Four ORFs were observed between hypF and hupC
genes, including two transposases (T1 and T2), as well as cyrN and
cyrO genes. Intergenic sequences between hypF and hupC genes in
other strains of the C/R group were also characterized (see Fig. S8
in the supplemental material). As a result, the cyrN gene was only
found in CYN-producing strains, and the cyrO gene was observed
in both CYN-producing and non-CYN-producing strains. There-
fore, the cyrN gene, rather than the cyrO gene, likely belongs to the
cyr gene cluster. The whole cyr gene cluster was probably originally
inserted into the hyp gene cluster and then translocated to other
genomic loci, with cyrN being a remnant. On the other hand, the
cyr genes may have experienced acquisition, loss, and reacquisi-
tion in Chinese CYN-producing strains. The transfer of the cyr
gene cluster was probably mediated by transposases observed to
surround the gene cluster and between hyp genes.
The screening detection of potential CYN producers in the
present study was performed with cyrJ gene as a molecular probe
for its higher specificity to CYN-producing species than PS/PKS
genes (37). However, Cylindrospermopsis-like cyr fragments ex-
cept cyrJ were detected in Cylindrospermopsis strains from Brazil
and water samples from Florida (34,36). The Brazilian C. racibor-
skii cyDB-1 showed the presence of both cyr genes and CYNs and
thus provides strong evidence for the distribution of CYN-pro-
ducing Cylindrospermopsis in the American continent.
The aquatic ecosystems that contained rpoC1 genes of C/R
group included those with cyr genes and are located in both sub-
TABLE 4 Percent extracellular CYNs in cultures of four CYN-
producing cyanobacterial strains
CYN
Mean extracellular CYN content (%) ⫾SD
a
AWT205 CHAB358 CHAB3438 CHAB1150
CYN
Day 3 27 ⫾6.0 – 24 ⫾3.0 –
Day 7 39 ⫾3.0 – 30 ⫾6.0 –
7-Deoxy-CYN
Day 3 24 ⫾4.0 21 ⫾1.0 47 ⫾4.0 15 ⫾1.0
Day 7 45 ⫾2.0 24 ⫾1.0 51 ⫾9.0 26 ⫾2.0
Total CYNs
Day 3 27 ⫾6.0 21 ⫾1.0 25 ⫾3.0 15 ⫾1.0
Day 7 40 ⫾3.0 24 ⫾1.0 31 ⫾6.0 26 ⫾2.0
a
The four strains are described in the text. Data obtained on days 3 and 7 after
inoculation are shown. ⫺, not detected.
Jiang et al.
5226 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

FIG 5 Phylogenetic tree of rpoC1 gene sequences from environmental samples and cyanobacterial strains (topology based on a Bayesian tree). Bootstrap values
above 50% are indicated at the nodes of the tree (Bayesian/ML/NJ). Aphanizomenon gracile ANA196-A and Anabaena variabilis ATCC 29413 were used as
outgroups.
September 2014 Volume 80 Number 17 aem.asm.org 5227
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

tropical and temperate regions. Thus, non-CYN-producing spe-
cies were more widely distributed than were the CYN-producing
species. The phylogenetics of potential CYN producers (C/R
group) were analyzed based on the rpoC1 gene that displays higher
discriminatory power at the genus and species levels than does the
16S rrn gene (68). The sequences in each clade were homogeneous
but a little divergent in clade IV. Low support values were ob-
tained for most of the five clades (Fig. 5), but sequence similarities
among clades were lower than those within each clade. Raphidi-
opsis-mix clade I, Cylindrospermopsis-like clade II, and R. curvata-
like clade V were also observed in a phylogenetic tree based on
multigene sequences (69). Clade III and clade IV indicated cryptic
and intricate evolutionary clades in C/R group. Clade III, clade IV,
and clade V contained sequences from only subtropical regions,
indicating the existence of warm-adaptive species in the C/R
group. The distribution of CYN producers in these clades was
sporadic, as reported previously (70). Cylindrospermopsis and
Raphidiopsis might be congeneric as previously described (67).
Meanwhile, both genera are suggested to be paraphyletic and tax-
onomic reconsideration of the C/R group is necessary.
