Article

Effect of biochar additions to soil on nitrogen leaching, microbial biomass and bacterial community structure

Authors:
To read the full-text of this research, you can request a copy directly from the authors.

No full-text available

Request Full-text Paper PDF

To read the full-text of this research,
you can request a copy directly from the authors.

... First, the trees samples (0.3 g) and soil samples (0. The ITS1 region of the fungal ITS gene was amplified using primer combinations ITS1F/ITS2R (ITS1F: 5′-CTT GGT CAT TTA GAG GAA GTAA-3′, ITS2R: 5′-GCT GCG TTC TTC ATC GAT GC-3′) [22] and 338F/806R (338F: 5′-ACT CCT ACG GGA GGC AGC AG-3′, 806R: 5′-GGA CTA CHVGGG TWT CTAAT-3′) [23]. TransStart Fastpfu DNA Polymerase (TransStart) was used in all PCR experiments. ...
... Also, some genera such as Membranomyces, Ganoderma, Tomentella, Menispora, Ophiostoma, Hamamotoa, Graphilbum, Xenoacremonium, Cytospora, Clonostachys and Entomocorticium were only exist in diseased trees. Among the healthy trees, some genera with the highest abundance were Candida (27), Geminibasidium (23) and Mortierella (23). Also, there were some genera such as Geminibasidium, Bifiguratus, Fusarium, Cladosporium, Lasiodiplodia, Tylospora, Phialemoniopsis, Umbelopsis, Paraconiothyrium, Capnobotryella, Neopestalotiopsis, Pestalotiopsis, Catenulostroma and Wallemia. ...
... Also, some genera such as Membranomyces, Ganoderma, Tomentella, Menispora, Ophiostoma, Hamamotoa, Graphilbum, Xenoacremonium, Cytospora, Clonostachys and Entomocorticium were only exist in diseased trees. Among the healthy trees, some genera with the highest abundance were Candida (27), Geminibasidium (23) and Mortierella (23). Also, there were some genera such as Geminibasidium, Bifiguratus, Fusarium, Cladosporium, Lasiodiplodia, Tylospora, Phialemoniopsis, Umbelopsis, Paraconiothyrium, Capnobotryella, Neopestalotiopsis, Pestalotiopsis, Catenulostroma and Wallemia. ...
Article
Full-text available
Pine wilt disease (PWD) is a worldwide forest disease caused by pine wood nematode (PWN). In this article, we investigated the composition, organization, correlation, and function of the endophytic microbial community in Pinus massoniana field with and without PWN. Samples were taken from branches, upper, middle, and lower trunks, as well as soil, from both healthy and infected trees. The results showed that the fungal diversity of healthy pines is around 1.1 times that of infected pines, while the bacterial diversity is about 0.75 times that of infected pines at the OTUs level. An increase of the abundance of pathogenic fungus such as Saitozyma, Graphilbum, Diplodia, Candida, Pseudoxanthomonas, Dyella and Pantoea was witnessed in infected pines according to the result of LEfSe. Furthermore, Ophiostoma and saprophytic fungus such as Entomocorticium, ganoderma, tomentella, entomocorticium were exclusively prominent in infected pines, which were substantially and highly connected with other species (p < 0.05), indicating the trees’ vulnerability and making the wood blue. In healthy pines, the top three functional guilds are parasites, plant pathogens, and saprotrophs. Parasites (36.52%) are primarily found in the branches, plant pathogens (29.12%) are primarily found in the lower trunk, and saprotrophs (67.88%) are primarily found in the upper trunk of disease trees. Pines’ immunity is being eroded due to an increase in the quantity and types of diseases. PICRUSt2 research revealed that NADH or NADPH, as well as carbon-nitrogen bonds, were more abundant in healthy pines, but acid anhydrides and transferring phosphorus-containing groups were more abundant in infected pines. The shift in resin secretion lowers the tree’s potential and encourages pine wilt and mortality. In total, PWN may have disrupted the microbiological ecology and worked with the community to hasten the demise of pines.
... The final DNA concentration and purification were quantified by a NanoDrop spectrophotometer (Thermo Fisher Scientific, Wilmington, NC, USA), and DNA quality was checked by 1% agarose gel electrophoresis. The V3-V4 hypervariable region of the 16S rRNA (341 F 5 -ACTCCTACGGGAGGCAGCA-3 and 806R F 5 -GGACTACHVGGGTWTCTAAT-3 ) was amplified for assessment of the bacteria [27]. The PCR product was excised from the 1.5% agarose gel and purified using a QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany), quantified using real-time PCR, and sequenced at Sangon Biotech Co., Ltd., Shanghai, China. ...
... The physicochemical data of rhizosphere soil were analyzed by one-way analysis of variance (ANOVA) followed by Duncan's multiple range tests (p < 0.05) in SPSS v24.0 (BM Corporation, New York, USA). Chao1, Shannon, Simpson, and Coverage indexes were calculated with Mothur v.1.21.1 [27]. The system clustering method was used to classify the samples at the genus level with the R Stats package. ...
Article
Full-text available
Long-term continuous monoculture cultivation harms soil physicochemical and microbial communities in agricultural practices. However, little has been reported on the effect of continuous cropping of industrial hemp on bacterial community and diversity in the rhizosphere soil. Our study investigated the changes in physicochemical properties and bacterial communities of industrial hemp rhizosphere soils in different continuous cropping years. The results showed that continuous cropping would reduce soil pH and available phosphorus (AP), while electrical conductivity (EC), available nitrogen (AN), and available potassium (AK) would increase. Soil bacterial diversity and richness index decreased with continuous cropping years. At the same time, continuous cropping marked Acidobacteria, Bacteroidetes, and Gemmatimonadetes increase, and the Proteobacteria and Actinobacteria decreased. Moreover, we found that pH, AK, and AP were the critical factors associated with the changes in the abundance and structure of the bacterial community. Overall, our study first reported the effect of continuous cropping on the rhizosphere soil microflora of industrial hemp. The results can provide a theoretical basis for revealing the obstacle mechanism of continuous cropping of industrial hemp and contribute to the sustainable cultivation of industrial hemp in the future.
... The amount of NH 4 + -N leached was remarkably lower than that of NO 3 − -N irrespective of treatment, which agrees with other studies (Xu et al. 2016;Li et al. 2018). However, the differences in NH 4 + -N losses were more evident among the different soil textural gradients than the NO 3 − -N losses. ...
... Similarly, under laboratory conditions, Barth et al. (2019) reported suitable nitrification inhibition by DMPP in tropical sandy soils under warmer temperatures (25 °C), which is an important consideration for its use in tropical agriculture. This finding can be related to the tendency of NH 4 + to be adsorbed into negatively charged clay minerals of the soil (Xu et al. 2016). Therefore, we could expect that NH 4 + -N leaching losses would be greater following a textural gradient, as verified in our study. ...
Article
Nitrification inhibitors applied to soil could reduce nitrogen (N) fertilizer leaching losses by delaying the nitrification process via enhanced N fertilizer management. Thus, we investigated the agronomic efficiency of the nitrification inhibitor 3,4-dimethylpyrazole phosphate (DMPP) applied in three tropical soils (Typic Quartzipsamment, Typic Hapludox and Rhodic Hapludox) cultivated with cotton plants, evaluating the fate of N (NH 4 +-N, NO 3 −-N, and total N in leached water and soil), N accumulation and N use efficiencies (agronomic, physiological, and recovery efficiencies). Five treatments were tested with each treatment consisting of two N sources applied, urea (U) and ammonium sulfate nitrate (ASN), either with or without DMPP application; an additional control treatment (absence of N application) was also tested. Leaching columns were used to assess NH 4 +-N and NO 3 −-N losses. DMPP improved the recovery efficiency from applied U and ASN fertilizers by reducing NO 3 −-N and NH 4 +-N leaching, leading to enhanced N acquisition from fertilizer and augmenting plant N accumulation and biomass. We found that agronomic efficiency in cotton plants increased from 4 to 52% with the DMPP + ASN source relative to ASN along the soil types. In addition, DMPP use increased agronomic efficiency from urea application from 32 to 91% relative to conventional urea. The use of DMPP would benefit from more urea than ASN mainly in sandy-textured soils, where the leaching losses were observed to be increased. The reduction in NO 3 −-N and NH 4 +-N losses highlights the potential of DMPP to mitigate the impact of N-based fertilizer application on N leaching, thereby improving agronomic efficiency, N uptake, and cotton growth-related responses under tropical soil conditions.
... Nitrogen is the most limiting factor for microbial activity in semiarid and arid tropical zones of the world (Xu et al. 2003;Pokharel et al. 2020). Previous studies have indicated that adding biochar to agricultural soils may alter conditions that influence denitrification, nitrification, and other nitrogen transformation loss processes (Lehmann et al. 2011;Gul et al. 2015;Xu et al. 2016). Similarly, soil enzymes play an important role in the metabolic process that takes place in the soil, influencing the nutrient cycling, i.e., nitrogen and decomposition of soil carbon and nutrients (Oladele et al. 2019). ...
... Under the condition of conventional fertilizer, the addition of excessive biochar increased the C/N ratio of soil, resulting in the decrease of the proportion of active nitrogen that could be directly utilized by microorganisms in the soil (Yang et al. 2019), and the sequestration of nitrogen (Oladele et al. 2019), which was more like a carbon pool than a nitrogen source (Zhang et al. 2016) to soil microorganisms. Soil acid hydrolyzed organic nitrogen is an active part of the soil nitrogen pool, which is easily distributed by human activities (Xu et al. 2016). The transformation rate of nonacid hydrolyzed nitrogen in the soil is slow, so it is a stable and difficult mineralization component in the soil nitrogen pool. ...
Article
Soil fertility has become a major issue in the Loess Plateau, China. The present study explored the effects of maize straw biochar application on soil nitrogen (N) fractions, microbial biomass carbon (C), and wheat yields in a calcareous, sandy loam soil in the Loess Plateau region. Six maize straw biochar (BC) application rates were applied to the soil in July 2015, including control with no biochar (CK), BC1 (10 t ha−1), BC2 (20 t ha−1), BC3 (30 t ha−1), BC4 (40 t ha−1), and BC5 (50 t ha−1). Wheat was cultivated in the amended soil for 5 years using routine mineral N and P fertilization practices. Four to 5 years after biochar application, the soil contents of total N, microbial biomass C, and amino acid N significantly increased by 9.0–30.9%, 55.1–81.4%, and 64.5–68.2% (in 2019) and 6.5–10.9%, 68.6–139.7%, and 66.9–77.2% (in 2020), respectively, as compared to CK. Moreover, the content of unknown-acidolyzable nitrogen decreased by 45.0–63.1% (in 2019) and 83.5–89.6% (in 2020) compared with CK, respectively. Application of BC3 increased the total acidolyzable nitrogen, acidolyzable ammonium nitrogen, and amino-acid nitrogen contents in 0 to 30-cm soil layer by 6.3–7.8%, 23.0–25.2%, and 62.2–0.9% (in 2019) and 14.7–18.0%, 23.5–29.0%, and 41.9–107.6% (in 2020), respectively, as compared with CK. However, after 4 and 5 years, nonacid hydrolyzed N was the highest in BC5 (50 t ha−1) treatment, which increased by 27.0% and 44.8%, respectively, compared to the CK, while after 5 years, it was the lowest in BC3 (30 t ha−1) treatment, decreased by 35.4%. After 5 years, all biochar treatments significantly improved wheat yields compared to CK. The highest wheat yield was obtained in the BC3 treatment, which was 21.6% and 24.8% higher than the CK in years 4 and 5, respectively. In conclusion, the application of biochar as a soil conditioner can significantly affect the soil total and organic N fractions and microbial biomass after aging for 4–5 years and has a positive effect on improving soil nutrient supply capacity.
... Significant increases in the abundance of Actinobacteria and Chloroflexi under N1C2 treatment were found (Fig. S2), and the pearson correlation between them and soil physicochemical properties was consistent. Xu et al. (2016) and Hua et al. (2020) demonstrated biochar addition increased relative abundance of Actinobacteria but decreased the relative abundance of Chloroflexi, which was partially consistent with our results. Biochar addition was characterized by the increase in the relative abundance of Actinobacteria, which are generally associated with the degradation of recalcitrant C compounds and the turnover of soil organic matter (Lehmann et al., 2011). ...
Article
Full-text available
Biochar is widely used for soil carbon sequestration and fertility improvement. However, the effects of biochar interacted with nitrogen (N) on the mineralization of soil organic carbon (SOC) and microbial community have not been thoroughly understood, particularly no reports have been published on the long term effects of biochar in vegetable field. Here, we examined soil properties, SOC mineralization and microbial community affecting by biochar (0, 20 and 40 t ha⁻¹; C0, C1 and C2, respectively), N (0 or 240 t ha⁻¹; N0 or N1, respectively) and their interaction in a greenhouse vegetable field. Results indicated that biochar addition increased soil pH, SOC, recalcitrant C pool, especially for the 40 t ha⁻¹ treatment. Biochar addition generally decreased soil C-cycling enzyme activity while increasing N and P-cycling enzyme and oxidase activities. Biochar combined with N addition reduced SOC mineralization rate and metabolic quotient (qCO2) by 10.2–22.0% and 6.85–30.4%, respectively, across 15–35 °C and the temperature sensitivity (Q10) by 0.96–4.70%, except for the N1C2 at 25–35 °C. Apparent changes in bacterial alpha diversity and community structures were observed among treatments. Besides, biochar mixed with N application significantly enhanced the relative abundance of Proteobacteria and decreased Acidobacteria, while did not result in significant differences in fungal diversity and community composition. Redundancy analysis indicated that the microbial community composition shifts induced by the interaction between N and biochar were attributed to the changes in soil chemical properties, such as pH and SOC. Overall, the combination of biochar and N fertilizer is recommended to improve SOC sequestration potential and regulate bacterial community diversity and composition in vegetable field for sustainable intensification.
