No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Effect of biochar additions to soil on nitrogen leaching, microbial biomass and bacterial community structure
... The 16S rDNA (V5-V7 region) from 72 samples of bamboo tissue and soil from the HY and LY forests in JL and YA was subjected to high-throughput sequencing. Primers were designed according to the conserved regions and were followed by the addition of sequencing adapters to the ends of the primers [12,15]. Polymerase chain reaction (PCR) amplification was performed, and the products were purified, quantified, and homogenized to construct a sequence library. ...
... Polymerase chain reaction (PCR) amplification was performed, and the products were purified, quantified, and homogenized to construct a sequence library. The library was first checked for quality [12,15]. Libraries that passed the quality control were sequenced using the Illumina NovaSeq 6000 platform (Illumina, San Diego, CA, USA). ...
... Soil DNA extraction, PCR amplification, and high-throughput gene sequencing (Luo et al., 2023). After the test, the extracted genomic DNA was used as template, and 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTAC HVGGGTWTCTAAT-3′) were used for PCR amplification and Illumina HiSeq sequencing of V3-V4 region of bacterial 16S rRNA gene (Xu et al., 2016). The PCR amplification steps are shown in Table 1. ...
... Bacterial 16S rRNA genes in the above-mentioned soil total genomic DNA samples were sequenced using the Illumina MiSeq platform of Kidio Science and Technology Service Company (Guangzhou, China). The genes were amplified with the primer sets 338F/806R (16S rDNA V3-V4 region gene), respectively (Xu et al., 2016). The sequence reads were assigned to each sample based on their unique barcode, and the original data obtained was quality filtering and chimera removal by using FLASH and trimmomatic software (Magoc and Salzberg, 2011;Li et al., 2022). ...
Rapid growth in the mining industry has brought about a large formation of tailings, which result in serious destruction of the ecological environment and severe soil pollution problems. This study assesses soil nutrients, soil bacterial community and soil microbes’ metabolic function in heavily polluted areas (W1), moderately polluted areas (W2), lightly polluted areas (W3) and clean areas (CK) using 16S Illumina sequencing. The results of this study showed that compared with CK, a severe loss of soil nutrients and richness of OTUs (Chao1 and ACE indices) were observed with the aggravated pollution of tailings. The Chao1 and ACE indices in the W1 group decreased significantly by 15.53 and 16.03%, respectively, (p < 0.01). Besides, the relative abundance of Actinobacteria and Proteobacteria was high whereas and relative abundance of Chloroflexi in the polluted areas. Among them, W1 groups increased significantly the relative abundance of Actinobacteria and decreased significantly the relative abundance of Chloroflexi, these can be used as indicator phyla for changes in soil community structures under polluted stress. Tax4 Fun analysis showed that W1 groups affected the soil bacterial community and altered the primary types of biological metabolism in polluted areas. Tailings have adverse impacts on soil bacterial community and metabolic functions, and the deterioration in soil quality is dependent on the levels of tailings pollution. Cumulatively, this study provides valuable information on the bacterial community structure and metabolic functions in the tailing polluted soil.
... The extracted DNA was used as a template for polymerase chain reaction (PCR) amplification, and MiSeq amplicon sequencing of the 16S rRNA gene V 3 -V 4 region of soil bacteria and the fungal ITS region, the universal bacterial primer was 338F (ACTCCTACGGGA GGCAGCA)-806 R (GGACTACHVGGGTWTCTAAT) (Xu et al., 2016) and the universal fungal primer was ITS1F (GGACTACHV GGGTWTCTAAT)-ITS2R (GCTGCGTTCTTCATCGATGC) (Adams et al., 2013). ...
... The soil 16S rRNA gene and fungal ITS gene were amplified using primers 338F (ACTCCTACGGGAGGCAGCA)-806 R (GGACTACHVGGGTWTCTAAT) (Xu et al., 2016) and ITS1F (GGACTACHVGGGTWTCTAAT)-ITS2R (GCTGCGTTCTTC ATCGATGC) (Adams et al., 2013), respectively. Plasmid construction and standard curves were generated following the method described by Fraser et al. (2015). ...
Introduction
Panax notoginseng is a precious Chinese medicinal material. Soil fumigation can control soil-borne disease and overcome the continuous cropping obstacles of P. notoginseng . However, chloropicrin (CP) fumigation can kill non-target soil microorganisms and reduce microbial diversity, but the long-time impacts of CP fumigation on soil microbial are less reported.
Methods
We studied the long-term effects of CP fumigation on soil microbes with high-throughput gene sequencing, and correlated the changes in the composition of microbial communities with environmental factors like soil physicochemical properties and soil enzyme activities. This study mainly focuses on the recovery characteristics of soil microbe after soil fumigation by evaluating the ecological restoration of P. notoginseng soil, its sustained control effect on plant diseases, and its promotion effect on crop growth by focusing on the CP fumigation treatment.
Results
The results showed that CP fumigation significantly increased soil available phosphorus (P) to 34.6 ~ 101.6 mg/kg and electrical conductivity (EC) by 18.7% ~ 34.1%, respectively. High-throughput gene sequencing showed that soil fumigation with CP altered the relative abundance of Trichoderma , Chaetomium , Proteobacteria , and Chloroflexi in the soil while inhibiting a lot of Fusarium and Phytophthora. The inhibition rate of Phytophthora spp. was still 75.0% in the third year after fumigation. Fumigation with CP enhanced P. notoginseng’s survival rate and stimulated plant growth, ensuring P. notoginseng’s healthy in the growth period. The impact of fumigation on microbial community assembly and changes in microbial ecological niches were characterized using normalized stochasticity ratio (NST) and Levins’ niche breadth index. Stochasticity dominated bacterial community assembly, while the fungal community was initially dominated by stochasticity and later by determinism. Fumigation with CP reduced the ecological niches of both fungi and bacteria.
Conclusion
In summary, the decrease in microbial diversity and niche caused by CP fumigation could be recovered over time, and the control of soil pathogens by CP fumigation remained sustainable. Moreover, CP fumigation could overcome continuous cropping obstacles of P. notoginseng and promote the healthy growth of P. notoginseng .
... Sediment samples were simultaneously collected alongside water samples and subjected to rigorous analysis using established methodologies. Upon collection, fresh samples underwent meticulous thawing, homogenization, and subsequent processing to quantify critical parameters, including TN, NH 4 + -N, NO 3 − -N, NO 2 − -N, TP, and inorganic phosphorus (IP) [48]. The determination of TN and TP was accomplished through the application of the peroxysulfate-assisted digestion method (HJ 832-2017). ...
Bacteria in lake water bodies and sediments play crucial roles in various biogeochemical processes. In this study, we conducted a comprehensive analysis of bacterioplankton and sedimentary bacteria community composition and assembly processes across multiple seasons in 18 outdoor mesocosms exposed to three temperature scenarios. Our findings reveal that warming and seasonal changes play a vital role in shaping microbial diversity, species interactions, and community assembly disparities in water and sediment ecosystems. We observed that the bacterioplankton networks were more fragile, potentially making them susceptible to disturbances, whereas sedimentary bacteria exhibited increased stability. Constant warming and heatwaves had contrasting effects: heatwaves increased stability in both planktonic and sedimentary bacteria communities, but planktonic bacterial networks became more fragile under constant warming. Regarding bacterial assembly, stochastic processes primarily influenced the composition of planktonic and sedimentary bacteria. Constant warming intensified the stochasticity of bacterioplankton year-round, while heatwaves caused a slight shift from stochastic to deterministic in spring and autumn. In contrast, sedimentary bacteria assembly is mainly dominated by drift and remained unaffected by warming. Our study enhances our understanding of how bacterioplankton and sedimentary bacteria communities respond to global warming across multiple seasons, shedding light on the complex dynamics of microbial ecosystems in lakes.
... Samples were washed with the phosphoric acid buffer for three times. Microbial DNA was directly extracted from samples with the E.Z.N.A. ® Soil DNA Kit (D5625-01, USA) and the 16S rRNA gene of V3-V4 according to the manufacturer's instructions(Xu et al. 2016). The polymerase chain reaction and analysis of high-quality sequences were performed according to the description ofWu et al. (2018). ...
The treatment and disposal of activated sludge are currently challenging tasks in the world. As a common biological engineering technology, biological fermentation exists with disadvantages such as low efficiency and complex process. Ozone pretreatments are commonly applied to improve this problem due to their high efficiency and low cost. In this study, the significant function of ozone in anaerobic fermentation gas production was verified with excess sludge. Compared with other untreated sludge, ozone pretreatment can effectively degrade activated sludge. After ozone treatment and mixing with primary sludge, the methane production of excess sludge increased by 49.30 and 50.78%, and the methanogenic activity increased by 69.99 and 73.83%, respectively. The results indicated that the mixing of primary sludge with excess sludge possessed synergistic effects, which contributed to the anaerobic fermentation of excess sludge. The results of microbial community structure exhibited that methanogenic processes mainly involve hydrogenogens, acidogens and methanogens. The relative abundance of both bacteria and microorganisms changed significantly in the early stage of hydraulic retention time, which coincided exactly with the gas production stage. This study provided a feasible pretreatment strategy to improve sludge biodegradability and revealed the role of microorganisms during anaerobic digestion.
... The FastDNA ® Spin Kit (MP Biomedicals, Norcross, GA, USA) was used to extract microbial DNA from tea samples according to the instructions. The extracted 16S rRNA gene in the V3-V4 region was amplified using forward primer 338F (5 -ACTCCTACGGGAGGCAGCA-3 ) [18] and reverse primer 806R (5 -GGACTACHVGGGT WTCTAAT-3 ) [19]. Before amplifying the DNA in triplicate, the sample was subjected to electrophoresis on 2% agarose gels. ...
The sensory quality and health benefits of Pu-erh tea are mainly determined by microbial fermentation processing. The directed exogenous inoculation of specific microorganisms is an effective method to improve the quality and flavor of Pu-erh tea. In this study, Lactobacillus plantarum and Saccharomyces cerevisiae were introduced into the fermentation processes of Pu-erh tea, as they are the main contributors to enzyme secretion, to change the tea’s functional components. The raw tea materials, spontaneous fermentation tea and microbiological fermentation tea were analyzed by microbiomics and metabolomics. A total of 248 metabolites were characterized, 71 of which were identified as essential metabolites involved in the metabolic changes. These essential metabolites were produced by specific dominant microbial species with multivariate analysis methods. Metabolites essential to the sensory quality and health benefits of Pu-erh tea, such as flavonoids and free amino acids, were increased in tea samples inoculated with Lactobacillus plantarum and Saccharomyces cerevisiae following fermentation. Fungal diversity decreased after fermentation, and both the diversity and richness of bacteria were significantly decreased. In conclusion, our results demonstrate the advantages of Lactobacillus plantarum and Saccharomyces cerevisiae in forming the unique sensory characteristics of Pu-erh tea, and they indicate that the microbial composition is a key factor in altering the tea’s metabolic profile. Our work establishes a theoretical foundation for the promotion of the safety and quality of Pu-erh tea through exogenous inoculation with Lactobacillus plantarum and Saccharomyces cerevisiae.
... Although changed microbial diversity was detected in biocharamended soil by many studies (Xu et al., 2016;Cheng et al., 2018;Li X. et al., 2020;Wan et al., 2022). Our results indicated that the alpha Variation of bacterial function profiles under different treatments analyzed by PICRUSt. ...
Introduction
Lead (Pb) pollution in agricultural soil has been accelerated by industrial development and human activities, and poses a major threat to agricultural ecosystems. Both biochar and arbuscular mycorrhiza (AM) fungi are considered to play an important role in remediation of Pb contaminated soil.
Methods
The combined remediation effects of introduced AM fungi and biochar on soil properties, Pb availability, microbial community and functional profiles were systematically investigated in unsterilized Pb-polluted agricultural soil.
Results
Results indicated that soil nutrients were significantly improved through the combined application of biochar and introduced AM fungi. The introduced AM fungi combined with biochar prepared at 400°C and 500°C promoted the transformation of Pb to a more stable state with low bioavailability. Moreover, the addition of AM fungi and biochar affected the relative abundances of dominant bacteria and fungi at the phylum and genus levels. Biochar mainly affected soil bacterial community and obviously increased the relative abundance of Actinobacteria and Blastococcus . The interactions between biochar and introduced AM fungi mainly affected fungal community, and increased the abundance of Ascomycota and Botryotrichum . Further, PICRUSt analysis indicated biochar amendment supported stronger bacterial metabolic functional potentials.
