ThesisPDF Available

Reishi (Ganoderma lucidum) effects in patients with fibromyalgia.

Authors:

Abstract and Figures

Fibromyalgia is a chronic syndrome of unknown etiology characterized by widespread musculoskeletal pain which affects between 2% and 5% of the world population. The main symptoms are fatigue, decreased physical fitness, poor sleep and depression, among many others. Likewise, patients with fibromyalgia often suffer obesity problems, that represent a risk factor for the onset of other cardiovascular problems as hypertension and type 2 diabetes. These symptoms can lead to decreased Health Related Quality of Life and a high level of impediment. To date, it has not been identified an effective treatment for this syndrome yet. The best therapeutic strategy involves a multidisciplinary approach based on drug treatment, physical activity and psychological therapy. Recent studies have also started to assess functional food in order to complement the actual therapy. Reishi is the common name of a mushroom produced by the fungus called Ganoderma lucidum (Curt .: Fr.) P. Karst. This mushroom has proven to be useful to improve the quality and quantity of sleep, raise the defense levels of the organism, reduce cholesterol, triglycerides, glucose, weight and blood pressure and, finally, increase physical performance. To date, to our knowledge, there are no studies aimed to assess the effect of reishi on the fibromyalgic population. The main objective of the study was to evaluate the effects of 6 grams of micro-milled Ganoderma lucidum powder administered by oral route on the following variables: pain, quality of sleep and the inability of patients with fibromyalgia. Secondly, we have evaluated the effects of 6 grams of micro-milled Ganoderma lucidum powder in comparison with 6 grams of Carob (Ceratonia siliqua) flour on the following variables: happiness, depression, health related quality of life, perception of improvement, fitness, blood glucose, cholesterol and triglycerides, blood pressure and body composition. Seventy fibromyalgic patients were included in a randomized clinical trial with an experimental group and an active placebo group for the pain and sleep variables. The experimental group toke 2 doses of 3 grams of reishi daily, one at breakfast and another at dinner, for 42 days. The active placebo group toke the same dose of carob flour. Results showed that 6 daily grams of reishi decrease the impact of fibromyalgia and improve the following variables: sleep quality, happiness, perception of global clinical improvement, aerobic endurance, speed and flexibility of the lower limb. In addition, reishi may lower pain level. In conclusion, this study open a new line of investigation for the fibromyalgia treatment, since the intake of reishi could complement the actual strategy to combat the symptoms of fibromyalgia. Keywords: Fibromyalgia; Pain; Ganoderma lucidum; Ceratonia siliqua; Alternative medicine; Functional food.
Content may be subject to copyright.
TESIS DOCTORAL
Efectos del reishi (Ganoderma lucidum) en
pacientes con fibromialgia
Autor: D. Francesco Pazzi
Departamento de Didáctica de la Expresión Musical, Plástica y Corporal
2015
Citar como: Pazzi F. (2016). Efectos del reishi (Ganoderma lucidum) en
pacientes con fibromialgia. Tesis doctoral. Universidad de Extremadura.
Disponible en: Dehesa, Repositorio Institucional, Universidad de Extremadura.
Identifier: http://hdl.handle.net/10662/3913.
TESIS DOCTORAL
Titulo: Efectos del reishi (Ganoderma lucidum) en pacientes con fibromialgia.
Autor: D. Francesco Pazzi.
Departamento de Didáctica de la Expresión Musical, Plástica y Corporal.
Conformidad del Director: Dr. D. JOSÉ CARMELO ADSUAR SALA, profesor
del Área de Educación Física y Deportiva del departamento de Didáctica de la
Expresión Musical, Plástica y Corporal de la Universidad de Extremadura,
CERTIFICA:
Que la Tesis Doctoral realizada por D. Francesco Pazzi, con el título: Efectos
del reishi (Ganoderma lucidum) en pacientes con fibromialgia, bajo mi
dirección, reúne los requisitos necesarios de calidad, originalidad y presentación
para optar al grado de Doctor, y está en condiciones de ser sometida a valoración
de la Comisión encargada de juzgarla.
Y para que conste a los efectos oportunos, firmo la presente en Cáceres, a 23 de
Octubre de 2015.
Dr. D. JOSÉ CARMELO ADSUAR SALA
2015
MÉRITOS CIENTÍFICOS DE ESTA TESIS DOCTORAL
La producción científica relacionada con la presente tesis doctoral es:
- Collado-Mateo D., Pazzi F., Dominguez-Muñoz F.J., Martin-Martinez J.P.,
Olivares P.R., Adsuar J.C., Gusi N. (2015). El Ganoderma lucidum mejora la
condición física en mujeres con fibromialgia. Nutrición Hospitalaria 32(5).