Previous phylogeographic studies have suggested that Cylin-
drospermopsis strains were separated into three distinct groups,
namely, strains from Australia, Europe, and America, with Afri-
can strains and the former two groups being closely related (71–
74). However, inconsistent phylogenetics have been observed for
Tunisian and Spanish strains clustered into the America group
(75,76), and for clade II with strains from China, Australia, and
Brazil without geographical separation. The present hypotheses
suggested that the worldwide dispersion of Cylindrospermopsis
originated from the tropical zones of Africa and Australia (77)or
the warm refuge areas of each continent (73). The invasion success
of Cylindrospermopsis has been attributed to phenotypic plasticity
and different ecotypes (2,74). On the contrary, the adaptability of
Cylindrospermopsis and closely related Raphidiopsis in different
environmental conditions may imply that the two species have
similar cosmopolitan distribution to Microcystis (78), instead of
invasive colonization. Furthermore, the coexistence of local and
invasive species is a probable reason for the inconsistent results of
phylogeographic analyses. For instance, R. curvata CHAB3413
and R. curvata CHAB3416 were isolated from the same water body
with highly similar morphology and clustered into clade I and
clade V, respectively. Worldwide cooperation is suggested for fur-
ther phylogeographic study of Cylindrospermopsis and Raphidiop-
sis with strains from all climate conditions of each continent and
through more effective methods, such as comparative genomics.
Particularly, evidence for the distribution and growth conditions
of Raphidiopsis should be provided in the future.
In conclusion, CYN biosynthesis genes were found to be spo-
radically distributed in cyanobacterial strains and freshwater eco-
systems of China. All of the CYN-producing strains and environ-
mental cyr sequences described here belong to congeneric and
paraphyletic Cylindrospermopsis and Raphidiopsis species. Dis-
tinctive sequence variations, including base mutations, repeat se-
quences, and transposon insertions in the conserved cyr genes, are
likely to be created during the formation of these genes. The C-
terminal sequence of CyrK is probably not crucial for its function
as a transporter. The cyrN gene is likely to be a member of the cyr
gene cluster and distant from other cyr genes in Chinese CYN-
producing strains. The intragenomic translocations and HGT of
the cyr gene cluster are related to flanking transposases. The
worldwide dispersion of Cylindrospermopsis may result from the
simultaneous spread of local and invasive species.
ACKNOWLEDGMENTS
We are grateful to Assaf Sukenik for the provision of the strain Aphani-
zomenon ovalisporum ILC-164.
This research was supported by the National Natural Science Founda-
tion of China (31170189) and the National Water Science and Technology
Projects (2012ZX07101-02-001-01 and 2012ZX07105-004).
REFERENCES
1. Paerl HW, Huisman J. 2009. Climate change: a catalyst for global expan-
sion of harmful cyanobacterial blooms. Environ. Microbiol. Rep. 1:27–37.
http://dx.doi.org/10.1111/j.1758-2229.2008.00004.x.
2. Bonilla S, Aubriot L, Soares MCS, González-Piana M, Fabre A, Huszar
VLM, Lürling M, Antoniades D, Padisák J, Kruk C. 2012. What drives
the distribution of the bloom-forming cyanobacteria Planktothrix agard-
hii and Cylindrospermopsis raciborskii? FEMS Microbiol. Ecol. 79:594 –
607. http://dx.doi.org/10.1111/j.1574-6941.2011.01242.x.
3. Sinha R, Pearson LA, Davis TW, Burford MA, Orr PT, Neilan BA. 2012.
Increased incidence of Cylindrospermopsis raciborskii in temperate zones:
is climate change responsible? Water Res. 46:1408 –1419. http://dx.doi.org
/10.1016/j.watres.2011.12.019.
4. Paerl HW, Otten TG. 2013. Harmful cyanobacterial blooms: causes,
consequences, and controls. Microb. Ecol. 65:995–1010. http://dx.doi.org
/10.1007/s00248-012-0159-y.
5. Pearson L, Mihali T, Moffitt M, Kellmann R, Neilan B. 2010. On the
chemistry, toxicology and genetics of the cyanobacterial toxins, microcys-
tin, nodularin, saxitoxin, and cylindrospermopsin. Mar. Drugs 8:1650 –
1680. http://dx.doi.org/10.3390/md8051650.