Discussion
Therefore, the combined application of biochar and Therefore, the combined application of biochar and introduced AM fungi could improve soil nutrients, reduce Pb introduced AM fungi could improve soil nutrients, reduce Pb availability, availability, and show and show a positive effect on a positive effect on indigenous microbial communities and indigenous microbial communities and metabolic functions in metabolic functions in farmland soil.
... Harter et al. (2014) reported enhanced activities of N 2 O reducing bacteria under biochar treated soils reducing N 2 O to N 2 during denitrification process. In present study, the relatively lower N 2 O emission flux under biochar based SRNFs (RSBU 100 % and RSBU 75 %) can be attributed to prolonged nitrogen release pattern which limits the NH 4 + -N and NO 3̄\ \N forms for N 2 O liberation (Xu et al., 2016). Similarly, reduced N 2 O emissions flux under biochar application may be attributed to slight increment in initial soil pH in which reduced the abundance of ammonia oxidizing microbes (Wu et al., 2018). ...
The Paris Agreement goal of a net-zero equation will require decarbonization technologies in agriculture. Agri-waste biochar offers huge potential for carbon abatement in agricultural soils. The present experiment was carried out to compare the effects of residue management, viz., no residue (NR), residue incorporation (RI), and biochar (BC), as well as nitrogen options for emission reduction and carbon capture under the rice-wheat cropping sequence (RWCS) of the Indo-Gangetic Plains (IGP), India. After two cycles of cropping pattern, the analysis revealed that the biochar application (BC) reduces the RWCS's annual CO2 emissions by 18.1 % over residue incorporation (RI), while CH4 and N2O emissions were reduced by 23 % and 20.6 % over RI and 11 % and 29.3 % over no residue (NR), respectively. The application of biochar-based nutrient composites with rice straw biourea (RSBU) at 100 % and 75 % significantly reduced greenhouse gases (CH4 and N2O) compared to commercial urea at 100 %. The global warming potential of cropping systems recorded with BC was 7 % and 19.3 % lower than NR and RI, respectively, while 6-15 % under RSBU over urea 100 %. The annual carbon footprint (CF) under BC and NR decreased by 37.2 % and 30.8 % over RI, respectively. The net CF under residue burning was estimated to be the highest (132.5 Tg CO2-Ce), followed by RI (55.3 Tg CO2-Ce), showing net positive emissions; however, net negative emissions were found under a biochar-based system. The estimated annual carbon offset potential of a complete biochar system over residue burning, incorporation, and partial biochar as calculated was 189, 112, and 92 Tg CO2-Ce yr-1, respectively. A biochar-based approach to managing rice straw had great carbon offset potential through a large drop in greenhouse gas emissions and an improved soil carbon pool under the rice wheat system along the IGP, India.
... The fungal ITS gene was amplified using the primers ITS1F (5′-CTTGGTCATTTAGAGGAAGTAA -3′) and ITS2R (5′ -GCTGCGTTCTTCATCGATGC-3′) (Adams et al., 2013). The bacterial 16S rRNA gene was amplified with the primers 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) (Xu et al., 2016). The sequencing of the amplification products was conducted utilizing the Illumina HiSeq2500 PE250 platform, which was provided by Majorbio Biopharm Technology Co., Ltd. ...
... Numerous studies have indicated that more than 50% of the N required by crops is obtained from soil, whereas the remainder is derived from in-season fertilizer applications. In soil, soil organic N constitutes approximately 90% of the TN content (Xu et al., 2016). This is consistent with previous studies consistently demonstrating that the application of organic fertilizer significantly enhances soil organic N and SOM content, thereby promoting plant growth (Zhou et al., 2013). ...
The substitution of chemical fertilizers with organic fertilizers is a viable strategy to enhance crop yield and soil quality. In this study, the aim was to investigate the changes in soil microorganisms, soil chemical properties, and growth of Chinese flowering cabbage under different fertilization treatments involving earthworms and cow manure. Compared with the control (100% chemical fertilizer), CE (30% reduction in chemical fertilizer + earthworms) and CFE (30% reduction in chemical fertilizer + cow dung + earthworms) treatments at soil pH 8.14 and 8.07, respectively, and CFC (30% reduction in chemical fertilizer + cow manure) and CFE treatments increased soil organic matter (SOM), total nitrogen (TN), available nitrogen (AN), and available potassium (AK) contents. Earthworms and cow manure promoted the abundance of Bacillus and reduced that of the pathogens Plectosphaerella and Gibberella . The mantle test revealed that pH was not correlated with the microbial community. Random forest analysis verified that AN, SOM, and TN were important factors that jointly influenced bacterial and fungal diversity. Overall, the synergistic effect of earthworms and cow manure increased soil fertility and microbial diversity, thereby promoting the growth and development of Chinese flowering cabbage. This study enhanced the understanding of how bioregulation affects the growth and soil quality of Chinese flowering cabbage, and thus provided a guidance for the optimization of fertilization strategies to maximize the yield and quality of Chinese flowering cabbage while reducing environmental risks.
... The samples were then stored at −80°C before further analysis. The 16 S rRNA gene's hypervariable regions were amplified using the 806 R and 338 F primer pairs, employing an ABI GeneAmp ® 9700 PCR thermocycler (ABI, CA, USA) (Xu et al 2016). The PCR reaction mixture contained 4 μl 5 × Fast Pfu buffer, 2 μl 2.5 mM dNTPs, 0.8 μl each primer (5 μM), 0.4 μl Fast Pfu polymerase, 10 ng of template DNA, and ddH 2 O to a final volume of 20 μl. ...
The microorganisms in sediments play a significant role in Arsenic (As) migration in groundwater systems. However, the impact mechanisms of microbial community structure on As release and enrichment are not completely clear. In this study, the community structure and characteristics of microorganisms in sediments of the Kuitun River Basin were first investigated through field investigation, high-throughput sequencing, and microbial analysis. The obtained results showed that Proteobacteria, Actinobacteria, Firmicutes, and Bacteroidetes were the dominant phyla in the sediments, accounting for 30.23%–87.87%, 3.280%–65.22%, 1.71%–14.37%, and 0.46%–16.67%, respectively. Whereas, Arthrobacter , Acinetobacter , Pseudomonas , and Hydrogenophaga were the main genera in the collected sediments from the Kuitun River Basin, accounting for 1.81%–60.13%, 0.70%–77.24%, 0.21%–35.5%, and 0.38%–26.27%, respectively. Arthrobacter can increase the As contents in the sediments. In contrast, Acinetobacter can both inhibit and promote the release of As from the sediments, while Pseudomonas and Hydrogenophaga can only inhibit the release of As from the sediments. The Variance Inflation Factor (VIF) suggested that Ca, Mg, Mn, Cu, and As were highly correlated with each other. The distance-based redundancy analysis (Db-RDA) analysis demonstrated significant influences of the sediment chemical properties on the microbial activity and community structure in the sediments, according to the following order: Ca > Cu > Mn > Mg > As. Ca ²⁺ and Mn ²⁺ in the environment can influence the growth and metabolism of microorganisms, thus affecting the redox environment and As release from sediments. This study confirmed the interaction that may exist between microorganisms and As. Moreover, this study not only confirmed the interaction between microorganisms and As, but also provided a comprehensive understanding of the effects of the microbial community on the chemical cycle of the groundwater system in the Kuitun River basin. The analysis of the influences of the microbial community on sediment As provided further insights into As release from sediments and As enrichment in groundwater in the study area.
... Then, a NanoDrop 2000 UV-vis spectrophotometer (Thermo Scientific, USA) was used to determine DNA concentration and purity. The bacterial 16S rRNA gene was amplified with primers 338F and 806R (Liu et al., 2016); the archaea gene was amplified with primers 524F10extF and Arch958RmodR (Xu et al., 2016). The Miseq PE300 platform (Illumina, USA) was used to sequence the final libraries . ...
Membrane-covered composting (MC + AC) effectively reduced methane production. • Average methane concentration in MC + AC was 27.48% lower than that in SC. • Methanobacteriales was inhibited in the early stage of aerobic composting. • Restricting acetoclastic pathway was key to inhibiting methanogenesis. • ACSS and cdhC were the key genes regulating the acetoclastic pathway. A R T I C L E I N F O Keywords: Acetoclastic pathway Methane metabolism Microbial community Semipermeable membrane Solid dairy manure A B S T R A C T In this study, the microbial mechanism of reducing methanogenesis during membrane-covered aerobic com-posting from solid dairy manure was investigated. An industrial-scale experiment was carried out to compare a static composting group (SC) and a forced aeration composting group (AC) with a semipermeable membrane-covered composting group (MC + AC). The results showed that the semipermeable membrane-covered could improve the oxygen utilization rate and inhibit the anaerobic bacterial genus Hydrogenispora and archaea order Methanobacteriales. During the membrane-covered period, the acetoclastic methanogenesis module in MC + AC, AC and SC decreased by 0.58%, 0.05% and 0.04%, respectively, and the cdhC gene in the acetoclastic pathway was found to be decreased by 65.51% only in MC + AC. Changes in methane metabolism pathways resulted in a 27.48% lower average methane concentration in MC + AC than in SC. Therefore, the semipermeable membrane-covered strategy can effectively reduce methane production during dairy manure aerobic composting by restricting the methanogenesis of the acetoclastic pathway.
... Extracted DNA were quality-checked by 1% of agarose gel electrophoresis and quantified with the NanoDrop 1000 spectrophotometer (Thermo Scientific). The V3-V4 region of bacterial 16S rRNA gene was amplified by primer pairs 338F (5′-ACTCCTACGGGAGGCAGCAG-3′)/ 806R (5′-GGACTACHVGGGTWTCTAAT-3′) (Xu et al., 2016). The forward primers tagged with a 5′-nucleotide barcode, and amplicons were purified using the EZNA Cycle-Pure Kit (Omega Bio-tek Inc., Doraville, GA). ...
... This study also revealed the emergence of Nitrospira and Bacillus in rhizosphere soil ( Fig. 3a; Fig. S1b), indicating the potential improvement in soil quality, thereby promoting the growth and development of the wheat plants (Feng et al., 2021). Previous studies also reported that Bacillus and Nitrospira improved phosphorus solubilisation and enhanced soil nitrogen cycling, thus, accelerating wheat development (Xu et al., 2016b;Feng et al., 2021). Furthermore, these bacterial strains are linked to enhanced degradation of lignin and other complex molecules, which facilitate nutrient cycling and absorption in wheat (Donn et al., 2015;Zhang et al., 2021). ...
Many fields where wheat is grown in northern China are co-polluted by arsenic (As) and cadmium (Cd). Thus,
remediation of As and Cd-contaminated alkaline soils is crucial for safe wheat production. In this study, a pot
experiment was carried out to investigate the impact of 1% and 2% maize straw (MS) incorporation on As and Cd
bioavailability, binding forms, uptake by winter wheat (Triticum aestivum L.), and bacterial communities in
smelter (SS) and irrigation (IS) alkaline contaminated soils. The results indicated that 2% MS incorporation
significantly (p < 0.05) increased bioavailable-As by 37% (SS) and 39% (IS) with no significant change in the
bioavailable-Cd in SS2% (31.95%) from 31.95% (SSCK) and IS2% (33.33%) from 32.82% (ISCK). Incorporation
of 2% MS increased the grain As concentration from 0.22 mg kg− 1 (SSCK) to 0.51 mg kg− 1 (SS2%) and from 0.59
mg kg− 1 (ISCK) to 0.84 mg kg− 1 (IS2%) which is above the acceptable standard of 0.5 mg kg− 1 (GB2726-2017).
In contrast, the Cd content in grains was maintained at 0.09 (SS1%), 0.04 (SS2%) and 0.03 (IS1%), 0.02 (IS2%)
below the acceptable standard of 0.10 mg kg− 1 (GB2762–2017). The amendment through dissolved organic
carbon mediated As desorption enhanced As transfer to wheat grain, decreasing DTPA-Cd in the soils and its
consequent translocation to wheat leaves and grain. The 2% MS incorporation increased the active As fractions,
reduced mobile Cd into immobile fractions, and promoted the abundance of Actinobacteria, Bacteroidetes, and
Firmicutes in the two soils. These attributes of MS in decreasing the accumulation of Cd in wheat leaves and grains
signified its potential as a suitable ingredient for Cd sequestration and food safety in Cd-contaminated soils.
... The Shannon index showed a trend of first decreasing and then increasing during the composting process, indicating that the high temperature period was not conducive to the growth and reproduction of intolerant microorganisms, resulting the community diversity was reduced. The addition of BC prepared from different raw materials had different effects on the physicochemical properties and bacterial communities of the fertilizer (Xu et al. 2016;Muhammad et al. 2014). The MBC2 had the lowest Shannon index during the high-temperature period; at the end of composting, the Simpson index was lower than the CK, indicating that the addition of 2% MBC reduced microbial diversity and inhibited the transfer of ARGs. ...