DOI: http://dx.doi.org/10.3305%2Fnh.2015.32.5.9601
- Collado-Mateo D., Dominguez-Muñoz F.J., Pazzi F., Garcia-Gordillo M.A.,
Olivares P.R., Gusi N., Adsuar J.C. Effects of Ganoderma lucidum on pain in
women with fibromyalgia. Enviado para su publicación.
- Pazzi F., Collado-Mateo D., Dominguez-Muñoz F.J., Garcia-Gordillo M.A.,
Olivares P.R., Oria de Rueda J.A., Gusi N., Adsuar J.C. Ganoderma lucidum
improves happiness in patients with fibromyalgia. Enviado para su
publicación.
Collado-Mateo D., Pazzi F., Dominguez-Muñoz F.J., Garcia-Gordillo M.A.,
Olivares P.R., Oria de Rueda J.A., Gusi N., Adsuar J.C. Effects of Ganoderma
lucidum and Ceratonia siliqua on blood glucose, lipid profile and body
composition in women with fibromyalgia. Enviado para su publicación.
Comunicaciones a Congresos
Adsuar J.C., Parraca J.A., Collado D., Pazzi F., Domínguez F.J., Garcia-Gordillo
M., Gusi N., Martinez J., Sousa A. Efectos del reishi (Ganoderma lucidum y de
la harina de algarrobo (Ceratonia siliqua) en la condición física de mujeres
con fibromialgia. I Jornadas Internacionais: Exercício Físico e Terapêuticas
Complementares nas Doenças Reumatológicas. Instituto Superior de Ciências
Educativas (ISCE). Odivelas, 15-16 mayo 2015.
Parraca J.A., Adsuar J.C., Pazzi F., Collado D., Domínguez F.J., Garcia-Gordillo
M., Gusi N., Martinez J., Barroso M., Marques I.F. Efectos del reishi
(Ganoderma lucidum y de la harina de algarrobo (Ceratonia siliqua) en la
felicidad de mujeres con fibromialgia. I Jornadas Internacionais: Exercício
Físico e Terapêuticas Complementares nas Doenças Reumatológicas. Instituto
Superior de Ciências Educativas (ISCE). Odivelas, 15-16 mayo 2015.
Collado D., Adsuar J.C., Pazzi F., Domínguez F.J. Los efectos del reishi en
pacientes con fibromialgia. Jornada de Fibromialgia y Síndrome de Fatiga
Crónica. Federación de Fibromialgia y Fatiga Crónica de Castilla y León
(FFISCYL). León, 9 mayo 2015.
Pazzi F. Ganoderma lucidum y fibromialgia. Primera Jornada Sobre Medicina
Alternativa y Fibromialgia. Asociación de Fibromialgia y Síndrome de Fatiga
Crónica de Salamanca (AFIBROSAL). Salamanca, 1 marzo 2015.
Collado D., Adsuar J.C., Pazzi F., Domínguez F.J. Efectos de 6 gramos de
Ganoderma lucidum en pacientes con fibromialgia. Jornada sobre
Fibromialgia, Fatiga Crónica y Reishi. Asociación de Fibromialgia y Fatiga
Crónica. Afectado en CYL (AFACYL). Palencia, 28 febrero 2015.
Pazzi F., Collado D., Oria de Rueda J.A., Adsuar J.C., Domínguez F.J., Garcia-
Gordillo M., Mendoza M., Hernández-Mocholi M., Olivares P.R., Gusi N.
Seguridad y coste-efectividad del reishi en pacientes con fibromialgia. 8º
Congreso Europeo de Pacientes, Innovación y Tecnología. Instituto Europeo de
Salud y Bienestar Social. Madrid, 18-19 noviembre 2014.
Mendoza M., Pazzi F., Collado D., Oria de Rueda J.A., Adsuar J.C., Domínguez
F.J., Garcia-Gordillo M., Hernández-Mocholi M., Olivares P.R., Gusi N.
Relación entre el nivel de conocimiento de la fibromialgia, nivel de
incapacidad y los síntomas depresivos. 8º Congreso Europeo de Pacientes,
Innovación y Tecnología. Instituto Europeo de Salud y Bienestar Social. Madrid,
18-19 noviembre 2014.
Pazzi F. Aplicaciones de los alimentos funcionales para la salud humana:
seguridad y coste-efectividad del reishi (setas de Ganoderma lucidum) en
paciente con fibromialgia. XXV Jornadas Micológicas Forestales, 2014. Las
setas saludables, tesoro para nuestra naturaleza. Cátedra de Micología.