6. Dittmann E, Fewer DP, Neilan BA. 2013. Cyanobacterial toxins: biosyn-
thetic routes and evolutionary roots. FEMS Microbiol. Rev. 37:23– 43.
http://dx.doi.org/10.1111/j.1574-6976.2012.12000.x.
7. Neilan BA, Pearson LA, Muenchhoff J, Moffitt MC, Dittmann E. 2013.
Environmental conditions that influence toxin biosynthesis in cyanobac-
teria. Environ. Microbiol. 15:1239 –1253. http://dx.doi.org/10.1111/j
.1462-2920.2012.02729.x.
8. Byth S. 1980. Palm Island mystery disease. Med. J. Aust. 2:40 – 42.
9. Hawkins PR, Runnegar MTC, Jackson ARB, Falconer IR. 1985. Severe
hepatotoxicity caused by the tropical cyanobacterium (blue-green alga)
Cylindrospermopsis raciborskii (Woloszynska) Seenaya and Subba Raju
isolated from a domestic water supply reservoir. Appl. Environ. Micro-
biol. 50:1292–1295.
10. Ohtani I, Moore RE, Runnegar MTC. 1992. Cylindrospermopsin: a
potent hepatotoxin from the blue-green alga Cylindrospermopsis raci-
borskii. J. Am. Chem. Soc. 114:7942–7944. http://dx.doi.org/10.1021
/ja00046a068.
11. Banker R, Teltsch B, Sukenik A, Carmeli S. 2000. 7-Epicylindrosper-
mopsin, a toxic minor metabolite of the cyanobacterium Aphanizomenon
ovalisporum from Lake Kinneret, Israel. J. Nat. Prod. 63:387–389. http:
//dx.doi.org/10.1021/np990498m.
12. Norris RL, Eaglesham GK, Pierens G, Shaw GR, Smith MJ, Chiswell RK,
Seawright AA, Moore MR. 1999. Deoxycylindrospermopsin, an analog of
cylindrospermopsin from Cylindrospermopsis raciborskii. Environ. Toxi-
col. 14:163–165.
13. Terao K, Ohmori S, Igarashi K, Ohtani I, Watanabe MF, Harada KI, Ito
E, Watanabe M. 1994. Electron microscopic studies on experimental
poisoning in mice induced by cylindrospermopsin isolated from blue-
green alga Umezakia natans. Toxicon 32:833– 843. http://dx.doi.org/10
.1016/0041-0101(94)90008-6.
14. Froscio SM, Humpage AR, Wickramasinghe W, Shaw G, Falconer IR.
2008. Interaction of the cyanobacterial toxin cylindrospermopsin with the
eukaryotic protein synthesis system. Toxicon 51:191–198. http://dx.doi
.org/10.1016/j.toxicon.2007.09.001.
15. Runnegar MT, Kong SM, Zhong YZ, Lu SC. 1995. Inhibition of reduced
glutathione synthesis by cyanobacterial alkaloid cylindrospermopsin in
cultured rat hepatocytes. Biochem. Pharmacol. 49:219 –225. http://dx.doi
.org/10.1016/S0006-2952(94)00466-8.
16. Reisner M, Carmeli S, Werman M, Sukenik A. 2004. The cyanobacterial
toxin cylindrospermopsin inhibits pyrimidine nucleotide synthesis and
alters cholesterol distribution in mice. Toxicol. Sci. 82:620 – 627. http://dx
.doi.org/10.1093/toxsci/kfh267.
Jiang et al.
5228 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

17. Bazin E, Huet S, Jarry G, Hégarat LL, Munday JS, Humpage AR,
Fessard V. 2012. Cytotoxic and genotoxic effects of cylindrospermopsin
in mice treated by gavage or intraperitoneal injection. Environ. Toxicol.
27:277–284. http://dx.doi.org/10.1002/tox.20640.
18. Alja Š, Filipi cˇ M, Novak M, Žegura B. 2013. Double strand breaks and
cell-cycle arrest induced by the cyanobacterial toxin cylindrospermopsin
in HepG2 cells. Mar. Drugs 11:3077–3090. http://dx.doi.org/10.3390
/md11083077.