... Subsequently, bacteria were analyzed by sequencing the V3-V4 hypervariable region of the 16S ribosomal RNA (rRNA) gene. The V3-V4 region was amplified using universal primers, 338F and 806R (338F: 5 -ACTCCTACGGGAGGCAGCA-3 and 806R: 5 -GGACTACHVGGGTWTCTAAT-3 ) (Xu et al., 2016). The PCR mixtures contain 5 × TransStart FastPfu buffer 4 µL, 2.5 mM dNTPs 2 µL, forward primer (5 µM) 0.8 µL, reverse primer (5 µM) 0.8 µL, TransStart FastPfu DNA Polymerase 0.4 µL, BSA 0.2 µL, template DNA 10 ng, and finally ddH 2 O up to 20 µL. ...
Article
Full-text available
Rhizosphere microbial communities are vital for plant growth and soil sustainability; however, the composition of rhizobacterial communities, especially the assembly process and co-occurrence pattern among microbiota after the inoculation of some beneficial bacteria, remains considerably unclear. In this study, we investigated the structure of rhizomicrobial communities, their assembly process, and interactions contrasting when Bradyrhizobium japonicum 5038 and Bacillus aryabhattai MB35-5 are co-inoculated or Bradyrhizobium japonicum 5038 mono-inoculated in black and cinnamon soils of soybean fields. The obtained results indicated that the Chao and Shannon indices were all higher in cinnamon soil than that in black soil. In black soil, the co-inoculation increased the Shannon indices of bacteria comparing with that of the mono-inoculation. In cinnamon soil, the co-inoculation decreased the Chao indices of fungi comparing with that of mono-inoculation. Compared with the mono-inoculation, the interactions of microorganisms of co-inoculation in the co-occurrence pattern increased in complexity, and the nodes and edges of co-inoculation increased by 10.94, 40.18 and 4.82, 16.91% for bacteria and fungi, respectively. The co-inoculation of Bradyrhizobium japonicum 5038 and Bacillus aryabhattai MB35-5 increased the contribution of stochastic processes comparing with Bradyrhizobium japonicum 5038 inoculation in the assembly process of soil microorganisms, and owing to the limitation of species diffusion might restrict the direction of pathogenic microorganism movement. These findings support the feasibility of rebuilding the rhizosphere microbial system via specific microbial strain inoculation and provide evidence that the co-inoculation of Bradyrhizobium japonicum 5038 and Bacillus aryabhattai MB35-5 can be adopted as an excellent compound rhizobia agent resource for the sustainable development of agriculture.
... In fact, we also found that N fertilization combined with lower dose of BC also caused an inhibited effect in soil nitrification, whereas the higher dose of BC treatment with N fertilization could improve nitrification processes. Our results corroborated the nitrification potential results reported in the previous study, wherein different levels of BC (2%, 4% and 8%) resulted in a reduced cumulative amount of total N by 18.8-20.2% in plough-layer soil collected from the fluvo-aquic soil (Tan et al., 2016). Relative to that in the no-N treatments, the nitrification potential improved considerably by 19.2-fold under N treatment, demonstrating that N fertilization also promoted N nitrification potential, which is consistent with previous reports by Ren et al. (2019). ...
Article
High-dose nitrogen (N) fertilization has been widely adopted to achieve higher yield in intensive sugarcane monocropping system in Southern China, while long-term excessive N fertilization causes high N losses and negative environmental impacts. Biochar (BC) has been considered a soil amendment to potentially improve soil fertility and crop productivity. However, little is known about the effects of N fertilization combined with BC on sugarcane growth, rhizosphere soil characteristics and microbial community composition. In this study, a greenhouse-pot experiment with six treatments in triplicates was carried out to examine the responses of root-shoot growth, rhizosphere soil properties and bacterial communities to different BC and N fertilization treatments in sugarcane monocropping soil (duration over 20 years). The results demonstrated that N fertilization combined with BC promoted the aboveground growth of sugarcane, while different dose of BC exhibited a significant effect on switching root and shoot growth responses. With the increase in the BC amendment rate, the rhizosphere soil pH, TC and C/N ratio increased correspondingly. As compared with the N-only treatment, N fertilization combined with moderate dose of BC significantly decreased soil NO 3-N and nitrification potential (SNP), whereas N treatment with higher-dose BC resulted in a sharp increase in SNP. DESeq2 analysis revealed that N fertilization coupled with higher BC-amendment enriched Mesorhizobium, Porphyrobacter, Rhizobacter and Allorhizobium-Neorhizobium-Pararhizobium-Rhizobium. Redundancy analysis indicated that soil pH, NO 3-N and C/ N were key edaphic factors that shifted the soil bacterial community composition, especially for nitrifying flora and N-fixing flora. The above findings suggest that the combination of N fertilization with moderate-dose BC might be an alternative strategy to promote crop growth and soil sustainability under sugarcane monocropping system.
... Biochar application also affects a wide range of microbial communities (Li et al. 2015). Several studies have found that biochar increases the activity of bacteria such as Actinobacteria, Bacteriodetes, Firmicutes, Planctomycetes, and Gemmatimonadetes Zheng et al. 2016), but decreases the activity of bacteria such as Acidobacteria and Chloroflexi (Xu et al. 2016).Limited research has been done on the effects of biochar application and mechanisms on microbial changes and the mechanisms of microbial changes, and CO 2 emission. In addition to its use in agriculture, biochar has also attained a significant interest in the waste management sector due to its check on landfill gas emissions. ...
Article
Climate change is expected with the ever rising human population on the planet earth. The different anthropogenic activities have resulted in increased levels of greenhouse gases (GHGs), higher temperatures, aberrant precipitation patterns, and other climate changes, calling for advanced restitution techniques. Renewable energy sources have gained momentum over the past few years under changing climatic scenarios coupled with demand for energy supply. Fruit peels, shells, wood, and leaves are the abundant waste materials associated with fruit production, representing a potential bio-resource to be transformed into valuable materials called biochar. Fruit crops are mainly known for their nutraceutical properties, but on the other hand, the nutrient deficiencies in fruit plants influence sustainable fruit production. Biochar production and its applications may offer a new concept to meet this challenge. The current status of knowledge on biochar production from fruit crop waste material and its application to the fruit production system has been reviewed in this article. Benefits include fruit productivity and quality through their positive effects on different plant traits. The role of biochar in the improvement of the soil physico-chemical properties has also been described via understanding the mechanisms of soil microbes and their interactions in fruit orchards.
... Biochar application to soil has previously been found to increase, reduce, or have no effect on N mineralization. In a soil column investigation, Xu et al., (2016) reported an increase in net N mineralization after biochar application. In a field research, Pereira et al., (2015) discovered a nearly two-fold increase in N mineralization after biochar addition in an organically maintained lettuce farm compared to the control. ...
Article
Full-text available
Biochar is produced in an environmentally friendly manner by recycling plant waste. Due to its stable aromatic forms of organic carbon, biochar is designed to be applied to soil and is relatively stable against microbial breakdown under varied environmental conditions. Biochar is being studied around the world as a way to improve soil fertility, ecosystem services, and carbon sequestration. The use of biochar as a source of soil nitrogen has been the topic of much research. Nitrogen is an important element in crop growth. The objective of this review paper, therefore, is to emphasize both existing knowledge and prospective mechanisms of biochar amendment effects on soil microbial and nitrogen transformation. Biochar addition was found to have significant impacts on the composition and abundance of soil microbial communities. Biochar application improved N2 fixation in common bean compared to the control treatment. Biochar application to soil has previously been found to increase, reduce, or have no effect on N mineralization. In terms of N immobilization, biochar studies have provided conflicting results. Furthermore, biochar's adsorption and cation exchange capacity for NH4 + and NO3- can effectively minimize nitrate leaching and retain nitrogen. Biochar also aerates the soil and provides a habitat for nitrifying bacteria to convert NH4+ to NO3 -. These modifications, however, may not be wholly helpful, as biochar is not always effective, and alterations to the nitrogen cycle may have unforeseen consequences. Because the features of biochar are strongly impacted by the pyrolytic conditions used to generate biochar and the type of soil it is employed in, more research into the interaction between biochar and soil chemistry is needed.
... The primer pair of 338F (5′-ACT CCT ACG GGA GGC AGC AG-3′) and 806R (5′-GGA CTA CHVGGG TWT CTAAT-3′) was used to amplify the V3-V4 region of 16S rDNA (Xu et al. 2016). A 20-μL PCR reaction system contained 4 μL of 5 × FastPfu Buffer, 2 μL of 2.5 mM dNTPs, 0.8 μL each of the 338F and 806R primers, 0.4 μL of FastPfu polymerase, 10 ng of template DNA, 0.2 μL of BSA, and residual ddH 2 O. ...
Article
Full-text available
Different types of mulching film could variously influence soil properties and plant growth. Yet, surprisingly few studies have investigated the effects of mulching film upon soil microbial diversity and community structure. In this research, two kinds of mulching film, a traditional PE (polyethylene) mulching film and a degradable PBAT ((Poly [butyleneadipate- co -terephthalate])) mulching film, were applied to cotton ( Gossypium spp.) plants grown in Xinjiang Province, China. The respective influence of the two mulching films on the cotton’s soil microbial (bacteria and fungi) diversity and community were investigated. The results showed that applying the PBAT mulching film could significantly alter the diversity of non-rhizosphere soil fungi when compared to using the PE mulching film. However, neither the PE nor PBAT mulching film had any significant influence on the diversity of soil bacteria and rhizosphere soil fungi. Nevertheless, soil microbial community composition differed under the PBAT mulching film treatment vis-à-vis the PE mulching film treatment. The abundance of Gibellulopsis was higher under the PBAT than PE mulching film treatment. Our study’s findings provided an empirical basis for the further application of degradable PBAT mulching film for the sustainable development of cotton crops.
... Some studies have indicated a considerable reduction in N leachate volume when biochar is used [57,58], associated with increased water retention, improved structure, and the aggregation of soil [59]. N-leaching is affected by soil type [60]. ...
Article
Full-text available
In agriculture, biochar (B) application has been suggested as a green technology to reduce nitrate pollution from agricultural origins and improve crop yield. The agronomic impact of B use on soil has been extensively studied, while knowledge of its possible effects on horticultural cultivation is still scarce. A greenhouse experiment was conducted to evaluate the effect of using biochar in soils treated with two different rates of nitrogen fertilizers on soil properties and nitrogen (N) leachate. This study also investigated the vegetative parameters during the crop growing season of Brassica oleracea L. var. botrytis. Soil mesocosms were set up to test the following treatments: untreated/control (C); normal dose of N fertilizer (130 kg N ha−1) (ND); ND+B; high dose of N fertilizer (260 kg N ha−1) (HD); and HD+B. Principal component analysis and cluster analysis were exploited to assess biochar's ability to reduce nitrate leaching and enhance soil–vegetative properties. Biochar addition affected the soil chemical properties of the fertilized microcosms (ND and HD). Biochar increased the content in HD soil and the in ND soil by 26 mg/L and 48.76 mg/L, respectively. The results showed that biochar application increased the marketable cauliflower yield. In ND+B and HD+B, the curd weight was 880.68 kg and 1097.60 kg, respectively. In addition, a small number of nitrogenous compounds in the leachate were quantified in experimental lines with the biochar. Therefore, biochar use improves the marketable yield of horticulture, mitigating the negative impacts associated with the mass use of N fertilizers in agriculture.
... The fusion primers, including the P5 or P7 Illumina adapter, an 8 nucleotide (nt) barcode sequence, and gene-specific primer pairs 338F (5'-ACTCCTACGGGAGGCAGCAG-3') and 806R (5'-GGACTACHVGGGTWTCTAAT-3') (Mori et al., 2014;Xu et al., 2016), were used for amplifying the 16S rDNA V3-V4 region of bacterial communities in bulk soil and rhizosphere soil samples. PCR amplification in triplicate, purification of the PCR product, determination of library quality, library quantification, and paired-end 300 high-throughput sequencing on the Illumina MiSeq platform (Illumina, CA, USA) were performed as previously described by Hu et al., (Hu et al., 2019). ...
... Soil pH and electrical conductivity (EC) were determined by mixing soil with deionized water at 1:5 and 1:2.5 (w/v), respectively. The mixture was manually shaken for 30 min, and the reading was taken using pH meters (pH-400, Spectrum Technologies, Inc., Aurora, IL, USA) and an electrical conductivity meter (DDS-307A, Shanghai Yoke Instrument Co., Ltd., Shanghai, China) [24]. Bulk density, total porosity and organic matter content of the soil were detected using the methods of Bao [25]. ...
Article
Full-text available
Continuous cropping has become a key factor limiting the sustainable development of greenhouse vegetables. It is a matter of great importance to maintain and improve the effective fertility of greenhouse soil. Catch crops planted as green manure is an effective method to improve soil quality. In order to determine the effects of catch crops on soil characteristics and the growth of afterculture vegetables, onion, corn, wheat, soybean and cabbage were planted as catch crops for two years during the summer fallow season, with no catch crop as CK. The results showed that the total porosity and organic matter content of the soil, with corn and wheat as catch crops, was significantly increased by 2.93%, 5.25% and 21.32%, 51.61%, respectively, while pH was decreased, compared with CK. The urease, sucrase, invertase, catalase and FDA enzyme activity of the soil with corn and wheat as catch crops was significantly increased by 30.14% and 30.21%, 14.81% and 25.31%, 15.43% and 15.21%, 29.37% and 28.69%, 46.32% and 44.23%. Meanwhile, the enzyme activity of the soil was increased with each catch crop planted. The amount of culturable bacteria and actinomycetes in the soil with corn and wheat as catch crops was increased by 33.42% and 38.12% at the period of 150dayII, while fungi was decreased by 59.95%. The yield of vegetables with corn and wheat as catch crops significantly increased by 5.59~13.33% and 4.35~11.18% compared with CK. Overall, catch crops could improve the soil quality as well as the growth of afterculture vegetables.