Universidad de Valladolid. Palencia, 10-16 noviembre 2014.
Estancias de investigación
Estancia de Investigación en Chimete Srl, laboratorio de investigación y
desarrollo en el sector de la síntesis químico-orgánica.
Rivalta Scrivia. Tortona (AL). Italia.
Fecha: desde el 01/06/2015 al 11/09/2015
Estancia de Investigación en la Cátedra de Micología, ETSIIAA. Campus
Palencia. Universidad de Valladolid. España.
Fecha: desde el 01/10/2014 al 31/03/2015
A Laura, pasado, presente y futuro…….
A todas las mujeres que padecen fibromialgia,
para que encuentren un remedio para sus dolores.......
La preocupación lleva al esfuerzo y el esfuerzo puede llevar al éxito……..en todo
caso acuérdate que nuestra recompensa se encuentra en el esfuerzo y no en el
resultado. Un esfuerzo total es una victoria completa.
J.C. Adsuar & Mahatma Gandhi
INDICE
INDICE DE TABLAS ............................................................................................ 1
INDICE DE FIGURAS ........................................................................................... 3
LISTA DE ABREVIATURAS ............................................................................... 4
RESUMEN .............................................................................................................. 5
ABSTRACT ............................................................................................................ 7
RIASSUNTO .......................................................................................................... 9
INTRODUCCIÓN ................................................................................................ 11
1. La fibromialgia .................................................................................................. 11
1.1. Posibles causas y síntomas ......................................................................... 15
2. El género Ganoderma ....................................................................................... 19
3. Reishi y fibromialgia ......................................................................................... 24
3.1 Reishi y dolor .............................................................................................. 26
3.2 Reishi y sueño ............................................................................................. 29
3.3 Reishi e incapacidad de pacientes con FM ................................................. 31
4. Otras propiedades del reishi .............................................................................. 32
4.1 Efectos protectores ...................................................................................... 32
4.2 Reishi y enfermedades ................................................................................ 33
4.3 Reishi y cáncer ............................................................................................ 33
5. Las moléculas bioactivas................................................................................... 33
6. Posología y contraindicaciones ......................................................................... 36
OBJETIVOS ......................................................................................................... 38
HIPÓTESIS ........................................................................................................... 40
MATERIAL Y MÉTODOS .................................................................................. 42
1. Diseño del estudio ............................................................................................. 42
2. Participantes ...................................................................................................... 42
2.1 Criterios de inclusión .................................................................................. 42
2.2 Cálculo de la muestra .................................................................................. 43
2.3 Lugar de obtención de la muestra y medición de datos .............................. 43
2.4 Características de la muestra y tipología de intervención ........................... 43
2.5 El placebo activo ......................................................................................... 45
3. Medidas principales y secundarias .................................................................... 50
3.1 Medidas principales .................................................................................... 50
3.2 Medidas secundarias ................................................................................... 51
3.3 Medidas de seguridad .................................................................................. 56
4. Método estadístico utilizado ............................................................................. 58
5. Aspectos éticos .................................................................................................. 59
RESULTS ............................................................................................................. 60
1. Safety and effects of G. lucidum on pain, sleep and impact on fibromyalgia... 60
2. Effects of G. lucidum on happiness, depression, HRQoL and global
improvement ......................................................................................................... 70
3. Effects of G. lucidum on physical fitness.......................................................... 74
4. Effects of G. lucidum on blood glucose, lipid profile and body composition .. 80
DISCUSSION ....................................................................................................... 84
1. Safety and effects of G. lucidum on pain, sleep and impact on fibromyalgia... 84
2. Effects of G. lucidum on happiness, depression, HRQoL and global
improvement ......................................................................................................... 86