Abatement of antibiotic resistance genes (ARGs) in livestock manure by composting has attracted attention. This study investigated the effect of adding magnesium-modified biochar (MBC) on ARGs and microbial communities in chicken manure composting. Twelve genes for tetracyclines, sulfonamides, and macrolides, and mobile genetic elements were measured in the compost pile. The results showed that after 45 days of the composting, the treatment groups of MBC had longer high temperature periods, significantly higher germination indices (GI) and lower phytotoxicity. There were four major dominant phyla (Firmicutes, Actinobacteriota, Proteobacteria, and Bacteroidota) in the compost. The abundance of Firmicutes decreased significantly during the compost cooling period; tetracycline resistance genes demonstrated an extremely significant positive correlation with Firmicutes, showing a trend of the same increase and decrease with composting time; tetT, tetO, tetM, tetW, ermB, and intI2 were reduced in the MBC group; the total abundance of resistance genes in the 2% MBC addition group was 0.67 times that of the control; Proteobacteria and Chloroflexi were also significantly lower than the other treatment groups. Most ARGs were significantly associated with mobile genetic elements (MGEs); MBC can reduce the spread and diffusion of ARGs by reducing the abundance of MGEs and inhibiting horizontal gene transfer (HGT).
... These phyla, particularly Proteobacteria, which often have a higher relative abundance in stressful environments, are the most active bacteria in the rhizosphere soil [7,44]. This is probably a result of the niche occupied by synergistic effects, such as co-metabolism or synthesis, in response to environmental, biological, chemical, or physical factors [45]. The results suggest that Actinobacteria, Gemmatimonadetes, and Nitrospirae are well-suited for survival in nutrient-rich non-rhizosphere soils, and these can also withstand heavy metal stress in soils, which is consistent with the results of previous studies [46,47]. ...
Heavy metal pollution in soil is a major global issue, and one effective method for addressing it is phytoremediation through bamboo planting. Nevertheless, there is a notable gap in our knowledge as no studies have explored the characteristics of soil organic matter (SOM) and the bacterial communities in bamboo forests during the remediation process. To bridge this knowledge gap, we conducted research to investigate the impact of different bamboo planting patterns on the SOM characteristics and microbial communities in soils contaminated with heavy metals. The contents of SOM and dissolved organic matter (DOM) in rhizosphere and non-rhizosphere soils differed significantly between monocropping and intercropping systems, with DOM accounting for only 1.7%–2.5% of SOM. Fourier transform infrared spectra showed that the contents of SOM polysaccharides C-O, carbonate C-O, aliphatic methyl, and methylene increased, while the aromatic C=C abundance decreased in the intercropping rhizosphere soil. The differences between bamboo cultivation patterns in the rhizosphere and non-rhizosphere soils were elucidated using the biomarkers, including MND1 and Nitrospira (non-rhizosphere), and Sphingomonas (rhizosphere). Heavy metals, DOM, SOM, and refined organic functional groups, especially C-O in polysaccharides and symmetric carboxylate, were the determining factors of soil bacterial communities. Compared to monocropping, intercropping increased the accumulation of Zn and Cd in bamboo shoots by 35% and 40%, respectively, and hence, intercropping soil, with a low toxicity, was suitable for bamboo shoot sprouting. Intercropping can alter the characteristics of SOM and bacterial communities and plays a vital role in phytoremediation and shoot growth in bamboo forests. Future studies on soil carbon dynamics and nutrient status during heavy metal remediation will improve our knowledge of soil transformation and its impact on soil ecosystem health and productivity.
... The relative abundance of Actinobacteria, Bacteroidetes, and Proteobacteria in the rhizosphere soil of fluecured tobacco was significantly increased by a high amount of biochar (1200 kg/ha) and high nitrogen (126 kg/ha), while that of Acidobacteria and Firmicutes decreased. These results are in accordance with previous reports that soil amendment with biochar enhanced the relative abundance of Proteobacteria, Bacteroidetes, and Actinobacteria but reduces the relative abundance of Acidobacteria, Chloroflexi, and Gemmatimonadetes (Xu et al., 2016). A co-occurrence network analysis showed a lower negative correlation among the rhizosphere bacterial communities under higher biochar and nitrogen fertilizer application rates than other treatments. ...
Background and aims: In agriculture, biochar (BC) and nitrogen (N) fertilizers are
commonly used for improving soil fertility and crop productivity. However, it remains unclear how different levels of BC and N fertilizer affect soil fertility and crop productivity.
Methods: This study elucidates the impact of different application rates of BC (0,
600, and 1200 kg/ha) and N fertilizer (105 and 126 kg/ha) on biomass accumulation, soil microbial biomass of carbon (SMC) and nitrogen (SMN), and soil biochemical properties, including soil organic carbon (SOC), total nitrogen (TN), soil nitrate nitrogen (NO3−−N), ammonium nitrogen (NH4+−N), urease (UE), acid phosphatase (ACP), catalase (CAT), and sucrase (SC) of tobacco plants. In addition, a high throughput amplicon sequencing technique was adopted to investigate the effect of different application rates of BC/N on rhizosphere bacterial communities of tobacco plants.
Results: The results confirm that high dosages of BC and N fertilizer (B1200N126)
significantly enhance dry matter accumulation by 31.56% and 23.97% compared with control B0N105 and B0N126 under field conditions and 23.94% and 24.52% under pot experiment, respectively. The soil biochemical properties, SMC, and SMN
significantly improved under the high application rate of BC and N fertilizer (B1200N126), while it negatively influenced the soil carbon/nitrogen ratio. Analysis
of rhizosphere bacteriome through amplicon sequencing of 16S rRNA revealed that
the structure, diversity, and composition of rhizosphere bacterial communities
dramatically changed under different BC/N ratios. Proteobacteria, Bacteroidetes,
Actinobacteria, Firmicutes, and Acidobacteria were highly abundant bacterial phyla
in the rhizosphere of tobacco plants under different treatments. Co-occurrence
network analysis displayed fewer negative correlations among rhizosphere bacterial
communities under high dosages of biochar and nitrogen (B1200N126) than other
treatments, which showed less competition for resources among microbes. In addition, a redundancy analysis further proved a significant positive correlation
among SMC, SMN, soil biochemical properties, and high dosage of biochar and
nitrogen (B1200N126).
Conclusions: Thus, we conclude that a high dosage of BC (1200 kg/ha) under a
high application rate of N fertilizer (126 kg/ha) enhances the biomass
accumulation of tobacco plants by improving the soil's biochemical properties
and activities of rhizosphere bacterial communities.
... Using the V3-V4 region of the bacterial 16S rRNA gene as the target sequence, bacterial genome were amplified with a set of universal primers, for the positive strand as 338F(5'-ACT CCT ACG GGA GGC AGC AG-3') and the negative strand as 806R(5'-GGA CTA CHVGGG TWT CTAAT-3') by following other researchers [26], and the amplified product was 468 bp. The Internally Transcribed Space (ITS) region as the fungal target sequence, was amplified with the universal primer set ITS1F (5'-CTT GGT CAT TTA GAG AGG AAG TAA -3') / ITS2R (5'-GCT GCG TT CTT CAT CGA TGC -3) [27], and the amplified product was 300 bp. ...
Background
Panax ginseng cultivated under the forest is popular because its shape and effective ingredients are similar to wild ginseng. The growth of P. ginseng in the larch forest is generally better than in the broad-leaved forest, and the incidence rate of diseases is low. Therefore, the selection of forest species is one of the basic factors in the successful cropping of P. ginseng.
Methods
Illumina HiSeq high-throughput sequencing was used to analyze the 16S rRNA/ITS gene sequence of P. ginseng rhizosphere soil under larch forest to study the rhizosphere microbiome's diversity and community composition structure.
Results
The species classification and richness of rhizosphere bacterial and fungal communities in the same-aged P. ginseng were similar. Consistent with the soil system of commonly cultivated crops, Proteobacteria, Actinobacteriota, Acidobacteriota, Verrucomicrobiota, Chloroflexi, and Basidiomycota, Ascomycota were the dominant phylum of bacteria and fungi, respectively. Compared with the soil without planting P. ginseng, the diversity of microorganisms and community structure of continuous planting for 2 years, 5 years, and 18 years of P. ginseng rhizosphere soil had little change. The accumulation levels of Ilyonectria, Fusarium, Gibberella, and Cylindrocarpon were not significantly increased with planting P. ginseng and the increased age of cropping P. ginseng.
Conclusions
The results of this study showed that the soil function of the larch forest was good, which provided a theoretical basis for the land selection and soil improvement of cultivating P. ginseng under the larch forest.
... The quantity and quality of the DNA were detected with a NanoDrop 2000C spectrophotometer (Thermo Scientific, USA) and agarose gel electrophoresis, respectively. The V3-V4 variable region of the 16S rRNA gene was amplified using 338F/806R primers (338F: 5 ′ -ACTCCTACGGGAGGCAGCAG-3 ′ , 806R: 5 ′ -GGACTACHVGGGTWTCTAAT-3 ′ ) (Xu et al., 2016). The quantification, qualification, and purification of PCR products (Yeasen, China), library preparation, and sequencing were conducted as previously reported . ...
Cotton bollworm ( Helicoverpa armigera) poses a global problem, causing substantial economic and ecological losses. Endosymbionts in insects play crucial roles in multiple insect biological processes. However, the interactions between H. armigera and its symbionts have not been well characterized to date. We investigated the symbionts of H . armigera in the whole life cycle from different geographical locations. In the whole life cycle of H . armigera , Proteobacteria, Firmicutes, Bacteroidetes, and Actinobacteria were the dominant bacteria at the phylum level, while Enterococcus, Enterobacter, Glutamicibacter , and Bacillus were the four dominant bacteria at the genus level. Furthermore, high similarity in symbiotic bacterial community was observed in different stages of H . armigera , which were dominated by Enterococcus and Enterobacter . In fields, the dominant bacteria were Proteobacteria and Bacteroidetes, whereas, in the laboratory, the dominant bacteria were Proteobacteria. At the genus level, the dominant bacteria in cotton bollworm eggs of wild populations were Enterobacter, Morganella, Lactococcus, Asaia, Apibacter , and Enterococcus , and the subdominant bacteria were Bartonella, Pseudomonas , and Orbus . Moreover, the symbionts varied with geographical locations, and the closer the geographical distance, the more similar the microbial composition. Taken together, our study identifies and compares the symbiont variation along with geographical gradients and host development dynamic and reveals the high flexibility of microbiome communities in H. armigera , which probably benefits for the successful survival in a complicated changing environment.
... Furthermore, over dose of lime application can reduce the of micronutrient availability (Murphy and Sims, 2012). In this context, organic amendment like biochar might be a worthy choice for neutralizing soil acidity, since it has an alkalizing ability and it can potentially raise pH of soil (Randolph et al., 2017;Xu et al. 2016). Biochar is a carbonaceous solid material produced through the thermochemical transformation of organic ingredients in anaerobic or less oxygen ambiance (Magnusson, 2015;Guo, 2020). ...
The potential of biochar as a soil conditioner has been approved by scientists worldwide due to its large surface area, high water retention capacity, slow nutrient releasing nature and liming ability; and it might also help to get desirable crop yield in problem soil like acidic soil. Hence, an experimental field trial was operated at the research field of the Department of Agroforestry and Environmental Science, Sylhet Agricultural University, Sylhet to evaluate the performance of banana peel biochar (BB) and orange peel biochar (OB) in the growth and yield of tomato (Solanum lycopersicon Mill.) and country bean (Lablab purpureus) under acidic soil conditions. In case of tomato, plant height (PH), number of leaves plant-1 (NLP), leaf length (LL), and stem diameter (SD) in treatments having different levels of biochar were significantly higher than the control. The maximum PH (72.20 cm), NLP (21), LL (35.66 cm), SD (9.05 cm), and total leaf chlorophyll content (TLCC) (50.56 µmol m-2) of tomato were found in T7 (3% OB w/w + CF) followed by T4 (3% BB w/w + CF) whereas in country bean, the PH (373 cm), NLP (34), branch number (BN) (3), and TLCC (36.65 µmol m-2) were also recorded in T7 followed by T4. The root length (RL) (43.5 cm) and fresh root weight (FRW) (14 g) of country bean were the maximum at T7, followed by T5 (1% OB w/w + CF). According to the results, positive effects of BB and OB application were observed on all the yield parameters of country bean and tomato. The number of pod plant-1 (NPP) (384), individual pod weight (IPW) (5.78 g), total pod weight plant-1 (TPWP) (2220 g), and pod length (PL) (10.57 cm) of country bean were also found to be highest in T7, followed by the T4. Similarly, the highest NFP (37), IFW (55 g), and TFWP (1980 g) of tomato were noted in T7, followed by T4. After the cultivation of country bean and tomato, a significant increase in the soil pH was noticed at T3 (2% BB w/w + CF), T4, T6 (2% OB w/w + CF) and T7 in respect of the control. Therefore, the findings of the study suggest that both BB and OB could have a positive impact on growth and yield components of tomato and country bean by altering soil pH of acidic soil.