19. Banker R, Carmeli S, Werman M, Teltsch B, Porat R, Sukenik A. 2001.
Uracil moiety is required for toxicity of the cyanobacterial hepatotoxin
cylindrospermopsin. J. Toxicol. Environ. Health A 62:281–288. http://dx
.doi.org/10.1080/009841001459432.
20. Saker ML, Eaglesham GK. 1999. The accumulation of cylindrospermop-
sin from the cyanobacterium Cylindrospermopsis raciborskii in tissues of
the redclaw crayfish Cherax quadricarinatus. Toxicon 37:1065–1077. http:
//dx.doi.org/10.1016/S0041-0101(98)00240-2.
21. Kinnear S. 2010. Cylindrospermopsin: a decade of progress on bioac-
cumulation research. Mar. drugs 8:542–564. http://dx.doi.org/10.3390
/md8030542.
22. Li R, Carmichael WW, Brittain S, Eaglesham GK, Shaw GR, Liu Y,
Watanabe MM. 2001. First report of the cyanotoxins cylindrospermopsin
and deoxycylindrospermopsin from Raphidiopsis curvata (Cyanobacte-
ria). J. Phycol. 37:1121–1126. http://dx.doi.org/10.1046/j.1529-8817.2001
.01075.x.
23. McGregor GB, Sendall BC, Hunt LT, Eaglesham GK. 2011. Report of the
cyanotoxins cylindrospermopsin and deoxy-cylindrospermopsin from
Raphidiopsis mediterranea Skuja (Cyanobacteria/Nostocales). Harmful
Algae 10:402– 410. http://dx.doi.org/10.1016/j.hal.2011.02.002.
24. Banker R, Carmeli S, Hadas O, Teltsch B, Porat R, Sukenik A. 1997.
Identification of cylindrospermopsin in Aphanizomenon ovalisporum (Cy-
anophyceae) isolated from Lake Kinneret, Israel. J. Phycol. 33:613– 616.
http://dx.doi.org/10.1111/j.0022-3646.1997.00613.x.
25. Preussel K, Stüken A, Wiedner C, Chorus I, Fastner J. 2006. First report
on cylindrospermopsin producing Aphanizomenon flos-aquae (Cyano-
bacteria) isolated from two German lakes. Toxicon 47:156 –162. http://dx
.doi.org/10.1016/j.toxicon.2005.10.013.
26. Kokocin´ski M, Mankiewicz-Boczek J, Jurczak T, Spoof L, Meriluoto J,
Rejmonczyk E, Hautala H, Vehniäinen M, Pawełczyk J, Soininen J.
2013. Aphanizomenon gracile (Nostocales), a cylindrospermopsin-
producing cyanobacterium in Polish lakes. Environ. Sci. Pollut. Res. 20:
5243–5264. http://dx.doi.org/10.1007/s11356-012-1426-7.
27. Spoof L, Berg KA, Rapala J, Lahti K, Lepistö L, Metcalf JS, Meriluoto J.
2006. First observation of cylindrospermopsin in Anabaena lapponica iso-
lated from the boreal environment (Finland). Environ. Toxicol. 21:552–
560. http://dx.doi.org/10.1002/tox.20216.
28. Harada KI, Ohtani I, Iwamoto K, Suzuki M, Watanabe MF, Watanabe
M, Terao K. 1994. Isolation of cylindrospermopsin from a cyanobacte-
rium Umezakia natans and its screening method. Toxicon 32:73– 84. http:
//dx.doi.org/10.1016/0041-0101(94)90023-X.
29. Niiyama Y, Tuji A, Tsujimura S. 2011. Umezakia natans M. Watan. does
not belong to Stigonemataceae but to Nostocaceae. Fottea 11:163–169.
30. Mazmouz R, Chapuis-Hugon F, Mann S, Pichon V, Méjean A, Ploux O.
2010. Biosynthesis of cylindrospermopsin and 7-epicylindrospermopsin
in Oscillatoria sp. strain PCC 6506: identification of the cyr gene cluster
and toxin analysis. Appl. Environ. Microbiol. 76:4943– 4949. http://dx.doi
.org/10.1128/AEM.00717-10.