... DNA was checked on 1% agarose gels and concentration and purity were determined using a NanoDrop 2000 UVvis spectrophotometer (Thermo Fisher Scientific, Wilmington, United States). The V3-V4 hypervariable region of the bacterial 16S rRNA gene was amplified using the following primers; 338 F (5 -ACTCCTACGGGAGGCAGCAG-3 ) and 806 R (5 -GGACTACHVGGGTWTCTAAT-3 ) on an ABI GeneAmp R 9700 PCR thermocycler (ABI, CA, United States) (Xu et al., 2016). The PCR amplification system and conditions have been previously described (Yang J. et al., 2020). ...
Article
Full-text available
The aim of the present study is to investigate the effects of dietary Lycium barbarum polysaccharides (LBPs) supplementation on the growth performance, immune response, serum antioxidant status, and intestinal health of weaned piglets. In total, 24 crossed healthy weaned piglets [Duroc × (Yorkshire × Landrace)], of similar body weight (7.47 ± 0.22 kg), were randomly allocated to three treatment groups: CON (basal diet); LBPs (basal diet plus 4,000 mg/kg LBPs); and antibiotic (ABO, basal diet plus 20 mg/kg flavomycin and 50 mg/kg quinocetone). There were eight pigs per group. The study lasted 28 days. When compared with CON, LBPs or ABO dietary supplementation increased average daily gain ( P < 0.05), decreased the ratio of feed to gain and the diarrhea ratio ( P < 0.05). Similarly, when compared with CON, LBPs dietary supplementation increased serum immunoglobulin G, immunoglobulin M, interleukin-10, interleukin-2, and tumor necrosis factor-α levels ( P < 0.05). Dietary LBPs enhanced the activity of serum total antioxidant capacity and glutathione peroxidase, and decreased malondialdehyde levels ( P < 0.05). Principal component analysis showed a distinct separation between CON and LBPs groups, but no differences between ABO and LBPs groups. LBPs addition increased Lactobacillus and Faecalibacterium ( P < 0.05) levels, while it decreased Enterococcaceae and Enterobacteriaceae ( P < 0.05) levels. Furthermore, when compared with the CON group, LBPs increased villus height ( P < 0.05) and the villus height to crypt depth ratio in the duodenum and jejunum ( P < 0.05). Thus, dietary supplementation with LBPs improved growth performance, antioxidant capacity and immunity, regulated intestinal microbial composition, and may be used as an efficient antibiotic alternative in weaned piglet feed.
... The total genomic DNA was also extracted using a PowerSoil DNA Isolation Kit (Mo Bio Laboratories, Carlsbad, CA, USA). Bacterial 16S rRNA gene fragments were amplified via the polymerase chain reaction (PCR) with the primer set 338F (ACTCCTACGGGAGGCAGCAG)/806R (GGAC-TACHVGGGTWTCTAAT) [24]. Majorbio Biotech Co., Ltd., Shanghai, China, analyzed the microbial community structures. ...
Article
Full-text available
The typical characteristics of wastewater produced from seafood, chemical, textile, and paper industries are that it contains ammonia, sulfate, and a certain amount of chemical oxygen demand (COD). The sulfate-reducing ammonium oxidation process is a biochemical reaction that allows both ammonia and sulfate removal, but its low growth rate and harsh reaction conditions limit its practical application. Due to the adsorption properties of the iron sponge and its robust structure, it provides a suitable living environment for microorganisms. To reduce the negative impact on the environment, we employed 4.8 kg of sponge iron in a 2.0 dm3 anaerobic sequencing batch reactor (ASBR). We investigated the effects of the type and concentration of carbon sources on the performance of the sulfate-reducing ammonium oxidation (SRAO) process. The results demonstrated that during a start-up period of 90 days, the average ammonium removal efficiency and the sulfate conversion efficiency of the reactor containing the sponge iron were 4.42% and 8.37% higher than those of the reactor without the sponge iron. The addition of the sponge iron shortens the start-up time of this greenhouse gas-free denitrification process and reduces future costs in practical applications. The removal of total nitrogen (TN) significantly increased after adding organic carbon sources and then declined sharply, while the most considerable reduction of ammonium removal efficiency from 98.4% to 30.5% was observed with adding phenol. The performance of the group employing glucose as the carbon source was recovered on the 28th day, with the average ammonium removal efficiency increasing from 49.03% to 83.5%. The results of this simulation study will help the rapid start-up of SRAO in the water treatment industry and can precisely guide the application of the SRAO process for wastewater containing different organic carbon sources.
... The genomic DNA was detected and extracted by 1% agarose gel electrophoresis. (ii) Primer 338F (5 ′ -ACTCCTACGG-GAGGCAGCAG-3 ′ ) and 806R (5 ′ -GGACTACHVGGGTWTCTAAT-3 ′ ) were used to PCR amplify the V3-V4 region fragment of the 16S rRNA gene (Xu et al., 2016). The PCR amplification of the 16S rRNA gene was carried out as follows: initial denaturation at 95 • C for 3 min, followed by 27 cycles of denaturing at 95 • C for 30 s, annealing at 55 • C for 30 s and extension at 72 • Cfor 45 s, and single extension at 72 • C for 10 min, and end at 4 • C. 5 × TransStart FastPfu buffer 4 μL, 2.5 mM dNTPs 2 μL, forward primer (5 μM) 0.8 μL, reverse primer (5 μM) 0.8 μL, TransStart FastPfu DNA Polymerase 0.4 μL, template DNA 10 ng, and lastly ddH 2 O up to 20 μL were used in the PCR mixes. ...
Article
Full-text available
Due to the leaching of capillary water, the petroleum pollutants initially trapped in vadose zone may migrate to lower aquifer, thus increasing the risk of groundwater pollution. In order to explore the effect of capillary leaching on toluene-contaminated soil and the relationship between toluene concentration (TC) and environmental factors (EFs) during the leaching process, the sterilized and non-sterilized soil column experiments were designed. The EFs were used to estimate TC. The results showed that the difference between leaching and volatilization rates directly determined the changing trend of toluene concentration in capillary water. The toluene concentration in the medium always showed decreasing trend due to leaching. The indigenous microbial community structure of the non-sterilized soil column was analyzed by 16S rRNA sequencing. It was found that indigenous microorganisms could degrade toluene after 33.0 days of acclimatation. The microbial population was dominated by bacteria, among them the Ellin6055 strain and Pseudomonas, Pseudoxanthomonas, Cupriavidus, Bdellovibrio, Sphingobium, Phenylobacterium, Ramlibacter, Bradyrhizobium, Shinella genera. The Pseudomonas was the most crucial bacterial genus that degraded toluene. Indigenous microbial degradation was the fundamental reason for strong response relationship. Furthermore, we suggested a relationship of function between environmental factors (pH, DO, ORP) and time (t) for toluene attenuation: C 0 + ln(e At α B γ Cβ) = C Toluene , (α, β, γ represent the pH, DO, and ORP in leaching capillary water, respectively; A, B, and C represent undetermined coefficients), and the fitting coefficient R 2 > 0.950. This relationship can only characterize the attenuation process of capillary zone leaching on toluene. However, it may still be utilized to give a theoretical foundation for understanding the dynamic of pollutant concentration change processes under specific environmental factors.
... The quality of the extracted DNA was verified via 1% agarose gel electrophoresis. The amplification and sequencing of the 16S rRNA targeting the variable V3-V4 regions (Xu et al. 2016;Perez-Jaramillo et al. 2019) was subsequently performed using the primers 338F (5′-ACT CCT ACG GGA GGC AGC AG-3′) and 806R (5′-GGA CTA CHVGGG TWT CTAAT-3′) and resulted in amplicons of approximately 460 bp. Error-correcting barcodes were added to both forward and reverse primers (Hamady et al. 2008). ...
Article
Full-text available
Purpose Atractylodes lancea is a medicinal plant widely used in treating rheumatic diseases, digestive disorders, night blindness, and influenza. Microbes greatly impact plant growth and metabolism. However, the microbiome associated with A. lancea remains unclear. Hence, we aimed at assessing the effect of soil microbe inoculation on A. lancea under heat stress from multiple perspectives, including regulation of growth, valuable secondary metabolites, root endophytic and rhizosphere bacterial communities. Methods A. lancea was inoculated with soil microbes, then grown under normal/high temperature. Biomass, chlorophyll contents, production of major medicinal compounds, physiochemical properties of the soil, and in the composition of root bacterial communities of A. lancea were investigated. Results Soil microbe inoculation promoted root sink strength, accumulation of medicinal compounds, and attenuated damage caused by heat stress. A. lancea showed preference for the endophytic bacterial genera Rhodococcus, Ralstonia, Dongia Paenibacillus and Burkholderia-Caballeronia-Paraburkholderia post-inoculation, the latter four genera playing important roles in protection from heat stress, with abundance of the latter two specifically positively correlated to medicinal compound production. A. lancea enriched the bacterial genera Saccharimonadales, Novosphingobium and excluded Chitinophaga in its rhizosphere post-inoculation. Conclusions Soil microbes characteristically promoted A. lancea growth, improved heat stress tolerance, and promoted root medicinal compound accumulation. A. lancea selectively enriched particular endophytic and rhizospheric bacterial communities post-inoculation, possibly due to unique aromatic root exudates. The selected bacteria potentially synergistically improved soil available nutrients and uptake by root. Bacterial species selected by A. lancea root have the potential to serve as biological fertilizers for A. lancea farming.
... The increases of EC value might be due to the high salt content of biochar material. For biochar-treated soils, more mineral ions, such as Ca 2+ , K + , and Mg 2+ , were dissolved in soil solution, which was supported by the higher soil salinity (Xu et al. 2016). ...
Article
Full-text available
Although the use of biochar to promote plant growth has been reported by many researchers, the combined effect of prickly pear waste biochar (BC) and Azolla (AZ) in a field experiment on the roselle plants did yet receive attention. Therefore, the study aims to evaluate the effect of biochar and Azolla extract on the growth, production, and quality of roselle plants. The experiment treatments were in a completely randomized block design with three replicates. Biochar was added at rates of 0, 10, and 20 ton ha ⁻¹ and AZ was applied at rates of 0, 3, and 6% in addition to a control treatment. Biochar added at high rate (20 ton ha ⁻¹ ) significantly increased the fresh and dry weights of sepals by 27.98 and 35.73%, respectively, compared to the control. The corresponding values were significantly increased by 11.89 and 11.85% over the control when Azolla was added at rate of 6%. The interaction effect of both BC and AZ treatments at high rate significantly increased the fresh and dry weight of sepals by 47.16 and 60.59%, respectively, compared to the control. The interaction effect of BC and AZ realized significant effect on soil properties, growth and yield, as well as pigments of roselle plants. This is a good evident means that BC and AZ applications separately or combined are considered promising materials for sustainable organic agriculture and safety food.
... Moreover, C:N ratio, respiration (BR, Arg-SIR), and nitrification (Ure) significantly (p ≤ 0.001) positively correlated with pH (r = 0.5, 0.53, 0.52, and 0.63, respectively). This was consistent with the positive relation between pH, CO 2 evolution, and N mineralization reported in previous studies [64][65][66]. The long-term interaction of carbon-enriched digestate, soil, and plant led to an even broader effect on pH, whose values increased significantly compared to the control (D) in all other variants in the second part of the experiment. ...
Article
Full-text available
The effective use of digestate as exogenous organic matter to enhance soil carbon sequestration depends on the balance between labile and recalcitrant organic carbon, which is influenced by the type of feedstock, the fermentation process, and the fraction (liquid, solid) of the fermented product used. In this work, in order to change the ratio of labile to stable carbon in the resulting fertiliser, the digestate was mixed with organic carbon-rich supplements: biochar and Humac (a humic acid-rich substance). The pot experiment was carried out under controlled conditions with maize (Zea mays L.) in soil amended with the digestate (D), which was incubated with Humac (H), biochar (B), or a combination of both (D + B + H) before the application. Digestate enriched with Humac showed improved short-term nutrient (carbon, phosphorus, nitrogen) transformation, as indicated by soil enzyme activity and the highest maize biomass production of. Total carbon content, C:N ratio, short-term respiration activity, and nitrification were most enhanced by digestate enriched with either biochar or combined biochar + Humac). Long-term nitrogen mineralization was mostly enhanced by digestate + Humac, as indicated by amino-acid-induced respiration and urease activity. Short-term positive effects of digestate + biochar (eventually + Humac) on catabolism were proven, whereas their long-term effects on nutrient mineralization were negative (i.e., biochar-mediated immobilization, sequestration), which should be the focus of further research in future.
... The corresponding primers for the bacterial 16S rRNA V3-V4 region were: 338F (5′-GTG CCA GCM GCC GCG G-3′) and 806R (5′-CCG TCA ATT CMT TTR AGT TT-3′) (Xu et al., 2016). The fungal ITS (ITS1-ITS2) primers used were ITS1F (5′-CTT GGT CAT TTA GAG GAA GTA A-3′) and ITS2 (5′-GCT GCG TTC ATC GAT GC-3′) (Adams et al., 2013). ...