... Figure 6C displays the top 10 most abundant phyla, which collectively represent 96.39% of the total sequences. RSBC2 treatment increased the relative abundance of (Xu et al., 2016). ...
This study aims to explore novel, environmentally friendly technologies for converting organic waste into biochar for land application for sustainable management. However, the impact of biochar on the soil environment and crop yield depends on the specific feedstock and its interaction with the soil. Through pot experiments, we investigated the effects of three different biochars (sawdust biochar, rice straw biochar, and coconut shell biochar) on the growth of D. rubrovolvata at two different input levels (1% and 2%). It was found that contrary to expectations, high input levels of sawdust biochar had a negative impact on D. rubrovolvata yield, while rice straw biochar and coconut shell biochar increased D. rubrovolvata yield by 16.0% to 159.1% and 54.4% to 64.0%, respectively, at the two input levels. The study revealed the key role of soil factors (such as total phosphorus, nitrogen/phosphorus ratio, water holding capacity, ammonium nitrogen, nitrate nitrogen, CaCl2‐phosphorus, dissolved organic carbon, and invertase activity) in affecting the growth of D. rubrovolvata. Through structural equation modeling analysis, the application of sawdust biochar resulted in a low N/P ratio, thereby limiting the growth of D. rubrovolvata, while the application of straw biochar and coconut shell biochar promoted mushroom growth by increasing sucrase activity and DOC content. The increase in D. rubrovolvata biomass and nutrient content indicated the superiority of RSBC and CSBC as soil amendments. However, further research is needed to determine the appropriate application scenarios for SDBC. The findings also show that the application of biochar can help improve soil physicochemical biological properties, thus having potential benefits in sustainable agricultural practices. Overall, this study provides insights into the potential of biochar technology in sustainable agricultural practices, its role in improving soil quality and crop productivity, and explores for the first time a new field of biochar application in D. rubrovolvata cultivation.
... Because of the elevated nutrient content, crop residue-derived biochars are favored in crop growth trials, but the impact on the microbiome functional activity has yet to be studied in detail. Several recent studies and reviews have indicated that, in addition to enhancing key physical and chemical properties of soil that enhance the growth of certain crops, biochar may also elicit changes in the soil microbiome; this may be due to the increased presence of labile carbon and biochar-bound nutrients that could serve to feed microbial growth (Xu et al., 2016;Li et al., 2020); moreover, the pore structure of biochar could lend protection from predation to certain microbes (Palansooriya et al., 2019;Li et al., 2020). ...
We characterized the effects of crop residue derived biochar on tomato growth, soil microbial diversity, and rhizosphere-level gene expression responses in an organic production system. Shoot fresh biomass and fruit yield were assessed at the end of the growing cycle. The corresponding transcriptomic response of the roots, the soil microbial community profiles, and the active transcripts within the communities were quantified using a metatranscriptomic approach at four different developmental stages of the plant. Biochar treatment did not impact shoot biomass or fruit production; however, metatranscriptome analysis revealed that the gene expression activity of the tomato rhizosphere changes over time in response to the biochar treatment, with a number of bacteria with known benefits to soil health and plant growth displaying increased gene expression (e.g., Rhizobiaceae, Pseudomonadaceae, Micromonosporaceae, Sphingomonadaceae). Streptomycetaceae were expressed at the highest levels in the rhizosphere. Biochar seemed to attenuate the expression of this bacteria by the end of the time course, possibly due to the rise in competition for resources driven by the increased activity of other beneficial microbes. Notably, pathogenic fungi in the soil displayed generally reduced expression in the biochar-amended rhizosphere in comparison with the control. In addition to the assessment of the rhizosphere microbiome, transcriptome analysis and gene ontology analysis of tomato roots revealed functional enrichment of genes associated with nitrogen metabolic processes, regulation of metabolic processes, and production of organic compounds in the biochar treated rhizosphere. Together, these results suggest that biochar amendment enhances gene expression of beneficial soil microbes, and also impacts gene expression in the plant roots, which may in turn lead to improvements in soil and plant health. The results of this study provide foundations and a methodology for using metatranscriptomic approaches to investigate the impacts of biochar or other soil amendments in different crops, varying soil types, and with greater experimental complexity. The findings of such investigations will inform the development of biochar-based soil amendment strategies to enhance soil fertility and crop health in a wide range of production systems.
... The resulting digestate samples were firstly subjected to centrifuging, supernatant decanning and then the pellet was stored with dry ice and subsequently delivered to subsequently Shanghai Meiji Biomedical Technology Company for further analysis [29]. Specifically, the V3-V4 region of the 16 S rRNA gene was amplified using primers specific to bacteria and archaea based on previous studies [30,31]. The extracted DNA was then quantified for yield and purity, purified after PCR amplification. ...
... The effects of biochar application on soil properties have drawn the attention of specialists worldwide, especially its impact on the bacterial community essential to maintain ecosystem balance, soil quality, and nutrient content (Lehmann et al. 2011;Campos et al. 2020). The changes in these soil properties caused by biochar application significantly affect edaphic microbial communities (Xu et al. 2016). Additionally, bacterial abundance is usually related to changes in soil pH and plant development soon after biochar application (Campos et al. 2020). ...
The current agricultural scenario faces diverse challenges, among which phytosanitary issues are crucial. Plant diseases are mostly treated with chemicals, which cause environmental pollution and pathogen resistance. In light of the UN Sustainable Development Goals (SDGs), the biochar alternative use to chemical inputs fits into at least six of the proposed goals (2, 3, 7, 13, 15, and 17), highlighting the 12th, which explains responsible consumption and production. Biochar is valuable for inducing systemic resistance in plants because it is a practical and frequently used resource for improving physical, chemical, and biological soil attributes. This review assessed the beneficial and potential effects of applying biochar to agricultural soils on bacterial pathogen management. Such application is a recent strategy; therefore, this research evaluated 20 studies that used biochar to manage plant diseases caused by pathogens inhabiting the soil in different systems. The effectiveness of biochar application in controlling plant diseases has been attributed to its alkaline pH, which contributes to the growth of beneficial microorganisms and increases nutrient availability, and its porous structure, which provides habitat and protection for soil microbiome development. Therefore, the combined effect of improvements on soil attributes through biochar application aids pathogen control. Biochar application helps manage plant diseases through different mechanisms, inducing plant resistance, increasing activities and abundance of beneficial microorganisms, and changing soil quality for nutrient availability and abiotic conditions.
... Most anthropogenic influences on the STN pool moderate nitrogen inputs and outputs (see Box 1). 1 For example, in agroecosystems, nitrogen fertilization and crop removal represent an additional but substantial and artificial soil nitrogen input and output (Sainju, 2017). Some agricultural practices have worked to improve nitrogen use efficiency and employ rotation with nitrogen fixing crops (Hossain et al., 2016;Yong et al., 2018) that can bring more nitrogen into soil environments, while others till or irrigate such that they trigger higher soil nitrogen loss through leaching (Bender and van der Heijden, 2015;Xu et al., 2016) and nitrous oxide (N 2 O) emission to the atmosphere (Oikawa et al., 2015). The outcome being that agricultural soils may not retain the increased nitrogen for long since increased nitrogen outputs compensate for much of those additional nitrogen inputs. ...
The amount of nitrogen stored in terrestrial soils, its "nitrogen pool", moderates biogeochemical cycling affecting primary productivity, nitrogen pollution and even carbon budgets. The soil nitrogen pools and the transformation of nitrogen forms within them are heavily influenced by environmental factors including anthropogenic activities. However, our understanding of the global distribution of soil nitrogen with respect to anthropogenic activity and human land use remains unclear. We constructed a meta-analysis from a global sampling, in which we compare soil total nitrogen pools and the driving mechanisms affecting each pool across three major classifications of human land use: natural, agricultural, and urban. Although the size of the nitrogen pool can be similar across natural, agricultural and urban soils, the ecological and human associated drivers vary. Specifically, the drivers within agricultural and urban soils as opposed to natural soils are more complex and often decoupled from climatic and soil factors. This suggests that the nitrogen pools of those soils may be co-moderated by other factors not included in our analyses, like human activities. Our analysis supports the notion that agricultural soils act as a nitrogen source while urban soils as a nitrogen sink and informs a modern understanding of the fates and distributions of anthropogenic nitrogen in natural, agricultural, and urban soils.
... The neutral to moderately acidic conditions within BSRNFs, as well as the chemical binding of urea and NH 4 Cl to functional groups on biochar surfaces, represent a second mechanism for limiting the release of urea-N and NH 4 Cl-N into the soil solution. Biochar as a fertilizer carrier can limit leaching and increase nutrient availability owing to increased surface area and compact structure (Gwenzi et al., 2018) and large cation exchange capacity (Xu et al., 2016). This was also reported by Chen et al. (2018) testing a biochar-based fertilizer made from biochar, kaolin and urea hydrogen peroxide with a 74% reduction in leaching. ...
Increasing consideration is being paid to sustainable slow release fertilizers (SRFs). Biochar is a novel carbon material, and gaining momentum as a natural carrier for sustainable nutrient application and release and improved soil health. Accordingly, a recent biochar‐embedded slow‐release nitrogen (N) fertilizer has been prepared using acacia biochar, urea, ammonium chloride, starch and organic acid. This and other biochar‐embedded slow release N fertilizers (BSRNFs) were characterized using Fourier transform infrared spectroscopy (FT‐IR) and scanning electron microscope (SEM). BSRNFs were tested in the laboratory and field experiments for their N release pattern, nitrate (NO 3 ‐N) leaching loss, N use efficiency (NUE), growth and yield of rice crops. Among the BSRNFs tested, the one with 75% urea‐N (BSRNF‐U75) released 109 mg kg ‐1 of N ( in an incubation study and the least NO 3 ‐N leaching losses (8.8, 14.6, and 26.4 mg kg ‐1 ) at 10, 20 and 30 cm depth in a column study, respectively compared to conventional urea. Application of biochar‐embedded slow release N fertilizer 100% urea‐N (BSRNF‐U100) augmented plant growth to increase grain yield (6610 kg ha ‐1 ), straw yield (9612 kg ha ‐1 ) and NUE (12%) in rice.
... The DNA concentration and purity were measured using a Nan-oDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). The V3-V4 regions of the bacterial 16S rRNA genes were amplified with universal primers 338F (5′-ACT CCT ACG GGA GGC AGC AG-3′) and 806R (5′-GGA CTA CHVGGG TWT CTAAT-3′) (Xu et al. 2016). PCR amplicons were purified, quantified, and pooled in equal molar amounts to form a composite DNA sample. ...
With continued anthropogenic inputs of nitrogen (N) into the environment, non-point source N pollutants produced in winter cannot be ignored. As the water-soil interface zones, riparian wetlands play important roles in intercepting and buffering N pollutants. However, winter has the antagonistic effect on the N removal. Substrate improvement has been suggested as a strategy to optimize wetland performance and there remain many uncertainties about the inner mechanism. This study explores the effects of substrate improvement on N removal in winter and rhizospheric crosstalk between reed (Phragmites australis) and microbes in subtropical riparian reed wetlands. The rates of wetland N removal in winter, root metabolite profiles, and rhizosphere soil microbial community compositions were determined following the addition of different substrates (gravel, gravel + biochar, ceramsite + biochar, and modified ceramsite + biochar) to natural riparian soil. The results showed that the addition of different substrates to initial soil enhanced N removal from the microcosms in winter. Gravel addition increased NH4⁺-N removal by 8.3% (P < 0.05). Gravel + biochar addition increased both TN and NH4⁺-N removals by 8.9% (P < 0.05). The root metabolite characteristics and microbial community compositions showed some variations under different substrate additions compared to the initial soil. The three treatments involving biochar addition decreased lipid metabolites and enhanced the contents and variety of carbon sources in rhizosphere soil, while modified ceramsite + biochar addition treatment had a greater impact on the microbial community structure. There was evidence for a complex crosstalk between plants and microbes in the rhizosphere, and some rhizosphere metabolites were seen to be significantly correlated with the bacterial composition of the rhizospheric microbial community. These results highlighted the importance of rhizospheric crosstalk in regulating winter N removal in riparian reed wetland, provided a scientific reference for the protection and restoration of riparian reed areas and the prevention and control of non-point source pollution.