31. Seifert M, McGregor G, Eaglesham G, Wickramasinghe W, Shaw G.
2007. First evidence for the production of cylindrospermopsin and deoxy-
cylindrospermopsin by the freshwater benthic cyanobacterium, Lyngbya
wollei (Farlow ex Gomont) Speziale and Dyck. Harmful Algae 6:73– 80.
http://dx.doi.org/10.1016/j.hal.2006.07.001.
32. Fastner J, Heinze R, Humpage AR, Mischke U, Eaglesham GK, Chorus
I. 2003. Cylindrospermopsin occurrence in two German lakes and pre-
liminary assessment of toxicity and toxin production of Cylindrospermop-
sis raciborskii (Cyanobacteria) isolates. Toxicon. 42:313–321. http://dx.doi
.org/10.1016/S0041-0101(03)00150-8.
33. Valério E, Pereira P, Saker ML, Franca S, Tenreiro R. 2005. Molecular
characterization of Cylindrospermopsis raciborskii strains isolated from
Portuguese freshwaters. Harmful Algae 4:1044 –1052. http://dx.doi.org
/10.1016/j.hal.2005.03.002.
34. Yilmaz M, Phlips EJ, Szabo NJ, Badylak S. 2008. A comparative study of
Florida strains of Cylindrospermopsis and Aphanizomenon for cylindro-
spermopsin production. Toxicon 51:130 –139. http://dx.doi.org/10.1016
/j.toxicon.2007.08.013.
35. Mankiewicz-Boczek J, Kokocin´ski M, Gagała I, Pawełczyk J, Jurczak T,
Dziadek J. 2012. Preliminary molecular identification of cylindrosper-
mopsin-producing cyanobacteria in two Polish lakes (Central Europe).
FEMS Microbiol. Lett. 326:173–179. http://dx.doi.org/10.1111/j.1574
-6968.2011.02451.x.
36. Hoff-Risseti C, Dörr FA, Schaker PDC, Pinto E, Werner VR, Fiore MF.
2013. Cylindrospermopsin and saxitoxin synthetase genes in Cylindro-
spermopsis raciborskii strains from Brazilian freshwater. PLoS One
8:e74238. http://dx.doi.org/10.1371/journal.pone.0074238.
37. Mihali TK, Kellmann R, Muenchhoff J, Barrow KD, Neilan BA. 2008.
Characterization of the gene cluster responsible for cylindrospermopsin
biosynthesis. Appl. Environ. Microbiol. 74:716 –722. http://dx.doi.org/10
.1128/AEM.01988-07.
38. Jiang Y, Xiao P, Yu G, Sano T, Pan Q, Li R. 2012. Molecular basis and
phylogenetic implications of deoxycylindrospermopsin biosynthesis in
the cyanobacterium Raphidiopsis curvata. Appl. Environ. Microbiol. 78:
2256 –2263. http://dx.doi.org/10.1128/AEM.07321-11.
39. Stüken A, Jakobsen KS. 2010. The cylindrospermopsin gene cluster of
Aphanizomenon sp. strain 10E6: organization and recombination. Micro-
biology 156:2438 –2451. http://dx.doi.org/10.1099/mic.0.036988-0.
40. Muenchhoff J, Siddiqui KS, Poljak A, Raftery MJ, Barrow KD, Neilan
BA. 2010. A novel prokaryotic L-arginine: glycine amidinotransferase is
involved in cylindrospermopsin biosynthesis. FEBS J. 277:3844 –3860.
http://dx.doi.org/10.1111/j.1742-4658.2010.07788.x.
41. Burgoyne DL, Hemscheidt TK, Moore RE, Runnegar MTC. 2000.
Biosynthesis of cylindrospermopsin. J. Org. Chem. 65:152–156. http://dx
.doi.org/10.1021/jo991257m.
42. Mazmouz R, Chapuis-Hugon F, Pichon V, Méjean A, Ploux O. 2011.
The Last step of the biosynthesis of the cyanotoxins cylindrospermopsin
and 7-epi-cylindrospermopsin is catalyzed by CyrI, a 2-oxoglutarate-
dependent iron oxygenase. Chembiochem 12:858 – 862. http://dx.doi.org
/10.1002/cbic.201000726.