Article
Full-text available
The excessive application of phosphorus (P) fertilizer is becoming a major agricultural problem, which reduces the utilization rate of the P fertilizer and degrades soil quality. The following five P fertilizer treatments were investigated to know how they affect soil properties, enzyme activity, bacterial and fungal community structure. 1) no P fertilizer (P0); 2) farmers’ traditional P fertilization scheme (FP); 3) 30% reduction in P fertilizer application (P1, microbial blended fertilizer as base fertilizer); 4) 30% reduction in P fertilizer application (P2, diammonium phosphate as starting fertilizer); 5) 30% reduction in P fertilizer application (P3, microbial inoculum seed dressing). The P fertilizer reduction combined with microbial fertilizer significantly increased soil organic matter (SOM), total phosphorus (TP), available phosphorus (AP) available potassium (AK) contents, and acid phosphatase activity (ACP), however, soil urease activity was significantly reduced. Moreover, the P fertilizer reduction combined with microbial fertilizer significantly increased the relative abundance of a potential beneficial genus (i.e., Bacillus, Pseudomonas, Penicillium, and Acremonium) and potentially pathogenic genus (i.e., Fusarium, Gibberella, and Drechslera). The structural equation model (SEM) revealed that different P fertilizer reduction systems had significant indirect effects on bacterial and fungal community structures. The results suggested that the P fertilizer reduction combined with microbial fertilizer systems regulated the pathogenic and beneficial genus which created a microbial community that is favorable for maize growth. Moreover, the findings highlighted the importance of soil properties in determining the soil bacterial and fungal community structure.
... and 1492 of bacterial 16S rRNA genes (numbered according to Escherichia coli rRNA) (Lane, 1991) because such an amplification provides a nearly full-length gene (~1,450 bp) and, therefore, the most specific phylogenetic analysis (Johnson et al., 2019). Currently used massively parallel sequencing platforms produce much shorter reads than the length of 16S rRNA genes (Tucker et al., 2009), and sometimes because of economic aspects, some special primers have been used to amplify shorter 16S rRNA fragments that contain one or more specific variable regions (Lane, 1991;Chelius and Triplett, 2001;Sun et al., 2008;Bulgarelli et al., 2012;Mizrahi-Man et al., 2013;Tuan et al., 2014;Fischer et al., 2016;Xu et al., 2016;Chen et al., 2021). ...
Article
Magnetotactic bacteria (MTB) biomineralize intracellular magnetic nanocrystals and swim along geomagnetic field lines. While few axenic MTB cultures exist, living cells can be separated magnetically from natural environments for analysis. The bacterial universal 27F/1492R primer pair has been used widely to amplify nearly full‐length 16S rRNA genes and to provide phylogenetic portraits of MTB communities. However, incomplete coverage and amplification biases inevitably prevent detection of some phylogenetically specific or non‐abundant MTB. Here, we propose a new formulation of the upstream 390F primer that we combined with the downstream 1492R primer to specifically amplify 1,100‐bp 16S rRNA gene sequences of sulfate‐reducing MTB in freshwater sediments from Lake Weiyanghu, Xi'an, northwestern China. With correlative fluorescence in situ hybridization and scanning/transmission electron microscopy, three novel MTB strains (WYHR‐2, WYHR‐3, and WYHR‐4) from the Desulfobacterota phylum were identified phylogenetically and structurally at the single cell level. Strain WYHR‐2 produces bullet‐shaped magnetosome magnetite, while the other two strains produce both cubic/prismatic greigite and bullet‐shaped magnetite. Our results expand knowledge of bacterial diversity and magnetosome biomineralization of sulfate‐reducing MTB. We also propose a general strategy for identifying and characterizing uncultured MTB from natural environments. This article is protected by copyright. All rights reserved.
... El nitrógeno total fue mayor para la parcela control con 0.57%, seguido de la parcela 2 con 0.49%, parcela 1 con 0.48 y parcela 3 con 0.47%. El fósforo disponible demostró valores de 14.23 mg/Kg de la parcela 1 y 12.71 mg/Kg para la parcela 3, la parcela control con 9.53 mg/Kg y la parcela 2 con 8. 94 , 5% y control. Seguido en el muestreo 3, hay cambios leves en sus porcentajes teniendo en la adición al 1% con 3.72%, adición al 3% con 3.9%, adición al 5% con 3.73% y control con 3.83%, para encontrar al transcurso de un año en el 4 muestreo, nuevamente una disminución de sus porcentajes a 2.99%, 3.13%, 2.95%, en las adiciones al 1%, 3% y 5% respectivamente y sobre el control a 3.15%. ...
Thesis
Full-text available
Actualmente, la fuerte demanda agrícola y las malas prácticas han alterado el equilibrio natural del suelo, así como las interacciones físicas, químicas y biológicas, ocasionando su degradación del suelo; por tanto, los índices de calidad del suelo son considerados como herramientas para evaluar el estado de este sustrato en condiciones naturales o el utilizado para la producción agrícola. Una de las prácticas utilizadas para mitigar su degradación es el uso de enmiendas orgánicas, como el biochar, a nivel mundial se ha evaluado su adición como medio para mejorar la fertilidad del suelo y mitigar el cambio climático, además, sus efectos en parámetros biológicos del suelo han empezado a ser cada vez más relevantes, en conjunto con sus efectos sobre propiedades fisicoquímicas del suelo. El objetivo de este estudio fue, evaluar el uso de biochar como enmienda de suelo degradado, sobre microorganismos relacionados con la transformación del carbono, para esto, se tomaron muestras de suelo de una localidad agrícola de Sibaté, en el departamento de Cundinamarca-Colombia, en donde se realizó un ensayo con 1%, 3% y 5% de biochar, como tratamientos y el control negativo al cual no se le adicionó ninguna enmienda. A través de muestras de suelo se evaluaron parámetros fisicoquímicos, composición de microorganismos indicadores de transformaciones de carbono y diversidad de microorganismos heterótrofos, durante un periodo de un año de evolución del biochar en suelo degradado. Los resultados indicaron la disminución tanto del contenido de carbono orgánico como de materia orgánica, pero sin diferencias significativas entre los tratamientos y el control. Se evidenció la reducción del pH hasta el tercer muestreo y aumento hasta el cuarto muestreo. Así mismo, se evidenció la disminución de los nitratos del suelo hasta el tercer mes en los tratamientos y control, con un efecto tardío en el periodo de 9 meses finales los tratamientos aumentaron sus valores y se diferenciaron del control que permaneció constante en el año de evaluación. Se reporta, un cambio en la riqueza de morfotipos y mayor abundancia de un morfotipo presente en Agar nutritivo del tratamiento al 3%. Sin embargo, se presentó baja diversidad de microorganismos heterótrofos en Agar nutritivo para la muestra inicial, tratamientos y control. Por lo tanto, se espera que la adición de biochar como enmienda para el suelo, sea una opción a futuro para promover estrategias de mitigación de suelos degradados y mejorar el manejo agroindustrial de residuos.
... Zhang et al. reported that straw biochar application significantly shifted the AOB community composition, and the abundance of amoA-AOB gene contributed to soil potential nitrification rates (PNR), whereas the abundance of amoA-AOA gene was almost not responsive to biochar addition [10]. Similarly, Xu et al. discovered that a significant response in amoA-AOB gene abundance, rather than amoA-AOA gene abundance, was observed under biochar application, although biochar addition significantly increased the diversity indices of AOB and AOA [48]. In a recent study, Li et al. concluded that biochar stimulated amoA-AOB gene abundance, which was significantly more abundant than amoA-AOA gene abundance, but the amoA activity showed a significant negative correlation with soil salinity and watersoluble carbon [49]. ...
Article
Full-text available
Biochar has been widely recognized as an effective and eco-friendly ameliorant for saline soils, but information about the mechanism of how biochar influences nitrification in salt-affected agroecosystem remains fragmented. An incubation experiment was performed on the salt-affected soil collected from a three-consecutive-year experiment at biochar application gradients of 7.5 t⋅ha−1, 15 t⋅ha−1 and 30⋅t ha−1 and under nitrogen (N) fertilization. Responses of the nitrification rate (NR), numbers of ammonia monooxygenase (amoA) gene copies, and community structures of ammonia-oxidizing bacteria (AOB) and archaea (AOA) to biochar application were investigated. The results indicated that, under N fertilization, the NR and numbers of amoA-AOB and amoA-AOA gene copies negatively responded to biochar addition. Biochar application increased the community diversity of AOB but decreased that of AOA. Biochar addition and N fertilization shifted the AOB community from Nitrosospira-dominated to Nitrosospira and Nitrosomonas-dominated, and altered the AOA community from Nitrososphaera-dominated to Nitrososphaera and Nitrosopumilus-dominated. The relative abundance of Nitrosospira, Nitrosomonas and Nitrosopumilus decreased, and that of Nitrosovibrio and Nitrososphaera increased with biochar application rate. Soil SOC, pH and NO3−-N explained 87.1% of the variation in the AOB community, and 78.1% of the variation in the AOA community was explanatory by soil pH and SOC. The SOC and NO3−-N influenced NR through Nitrosovibrio, Nitrosomonas, Norank_c_environmental_samples_p_Crenarchaeota and amoA-AOB and amoA-AOA gene abundance. Therefore, biochar addition inhibited nitrification in salt-affected irrigation-silting soil by shifting the community structures of AOB and AOA and reducing the relative abundance of dominant functional ammonia-oxidizers, such as Nitrosospira, Nitrosomonas and Nitrosopumilus.
... The DNA quality was confirmed by 1% agarose gel electrophoresis. The extracted DNA samples were selected and used to conduct microbial community analysis by PCR using primers 338F (5′-ACT CCT ACG GGA GGC AGC AG-3′) and 806R (5′-GGA CTA CHVGGG TWT CTAAT-3′) for 16S rDNA in bacteria [41], and primers ITS1F (5′-CTT GGT CAT TTA GAG GAA GTAA-3′) and ITS2R (5′-GCT GCG TTC TTC ATC GAT GC-3′) for ITS in fungi [42]. ...
Article
Full-text available
Background Organic mulch is an important management practice in agricultural production to improve soil quality, control crop pests and diseases and increase the biodiversity of soil microecosystem. However, the information about soil microbial diversity and composition in litchi plantation response to organic mulch and its attribution to litchi downy blight severity was limited. This study aimed to investigate the effect of organic mulch on litchi downy blight, and evaluate the biodiversity and antimicrobial potential of soil microbial community of litchi plantation soils under organic mulch. Results Organic mulch could significantly suppress the disease incidence in the litchi plantation, and with a reduction of 37.74% to 85.66%. As a result of high-throughput 16S rRNA and ITS rDNA gene illumine sequencing, significantly higher bacterial and fungal community diversity indexes were found in organic mulch soils, the relative abundance of norank f norank o Vicinamibacterales, norank f Vicinamibacteraceae, norank f Xanthobacteraceae, Unclassified c sordariomycetes, Aspergillus and Thermomyces were significant more than that in control soils. Isolation and analysis of antagonistic microorganism showed that 29 antagonistic bacteria strains and 37 antagonistic fungi strains were unique for mulching soils. Conclusions Thus, we believe that organic mulch has a positive regulatory effect on the litchi downy blight and the soil microbial communities, and so, is more suitable for litchi plantation.
... In general, biochar application significantly increased bacterial and fungal diversity. This improvement can be attributed to the amounts of labile carbon, and micro-or macro-nutrients, provided by biochar that are available to the microbial communities in soils (Sohi et al. 2010;Xu et al. 2016). Additionally, the increase in soil porosity with biochar applications protects some microbial organisms from predation, thereby increasing microbial biomass and diversity (Palansooriya et al. 2019;Warnock et al. 2007). ...
Article
Full-text available
Biochar is a widely known soil amendment. Here we synthesize the available information on influence of biochar application on different soil properties and crop productivity using meta-analysis. Global data on influence of biochar applications on different soil physical, chemical, microbial properties, and crop productivity were extracted from literature and statistically analyzed. Based on selection criteria, 59 studies from the literature published between 2012 and 2021 were selected for the meta-analysis. Correlations were developed between effect size of biochar application on different soil properties and crop productivity. Application of biochar increased soil pH, cation exchange capacity, and organic carbon by 46%, 20%, and 27%, respectively, with greater effects in coarse and fine-textured soils. Effects on chemical properties were variable among biochar prepared from different feedstocks. Among physical properties, biochar application reduced bulk densities by 29% and increased porosity by 59%. Biochar prepared at higher pyrolytic temperatures (> 500 ℃) improved bulk density and porosity to greater extents (31% and 66%, respectively). Biochar prepared at lower pyrolytic temperatures (< 500 ℃) had a greater effect on microbial diversity (both bacterial and fungal), with more diverse bacterial populations in medium and coarse textured soils, while fungal diversity increased in fine textured soils. Biochar applications increased crop productivity only in fine and coarse textured soil. The effect size of biochar application on crop productivity was correlated with responses to physical properties of soils. The meta-analysis highlighted the need to conduct long-term field experiments to provide better explanations for changes in biochar properties as it undergoes aging, its longer-term effects on soil properties, and timing of re-application of different biochars. Highlights • Meta-analysis was conducted to assess overall effect of biochar application to soil. • Biochar application increased soil pH, CEC, and organic carbon with greater effects in controlled environment studies. • Microbial diversity was increased with biochar application but was negatively affected at higher rates.
... PCR amplifications targeting the V3-V4 region of archaeal 16S rRNA genes were performed in all samples using primers 524-10-ext (5 -TGYCAGCCGCCGCGGTAA-3 ) and arch958RmodR (5 -YCCGGCGTTGAVTCCAATT-3 ) [34]. PCR amplifications targeting the V3-V4 region of bacterial 16S rRNA genes were performed for all samples using primers 338F (5 -ACTCCTACGGGAGGCAGCAG-3 ) and 806R (5 -GGACTACHVGGGTWTCTAAT-3 ) [35]. PCR amplifications targeting the ITS region of fungal genes were performed for all samples using primers ITS3F (5 -CTTGGTCATTTAGAGGAAGTAA-3 ) and ITS3R (5 -GCTGCGTTCTTCATCG ATGC-3 ) [36]. ...