... The imbalance in soil microbial community structure is therefore one of the most important causes of crop barriers in tea plants. Bamboo charcoal is increasingly being used to address this problem because of its multiple excellent properties [13,25]. However, there are currently limited studies on the effects of bamboo charcoal on the microbial community structure of tea trees. ...
Bamboo charcoal, a type of manufactured biochar, is produced by pyrolyzing bamboo residue under anoxic conditions. Its beneficial properties in absorption, catalyst support, and agricultural function have attracted significant attention; however, relatively few studies have examined its effects on the soil microbiota. In this study, we analyzed the effects of bamboo charcoal on soil physicochemical properties, enzymes, and microbial community structure in tea plantations and investigated the optimal amount of bamboo charcoal to be added to organic fertilizer. The results show that bamboo charcoal can further increase soil available nitrogen, total and available phosphorus and potassium, organic carbon content, pH, and urease activity. However, only the combined use of bamboo charcoal and organic fertilizer significantly increased total nitrogen, sucrase, and β-glucosidase activities in the soil. Bamboo charcoal also significantly increased the Chao1 and Shannon indices of microbiota diversity in a concentration-dependent manner. The structure of the bacterial community changed significantly after the bamboo charcoal addition, with Proteobacteria, Actinobacteria, and Firmicutes increasing and Acidobacteria decreasing. This study provides fundamental insights into the suitability of bamboo charcoal application for the ecological remediation of diseased soils.
... En el estudio de XU N. et al. (84) un antes y después del medio recuperado con biocarbón, evaluando el cambio de la diversidad bacteriana, los cuales reducen el nitrógeno lixiviado total del orden del 18,8% agregando biochar al 2%, con biochar al 4% se reduce el nitrógeno lixiviado total en 19,5% y con un biochar al 8% se reduce el nitrógeno lixiviado en 20,2%; con respecto al nitrato lixiviado, este se reduce en 16 ...
El alto impacto ambiental de los desechos sólidos y líquidos que contienen elementos tóxicos y metales está teniendo un impacto negativo en diversos ecosistemas, este trabajo tiene como objetivo realizar una revisión sistemática y análisis bibliométrico de la producción científica, con la esperanza de comprender la capacidad de retención y absorción de biocarbón, análisis Capacidad de diferentes biochars para ciertos elementos contaminantes incluyendo metales pesados; el análisis bibliométrico se realizó a través de una revisión de las bases de datos web of science (WoS) y Scopus. Los registros obtenidos se analizan utilizando teoría de grafos y herramientas como bibliometrix, Sci2 Tool, Gephi, se dividen en tres categorías: clásica, estructural y reciente, donde se obtienen tres perspectivas: captación de metales pesados, biodisponibilidad y contaminantes; De igual manera, se identificó que el campo de estudio es nuevo. El principal autor es Yang Yi, autores importantes como Geng Yong y Liang Dong cuentan con un H-index bastante alto. Adicionalmente, los países con mayor producción en el tema son: CHINA que ocupa el primer lugar, USA con el segundo lugar y KOREA con el tercer puesto.
... However, Ren et al. [77] reported that Gemmatimonadota were positively correlated with soil water content and Murphy et al. [78] reported that Myxococcota were aerobic bacteria and negatively correlated with soil water content, which is consistent with the relationship between W and relative abundance of Gemmatimonadetes and Myxococcota that was significantly affected by biochar and subsurface drainage in our study. In our study, the relative abundance of Acidobacteriota was found to be significantly lower in B-S compared to the other two groups, and Xu et al. [79] observed that Acidobacteriota are usually the dominant bacteria in oligotrophic and low-pH soils, and the decrease in their abundance may be due to the increase in soil pH and nutrient content after the addition of biochar. In this research, Chloroflexi showed a strong negative correlation with nitrate and SOM and a positive correlation with W. The relative fractional abundance of Chloroflexi in CK was significantly higher than that of B-S and S. Chloroflexi are parthenogenic anaerobes that can metabolize autotrophically through photosynthesis, and many microorganisms can grow in the inter-rhizosphere under anaerobic conditions [80]. ...
Waterlogging and salinization are considered to be the main threats to agricultural productivity and land resources in coastal areas of China. Thus far, drainage and field soil improvement programs have been ineffective. In this article, we investigated the effect of subsurface drainage combined with biochar (B–S) on soil physicochemical properties and soil bacterial community structure in coastal saline soil. In this study, B–S significantly reduced soil electrical conductivity (EC) and soil water content (W) by 35% and 10.65% compared to no drainage (CK). Compared to CK and drainage alone (S), B–S significantly increased soil total nitrogen (TN) by 24.78% and 39.62%, soil available phosphorus (AP) by 28.29% and 69.82%, soil nitrate (NO3−-N) by 64.65% and 35.45%, and significantly increased soil organic matter (SOM) by 74.69% and 66.10%, respectively. It also significantly increased alkaline phosphatase (ALP) and urease activities. The results of redundancy analysis (RDA) showed that CAT and urease made the greatest response to changes in environmental factors, indicating that CAT is more sensitive to changes in environmental alterations than ALP. AP was the dominant factor in the change in enzyme activity (R2 = 53.0%, p < 0.05), followed by NO3−-N (R2 = 14.8%). SOM was the dominant factor in the variation in microbial abundance content (R2 = 38.5%, p < 0.05), followed by ALP (R2 = 20.0%, p < 0.05). The results of the study can provide guidance for effective land use and sustainable development of agricultural soil ecology in coastal areas.
... To create biochar, a variety of biomass waste can be utilized. The characteristics of the biomass feedstock and the management methods implemented would influence the number of emissions reduced by using waste for biochar (Xu et al ., 2016). It has been demonstrated that biochar incorporation to soil can affect how nitrogen (N) and carbon (C) are transformed and retained in the soil. ...
Biochar is gaining a lot of attention because it can boost crop yield and quality,
enhance the health and fertility of the soil, and carbon sequestration (C). To make up
for anthropogenic carbon emissions, biochar is primarily used to trap carbon. By
agglomerating the soil with biochar, one can increase the rate of infiltration, increase the
soil’s ability to hold water, and purify the water that penetrates into the soil. The addition
of biochar is a solution since it has been demonstrated to boost crop production, decrease
pollution, and improve soil fertility. The soil’s characteristics are reported to be changed by
biochar, as it promotes microbial growth and improves the sorption of both inorganic and
organic chemicals. The organic matter in the soils is essential for sustainable agriculture.
Large amounts of biomass residues, which should be valued as precious residues, are
disposed of or burned, which has a significant negative impact on soil quality. This
chapter highlights the significance of biochar as an alternative to conventional products
used for energy, the environment, and agriculture due to its numerous applications.
According to many studies, the major effects of biochar amendment on crop development
are favourable. However, there is a vast scope to probe and standardize crop specific raw
material, method, dose of biochar application for different agroclimatic regions.
... The hypervariable regions of bacterial V3-V4 and fungal ITS1 were amplified by using a thermocycler PCR system (GeneAmp R 9700, ABI, USA). The amplified primers of bacteria and fungi were 338F (5 ′ -ACTCCTACGGGAGGCAGCAG-3 ′ ) and 806R (5 ′ -GGACTACHVGGGTWTCTAAT-3 ′ ) (Xu et al., 2016), and ITS1F (5 ′ -CTTGGTCATTTAGAGGAAGTAA-3 ′ ) and ITS2R (5 ′ -GCTGCGTTCTTCATCGATGC-3 ′ ) (Adams et al., 2013), respectively. The PCR reaction mixture was as follows: 0.4 µl of FastPfu polymerase (TransGen AP221-02), 4 µl of 5×FastPfu Buffer, 2 µl of 2.5 mM dNTPs, 0.8 µl of forwarding primer (5 µM), 0.8 µl of reverse primer (5 µM), 0.2 µl of BSA, 10 ng of template DNA, and added ddH 2 O to 20 µl. ...
This study was conducted to investigate the capability of the microbial community characteristics and soil variables to promote carbon and nitrogen cycles in maize fields under straw mulch. We covered the surface soil of the maize field with different amounts of wheat straw (0 kg/ha, 2,250 kg/ha, and 4,500 kg/ha) and used 16S rRNA and ITS sequencing, Biology ECO-plate, traditional enzymology, TOC analyzer, and HPLC to measure bacterial and fungal community composition and functions, characteristics of microbial carbon source metabolism, carbon and nitrogen fraction, enzyme activity, and organic acid content in the maize rhizosphere and non-rhizosphere. The results indicated that short-term straw mulch insignificantly affected the alpha diversity of bacterial and fungal communities whereas significantly influenced their beta diversity. The results of functional prediction revealed that straw mulch considerably boosted the relative abundances of bacteria belonging to chemoheterotrophy, aerobic chemoheterotrophy, ureolysis, and nitrogen fixation and inhibited fermentation and nitrate reduction in maize rhizosphere soil. These processes primarily drove the C and N cycles in soil. Straw mulch also improved fungal saprotrophs by raising the proportion of Chaetomiaceae and Chaetosphaeriaceae . The Biology ECO-plate results illustrated that straw mulch weakened the metabolism capacity of microbial labile carbon resources. As a result, the labile C and N fractions were raised under straw mulch. Our results also showed that straw mulch primarily regulated the microbial community structure in rhizosphere soil by significantly decreasing Firmicutes and Ascomycota relative abundance while increasing Basidiomycota . The fungal community structure is more than bacterial for affecting soil microbial biomass carbon, readily oxidizable organic carbon, dissolved organic carbon, available nitrogen, ammonium, and nitrate directly and indirectly through malic acid content and cellulase, protease, and amylase activity. Overall, our findings imply that straw mulch might influence the bacterial and fungal community structures, thereby boosting the production of labile C and N components and accelerating the C and N cycle in maize fields.
... This could be attributed to BC promoting the uptake of upper water and mineral N ( Fig. 4 and S1). The high level of rainfall in 2018-2019 and the waternutrient retention effects of BC may have mostly met the plant's needs by avoiding the depletion of water in the lower layer (Foster et al. 2016;Xu et al. 2016). ...
Background
Nitrogen (N) is an essential plant nutrient that limits growth in most terrestrial ecosystems, and to compensate for this, biochar (BC) is often utilized to reduce soil N losses and thus improve yields. However, optimizing root morphology with BC to help reduce N fertilization use and achieve consistent yields has not been widely investigated.
Methods
To address this, a two-year wheat field experiment was conducted in the drylands of the Loess Plateau in China. BC was applied at 0, 10, 20, and 30 t ha− 1 (BC0, BC10, BC20, and BC30, respectively) along with two N fertilization treatments (90 and 120 kg N ha− 1; N90 and N120, respectively).
Results
The results showed that BC promoted root growth in 2017–2018 (normal year) and reduced excessive root growth in 2018–2019 (wet year). The root strategy that resulted from the BC treatments reduced the variation in mineral nitrogen storage (ΔMNS) in the soil profile, thus supporting the efficient use of water and N for higher yields and partial factor productivity of N (PFPN), especially with the N120BC20 treatment. Furthermore, the PFPN was higher with the N90BC20 treatment than with the N120BC20 treatment, but there was no significant difference in yield. These results thus indicate that BC can compensate for the yield reduction caused by reduced N fertilizer use.
Conclusions
Our study provides different insights into potential strategies to reduce N applications in semiarid farmland and other rain-fed cropping regions using a BC-optimized root system strategy.
... The amplicon pools were prepared for sequencing, and the size and quantity of the amplicon library were assessed using the Agilent 2100 Bioanalyzer and the Library Quantification Kit for Illumina, respectively. The libraries were sequenced on the NovaSeq PE250 platform, and the V3-V4 fragment of nuclear bacterial DNA was amplified using 341F (5′-CCTACGGGNGGCWGCAG-3′) and 805R (5′-GACTACHVGGGTATCTAATCC-3′) primers (Xu et al., 2016;Sundberg et al., 2013;Xiong et al., 2012). ...
... After the extraction of microbial DNA, the DNA quality was evaluated with 1.5 % agarose gel electrophoresis. The 16S rRNA V4-V5 gene was amplified according to Xu et al. (2016). PCR amplification was completed, and PCR products were purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, USA) (Mori et al., 2013). ...