43. Shalev-Malul G, Lieman-Hurwitz J, Viner-Mozzini Y, Sukenik A, Gaa-
thon A, Lebendiker M, Kaplan A. 2008. An AbrB-like protein might be
involved in the regulation of cylindrospermopsin production by Aphani-
zomenon ovalisporum. Environ. Microbiol. 10:988 –999. http://dx.doi.org
/10.1111/j.1462-2920.2007.01519.x.
44. Saker ML, Griffiths DJ. 2000. The effect of temperature on growth and
cylindrospermopsin content of seven isolates of Cylindrospermopsis raci-
borskii (Nostocales, Cyanophyceae) from water bodies in northern Aus-
tralia. Phycologia 39:349 –354. http://dx.doi.org/10.2216/i0031-8884-39
-4-349.1.
45. Saker ML, Neilan BA. 2001. Varied diazotrophies, morphologies, and
toxicities of genetically similar isolates of Cylindrospermopsis raciborskii
from northern Australia. Appl. Environ. Microbiol. 67:1839 –1845. http:
//dx.doi.org/10.1128/AEM.67.4.1839-1845.2001.
46. Bácsi I, Vasas G, Surányi G, Máthé C, Tóth E, Grigorszky I, Gáspár A,
Tóth S, Borbely G. 2006. Alteration of cylindrospermopsin production in
sulfate- or phosphate-starved cyanobacterium Aphanizomenon ovalispo-
rum. FEMS Microbiol. Lett. 259:303–310. http://dx.doi.org/10.1111/j
.1574-6968.2006.00282.x.
47. Preussel K, Wessel G, Fastner J, Chorus I. 2009. Response of cylindro-
spermopsin production and release in Aphanizomenon flos-aquae (Cyano-
bacteria) to varying light and temperature conditions. Harmful Algae
8:645– 650. http://dx.doi.org/10.1016/j.hal.2008.10.009.
48. Bar-Yosef Y, Sukenik A, Hadas O, Viner-Mozzini Y, Kaplan A. 2010.
Enslavement in the water body by toxic Aphanizomenon ovalisporum, in-
ducing alkaline phosphatase in phytoplanktons. Curr. Biol. 20:1557–1561.
http://dx.doi.org/10.1016/j.cub.2010.07.032.
49. Orr PT, Rasmussen JP, Burford MA, Eaglesham GK, Lennox SM. 2010.
Evaluation of quantitative real-time PCR to characterise spatial and tem-
poral variations in cyanobacteria, Cylindrospermopsis raciborskii (Wolo-
szynska) See-naya et Subba Raju and cylindrospermopsin concentrations
in three subtropical Australian reservoirs. Harmful Algae 9:243–254. http:
//dx.doi.org/10.1016/j.hal.2009.11.001.
50. Cirés S, Wörmer L, Timón J, Wiedner C, Quesada A. 2011. Cylindro-
spermopsin production and release by the potentially invasive cyanobac-
terium Aphanizomenon ovalisporum under temperature and light gradi-
ents. Harmful Algae 10:668 – 675. http://dx.doi.org/10.1016/j.hal.2011.05
.002.
51. Davis TW, Orr PT, Boyer GL, Burford MA. 2014. Investigating the
Distribution and Variations of CYN Genes
September 2014 Volume 80 Number 17 aem.asm.org 5229
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from

production and release of cylindrospermopsin and deoxy-
cylindrospermopsin by Cylindrospermopsis raciborskii over a natural
growth cycle. Harmful Algae 31:18 –25. http://dx.doi.org/10.1016/j.hal
.2013.09.007.
52. Lei L, Peng L, Huang X, Han B. 2014. Occurrence and dominance of
Cylindrospermopsis raciborskii and dissolved cylindrospermopsin in urban
reservoirs used for drinking water supply, South China. Environ. Monit.
Assess. 186:3079 –3090. http://dx.doi.org/10.1007/s10661-013-3602-8.
53. Ichimura T. 1979. Media for the cultivation of algae, p 295–296. In
Nishizawa K, Chihara M (ed), Methods in phycological studies. Kyouritu
Press, Tokyo, Japan. (In Japanese.)