Article
Full-text available
Soil physicochemical properties are the main driving factors affecting the stability and diversity of the soil microbial community. The impacts of the saline–alkali situation and associated soil degradation need to be understood and reversed as soil diversity and communities are increasingly affected by saline–alkaline soil. However, the differences between salinization and alkalization soil and their impact on microbiota have been overlooked. The object of this study is to demonstrate the differences in salinization and alkalization soil and the driving factors affecting microbiota. In this study, 12 soil samples collected from saline–alkaline spots were used to detect the differences in soil physicochemical properties. The soil microbial community was sequenced by high-throughput sequencing. The results of ESP and EC in the soil samples indicated that the soil samples were categorized as saline soil and sodic soil. Venn diagrams indicated that unique OTUs in saline soil showed higher adaptation and environmental tolerance. Partial Mantel tests showed that the differences in pH, exchangeable sodium percentage (ESP), C/N, Na, and K between saline and sodic soil were the primary determinants affecting the relative abundance of bacterial and fungal communities, besides electrical conductivity (EC). In the KEGG analysis, ESP mainly affected the cellular processes in the archaea. Metabolism in the bacterial function was positively correlated with K only in sodic soil. These results indicated that the proportions in sodic soil were more strongly affecting soil microbiota.
... The V3-V4 hypervariable regions of bacterial 16S rRNA gene were amplified using the universal primer with 338F/806R (Xu et al., 2016). PCRs comprised TransStart R Fastpfu DNA Polymerase (TransGen Biotech, Beijing, China) and reactions were prepared according to the manufacturer's instructions. ...
Article
Full-text available
Phaeocystis globosa ( P. globosa ) is one of the dominant algae during harmful algal blooms (HABs) in coastal regions of Southern China. P. globosa exhibits complex heteromorphic life cycles that could switch between solitary cells and colonies. The ecological success of P. globosa has been attributed to its colony formation, although underlying mechanisms remain unknown. Here, we investigated different bacterial communities associated with P. globosa colonies and their influence on colony formation of two P. globosa strains isolated from coastal waters of Guangxi (GX) and Shantou (ST). Eight operational taxonomic units (OTUs) were observed in ST co-cultures and were identified as biomarkers based on Linear discriminant analysis Effect Size (LEfSe) analysis, while seven biomarkers were identified in P . globosa GX co-cultures. Bacterial communities associated with the P. globosa GX were more diverse than those of the ST strain. The most dominant phylum in the two co-cultures was Proteobacteria, within which Marinobacter was the most abundant genus in both GX and ST co-cultures. Bacteroidota were only observed in the GX co-cultures and Planctomycetota were only observed in the ST co-cultures. Co-culture experiments revealed that P . globosa colony formation was not influenced by low and medium cell densities of Marinobacter sp. GS7, but was inhibited by high cell densities of Marinobacter sp. GS7. Overall, these results indicated that the associated bacteria are selected by different P . globosa strains, which may affect the colony formation and development of P. globosa .
Article
Biochar application to chemical-amended paddy soils has been proposed as a potential strategy to enhance nitrogen (N) retention and nitrogen use efficiency (NUE) by crops. However, optimal concentrations for these enhancements and the potential drivers are not well understood. Herein, a column-based pot experiment was carried out to investigate the impacts of reed-biochar application rate on N losses and dynamics in paddy soils treated by chemical fertilizer, and particularly, to explore the dominant factors of the processes. The addition of 2–4% reed-biochar had the most significant effects on mitigating N loss by leaching. Reed-biochar amendment increased soil total N and mineral N (NH4⁺-N and NO3⁻-N) content, and denitrifying gene abundance, and the increments of those variables were positively related to the application rate. Soil treated with 1–4% reed-biochar at harvest period showed higher gene abundances of ammonia-oxidizing and dissimilatory nitrate reduction to ammonium (DNRA) and higher activity of β-1,4-N-acetyl-glucosaminidase (NAG) and leucine aminopeptidase compared with the 4–8% application rate. The amoA-AOA gene abundance, NAG activity, and total carbon (C) content were the main predictors of total N and mineral N accumulated leakage. Total C content was the main predictor of soil total N and mineral N content, followed by the pH and NAG activity. These results suggest that adding 2–4% reed-biochar was more beneficial to mitigate N loss and thus enhance soil N storage and availability. This study highlights the importance of understanding how microbial populations mediate N transformation to decipher biochar-driven NUE enhancement in paddy soils.
Article
Full-text available
To reveal the effects of plantations on soil microbial environment,the composition and diversity of soil fungi and bacterial communities in five restoration models (Robinia pseudoacacia, Populus hopeiensis, Pinus tabuliformis, Picea crassifolia, natural restoration) in the mountainous area of southern Ningxia were compared by using high-throughput sequencing technology. The correlation between soil physical-chemical properties and dominant microbial groups was analyzed. The results showed that: 1) Dominant fungi in different restoration models were Ascomycota, Basidiomycota, Mortierellomycota, and unclassified fungi, which accounted for 90% of total fungal community. The dominant soil bacteria were Actinobacteria, Proteobacteria, Acidobacteriota, Chloroflexi, and other bacteria, accounting for more than 80% of total bacterial community. 2) The diversity of soil fungi in P. tabuliformis forest was the highest, with Shannon index, and Simpson index being 3.72±0.37 and 0.07±0.04, respectively. The richness of fungi in naturally restored forest land was the highest, with Ace and Chao1 index of 708.19±137.25 and 706.26±125.34, respectively. The bacterial diversity and richness of species in P. tabuliformis forest land was the highest. The Shannon, Simpson, Ace and Chao1 indices were 6.57±0.04, 0.004±0.00, 3439.81±41.67, 3463.14±32.16, respectively. 3) The fungus with significant difference among restoration models were Solicoccozyma, Cladosporium, and Alternaria. Bacteria from Norank_f_67-14, Rubrobacter_f_Rubrobacteraceae, Sphingomonas_f_Sphingomonadaceae had significant difference among restoration models. 4) The RDA ordination of the dominant microbial flora and soil physical-chemical properties showed that soil bulk density (BD), carbon to nitrogen ratio (C/N), and pH were the major factors affecting the dominant fungal flora. BD, nitrogen to phosphorus ratio (N/P), total phosphorus (TP), and total carbon (TC) were the main factors affecting the dominant bacterial flora. In general, the difference of composition and diversity in the fungal community of different restoration models was higher than that of the bacterial community, indicating that the fungal communities were more sensitive to the changes of tree species and soil environment than bacterial communities. Our results could provide the theoretical foundation for vegetation restoration measures and the maintenance of ecosystem function stability in southern Ningxia.
Article
Full-text available
Traditional herbal medicine (THM) is used worldwide for its safety and effectiveness against various diseases. Huoxiang Zhengqi (HXZQ) is an extensively used Chinese THM formula targeting gastrointestinal disordered gastroenteritis via regulating the intestinal microbiome/immuno-microenvironment. However, the specific mechanisms remain largely unexplored, besides as a lifestyle drug, its safety on the gut microbiome homeostasis has never been investigated. In this study, the effects of HXZQ on the gut microbiome of healthy adults were investigated for the first time, and the antibiotic-induced gut microbiota dysbiosis mice model was applied for verification. Based on healthy adults, our results revealed that HXZQ exhibited mild and positive impacts on the bacterial diversity and the composition of the gut microbiome in a healthy state. As for an unhealthy state of the gut microbiome (with low bacterial diversity and deficient compositions), HXZQ significantly restored the bacterial diversity and recovered the abundance of Bacteroidetes. In the antibiotic-induced mice model, HXZQ distinctly revived the deficient gut microbial compositions impaired by antibiotics. At the genus level, the abundances that responded most strongly and positively to HXZQ were Bifidobacterium in healthy adults and Muribaculaceae, Lactobacillus, and Akkermansia in mice. In contrast, the abundance of Blautia in healthy adults, Enterococcus, and Klebsiella in mice showed inversely associated with HXZQ administration. At last, HXZQ might exhibit an anti-inflammatory effect by regulating the concentration of interleukin-6 in plasma while causing no significant changes in the colon tissue structure in mice. In conclusion, our results elucidate that the safety of HXZQ in daily use further reveals the modulatory effects of HXZQ on gut microbial community structure. These results will provide new insights into the interaction of THM and gut microbiome homeostasis and clues about the safe use of THM as a lifestyle drug for its further development.
Article
In acidic soil, potassium (K) deficiency is a main limiting factor that restricts the growth of fruit trees. Biochar has been used as a soil amendment to increase pH and nutrients. However, studies on the effect of biochar on the bacterial community and soil properties in potted experiments are limited. Therefore, we used peanut shell biochar to investigate the effect of biochar on the structure and function of bacterial communities by high-throughput sequencing, soil enzymes (urease, dehydrogenase, and extracellular enzymes), and gene function prediction in response to K deficiency in acidic soil. The results indicated that soil pH, enzyme activity, and available nutrients were improved by biochar. In particular, biochar still had a beneficial effect on improving soil and plant K levels after thirty months of application. In addition, biochar promoted the growth of K-dissolving bacteria and relative abundance of bacteria (p_actinomycetes, p_chloroflexi, p_proteobacteria, p_acidobacteriota, and p_firmicutes). Based on the above results, we assumed that biochar application can effectively improve soil K levels and bacterial functions. Such as: K-dissolving, soil organic matter decomposition and the conversion of nutrients. Our findings encourage and support the use of biochar as an amendment in acidic soil.
Article
Biological nitrogen fixation (BNF) can help replenish available nitrogen (N) in cropland and reduce the use of chemical N fertilizers, with diazotrophs playing an important role. However, the response of diazotroph community and BNF activity in biochar amendment soil, especially in the deep soil horizon, are poorly understood. In this study, soil samples were collected from topsoil (0–20 cm) and subsoil (20–40 cm) in the field experiment (established in 2013) comprising treatments with no chemical fertilizer (CK), chemical fertilizer (NPK), biochar (BC), and biochar plus chemical fertilizers (BNPK). Here, we investigated the diazotroph community using real-time PCR and high-throughput sequencing of the nifH gene, and assessed the soil N 2 fixation rate (R Nfix ) using acetylene reduction assay (ARA). Results showed that in the topsoil, the treatments with biochar significantly increased nifH gene copies and R Nfix , which was consistent with the increased soil organic matter (SOM), total carbon-to-nitrogen ratio (C/N), dissolved organic carbon (DOC) and pH. In the subsoil, applying chemical fertilizers (NPK) strongly decreased R Nfix , but had no effect on diazotroph abundance; in contrast, biochar application (BC) had no effect on R Nfix , but suppressed the growth of bacteria and diazotrophs while increasing the abundance of Rhizobiales order. Diazotroph and bacterial gene copies were significantly and positively correlated in both top- and sub-soil, and they were mainly influenced by SOM and total nitrogen (TN). In addition, soil nitrate nitrogen (NO 3 ⁻ –N) was the major factor in shaping the vertical stratification of diazotroph community structure. Although nifH gene abundance was significantly correlated with R Nfix in the topsoil, the structure equation modeling (SEM) showed the highest correlation between diazotroph community structure and R Nfix . Hence, we suggested that soil carbon and nitrogen sources were the key factors correlated with changes in the vertical pattern of diazotroph abundance. Biochar induced the dominant diazotroph community succession and increased soil carbon content and pH, which contributed to the BNF activity. Changes in the BNF activity were driven by the variation in diazotroph community structure.
Article
Full-text available
The present study comprehensively compared two different breeding models in terms of their microbiome composition and the associations of the microbiomes with crayfish growth and water quality. RC model-specific microbiome composition was identified; these microbes were found to have a positive association with water quality and crayfish growth.
Article
Biochar has received increasing attention in agricultural and environmental fields as an integrated solution to agricultural waste recycling, soil amendment, carbon sequestration, and greenhouse gas (GHG) reduction. However, obtaining the environmental benefits of biochar is limited by an inadequate number of soil applications. Currently, the willingness to use biochar in soil management is relatively low, which results from the insufficient understanding and promotion of the roles of biochar in soil management and climate change mitigation. This review article presents biochar applications based on carbon-neutral strategies in agricultural soil systems. The primary roles of biochar in soil improvement and remediation are discussed and the main soil application methods are introduced. The focus of this article is on biochar-based soil management strategies for contributing to carbon neutrality. Carbon sequestration using biochar is an application-dependent strategy, as the key to obtaining this ecological benefit is to store biochar products in soil via effective agricultural management. This article offers insights into biochar-based soil management strategies and their contribution to carbon neutrality in agricultural soil systems, with recommendations for appropriate government involvement in promoting biochar-based soil management and for incorporating biochar into the carbon trading market.
Article
How microbial communities respond to extreme conditions in the stratosphere remains unclear. To test this effect, cyanobacterial crusts collected from Tengger Desert were mounted to high balloons and briefly exposed (140 min) to high UV irradiation and low temperature in the stratosphere at an altitude of 32 km. Freezing and thawing treatments were simulated in the laboratory in terms of the temperature fluctuations during flight. Microbial community composition was characterized by sequencing at the level of DNA and RNA. After exposure to the stratosphere, the RNA relative abundances of Kallotenue and Longimicrobium increased by about 2-fold, while those of several dominant cyanobacteria genera changed slightly. The RNA relative abundances of various taxa declined after freezing, but increased after thawing, whereas cyanobacteria exhibited an opposite change trend. The DNA and RNA relative abundances of Nitrososphaeraceae were increased by 1.4~2.3-fold after exposure to the stratosphere or freezing. Exposure to stratospheric environmental conditions had little impact on the total antioxidant capacity, photosynthetic pigment content, and photosynthetic rate, but significantly increased the content of exopolysaccharides by 16%. The three treatments (stratospheric exposure, freezing, and thawing) increased significantly the activities of N-acetyl-β-D-glucosidase (26~30%) and β-glucosidase (14~126%). Our results indicated cyanobacterial crust communities can tolerate exposure to the stratosphere. In the defense process, extracellular organic carbon degradation and transformation play an important role. This study makes the first attempt to explore the response of microbial communities of cyanobacterial crusts to a Mars-like stratospheric extreme environment, which provides a new perspective for studying the space biology of earth communities.