Functional bacterial communities (FBC) have members of different taxonomic biochemical groups, such as N2-fixation, nitrification and denitrification. This study explored the mechanism of the FBC from an upflow three-dimensional biofilm electrode reactor on enhancing the nitrogen removal efficiencies in a Sesuvium potulacastum (S. potulacastum) constructed wetland. There were high abundances of denitrifying bacteria detected in the FBC, and they had potential metabolic processes for nitrogen reduction. In the constructed wetland, cellular nitrogen compounds of S. potulacastum were enriched by overexpressed differentially expressed genes (DEGs), and the napA, narG, nirK, nirS, qnorB, and NosZ genes related to the denitrification process had more copies under FBC treatment. Nitrogen metabolism in root bacterial communities (RBCs) was activated in the FBC group compared with the control group without FBC. Finally, these FBCs improved the removal efficiencies of DTN (dissolved total nitrogen), NO3¯-N, NO2¯-N, and NH4+-N by 84.37 %, 87.42 %, 67.51 %, and 92.57 %, respectively, and their final concentrations met the emission standards of China. These findings indicate that adding FBC into S. potulacastum-constructed wetlands would result in high nitrogen removal efficiencies from wastewater and have large potential applications in further water treatment technology.
The relationship between water quality and bacterial composition may determine the sustainability level in an integrated
multi-trophic aquaculture (IMTA) system. In this study, the efects of diferent shrimp stocking densities on water quality
and bacterial community structure were studied in a sea cucumber-shrimp-crab-fsh IMTA system. The results showed cor�relations between bacterial community structure and water quality parameters (dissolved oxygen, salinity, pH, ammonia
nitrogen, nitrite nitrogen, and phosphate phosphorus) under diferent stocking densities of Penaeus japonicus. Temperature,
salinity, nitrite nitrogen, ammonia nitrogen, and phosphate phosphorus were signifcant factors (p<0.05) infuencing the
bacterial community in the samples. Nitrite nitrogen showed the greatest efect on bacterial community diversity and rich�ness. Flavobacteriaceae and Cryomorphaceae play important roles in the denitrifcation process, and these bacteria were
signifcantly more abundant in low-density ponds than in high-density ponds. This study provides practical knowledge on
shrimp stocking density management and its efect on IMTA system biosecurity.
Applying biochar to saline soil is a novel strategy for improving soil quality. However, how biochar addition amount affects soil nutrients, bacterial communities, and cotton growth at different stages remains unclear. Three biochar treatments, no biochar (BC0), 1% biochar (BC1, w/w), 3% biochar (BC3), and two cotton varieties, salt‐sensitive (SS) and salt‐tolerant (ST), were used in pot experiments, analyzing biochar effects on saline soil nutrients, bacterial communities, and cotton growth. The study found that biochar increased only organic carbon (SOC), total nitrogen (TN), and available potassium (AK) at the seedling stage. However, at the flowering‐boll stage, biochar also increased nitrate () and available phosphorus (AP) and reduced soil salt content. Biochar did not affect α‐diversity at the seedling stage, but BC3 reduced α‐diversity at the flowering‐boll stage. The principal coordinate analysis revealed changes in the soil bacterial community composition that were closely associated with biochar added. From the redundancy analyses, SOC and AK were the leading environmental factors for soil bacterial community composition changes. SOC, TN, and AK correlated positively with Proteobacteria, which increased their relative abundance through biochar addition and correlated negatively with Bacteroidetes, Chloroflexi, and Acidobacteria, which decreased their relative abundance due to biochar. Furthermore, the random forests analysis showed that SOC, Shannon index, and β‐diversity were significant predictors of cotton biomass. In summary, biochar drives changes in bacterial communities in saline soils by increasing nutrients such as SOC and AK, which affect cotton growth. This study provides data to support the application of biochar on saline soils.
Cambodia plans to expand its rice sector and become a prominent rice exporter. A key concern is that soil fertility is a crucial factor affecting rice production, and nutrient leaching into the environment can lead to reduced nutrient uptake and lower rice yield. Carbonized waste biochar has gained recognition not only as a potential soil fertility enhancer but also as a significant nutrient leaching reducer. It is currently being introduced in many regions. The study was to evaluate how a combination of chemical fertilizers and rice husk biochar affects nutrient leaching into the topsoil layer and plow sole of soil columns during direct seeding with continuous flooding, and to assess their combined effects on rice growth and yield. In the leachate from these two soil layers, except for ortho-phosphate (PO43−), the combination of CHEM + BIO2 or + BIO4 treatment (chemical fertilizers + biochar at a rate of 2t ha−1 or + biochar at a rate of 4t ha−1) significantly decreased ammonium (NH4+) and nitrate (NO3−) levels more than CHEM alone, particularly in the plow sole, suggesting that their combination and biochar sorption capacity are beneficial for nitrogen use by plants. CHEM + BIO2 had varying effects, whereas CHEM + BIO4 led to a significant increase in rice yield, plant biomass, tiller number, panicle length, grains per panicle, and grain weight per panicle. These findings suggest that incorporating biochar amendments in rice production can reduce N leaching. However, there is no evidence to support its effectiveness in reducing P leaching. Therefore, further studies are needed to determine the usefulness of this approach.
As one of the quintessential representatives of Chinese rice wine, Hongqu rice wine is brewed with glutinous rice as the main raw material and Hongqu (Gutian Qu or Wuyi Qu) as the fermentation starter. The present study aimed to investigate the impact of Hongqu on the volatile compositions and the microbial communities in the traditional production of Gutian Hongqu rice wine (GT) and Wuyi Hongqu rice wine (WY). Through the OPLS-DA analysis, 3-methylbutan-1-ol, isobutanol, ethyl lactate, ethyl acetate, octanoic acid, diethyl succinate, phenylethyl alcohol, hexanoic acid and n-decanoic acid were identified as the characteristic volatile flavor components between GT and WY. Microbiome analysis revealed significant enrichments of Lactobacillus, Pediococcus, Aspergillus and Hyphopichia in WY brewing, whereas Monascus, Saccharomyces, Pantoea, and Burkholderia-Caballeronia-Paraburkholderia were significantly enriched in GT brewing. Additionally, correlation analysis showed that Saccharomyces, Lactobacillus, Weissella and Pediococcus were significantly positively correlated wih most characteristic volatile components. Conversely, Picha, Monascus, Franconibacter and Kosakonia showed significant negative correlations with most of the characteristic volatile components. Furthermore, bioinformatical analysis indicated that the gene abundances for enzymes including glucan 1,4-alpha-glucosidase, carboxylesterase, alcohol dehydrogenase, dihydroxy-acid dehydratase and branched-chain-amino-acid transaminase were significantly higher in WY compared to GT. This finding explains the higher content of higher alcohols and characteristic esters in WY relative to GT. Collectively, this study provides a theoretical basis for improving the flavor profile of Hongqu rice wine and establishing a solid scientific foundation for the sustainable development of Hongqu rice wine industry.
Three Gorges Reservoir (TGR) water fluctuation creates high water level (HWL) and low water level (LWL) condition in TGR aquatic ecosystem. HWL fluies significant nutrients, mainly introducing carbon and nitrogen into the ecosystem. The nitrogen input is a concern for water quality management of TGR since the possible eutrophication caused by nitrogen spike. Sediment denitrification is widely recognized as the dominant nitrogen removal process in freshwater ecosystem. Therefore, the response of TGR sediments microbiome to the input nitrogen flucatution is crucial for both nitrogen balance and the eutrophication status of the ecosystem. Using high throughout sequencing of 16S rRNA gene and the predicted denitrification enzyme, and qualitative PCR of denitrification functional genes, we investigated how TGR sediments denitrification microbiome respond to the input nitrogen flux during two seasonal water fluctuation events. Concomitant to expected input carbon and nitrogen, we observed distinct microbial community structure and denitrification microbiota in HWL and LWL, and also in seasonal sampling events. Sediments pH, total nitrogen and nitrate were the significant impact factors in shaping the microbial community structure. Important denitrification microbiota (e.g., Saprospiraceae, Gemmatimonadaceae, Pseudomonas) are the main taxa of the microbial community and also showed water level and seasonal variation. The relative abundance of denitrification enzyme (nar, nir, nor, nos) and function genes (nirS, nirK, nosZ) were higher in LWL than HWL. Denitrification enzyme were significantly (p < 0.05) correlated with the nitrate concentration. In addition, the relative abundance of denitrification enzyme and function genes increased during the transition from 2014 HWL to 2015 LWL. Results suggested that TGR sediments denitrification is nitrate concentration dependent. The denitrification microbiome is initially inhibited due to high nitrate input, then they developed denitrification ability in response to high nitrate concentration.
Patterns of microbial diversity on elevational gradients have been extensively studied, but little is known about those patterns during the restoration of earthquake-fractured alpine ecosystems. In this study, soil properties, soil enzyme activities, abundance and diversity of soil bacterial and fungal communities at four positions along a 2.6-km elevational gradient in the Snow Treasure Summit National Nature Reserve, located in Pingwu County, Southwest China. Although there were no significant changes in the soil chemical environment, bacterial and fungal communities were significantly different at different elevations. The overall fungal community presented an N-shaped diversity pattern with increasing elevation, while bacterial diversity decreased significantly with elevation. Changes in microbial diversity were associated with soil phosphorus, plant litter, and variations in dominant microbial taxa. Differences in enzyme activities among elevations were regulated by microbial communities, with changes in catalase and acid phosphatase activities mainly controlled by Acidobacteria and Planctomycetaceae bacteria, respectively (catalase: p < 0.001; acid phosphatase: p < 0.01), and those in β-glucosidase, sucrase, and urease activities mainly controlled by fungi. The β-glucosidase and sucrase were both positively correlated with Herpotrichiellaceae , and urease was positively correlated with Sebacinaceae ( p < 0.05). These findings contribute to the conservation and management of mountain ecosystems in the face of changing environmental conditions. Further research can delve into the specific interactions between microbial communities, soil properties, and vegetation to gain deeper insights into the intricate ecological dynamics within earthquake-prone mountain ecosystems.
Changes in soil microbial communities may impact soil fertility and stability because microbial communities are key to soil functioning by supporting soil ecological quality and agricultural production. The effects of soil amendment with biochar on soil microbial communities are widely documented but studies highlighted a high degree of variability in their responses following biochar application. The multiple conditions under which they were conducted (experimental designs, application rates, soil types, biochar properties) make it difficult to identify general trends. This supports the need to better determine the conditions of biochar production and application that promote soil microbial communities. In this context, we performed the first ever meta-analysis of the biochar effects on soil microbial biomass and diversity (prokaryotes and fungi) based on high-throughput sequencing data. The majority of the 181 selected publications were conducted in China and evaluated the short-term impact (<3 months) of biochar. We demonstrated that a large panel of variables corresponding to biochar properties, soil characteristics, farming practices or experimental conditions, can affect the effects of biochar on soil microbial characteristics. Using a variance partitioning approach, we showed that responses of soil microbial biomass and prokaryotic diversity were highly dependent on biochar properties. They were influenced by pyrolysis temperature, biochar pH, application rate and feedstock type, as wood-derived biochars have particular physico-chemical properties (high C:N ratio, low nutrient content, large pores size) compared to non-wood-derived biochars. Fungal community data was more heterogenous and scarcer than prokaryote data (30 publications). Fungal diversity indices were rather dependent on soil properties: they were higher in medium-textured soils, with low pH but high soil organic carbon. Altogether, this meta-analysis illustrates the need for long-term field studies in European agricultural context for documenting responses of soil microbial communities to biochar application under diverse conditions combining biochar types, soil properties and conditions of use.
Aims
Lakeshore wetlands are global carbon (C) hotspots, but their role in C sequestration has been largely overlooked. The rhizosphere has a complex interaction of microbiota and metabolites, which plays an important role in wetland C cycling. This study aims to understand how the rhizospheric interactions affects harvested aboveground C and soil C of lakeshore wetlands in a subtropical region.
Methods
An investigation of five lakeshore reed (Phragmites australis) wetlands at the similar latitudes of the Lower Yangtse Valley in China was carried out to explore the relationship of rhizospheric interactions with harvested aboveground C and soil C. The plant traits and soil physicochemical properties were determined due to their important role in affecting rhizosphere interactions.
Results
Plant traits and soil physicochemical properties significantly differed among the sites, while aboveground C fixation did not significantly differ. The soil organic C (SOC) content of the topsoil was accounting for the majority of the soil total C at most sites, except for the wetland at the Yangtze River estuary with higher soil pH and conductivity, whose soil inorganic C (SIC) accounted for almost half. Bacterial community and metabolite composition were significantly partitioned across the region. Structural equation modeling revealed the rhizospheric interactions positively affected aboveground C and SOC, but negatively affected SIC. Their effects on soil C content were stronger than those on aboveground C fixation.