54. Neilan BA, Jacobs D, Goodman AE. 1995. Genetic diversity and phylog-
eny of toxic cyanobacteria determined by DNA polymorphisms within the
phycocyanin locus. Appl. Environ. Microbiol. 61:3875–3883.
55. Posada D, Crandall KA. 1998. Modeltest: testing the model of DNA
substitution. Bioinformatics 14:817– 818. http://dx.doi.org/10.1093
/bioinformatics/14.9.817.
56. Guindon S, Dufayard JF, Lefort V, Anisimova M, Hordijk W, Gascuel
O. 2010. New algorithms and methods to estimate maximum-likelihood
phylogenies: assessing the performance of PhyML 3.0. Syst. Biol. 59:307–
321. http://dx.doi.org/10.1093/sysbio/syq010.
57. Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of
phylogenetic trees. Bioinformatics 17:754 –755. http://dx.doi.org/10.1093
/bioinformatics/17.8.754.
58. Tamura K, Dudley J, Nei M, Kumar S. 2007. MEGA4: molecular evo-
lutionary genetics analysis (MEGA) software version 4.0. Mol. Biol. Evol.
24:1596 –1599. http://dx.doi.org/10.1093/molbev/msm092.
59. Jones DT. 1999. Protein secondary structure prediction based on posi-
tion-specific scoring matrices. J. Mol. Biol. 292:195–202. http://dx.doi.org
/10.1006/jmbi.1999.3091.
60. Welker M, Bickel H, Fastner J. 2002. HPLC-PDA detection of cylindro-
spermopsin: opportunities and limits. Water Res. 36:4659 – 4663. http:
//dx.doi.org/10.1016/S0043-1354(02)00194-X.
61. Wormer L, Carrasco D, Cirés S, Quesada A. 2009. Advances in solid-phase
extraction of the cyanobacterial toxin cylindrospermopsin. Limnol. Ocean-
ogr. Methods 7:568 –575. http://dx.doi.org/10.4319/lom.2009.7.568.
62. Kellmann R, Mills T, Neilan BA. 2006. Functional modeling and phylo-
genetic distribution of putative cylindrospermopsin biosynthesis en-
zymes. J. Mol. Evol. 62:267–280. http://dx.doi.org/10.1007/s00239-005
-0030-6.
63. Christiansen G, Kurmayer R, Liu Q, Börner T. 2006. Transposons
inactivate biosynthesis of the nonribosomal peptide microcystin in natu-
rally occurring Planktothrix spp. Appl. Environ. Microbiol. 72:117–123.
http://dx.doi.org/10.1128/AEM.72.1.117-123.2006.
64. Fewer DP, Halinen K, Sipari H, Bernardová K, Mänttäri M, Eronen E,
Sivonen K. 2011. Non-autonomous transposable elements associated
with inactivation of microcystin gene clusters in strains of the genus
Anabaena isolated from the Baltic Sea. Environ. Microbiol. Rep. 3:189 –
194. http://dx.doi.org/10.1111/j.1758-2229.2010.00207.x.
65. Zarenezhad S, Sano T, Watanabe MM, Kawachi M. 2012. Evidence of
the existence of a toxic form of Cylindrospermopsis raciborskii (Nostocales,
Cyanobacteria) in Japan. Phycological Res. 60:98 –104. http://dx.doi.org
/10.1111/j.1440-1835.2012.00639.x.
66. Yilmaz M, Phlips EJ. 2011. Diversity of and selection acting on cylin-
drospermopsin cyrB gene adenylation domain sequences in Florida.
Appl. Environ. Microbiol. 77:2502–2507. http://dx.doi.org/10.1128
/AEM.02252-10.
67. Stucken K, John U, Cembella A, Murillo AA, Soto-Liebe K, Fuentes-
Valdéz JJ, Friedel M, Plominsky AM, Vásquez M, Glöckner G. 2010.
The smallest known genomes of multicellular and toxic cyanobacteria:
comparison, minimal gene sets for linked traits and the evolutionary im-
plications. PLoS One 5:e9235. http://dx.doi.org/10.1371/journal.pone
.0009235.