Article
Green tides caused by Ulva prolifera occur annually in the Yellow Sea, potentially influencing the marine microorganisms. Here, we focused on the variations in marine bacterial and archaeal communities during an U. prolifera green tide in coastal Qingdao areas with Illumina high-throughput sequencing analysis. Our results revealed that the diversity and structure of bacterial and archaeal communities, as well as the organization and structure of microbial co-occurrence networks, varied during the green tide. The decline phase may be favorable to the bacterial and archaeal diversity and richness. The bacterial community, as well as the archaeal community, showed clear variations between the outbreak and decline phases. A simpler and less connected microbial co-occurrence network was observed during the outbreak phase compared with the decline phase. Flavobacteriales and Rhodobacterales separately dominated the bacterial community during the outbreak and decline phase, and Marine Group II (MGII) dominated the archaeal community during the green tide. Combined with microbial co-occurrence network analysis, Flavobacteriales, Rhodobacterales and MGII may be important organisms during the green tide. Temperature, chlorophyll a content and salinity may have an important impact on the variations in bacterial and archaeal communities during the green tide.
Article
Full-text available
There is a renewed global awareness to improve soil health through the intensification and management of organic inputs such as the application of animal waste–based digestate and other types of organic fertilizers to the soil. The objective of this study was to evaluate the influence of different types of animal waste–based digestate application on soil prokaryotic diversity and composition in an agricultural cropping system over a period of 3 years, cultivated with three different annual cereal crops (spring wheat, triticale, and barley). Treatments were laid out in a randomized design with five conditions (three replicates per condition): fertilizer treatments included three different types of digestate (pig manure, chicken manure, and cow manure digestates), synthetic mineral nitrogen, and unfertilized control. Prokaryotic soil communities were characterized by Illumina MiSeq sequencing. The three most abundant phyla identified were Actinobacteria, Acidobacteria, and Proteobacteria, which accounted for over 55% of the total prokaryotic community. Other phylogenetic groups such as Verrucomicrobia and Bacteroidetes were also identified as part of the native soil microbiota. It was observed that the period of digestate application did not significantly influence the prokaryotic diversity in the soil. On the contrary, sampling time was a major factor in driving β-diversity. A correlation with soil pH was also observed for several taxonomic groups, indicating its importance in shaping prokaryotic community composition. Our study showed that the richness and diversity of the soil prokaryotic community were not affected by digestate application, while other factors such as the yearly crop varieties and seasonal/climate changes were the major contributors to differentiating the prokaryotic community composition over time.
Article
Biochar has been regarded as an effective amendment for soil carbon sequestration and soil quality improvement. However, it remains unclear how pyrolysis temperature and biochar aging impact the responses of soil properties and CO2 emissions to biochar addition. Here, we investigated the effect of biochar on soil properties and CO2 emissions in a laboratory incubation using soils amended with/without fresh biochar produced at 300 (BC300), 450 (BC450), and 600 °C (BC600) and their corresponding naturally aged samples (aged in soil for 360 days). The results showed that biochar significantly increased soil total nitrogen (by 8–36%), available phosphorus (by 19–69%) and available potassium (by 1.5–4.2-fold) throughout the incubation. Both fresh and aged biochar promoted the formation of soil macroaggregate at the end of the incubation. Moreover, fresh and aged BC300 increased the soil dissolved organic matter (DOM) content, whereas for BC450 and BC600, at the beginning, the content of soil DOM was reduced, but the effects finally became insignificant. Generally, fresh biochar had no significant effect on soil enzyme activities and soil bacterial richness and diversity, but an inhibitory effect occurred in the aged samples. Both fresh and aged BC300 increased soil CO2 emissions, which was due to the biochar-induced increase in soil DOM content and enrichment of copiotrophic bacteria (Proteobacteria) as well as the decline of oligotrophic bacteria (Acidobacteriota). A significant decrease in soil CO2 emissions was observed after fresh BC450 and BC600 addition, owing to the biochar-induced decline in soil DOM content, while an opposite trend was found in aged samples, which could be attributed to the shift of the dominant soil phylum from Acidobacteriota to Proteobacteria. These findings enhance our understanding of biochar's potential to improve soil quality and sequester soil carbon.
Chapter
Full-text available
Biochar application has long been recognized as one of the best approaches for sustainable agriculture. In this regard, studies involved investigating the impact of various biochar types on a wide range physicochemical and biological properties of different soil types and the growth performance of crop species. Although the studies focus on the diversity, abundance, community structure, and functional properties of microorganisms inhabited in charosphere, the immediate interfaces of soil and biochar are limited. Therefore this chapter provides insight into the bacterial, fungal, and soil faunal colonization characteristics in charosphere along with the functional properties affected in dissimilar soil types by biochar having different origins. The effect of altered physicochemical properties such as soil pH, soil aggregate stability, cation-exchange capacity, microbial biomass carbon and nitrogen, available nutrients, and soil porosity and water holding capacity accompanied by biochar application on colonization and functioning of soil microbiota is highlighted in different sections with reference to recent scientific publications. Furthermore, the soil biotic responses such as enzymatic activities and metabolism regulated by biochar application are extensively discussed and recommendations are provided.
Article
A balance between soil water and air is needed to optimize soil microbial activity in laboratory incubations. Some fraction of water holding capacity (WHC) is often used to optimize water during controlled laboratory incubations, and yet this level may differ among soils. This study was undertaken to develop relationships among gravimetric and volumetric water content, WHC, and water‐filled pore space (WFPS) among a variety of soils, representing eight soil orders, 46 subgroups, total soil N from 0.46 to 4.68 g kg–1, and clay concentration from .072 to .491 kg kg–1 (5–95% range). Gravimetric soil water content was determined for each sample under the following sequence of conditions: (a) from dry storage, (b) when dried at 55 °C, (c) near saturation, and (d) when drained to WHC. Gravimetric water content was calculated at 50% WFPS (.50 m3 m–3). Like that of WFPS, WHC varied strongly with soil clay and total N concentrations. To achieve 50% WFPS, water content was 69 ± 10% of WHC and 58 ± 3% of near saturation. Although drying soil to only 55 °C for routine soil microbial processing led to overestimation of soil bulk density by 0.012 ± 0.006 Mg m–3, it was a bias. Soil water content calculations are important for obtaining best estimates of soil‐test biological activity and other soil C and N fractions to assess soil health, and this research demonstrated that using drying temperature of 55 °C was practical but created a small and consistent bias. Water to achieve 50% water‐filled pore space was at 69 ± 10% of water‐holding capacity. Water retention characteristics were affected more by organic matter than texture. Soil water relations were dependent on total soil N and clay concentrations, not on geography. Dry mass of soil at 105 °C was .991 ± .005 times that at 55 °C.
Article
In recent years, the abuse of chemical fertilizers has caused numerous environmental problems, such as soil acidification and compaction. Replacing chemical fertilizers with organic fertilizers can effectively alleviate these problems. However, the effects of alternative organic fertilizers remain unclear. To explore the effects of organic fertilizer substitution on rice yield and paddy soil physicochemical properties and bacterial community structure, we conducted a 5-year experiment using different proportions of organic fertilizer substitution in a double-cropping rice field in Jiangxi, China. Our results showed that replacing chemical fertilizers with organic fertilizers can reduce soil acidification, increase soil organic matter content, nutrient contents, and enzyme activities, improve soil physicochemical properties and microbial community, and enhance soil metabolism. Appropriate organic substitution also had positive effects on rice production. These findings enhance our understanding of the effects of different alternative organic fertilization methods and have important theoretical significance for the promotion of the use of organic fertilizers in the future.
Article
This work developed calcium alginate (CA) embedded zero-valent iron ([email protected]) and CA embedded biochar (BC) immobilized microorganism (BC&[email protected]) gel beads as alternative to conventional Fe⁰ permeable reactive barriers for treating groundwater contaminated with 2,4,6-trichlorophenol (2,4,6-TCP). Lab-scale and field-scale biochar-microorganism augmented PRBs (Bio-PRBs) were constructed and tested. The underlying mechanisms were revealed by a multi-source data calibrated multi-process reaction model, X-ray photoelectron spectroscopy (XPS), X-ray diffraction (XRD), and high-throughput sequencing. Moreover, calibrated advection-dispersion (a) coupled with the two-site sorption (Kd) and chemical-biological multi-process reaction (λ) model were used for revealing 2,4,6-TCP transport behaviour and optimizing Bio-PRBs. Compared to that in the [email protected] (0.004 h–1) system, the reaction rate (0.011 h–1) of 2,4,6-TCP increased by 175% in the combined chemical-biological batch system. Moreover, chemical-biological augmentation significantly improved the retardation effect of Bio-PRBs for 2,4,6-TCP. It came from that chemical-biological augmentation significantly decreased the dispersivity a (0.53 to 0.20 cm), and increased the distribution coefficient Kd (2.20 to 19.00 cm³∙mg–1), the reaction rate λ (2.40 to 3.60 day–1), and the fraction (30% to 80%) of first-order kinetic sorption of 2,4,6-TCP in the lab-scale one-dimensional Bio-PRBs. Moreover, versatile functional bacteria Desulfitobacterium was crucial in the transformation of Fe (III) iron oxides. The diversity and richness of archaea in the reaction solution were improved by [email protected] gel beads addition. Furthermore, the field-scale reaction system was designed to remediate the chlorinated organic compounds and Benzene Toluene Ethylbenzene & Xylene contaminated groundwater in a pesticide factory site. The field test results demonstrated it is a promising technology to construct vertical reaction columns or horizontal Bio-PRBs for the efficient remediation of actually contaminated groundwater.
Article
In this study, the microbial mechanism of reducing methanogenesis during membrane-covered aerobic composting from solid dairy manure was investigated. An industrial-scale experiment was carried out to compare a static composting group (SC) and a forced aeration composting group (AC) with a semipermeable membrane-covered composting group (MC+AC). The results showed that the semipermeable membrane-covered could improve the oxygen utilization rate and inhibit the anaerobic bacterial genus Hydrogenispora and archaea order Methanobacteriales. During the membrane-covered period, the acetoclastic methanogenesis module in MC+AC, AC and SC decreased by 0.58%, 0.05% and 0.04%, respectively, and the cdhC gene in the acetoclastic pathway was found to be decreased by 65.51% only in MC+AC. Changes in methane metabolism pathways resulted in a 27.48% lower average methane concentration in MC+AC than in SC. Therefore, the semipermeable membrane-covered strategy can effectively reduce methane production during dairy manure aerobic composting by restricting the methanogenesis of the acetoclastic pathway.
Article
Sedimentary microorganisms play crucial roles in maintaining the functional stability of aquatic ecosystems. However, their taxonomic composition and assembly processes are not well known in estuarine–coastal margins because of their complex environment. We investigated microbial communities, co-occurrence relationships, and underlying mechanisms in 33 surface sediment samples collected in the Jiulong River Estuary and the Taiwan Strait to reveal their composition dynamics. The abundance, diversity, and composition of microorganisms demonstrated obvious spatial variables. Methanobacterium and Methanosarcina, as well as Candidatus_Nitrosopumilus and Nitrososphaeraceae were the main methanogenic and ammonia-oxidizing archaea, with an average abundance of more than 5.91% and 4.27%, respectively. Along with a salinity gradient increase, the relative abundance of methanogenic archaea (from 42.9% to 16.6%) contrasted with the trend of ammonia-oxidizing archaea (from 6.04% to 18.7%). The number of methanogenic archaea gradually decreased with increasing geographic distance (p < 0.05), whereas ammonia-oxidizing archaea showed no significant change (p > 0.05). In co-occurrence patterns, closer inter-taxa connections were observed among archaea–archaea and bacteria–bacteria than in archaea–bacteria, which indicated that coexistence within the same kingdom was greater than interaction between different kingdoms in shaping the community structure along the salinity gradient. Furthermore, null model analyses of the microbial community showed that undominated was the most prominent process, explaining over 44.9% of community variation, followed by heterogeneous selection and dispersal limitation, which contributed to 27.7% and 16.3%, respectively. We demonstrated that stochasticity, rather than determinism, regulates community assembly. These results further highlight that intra-kingdom co-occurrence and stochastic processes shape the structure and assembly of microbial communities in estuarine–coastal margins.
Article
The cartridge filter (CF) as a “firewall” is crucial between pretreatment and nanofiltration (NF) units, but CF fouling with risk has received limited attention. The systematic autopsy for CFs (CF1 and CF2) applied in a NF drinking water plant was conducted to reveal CF fouling profile. Herein, scale blocks, irregular-shaped particles, and stacked-floc clusters were observed as the main morphologies of foulants. The major elements from foulants included Fe, Ca, Al, Mg, Na, P, and Si. The dissolved matters especially bioproducts resulted in the secondary pollution of permeated water. Biofouling was mainly caused by Proteobacteria phyla, and consisted of a large proportion of polysaccharides (11% and 25.1%), proteins (10.3% and 22.7%), lipids (21.7% and 22.4%), respectively. In addition, an obvious contrast was observed regarding the antifouling performance of CFs. The surface scaling degree of CF1 with horizontal irregular loose-pleats was more serious than CF2 with vertical regular compact-pleats, while the latter with high-density pleats appeared the higher fouling potential due to a greater capacity for organic foulants in the inner layers of “firewall” and better bio-diversity and bio-evenness of microbial communities. This study provides a deeper insight into CF fouling and contributes to the application of CFs.