Conclusions
The rhizosphere exhibited the direct and indirect effects on harvested aboveground C and soil C by altering microbial community structure and metabolite composition.
Using a laboratory experiment, we investigated the effect of applying willow biochar to short rotation coppice soil on C and N dynamics and microbial biomass and community composition, in the presence and absence of willow litter. Application of biochar at a rate of 0.5 % had no effect on net CO2 mineralisation in the presence or absence of litter. However at a rate of 2 %, net CO2 mineralisation was reduced by 10 and 20 % over a 90-day period in the absence and presence of litter respectively. Biochar reduced N mineralisation when applied at both 0.5 and 2 % concentrations. pH was increased by application of 2 % biochar to soil. Phospholipid fatty acid analysis demonstrated that both concentrations of biochar affected microbial community composition, although the effect of biochar was not as great as the effect of time or litter application in shaping community structure. In particular, the amount of bacterial biomass was increased by biochar application to soil, and there was evidence for increased abundance of Gram-negative bacteria and actinobacteria following biochar application. The data is discussed in the context of microbial mechanisms underlying impacts of biochar on C cycling in soil, and the coupling of C and N cycles following amendment of soil with biochar.
Biochar has been suggested to improve acidic soils and to mitigate greenhouse gas emissions. However, little has been done on the role of biochar in ameliorating acidified soils induced by overuse of nitrogen fertilizers. In this study, we designed a pot trial in a greenhouse to study the interconnections between microbial community, soil chemical property changes and N2O emissions after biochar application. The results showed that biochar increased plant growth, soil pH, total carbon (TC), total N (TN), C: N ratio and soil cation exchange capacity (CEC). The results of high-throughput sequencing showed that biochar application increased α-diversity significantly and changed the bacterial community by mainly increasing the relative abundances of Acidobacteria and Chloroflexi, while decreasing the abundances of Bacteroidetes, Gemmatimonadetes, and TM7 at the phylum level. Biochar amendment stimulated both nitrification and denitrification processes, while reduced N2O emissions overall. Results of redundancy analysis (RDA) and variance partition analyses (VPA) indicated biochar could shift the soil microbial community by changing soil chemical properties, which modulate N-cycling processes and soil N2O emissions. The significantly increased nosZ transcription suggests that biochar brings about a decrease in N2O emissions by enhancing its further reduction to N2.
In spite of the numerous studies reporting a decrease in soil nitrous oxide (N2O) emissions after biochar amendment, there is still a lack of understanding of the processes involved. Hence the subject remains controversial, with a number of studies showing no changes or even an increase in N2O emissions after biochar soil application. Unraveling the exact causes of these changes, and in which circumstances biochar decreases or increases emissions, is vital to developing and applying successful mitigation strategies. With this objective, we studied two soils (Haplic Phaeozem (HP) and Haplic Calcisol (HC)), which showed opposed responses to biochar amendment. Under the same experimental conditions, the addition of biochar to soil HP decreased N2O emissions by 76%; whereas it increased emissions by 54% in soil HC. We combined microcosm experiments adding different nitrogen fertilizers, stable isotope techniques and the use of a nitrification inhibitor (dicyciandiamide) with the aim of improving our understanding of the mechanisms involved in the formation of N2O in these two soils. Evidence suggests that denitrification is the main pathway leading to N2O emissions in soil HP, and ammonia oxidation and nitrifier-denitrification being the major processes generating N2O in soil HC. Biochar systematically stimulated nitrification in soil HC, which was probably the cause of the increased N2O emissions. Here we demonstrate that the effectiveness of using biochar for reducing N2O emissions from a particular soil is linked to its dominant N2O formation pathway.
Biochar has been heralded as a solution to a number of agricultural and environmental ills. To get the most benefit from its application, environmental and social circumstances should both be considered.
Biochar application is a promising strategy for sequestering carbon in agricultural soils and for improving degraded soils. Nonetheless, contradictory and unsettled issues remain. This study investigates whether biochar influences the soil microbial biomass and community structure using phospholipid fatty acid (PLFA) analysis. We monitored the effects of four different types of biochar on the soil microbial communities in three temperate soils of Austria over several months. A greenhouse experiment and two field experiments were conducted. The biochar application did not significantly increase or decrease the microbial biomass. Only the addition of vineyard pruning biochar pyrolysed at 400°C caused microbial biomass to increase in the greenhouse experiment. The biochar treatments however caused shifts in microbial communities (visualized by principal component analysis). We concluded that the shifts in the microbial community structure are an indirect rather than a direct effect and depend on soil conditions and nutrient status.
Strongly acidic soil (e.g. pH < 5.0) is detrimental to tea productivity and quality. Wheat, rice and peanut biochar produced at low temperature (max 300 °C) and differing in alkalinity content were incorporated into Xuan-cheng (Ultisol; initial pHsoil/water = 1/2.5 4.12) and Ying-tan soil (Ultisol; initial pH soil/water = 1/2.5 4.75) at 10 and 20 g/kg (w/w) to quantify their liming effect and evaluate their effectiveness for acidity amelioration of tea garden soils. After a 65-day incubation at 25 °C, biochar application significantly (P < 0.05) increased soil pH and exchangeable cations and reduced Al saturation of both tea soils. Association of H+ ions with biochar and decarboxylation processes was likely to be the main factor neutralizing soil acidity. Further, biochar application reduced acidity production from the N cycle. Significant (P < 0.05) increases in exchangeable cations and reductions in exchangeable acidity and Al saturation were observed as the rate of biochar increased, but there were no further effects on soil pH. The lack of change in soil pH at the higher biochar rate may be due to the displacement of exchangeable acidity and the high buffering capacity of biochar, thereby retarding a further liming effect. Hence, a significant linear correlation between reduced exchangeable acidity and alkalinity balance was found in biochar-amended soils (P < 0.05). Low-temperature biochar of crop residues is suggested as a potential amendment to ameliorate acidic tea garden soils.
The deep sequencing of 16S rRNA genes amplified by universal primers has revolutionized our understanding of microbial communities by allowing the characterization of the diversity of the uncultured majority. However, some universal primers also amplify eukaryotic rRNA genes, leading to a decrease in the efficiency of sequencing of prokaryotic 16S rRNA genes with possible mischaracterization of the diversity in the microbial community. In this study, we compared 16S rRNA gene sequences from genome-sequenced strains and identified candidates for non-degenerate universal primers that could be used for the amplification of prokaryotic 16S rRNA genes. The 50 identified candidates were investigated to calculate their coverage for prokaryotic and eukaryotic rRNA genes, including those from uncultured taxa and eukaryotic organelles, and a novel universal primer set, 342F-806R, covering many prokaryotic, but not eukaryotic, rRNA genes was identified. This primer set was validated by the amplification of 16S rRNA genes from a soil metagenomic sample and subsequent pyrosequencing using the Roche 454 platform. The same sample was also used for pyrosequencing of the amplicons by employing a commonly used primer set, 338F-533R, and for shotgun metagenomic sequencing using the Illumina platform. Our comparison of the taxonomic compositions inferred by the three sequencing experiments indicated that the non-degenerate 342F-806R primer set can characterize the taxonomic composition of the microbial community without substantial bias, and is highly expected to be applicable to the analysis of a wide variety of microbial communities.
Biochar (BC) is a common minor constituent of soils and is usually derived from the burning of wood materials. In the case of Amazonian dark earth (ADE) soils, the increased amount of this material is believed to be due to anthropogenic action by ancient indigenous populations. In this study, we use 16S rRNA gene pyrosequencing to assess the bacterial diversity observed in the BC found in ADEs as well as in the dark earth itself and the adjacent Acrisol. Samples were taken from two sites, one cultivated with manioc and one with secondary forest cover. Analyses revealed that the community structure found in each sample had unique features. At a coarse phylogenetic resolution, the most abundant phyla in all sequence libraries were Actinobacteria, Acidobacteria, Verrucomicrobia and Proteobacteria that were present in similar relative abundance across all samples. However, the class composition varied between them highlighting the difference between the Acrisol and the remaining samples. This result was also corroborated by the comparison of the OTU composition (at 97 % identity). Also, soil coverage has shown an effect over the community structure observed in all samples. This pattern was found to be significant through unweighted UniFrac as well as P tests. These results indicate that, although the ADEs are found in patches within the Acrisols, the contrasting characteristics found between them led to the development of significantly different communities.
Large-scale soil application of biochar may enhance soil fertility, increasing crop production for the growing human population, while also sequestering atmospheric carbon. But reaching these beneficial outcomes requires an understanding of the relationships among biochar's structure, stability, and contribution to soil fertility. Using quantitative (13)C nuclear magnetic resonance (NMR) spectroscopy, we show that Terra Preta soils (fertile anthropogenic dark earths in Amazonia that were enriched with char >800 years ago) consist predominantly of char residues composed of ~6 fused aromatic rings substituted by COO(-) groups that significantly increase the soils' cation-exchange capacity and thus the retention of plant nutrients. We also show that highly productive, grassland-derived soils in the U.S. (Mollisols) contain char (generated by presettlement fires) that is structurally comparable to char in the Terra Preta soils and much more abundant than previously thought (~40-50% of organic C). Our findings indicate that these oxidized char residues represent a particularly stable, abundant, and fertility-enhancing form of soil organic matter.
Ribosomal 16S rRNA gene pyrosequencing was used to explore whether the genetically modified (GM) Bt-maize hybrid MON 89034 × MON 88017, expressing three insecticidal recombinant Cry proteins of Bacillus thuringiensis, would alter the rhizosphere bacterial community. Fine roots of field cultivated Bt-maize and three conventional maize varieties were analyzed together with coarse roots of the Bt-maize. A total of 547 000 sequences were obtained. Library coverage was 100% at the phylum and 99.8% at the genus rank. Although cluster analyses based on relative abundances indicated no differences at higher taxonomic ranks, genera abundances pointed to variety specific differences. Genera-based clustering depended solely on the 49 most dominant genera while the remaining 461 rare genera followed a different selection. A total of 91 genera responded significantly to the different root environments. As a benefit of pyrosequencing, 79 responsive genera were identified that might have been overlooked with conventional cloning sequencing approaches owing to their rareness. There was no indication of bacterial alterations in the rhizosphere of the Bt-maize beyond differences found between conventional varieties. B. thuringiensis-like phylotypes were present at low abundance (0.1% of Bacteria) suggesting possible occurrence of natural Cry proteins in the rhizospheres. Although some genera indicated potential phytopathogenic bacteria in the rhizosphere, their abundances were not significantly different between conventional varieties and Bt-maize. With an unprecedented sensitivity this study indicates that the rhizosphere bacterial community of a GM maize did not respond abnormally to the presence of three insecticidal proteins in the root tissue.The ISME Journal advance online publication, 12 July 2012; doi:10.1038/ismej.2012.77.
Soil fertility and leaching losses of nutrients were compared between a Fimic Anthrosol and a Xanthic Ferralsol from Central Amaznia. The Anthrosol was a relict soil from pre-Columbian settlements with high organic C containing large proportions of black carbon. It was further tested whether charcoal additions among other organic and inorganic applications could produce similarly fertile soils as these archaeological Anthrosols. In the first experiment, cowpea (Vigna unguiculata (L.) Walp.) was planted in pots, while in the second experiment lysimeters were used to quantify water and nutrient leaching from soil cropped to rice (Oryza sativa L.). The Anthrosol showed significantly higher P, Ca, Mn, and Zn availability than the Ferralsol increasing biomass production of both cowpea and rice by 38–45% without fertilization (P
Biochar can play a key role in nutrient cycling, potentially affecting nitrogen retention when applied to soils. In this project,
laboratory experiments were conducted to investigate the adsorption properties of bamboo charcoal (BC) and the influence of
BC on nitrogen retention at different soil depths using multi-layered soil columns. Results showed that BC could adsorb ammonium
ion predominantly by cation exchange. Ammonium nitrogen (NH4
+-N) concentrations in the leachate of the soil columns showed significant differences at different depths after ammonium chloride
application to the columns depending on whether BC had been added. Addition of 0.5% BC to the surface soil layer retarded
the downward transport of NH4
+-N in the 70-day experiment, as indicated by measurements made during the first 7days at 10cm, and later, in the experimental
period at 20cm. In addition, application of BC reduced overall cumulative losses of NH4
+-N via leaching at 20cm by 15.2%. Data appeared to suggest that BC could be used as a potential nutrient-retaining additive
in order to increase the utilization efficiency of chemical fertilizers. Nonetheless, the effect of BC addition on controlling
soil nitrogen losses through leaching needs to be further assessed before large-scale applications to agricultural fields
are implemented.