68. Toledo G, Palenik B. 1997. Synechococcus diversity in the California
current as seen by RNA polymerase (rpoC1) gene sequences of isolated
strains. Appl. Environ. Microbiol. 63:4298 – 4303.
69. Wu Z, Shi J, Xiao P, Liu Y, Li R. 2011. Phylogenetic analysis of two
cyanobacterial genera Cylindrospermopsis and Raphidiopsis based on
multi-gene sequences. Harmful Algae 10:419 – 425. http://dx.doi.org/10
.1016/j.hal.2010.05.001.
70. Stucken K, Murillo AA, Soto-Liebe K, Fuentes-Valdés JJ, Méndez MA,
Vásquez M. 2009. Toxicity phenotype does not correlate with phylogeny
of Cylindrospermopsis raciborskii strains. Syst. Appl. Microbiol. 32:37– 48.
http://dx.doi.org/10.1016/j.syapm.2008.10.002.
71. Dyble J, Paerl HW, Neilan B. 2002. Genetic characterization of Cylin-
drospermopsis raciborskii (Cyanobacteria) isolates from diverse geograph-
ical origins based on nifH and cpcBA-IGS nucleotide sequence analysis.
Appl. Environ. Microbiol. 68:2567–2571. http://dx.doi.org/10.1128/AEM
.68.5.2567-2571.2002.
72. Neilan BA, Saker ML, Fastner J, Törökné A, Burns BP. 2003. Phylo-
geography of the invasive cyanobacterium Cylindrospermopsis raciborskii.
Mol. Ecol. 12:133–140. http://dx.doi.org/10.1046/j.1365-294X.2003
.01709.x.
73. Gugger M, Molica R, Le Berre B, Dufour P, Bernard C, Humbert JF.
2005. Genetic diversity of Cylindrospermopsis strains (Cyanobacteria) iso-
lated from four continents. Appl. Environ. Microbiol. 71:1097–1100. http:
//dx.doi.org/10.1128/AEM.71.2.1097-1100.2005.
74. Piccini C, Aubriot L, Fabre A, Amaral V, González-Piana M, Giani A,
Figueredo CC, Vidal L, Kruk C, Bonilla S. 2011. Genetic and eco-
physiological differences of South American Cylindrospermopsis racibor-
skii isolates support the hypothesis of multiple ecotypes. Harmful Algae
10:644 – 653. http://dx.doi.org/10.1016/j.hal.2011.04.016.
75. Fathalli A, Ben Rejeb Jenhani A, Moreira C, Welker M, Romdhane M,
Antunes A, Vasconcelos V. 2011. Molecular and phylogenetic character-
ization of potentially toxic cyanobacteria in Tunisian freshwaters. Syst.
Appl. Microbiol. 34:303–310. http://dx.doi.org/10.1016/j.syapm.2010.12
.003.
76. Cirés S, Wörmer L, Ballot A, Agha R, Wiedner C, Velázquez D, Casero
MC, Quesada A. 2014. Phylogeography of cylindrospermopsin and par-
alytic shellfish toxin-producing Nostocales cyanobacteria from Mediterra-
nean Europe (Spain). Appl. Environ. Microbiol. 80:1359 –1370. http://dx
.doi.org/10.1128/AEM.03002-13.
77. Padisák J. 1997. Cylindrospermopsis raciborskii (Woloszynska) Seenayya
et Subba Raju, an expanding, highly adaptive cyanobacterium: worldwide
distribution and review of its ecology. Arch. Hydrobiol. Suppl. 107:563–
593.
78. van Gremberghe I, Leliaert F, Mergeay J, Vanormelingen P, Van der
Gucht K, Debeer AE, Lacerot G, De Meester L, Vyverman W. 2011. Lack
of phylogeographic structure in the freshwater cyanobacterium Microcys-
tis aeruginosa suggests global dispersal. PLoS One 6:e19561. http://dx.doi
.org/10.1371/journal.pone.0019561.
Jiang et al.
5230 aem.asm.org Applied and Environmental Microbiology
on August 8, 2014 by INSTITUTE OF HYDROBIOLOGYhttp://aem.asm.org/Downloaded from