Article
Environmental fluoride (F⁻) contamination, mainly due to natural geogenic processes, and in spot cases also of anthropogenic origin, is a widespread global issue, which has been recognized to affect all living organisms. From the contaminated soil and water, F⁻ is absorbed by plants which can manifest symptoms of abiotic stress including oxidative stress and interference with essential physiological and biochemical processes involved in seed germination and plant growth and development. Depending on the diet of the population living in the high F-polluted areas, F-contaminated crops can be key contributors to excessive F⁻ intake along food chains which can lead to human and animal health issues. Various strategies are being explored with the objective of reducing both F⁻ bioaccumulation and its damage on plants (e.g. by means of immobilization or phytoextraction processes) or aimed at limiting the F⁻ anthropogenic input in the soil (e.g. through the use of alternative phosphate fertilizers) but the literature is still fragmented. After a brief overview on the effects of F⁻ on the production and safety of food crops, its sources, mobility and bioavailability in agricultural soils, this paper reviews the available F⁻ mitigation and adaptation options and the involved mechanisms with the aim of providing stakeholders with knowledge to make informed decisions when selecting methods for coping with F⁻ impacts in agricultural systems. Research gaps and possible areas for future studies have also been suggested. Please find below a 50 days' free access link to this article that is active up to June 07, 2022 https://authors.elsevier.com/a/1ex4SB8ccuibJ
Article
Bio-mulching is a common agricultural practice in southwest China to improve crop productivity and soil fertility. In this study, a field experiment to investigate the effects of Chinese milk vetch (Astragalus sinicus L.) mulching and soybean straw retention (at the rate of 2250 and 4500 kg ha⁻¹) on wheat soil microbial community and carbon utilization efficiency was conducted in southwest China. Results showed that the alpha diversity indices (Chao and Shannon) of bacteria and fungi in milk vetch mulching treatment were significantly increased in the wheat non-rhizosphere soils compared with control soil (without mulching). Within the bacterial community, the relative abundance of Actinobacteria and Chloroflexi was significantly increased by milk vetch mulching over the control, while the relative abundance of Acidobacteria, Firmicutes, Verrucomicrobia, and Gemmatimonadetes were significantly decreased in both wheat rhizosphere and non-rhizosphere soil. Within the fungal community, the relative abundance of Basidiomycota was significantly increased in milk vetch mulching treatment than that of control. By contrast, the differences in microbial diversity and community structure between the soybean straw retention and control were not distinctive. The correlation analysis revealed that wheat soil moisture, soil nitrate content, microbial biomass carbon, dissolved organic carbon and nitrogen content were closely related to the soil microbial community structure under different mulching practices. Results of the Biology ECO-plate revealed that all bio-mulching practices have enhanced the carbon source utilization rate. In addition, the relative abundance of Actinobacteria and Basidiomycota has a positive correlation with the metabolism rate of carbon substrates, such as glycyl-L-glutamic acid, I-erythritol, D-xylose, and α-cyclodextrin. Overall, our results suggested that bio-mulching, especially milk vetch mulching, has changed greatly the soil microbial community structure and function in the wheat rhizosphere.
Article
Soil fumigation can reduce the impact of soil-borne diseases, weeds and insect pests on commercial crop production. Unfortunately, fumigation also kills beneficial microorganisms. In this study, we explored if dazomet fumigation could be used in combination with organic fertilizers (silicon fertilizer, potassium humate organic fertilizer, Bacillus microbial fertilizer, and mixtures of the last two) to reduce its impact on soil beneficial microorganisms. We evaluated the effects of adding these fertilizers after fumigation on the soil's physical and chemical properties and its enzyme activities, as well as its effects on the soil microbial communities under continuous production for >20 years. We found that fertilizers applied after fumigation increased the soil nitrate nitrogen content by 11.6%–29.4%, increased available potassium content by 5.6%–26.3% and increased organic matter content by 28.5%–48.8%. In addition, soil conductivity and water content increased significantly by 8.2%–26.5% and 8.0%–16.0%, respectively. The activities of soil catalase and soil sucrase were significantly increased by 6.2%–15.9% and 133.1%–238.5%, respectively. High-throughput DNA sequencing showed that fertilizers applied after fumigation increased the relative abundance of the phyla Proteobacteria, Actinobacteria and Ascomycota; and the genera Sphingomonas, Chaetomium and Mortierella. Silicon fertilizer applied after fumigation has the most significant promotion effect on soil micro-ecological health. The results showed that organic fertilizers applied after fumigation can improve the soil's fertility, activate soil enzyme activities and promote the recovery of soil beneficial microorganisms, which are all factors that improve crop quality and yield.
Article
Full-text available
Using a laboratory experiment, we investigated the effect of applying willow biochar to short rotation coppice soil on C and N dynamics and microbial biomass and community composition, in the presence and absence of willow litter. Application of biochar at a rate of 0.5 % had no effect on net CO2 mineralisation in the presence or absence of litter. However at a rate of 2 %, net CO2 mineralisation was reduced by 10 and 20 % over a 90-day period in the absence and presence of litter respectively. Biochar reduced N mineralisation when applied at both 0.5 and 2 % concentrations. pH was increased by application of 2 % biochar to soil. Phospholipid fatty acid analysis demonstrated that both concentrations of biochar affected microbial community composition, although the effect of biochar was not as great as the effect of time or litter application in shaping community structure. In particular, the amount of bacterial biomass was increased by biochar application to soil, and there was evidence for increased abundance of Gram-negative bacteria and actinobacteria following biochar application. The data is discussed in the context of microbial mechanisms underlying impacts of biochar on C cycling in soil, and the coupling of C and N cycles following amendment of soil with biochar.
Article
Full-text available
Biochar has been suggested to improve acidic soils and to mitigate greenhouse gas emissions. However, little has been done on the role of biochar in ameliorating acidified soils induced by overuse of nitrogen fertilizers. In this study, we designed a pot trial in a greenhouse to study the interconnections between microbial community, soil chemical property changes and N2O emissions after biochar application. The results showed that biochar increased plant growth, soil pH, total carbon (TC), total N (TN), C: N ratio and soil cation exchange capacity (CEC). The results of high-throughput sequencing showed that biochar application increased α-diversity significantly and changed the bacterial community by mainly increasing the relative abundances of Acidobacteria and Chloroflexi, while decreasing the abundances of Bacteroidetes, Gemmatimonadetes, and TM7 at the phylum level. Biochar amendment stimulated both nitrification and denitrification processes, while reduced N2O emissions overall. Results of redundancy analysis (RDA) and variance partition analyses (VPA) indicated biochar could shift the soil microbial community by changing soil chemical properties, which modulate N-cycling processes and soil N2O emissions. The significantly increased nosZ transcription suggests that biochar brings about a decrease in N2O emissions by enhancing its further reduction to N2.
Article
Full-text available
In spite of the numerous studies reporting a decrease in soil nitrous oxide (N2O) emissions after biochar amendment, there is still a lack of understanding of the processes involved. Hence the subject remains controversial, with a number of studies showing no changes or even an increase in N2O emissions after biochar soil application. Unraveling the exact causes of these changes, and in which circumstances biochar decreases or increases emissions, is vital to developing and applying successful mitigation strategies. With this objective, we studied two soils (Haplic Phaeozem (HP) and Haplic Calcisol (HC)), which showed opposed responses to biochar amendment. Under the same experimental conditions, the addition of biochar to soil HP decreased N2O emissions by 76%; whereas it increased emissions by 54% in soil HC. We combined microcosm experiments adding different nitrogen fertilizers, stable isotope techniques and the use of a nitrification inhibitor (dicyciandiamide) with the aim of improving our understanding of the mechanisms involved in the formation of N2O in these two soils. Evidence suggests that denitrification is the main pathway leading to N2O emissions in soil HP, and ammonia oxidation and nitrifier-denitrification being the major processes generating N2O in soil HC. Biochar systematically stimulated nitrification in soil HC, which was probably the cause of the increased N2O emissions. Here we demonstrate that the effectiveness of using biochar for reducing N2O emissions from a particular soil is linked to its dominant N2O formation pathway.
Article
Full-text available
Biochar has been heralded as a solution to a number of agricultural and environmental ills. To get the most benefit from its application, environmental and social circumstances should both be considered.
Article
Full-text available
Biochar application is a promising strategy for sequestering carbon in agricultural soils and for improving degraded soils. Nonetheless, contradictory and unsettled issues remain. This study investigates whether biochar influences the soil microbial biomass and community structure using phospholipid fatty acid (PLFA) analysis. We monitored the effects of four different types of biochar on the soil microbial communities in three temperate soils of Austria over several months. A greenhouse experiment and two field experiments were conducted. The biochar application did not significantly increase or decrease the microbial biomass. Only the addition of vineyard pruning biochar pyrolysed at 400°C caused microbial biomass to increase in the greenhouse experiment. The biochar treatments however caused shifts in microbial communities (visualized by principal component analysis). We concluded that the shifts in the microbial community structure are an indirect rather than a direct effect and depend on soil conditions and nutrient status.
Article
Full-text available
Strongly acidic soil (e.g. pH < 5.0) is detrimental to tea productivity and quality. Wheat, rice and peanut biochar produced at low temperature (max 300 °C) and differing in alkalinity content were incorporated into Xuan-cheng (Ultisol; initial pHsoil/water = 1/2.5 4.12) and Ying-tan soil (Ultisol; initial pH soil/water = 1/2.5 4.75) at 10 and 20 g/kg (w/w) to quantify their liming effect and evaluate their effectiveness for acidity amelioration of tea garden soils. After a 65-day incubation at 25 °C, biochar application significantly (P < 0.05) increased soil pH and exchangeable cations and reduced Al saturation of both tea soils. Association of H+ ions with biochar and decarboxylation processes was likely to be the main factor neutralizing soil acidity. Further, biochar application reduced acidity production from the N cycle. Significant (P < 0.05) increases in exchangeable cations and reductions in exchangeable acidity and Al saturation were observed as the rate of biochar increased, but there were no further effects on soil pH. The lack of change in soil pH at the higher biochar rate may be due to the displacement of exchangeable acidity and the high buffering capacity of biochar, thereby retarding a further liming effect. Hence, a significant linear correlation between reduced exchangeable acidity and alkalinity balance was found in biochar-amended soils (P < 0.05). Low-temperature biochar of crop residues is suggested as a potential amendment to ameliorate acidic tea garden soils.
Article
Full-text available
The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.
Article
Full-text available
Biochar (BC) is a common minor constituent of soils and is usually derived from the burning of wood materials. In the case of Amazonian dark earth (ADE) soils, the increased amount of this material is believed to be due to anthropogenic action by ancient indigenous populations. In this study, we use 16S rRNA gene pyrosequencing to assess the bacterial diversity observed in the BC found in ADEs as well as in the dark earth itself and the adjacent Acrisol. Samples were taken from two sites, one cultivated with manioc and one with secondary forest cover. Analyses revealed that the community structure found in each sample had unique features. At a coarse phylogenetic resolution, the most abundant phyla in all sequence libraries were Actinobacteria, Acidobacteria, Verrucomicrobia and Proteobacteria that were present in similar relative abundance across all samples. However, the class composition varied between them highlighting the difference between the Acrisol and the remaining samples. This result was also corroborated by the comparison of the OTU composition (at 97 % identity). Also, soil coverage has shown an effect over the community structure observed in all samples. This pattern was found to be significant through unweighted UniFrac as well as P tests. These results indicate that, although the ADEs are found in patches within the Acrisols, the contrasting characteristics found between them led to the development of significantly different communities.
Article
Full-text available
Large-scale soil application of biochar may enhance soil fertility, increasing crop production for the growing human population, while also sequestering atmospheric carbon. But reaching these beneficial outcomes requires an understanding of the relationships among biochar's structure, stability, and contribution to soil fertility. Using quantitative (13)C nuclear magnetic resonance (NMR) spectroscopy, we show that Terra Preta soils (fertile anthropogenic dark earths in Amazonia that were enriched with char >800 years ago) consist predominantly of char residues composed of ~6 fused aromatic rings substituted by COO(-) groups that significantly increase the soils' cation-exchange capacity and thus the retention of plant nutrients. We also show that highly productive, grassland-derived soils in the U.S. (Mollisols) contain char (generated by presettlement fires) that is structurally comparable to char in the Terra Preta soils and much more abundant than previously thought (~40-50% of organic C). Our findings indicate that these oxidized char residues represent a particularly stable, abundant, and fertility-enhancing form of soil organic matter.
Article
Full-text available
Ribosomal 16S rRNA gene pyrosequencing was used to explore whether the genetically modified (GM) Bt-maize hybrid MON 89034 × MON 88017, expressing three insecticidal recombinant Cry proteins of Bacillus thuringiensis, would alter the rhizosphere bacterial community. Fine roots of field cultivated Bt-maize and three conventional maize varieties were analyzed together with coarse roots of the Bt-maize. A total of 547 000 sequences were obtained. Library coverage was 100% at the phylum and 99.8% at the genus rank. Although cluster analyses based on relative abundances indicated no differences at higher taxonomic ranks, genera abundances pointed to variety specific differences. Genera-based clustering depended solely on the 49 most dominant genera while the remaining 461 rare genera followed a different selection. A total of 91 genera responded significantly to the different root environments. As a benefit of pyrosequencing, 79 responsive genera were identified that might have been overlooked with conventional cloning sequencing approaches owing to their rareness. There was no indication of bacterial alterations in the rhizosphere of the Bt-maize beyond differences found between conventional varieties. B. thuringiensis-like phylotypes were present at low abundance (0.1% of Bacteria) suggesting possible occurrence of natural Cry proteins in the rhizospheres. Although some genera indicated potential phytopathogenic bacteria in the rhizosphere, their abundances were not significantly different between conventional varieties and Bt-maize. With an unprecedented sensitivity this study indicates that the rhizosphere bacterial community of a GM maize did not respond abnormally to the presence of three insecticidal proteins in the root tissue.The ISME Journal advance online publication, 12 July 2012; doi:10.1038/ismej.2012.77.