KeywordsBamboo charcoal-Nitrogen leaching-Nitrogen retention-Ammonium nitrogen-Adsorption
The effects of fumigation on organic C extractable by 0.5 M K2SO4 were examined in a contrasting range of soils. EC (the difference between organic C extracted by 0.5 M K2SO4 from fumigated and non-fumigated soil) was about 70% of FC (the flush of CO2-C caused by fumigation during a 10 day incubation), meaned for ten soils. There was a close relationship between microbial biomass C, measured by fumigation-incubation (from the relationship Biomass C = FC/0.45) and EC given by the equation: Biomass C = (2.64 ± 0.060) EC that accounted for 99.2% of the variance in the data. This relationship held over a wide range of soil pH (3.9–8.0).ATP and microbial biomass N concentrations were measured in four of the soils. The ratios were very similar in the four soils, suggesting that both ATP and the organic C rendered decomposable by CHCl3 came from the soil microbial biomass. The C:N ratio of the biomass in a strongly acid (pH 4.2) soil was greater (9.4) than in the three less-acid soils (mean C:N ratio 5.1).We propose that the organic C rendered extractable to 0.5 m K2SO4 after a 24 h CHCl3-fumigation (EC) comes from the cells of the microbial biomass and can be used to estimate soil microbial biomass C in both neutral and acid soils.
Bacteria belonging to phylum Gemmatimonadetes comprise approximately 2% of soil bacterial communities. However, little is known of their ecology due to a lack of cultured
representation. Here we present evidence from biogeographical analyses and seasonal quantification of Gemmatimonadetes in soils, which suggests an adaptation to low soil moisture.
Adding biochar to soil has environmental and agricultural potential due to its long-term carbon sequestration capacity and
its ability to improve crop productivity. Recent studies have demonstrated that soil-applied biochar promotes the systemic
resistance of plants to several prominent foliar pathogens. One potential mechanism for this phenomenon is root-associated
microbial elicitors whose presence is somehow augmented in the biochar-amended soils. The objective of this study was to assess
the effect of biochar amendment on the root-associated bacterial community composition of mature sweet pepper (Capsicum annuum L.) plants. Molecular fingerprinting (denaturing gradient gel electrophoresis and terminal restriction fragment length polymorphism)
of 16S rRNA gene fragments showed a clear differentiation between the root-associated bacterial community structures of biochar-amended
and control plants. The pyrosequencing of 16S rRNA amplicons from the rhizoplane of both treatments generated a total of 20,142
sequences, 92 to 95% of which were affiliated with the Proteobacteria, Bacteroidetes, Actinobacteria, and Firmicutes phyla. The relative abundance of members of the Bacteroidetes phylum increased from 12 to 30% as a result of biochar amendment, while that of the Proteobacteria decreased from 71 to 47%. The Bacteroidetes-affiliated Flavobacterium was the strongest biochar-induced genus. The relative abundance of this group increased from 4.2% of total root-associated
operational taxonomic units (OTUs) in control samples to 19.6% in biochar-amended samples. Additional biochar-induced genera
included chitin and cellulose degraders (Chitinophaga and Cellvibrio, respectively) and aromatic compound degraders (Hydrogenophaga and Dechloromonas). We hypothesize that these biochar-augmented genera may be at least partially responsible for the beneficial effect of biochar
amendment on plant growth and viability.
Microbial community composition was examined in two soil types, Anthrosols and adjacent soils, sampled from three locations in the Brazilian Amazon. The Anthrosols, also known as Amazonian dark earths, are highly fertile soils that are a legacy of pre-Columbian settlement. Both Anthrosols and adjacent soils are derived from the same parent material and subject to the same environmental conditions, including rainfall and temperature; however, the Anthrosols contain high levels of charcoal-like black carbon from which they derive their dark color. The Anthrosols typically have higher cation exchange capacity, higher pH, and higher phosphorus and calcium contents. We used culture media prepared from soil extracts to isolate bacteria unique to the two soil types and then sequenced their 16S rRNA genes to determine their phylogenetic placement. Higher numbers of culturable bacteria, by over two orders of magnitude at the deepest sampling depths, were counted in the Anthrosols. Sequences of bacteria isolated on soil extract media yielded five possible new bacterial families. Also, a higher number of families in the bacteria were represented by isolates from the deeper soil depths in the Anthrosols. Higher bacterial populations and a greater diversity of isolates were found in all of the Anthrosols, to a depth of up to 1 m, compared to adjacent soils located within 50-500 m of their associated Anthrosols. Compared to standard culture media, soil extract media revealed diverse soil microbial populations adapted to the unique biochemistry and physiological ecology of these Anthrosols.
We provide a global assessment, with detailed multi-scale data, of the ecological and toxicological effects generated by inorganic nitrogen pollution in aquatic ecosystems. Our synthesis of the published scientific literature shows three major environmental problems: (1) it can increase the concentration of hydrogen ions in freshwater ecosystems without much acid-neutralizing capacity, resulting in acidification of those systems; (2) it can stimulate or enhance the development, maintenance and proliferation of primary producers, resulting in eutrophication of aquatic ecosystems; (3) it can reach toxic levels that impair the ability of aquatic animals to survive, grow and reproduce. Inorganic nitrogen pollution of ground and surface waters can also induce adverse effects on human health and economy.
Estimates of the number of species of bacteria per gram of soil vary between 2000 and 8.3 million (Gans et al., 2005; Schloss and Handelsman, 2006). The highest estimate suggests that the number may be so large as to be impractical to test by amplification and sequencing of the highly conserved 16S rRNA gene from soil DNA (Gans et al., 2005). Here we present the use of high throughput DNA pyrosequencing and statistical inference to assess bacterial diversity in four soils across a large transect of the western hemisphere. The number of bacterial 16S rRNA sequences obtained from each site varied from 26,140 to 53,533. The most abundant bacterial groups in all four soils were the Bacteroidetes, Betaproteobacteria and Alphaproteobacteria. Using three estimators of diversity, the maximum number of unique sequences (operational taxonomic units roughly corresponding to the species level) never exceeded 52,000 in these soils at the lowest level of dissimilarity. Furthermore, the bacterial diversity of the forest soil was phylum rich compared to the agricultural soils, which are species rich but phylum poor. The forest site also showed far less diversity of the Archaea with only 0.009% of all sequences from that site being from this group as opposed to 4%-12% of the sequences from the three agricultural sites. This work is the most comprehensive examination to date of bacterial diversity in soil and suggests that agricultural management of soil may significantly influence the diversity of bacteria and archaea.
We constructed error-correcting DNA barcodes that allow one run of a massively parallel pyrosequencer to process up to 1,544 samples simultaneously. Using these barcodes we processed bacterial 16S rRNA gene sequences representing microbial communities in 286 environmental samples, corrected 92% of sample assignment errors, and thus characterized nearly as many 16S rRNA genes as have been sequenced to date by Sanger sequencing.
Nitrogen leaching from agricultural soils is a major source of pollution for adjacent water systems. Biochar application to agricultural soils was reported to manageably reduce N leaching. For the sustainable use of biochar application, a mechanistic understanding of the changes in N leaching induced by biochar treatment is urgently needed. In this study, the effects of biochar [rice (Oryza sativa L.) chaff] application to rice paddy soil (sandy loam) on leaching and soil structure were investigated. Free-draining lysimeters (0.2 m in diameter by 0.1 m in height) filled with 500 g of air-dried soil were treated with biochar at 0, 2, and 10% application rates (BC0, BC2, and BC10, respectively) and N fertilizer (NH4Cl) at 0 and 100 kg ha(-1) application rates (Fert0 and Fert100, respectively). During the 9-wk incubation, the concentration of dissolved C in the leachates was higher in the soils treated with BC2 and BC10 compared with that treated with BC0 in the Fert0 soil while there were no significant differences among the biochar treatments in the Fert100 soil. This result indicated that the labile portion of the applied biochar C was utilized by microbes as the amended N was metabolized. Nitrate contents in leachates from the BC2 and BC10 treatments were significantly smaller than in those from the BC0 soil. Soil analysis showed that NH4+ content decreased and NO3- content increased under BC10 treatment compared with BC0 treatment in the Fert100 soil, indicating that net N mineralization in the soil was enhanced under biochar treatment. We suggested that the NO3- retention in the biochar-treated soil was related to increased soil aggregation. The C contents in the wet stable aggregates of size 53 to 1000 mm were significantly increased by biochar addition. This size fraction of aggregates is related to soil mesopores, which are involved in the soil's water holding. The water holding capacity (WHC) was higher in the BC2 and BC10 soils than in the BC0 soil, suggesting that application of rice chaff biochar to rice paddy soil could reduce N leaching through the redistribution of soil pores by forming more wet stable aggregates.
Due to its high adsorption capacity, the use of biochar to capture excess nutrients from wastewater has become a central focus in environmental remediation studies. In this study, its potential use in adsorption and removal of ammonium in piggery manure anaerobic digestate slurry was investigated. The adsorbed amount of NH4+-N (mg·g− 1) and removal percentage as a function of adsorbent mass in solution, adsorbent particle size, NH4+-N concentration in the effluent, contact time, pH and temperature were quantified in batch equilibrium and kinetics experiments. The maximum NH4+-N adsorption from slurry at 1400 mg N·L− 1 was 44.64 ± 0.602 mg·g− 1 and 39.8 ± 0.54 mg·g− 1 for wood and rice husk biochar, respectively. For both biochars, adsorption increased with increase in contact time, temperature, pH and NH4+-N concentration but it decreased with increase in biochar particle size. Furthermore, the sorption process was endothermic and followed Langmuir (R2 = 0.995 and 0.998) and Pseudo-second order kinetic models (R2 = 0.998 and 0.999). Based on the removal amounts, we concluded that rice husk and wood biochar have potential to adsorb NH4+-N from piggery manure anaerobic digestate slurry, and thus can be used as nutrient filters prior to discharge into water streams.
Biochar (BC) amendment to soils is a proposed strategy to improve soil fertility and mitigate climate change. However, before this can become a recommended management practice, a better understanding of the impacts of BC on the soil biota is needed. We determined the effect of addition rates (0, 1, 5, 10 and 20% by mass) of a fast-pyrolysis wood-derived BC on the extraction efficiency (EE), abundance and temporal dynamics of phospholipid fatty acids (PLFAs, microbial community biomarkers) in four temperate soils during a 1-year incubation. Additionally, the effects on microbial mineralization/incorporation of BC-C were determined by measuring CO2 efflux and the BC contribution to CO2 and PLFA-C using the natural 13C abundance difference between BC and soils. Biochar addition proportionally increased microbial abundance in all soils and altered the community composition, particularly at the greatest addition rate, towards a more gram-negative bacteria-dominated (relative to fungi and gram-positive) community. Though chemically recalcitrant, the BC served as a substrate for microbial activity, more so at large addition rates and in soil with little organic matter. Microbial utilization of BC-C for growth could only partially explain the observed increase in microbial biomass, suggesting that other, potentially abiotic, mechanisms were involved. The strong decrease in PLFA EE (−77%) in all soils with biochar addition emphasizes the need to measure and correct for EE when using PLFA biomarkers to estimate soil microbial responses to BC additions. Overall, our study provides support for BC use as a soil amendment that potentially stimulates microbial activity and growth.
Biochar has shown potential in reducing inorganic nitrogen (N) leaching losses from inorganic and organic fertilizer sources in coarse-textured soils. Little information, however, is available on the effect of biochar on the availability of the retained inorganic N in biochar-amended sandy soil. The objective of our study was to determine the potential of pine wood biochar to reduce the leaching of ammonium nitrate fertilizer (100 kg N ha−1) from sandy soil (W. Cape, South Africa) and to quantify the exchangeable inorganic N (2 m KCl) remaining after intensive leaching. Laboratory columns containing sandy soil and biochar (0, 0.5, 2.5 and 10.0% w/w) were leached weekly over a period of six weeks simulating heavy winter rainfall. Biochar (0.5, 2.5 and 10.0% w/w) significantly reduced the cumulative amount of ammonium (12, 50 and 86%, respectively) and nitrate (26, 42 and 96%, respectively) leached relative to the control soil. Despite the observed strong reduction in inorganic N leaching, the leached biochar-amended soils contained only small amounts of exchangeable ammonium (0–7.3 mg kg−1) and nitrate (5.8–8.0 mg kg−1). The results show that pine wood biochar can strongly reduce not only the amount of ammonium and nitrate leached from sandy soils, but also the amount of recoverable exchangeable ammonium and nitrate after leaching. Furthermore, the 2.5 and 10.0% biochar application rates led to over-liming. This raises some concerns as to the practical use of biochar in improving N fertilizer-use efficiency of plants.