Article
Full-text available
Soil fertility and leaching losses of nutrients were compared between a Fimic Anthrosol and a Xanthic Ferralsol from Central Amaznia. The Anthrosol was a relict soil from pre-Columbian settlements with high organic C containing large proportions of black carbon. It was further tested whether charcoal additions among other organic and inorganic applications could produce similarly fertile soils as these archaeological Anthrosols. In the first experiment, cowpea (Vigna unguiculata (L.) Walp.) was planted in pots, while in the second experiment lysimeters were used to quantify water and nutrient leaching from soil cropped to rice (Oryza sativa L.). The Anthrosol showed significantly higher P, Ca, Mn, and Zn availability than the Ferralsol increasing biomass production of both cowpea and rice by 38–45% without fertilization (P
Article
Full-text available
Biochar can play a key role in nutrient cycling, potentially affecting nitrogen retention when applied to soils. In this project, laboratory experiments were conducted to investigate the adsorption properties of bamboo charcoal (BC) and the influence of BC on nitrogen retention at different soil depths using multi-layered soil columns. Results showed that BC could adsorb ammonium ion predominantly by cation exchange. Ammonium nitrogen (NH4 +-N) concentrations in the leachate of the soil columns showed significant differences at different depths after ammonium chloride application to the columns depending on whether BC had been added. Addition of 0.5% BC to the surface soil layer retarded the downward transport of NH4 +-N in the 70-day experiment, as indicated by measurements made during the first 7days at 10cm, and later, in the experimental period at 20cm. In addition, application of BC reduced overall cumulative losses of NH4 +-N via leaching at 20cm by 15.2%. Data appeared to suggest that BC could be used as a potential nutrient-retaining additive in order to increase the utilization efficiency of chemical fertilizers. Nonetheless, the effect of BC addition on controlling soil nitrogen losses through leaching needs to be further assessed before large-scale applications to agricultural fields are implemented. KeywordsBamboo charcoal-Nitrogen leaching-Nitrogen retention-Ammonium nitrogen-Adsorption
Article
Full-text available
The effects of fumigation on organic C extractable by 0.5 M K2SO4 were examined in a contrasting range of soils. EC (the difference between organic C extracted by 0.5 M K2SO4 from fumigated and non-fumigated soil) was about 70% of FC (the flush of CO2-C caused by fumigation during a 10 day incubation), meaned for ten soils. There was a close relationship between microbial biomass C, measured by fumigation-incubation (from the relationship Biomass C = FC/0.45) and EC given by the equation: Biomass C = (2.64 ± 0.060) EC that accounted for 99.2% of the variance in the data. This relationship held over a wide range of soil pH (3.9–8.0).ATP and microbial biomass N concentrations were measured in four of the soils. The ratios were very similar in the four soils, suggesting that both ATP and the organic C rendered decomposable by CHCl3 came from the soil microbial biomass. The C:N ratio of the biomass in a strongly acid (pH 4.2) soil was greater (9.4) than in the three less-acid soils (mean C:N ratio 5.1).We propose that the organic C rendered extractable to 0.5 m K2SO4 after a 24 h CHCl3-fumigation (EC) comes from the cells of the microbial biomass and can be used to estimate soil microbial biomass C in both neutral and acid soils.
Article
Full-text available
Bacteria belonging to phylum Gemmatimonadetes comprise approximately 2% of soil bacterial communities. However, little is known of their ecology due to a lack of cultured representation. Here we present evidence from biogeographical analyses and seasonal quantification of Gemmatimonadetes in soils, which suggests an adaptation to low soil moisture.
Article
Full-text available
Adding biochar to soil has environmental and agricultural potential due to its long-term carbon sequestration capacity and its ability to improve crop productivity. Recent studies have demonstrated that soil-applied biochar promotes the systemic resistance of plants to several prominent foliar pathogens. One potential mechanism for this phenomenon is root-associated microbial elicitors whose presence is somehow augmented in the biochar-amended soils. The objective of this study was to assess the effect of biochar amendment on the root-associated bacterial community composition of mature sweet pepper (Capsicum annuum L.) plants. Molecular fingerprinting (denaturing gradient gel electrophoresis and terminal restriction fragment length polymorphism) of 16S rRNA gene fragments showed a clear differentiation between the root-associated bacterial community structures of biochar-amended and control plants. The pyrosequencing of 16S rRNA amplicons from the rhizoplane of both treatments generated a total of 20,142 sequences, 92 to 95% of which were affiliated with the Proteobacteria, Bacteroidetes, Actinobacteria, and Firmicutes phyla. The relative abundance of members of the Bacteroidetes phylum increased from 12 to 30% as a result of biochar amendment, while that of the Proteobacteria decreased from 71 to 47%. The Bacteroidetes-affiliated Flavobacterium was the strongest biochar-induced genus. The relative abundance of this group increased from 4.2% of total root-associated operational taxonomic units (OTUs) in control samples to 19.6% in biochar-amended samples. Additional biochar-induced genera included chitin and cellulose degraders (Chitinophaga and Cellvibrio, respectively) and aromatic compound degraders (Hydrogenophaga and Dechloromonas). We hypothesize that these biochar-augmented genera may be at least partially responsible for the beneficial effect of biochar amendment on plant growth and viability.
Article
Full-text available
Microbial community composition was examined in two soil types, Anthrosols and adjacent soils, sampled from three locations in the Brazilian Amazon. The Anthrosols, also known as Amazonian dark earths, are highly fertile soils that are a legacy of pre-Columbian settlement. Both Anthrosols and adjacent soils are derived from the same parent material and subject to the same environmental conditions, including rainfall and temperature; however, the Anthrosols contain high levels of charcoal-like black carbon from which they derive their dark color. The Anthrosols typically have higher cation exchange capacity, higher pH, and higher phosphorus and calcium contents. We used culture media prepared from soil extracts to isolate bacteria unique to the two soil types and then sequenced their 16S rRNA genes to determine their phylogenetic placement. Higher numbers of culturable bacteria, by over two orders of magnitude at the deepest sampling depths, were counted in the Anthrosols. Sequences of bacteria isolated on soil extract media yielded five possible new bacterial families. Also, a higher number of families in the bacteria were represented by isolates from the deeper soil depths in the Anthrosols. Higher bacterial populations and a greater diversity of isolates were found in all of the Anthrosols, to a depth of up to 1 m, compared to adjacent soils located within 50-500 m of their associated Anthrosols. Compared to standard culture media, soil extract media revealed diverse soil microbial populations adapted to the unique biochemistry and physiological ecology of these Anthrosols.
Article
Full-text available
We provide a global assessment, with detailed multi-scale data, of the ecological and toxicological effects generated by inorganic nitrogen pollution in aquatic ecosystems. Our synthesis of the published scientific literature shows three major environmental problems: (1) it can increase the concentration of hydrogen ions in freshwater ecosystems without much acid-neutralizing capacity, resulting in acidification of those systems; (2) it can stimulate or enhance the development, maintenance and proliferation of primary producers, resulting in eutrophication of aquatic ecosystems; (3) it can reach toxic levels that impair the ability of aquatic animals to survive, grow and reproduce. Inorganic nitrogen pollution of ground and surface waters can also induce adverse effects on human health and economy.
Article
Full-text available
Estimates of the number of species of bacteria per gram of soil vary between 2000 and 8.3 million (Gans et al., 2005; Schloss and Handelsman, 2006). The highest estimate suggests that the number may be so large as to be impractical to test by amplification and sequencing of the highly conserved 16S rRNA gene from soil DNA (Gans et al., 2005). Here we present the use of high throughput DNA pyrosequencing and statistical inference to assess bacterial diversity in four soils across a large transect of the western hemisphere. The number of bacterial 16S rRNA sequences obtained from each site varied from 26,140 to 53,533. The most abundant bacterial groups in all four soils were the Bacteroidetes, Betaproteobacteria and Alphaproteobacteria. Using three estimators of diversity, the maximum number of unique sequences (operational taxonomic units roughly corresponding to the species level) never exceeded 52,000 in these soils at the lowest level of dissimilarity. Furthermore, the bacterial diversity of the forest soil was phylum rich compared to the agricultural soils, which are species rich but phylum poor. The forest site also showed far less diversity of the Archaea with only 0.009% of all sequences from that site being from this group as opposed to 4%-12% of the sequences from the three agricultural sites. This work is the most comprehensive examination to date of bacterial diversity in soil and suggests that agricultural management of soil may significantly influence the diversity of bacteria and archaea.
Article
Full-text available
We constructed error-correcting DNA barcodes that allow one run of a massively parallel pyrosequencer to process up to 1,544 samples simultaneously. Using these barcodes we processed bacterial 16S rRNA gene sequences representing microbial communities in 286 environmental samples, corrected 92% of sample assignment errors, and thus characterized nearly as many 16S rRNA genes as have been sequenced to date by Sanger sequencing.
Article
Nitrogen leaching from agricultural soils is a major source of pollution for adjacent water systems. Biochar application to agricultural soils was reported to manageably reduce N leaching. For the sustainable use of biochar application, a mechanistic understanding of the changes in N leaching induced by biochar treatment is urgently needed. In this study, the effects of biochar [rice (Oryza sativa L.) chaff] application to rice paddy soil (sandy loam) on leaching and soil structure were investigated. Free-draining lysimeters (0.2 m in diameter by 0.1 m in height) filled with 500 g of air-dried soil were treated with biochar at 0, 2, and 10% application rates (BC0, BC2, and BC10, respectively) and N fertilizer (NH4Cl) at 0 and 100 kg ha(-1) application rates (Fert0 and Fert100, respectively). During the 9-wk incubation, the concentration of dissolved C in the leachates was higher in the soils treated with BC2 and BC10 compared with that treated with BC0 in the Fert0 soil while there were no significant differences among the biochar treatments in the Fert100 soil. This result indicated that the labile portion of the applied biochar C was utilized by microbes as the amended N was metabolized. Nitrate contents in leachates from the BC2 and BC10 treatments were significantly smaller than in those from the BC0 soil. Soil analysis showed that NH4+ content decreased and NO3- content increased under BC10 treatment compared with BC0 treatment in the Fert100 soil, indicating that net N mineralization in the soil was enhanced under biochar treatment. We suggested that the NO3- retention in the biochar-treated soil was related to increased soil aggregation. The C contents in the wet stable aggregates of size 53 to 1000 mm were significantly increased by biochar addition. This size fraction of aggregates is related to soil mesopores, which are involved in the soil's water holding. The water holding capacity (WHC) was higher in the BC2 and BC10 soils than in the BC0 soil, suggesting that application of rice chaff biochar to rice paddy soil could reduce N leaching through the redistribution of soil pores by forming more wet stable aggregates.
Article
Due to its high adsorption capacity, the use of biochar to capture excess nutrients from wastewater has become a central focus in environmental remediation studies. In this study, its potential use in adsorption and removal of ammonium in piggery manure anaerobic digestate slurry was investigated. The adsorbed amount of NH4+-N (mg·g− 1) and removal percentage as a function of adsorbent mass in solution, adsorbent particle size, NH4+-N concentration in the effluent, contact time, pH and temperature were quantified in batch equilibrium and kinetics experiments. The maximum NH4+-N adsorption from slurry at 1400 mg N·L− 1 was 44.64 ± 0.602 mg·g− 1 and 39.8 ± 0.54 mg·g− 1 for wood and rice husk biochar, respectively. For both biochars, adsorption increased with increase in contact time, temperature, pH and NH4+-N concentration but it decreased with increase in biochar particle size. Furthermore, the sorption process was endothermic and followed Langmuir (R2 = 0.995 and 0.998) and Pseudo-second order kinetic models (R2 = 0.998 and 0.999). Based on the removal amounts, we concluded that rice husk and wood biochar have potential to adsorb NH4+-N from piggery manure anaerobic digestate slurry, and thus can be used as nutrient filters prior to discharge into water streams.
Article
Biochar (BC) amendment to soils is a proposed strategy to improve soil fertility and mitigate climate change. However, before this can become a recommended management practice, a better understanding of the impacts of BC on the soil biota is needed. We determined the effect of addition rates (0, 1, 5, 10 and 20% by mass) of a fast-pyrolysis wood-derived BC on the extraction efficiency (EE), abundance and temporal dynamics of phospholipid fatty acids (PLFAs, microbial community biomarkers) in four temperate soils during a 1-year incubation. Additionally, the effects on microbial mineralization/incorporation of BC-C were determined by measuring CO2 efflux and the BC contribution to CO2 and PLFA-C using the natural 13C abundance difference between BC and soils. Biochar addition proportionally increased microbial abundance in all soils and altered the community composition, particularly at the greatest addition rate, towards a more gram-negative bacteria-dominated (relative to fungi and gram-positive) community. Though chemically recalcitrant, the BC served as a substrate for microbial activity, more so at large addition rates and in soil with little organic matter. Microbial utilization of BC-C for growth could only partially explain the observed increase in microbial biomass, suggesting that other, potentially abiotic, mechanisms were involved. The strong decrease in PLFA EE (−77%) in all soils with biochar addition emphasizes the need to measure and correct for EE when using PLFA biomarkers to estimate soil microbial responses to BC additions. Overall, our study provides support for BC use as a soil amendment that potentially stimulates microbial activity and growth.