3. Effects of G. lucidum on physical fitness.......................................................... 89
4. Effects of G. lucidum on blood glucose, lipid profile and body composition .. 90
5. Limitations ........................................................................................................ 91
CONCLUSIONES ................................................................................................ 92
CONCLUSION ..................................................................................................... 95
CONCLUSIONI .................................................................................................... 97
BIBLIOGRAFIA................................................................................................. 103
1
INDICE DE TABLAS
Tabla 1. Efectos terapéuticos y moléculas bioactivas del G. lucidum ................. 35
Tabla 2. Clasificación taxonómica del G. lucidum .............................................. 46
Tabla 3. Valor nutricional (por 100g) del G. lucidum utilizado en el estudio ..... 47
Tabla 4. Características organolépticas del G. lucidum utilizado en el estudio ... 47
Tabla 5. Características físicas del G. lucidum utilizado en el estudio ................ 47
Tabla 6. Características microbiológicas del G. lucidum utilizado en el estudio. 48
Tabla 7. Características genéticas del G. lucidum utilizado en el estudio ........... 48
Tabla 8. Clasificación taxonómica de la Ceratonia siliqua ................................. 49
Tabla 9. Valor nutricional (por 100g) de la Ceratonia siliqua............................. 49
Tabla 10. Herramientas y cronograma de las medidas de la presente tesis ......... 57
Table 11: Symptoms of participants who did not complete the minimum 80% of
the treatment .......................................................................................................... 60
Table 12. Characteristics of women with FM from both groups at baseline ....... 62
Table 13. Effects of 6 weeks of treatment on pain, impact of fibromyalgia and
HRQoL. Efficacy analysis .................................................................................... 64
Table 14. Effects of 6 weeks of treatment on pain, impact of fibromyalgia and
HRQoL. Intent-to-treat analysis ............................................................................ 69
Table 15. Effects of 6-week treatment with G. lucidum or C. siliqua on happiness,
depression, satisfaction with life and GIIS in women with fibromyalgia ............. 71
2
Table 16. Effects of 6-week treatment with Ganoderma lucidum or Ceratonia
siliqua on HRQoL in women with fibromyalgia. Efficacy analysis ..................... 72
Table 17. Effects of 6-week treatment with Ganoderma lucidum or Ceratonia
siliqua on HRQoL in women with fibromyalgia. Intent-to-treat analysis ............ 73
Table 18. Effects of 6-week treatment with G. lucidum or C. siliqua on physical
conditioning. Efficacy analysis ............................................................................. 76
Table 19. Effects of 6-week treatment with G. lucidum or C. siliqua on physical
conditioning. Intent-to-treat analysis .................................................................... 78
Table 20. Effects of 6-week treatment with G. lucidum or C. siliqua on blood
glucose, lipid profile and body composition. Intra-group analysis ....................... 82
Table 21. Effects of 6-week treatment with G. lucidum or C. siliqua on blood
glucose, lipid profile and body composition. Between-group analysis ................ 83
3
INDICE DE FIGURAS
Figura 1. Nuevos criterios de diagnóstico de la fibromialgia del 2010. .............. 14
Figura 2. Forma de cultivo y detalles macroscópicos del reishi. ......................... 20
Figura 3. Detalles microscópicos del reishi. ........................................................ 20
Figura 4. Variabilidad morfológica del G. lucidum encontrada en varias
colecciones Chinas. ............................................................................................... 22
Figura 5. Varias especies de Ganoderma en comercio. ....................................... 24
Figure 6. Flow diagram of participants. ............................................................... 61
Figure 7. Pain reported every day at morning by the 2 groups. ........................... 65
Figure 8. Fibromyalgia Impact Questionnaire (FIQ) profile for G. lucidum Group
(GLG; n=26) and C. siliqua Group (CSG; n=24) at baseline and after treatment. 66
Figure 9. 15D profile for G. lucidum Group (GLG; n=26) and C. siliqua Group
(CSG; n=24) at baseline and after treatment. ........................................................ 67
Figure 10. Flow diagram of participants for the physical fitness test. ................. 74
Figure 11. Flow diagram of participants for body composition. .......................... 80
4
LISTA DE ABREVIATURAS
ACR American College of Rheumatology
ADN Ácido Desoxirribonucleico
AMPK AMP-activated Protein Kinase
ANOVA Analysis of Variance
ANZCTR Australian New Zealand Clinical Trials Registry
BDI Beck’s Depression Inventory
CGRP Calcitonin Gene Related Peptide
CIF Cuestionario de Impacto de la Fibromialgia
CIFR Cuestionario de Impacto de la Fibromialgia Revisado
CS Ceratonia siliqua
CSG Ceratonia Siliqua Group
CVRS Calidad de Vida Relacionada con la Salud
ELISA Enzyme-Linked Immuno Sorbent Assay
FIQ Fibromyalgia Impact Questionnaire
FM Fibromialgia; Fibromyalgia
GDS Geriatric Depression Scale
GHS General Happiness Scale
GIIS Global Impression of Improvement Scale
GL Ganoderma lucidum
GLG Ganoderma Lucidum Group
HPLC High-Performance Liquid Chromatography
HRQoL Health-Related Quality of Life
ITS Internal Transcribed Spacer
No-REM Non Rapid Eye Movement
PCR Polymerase Chain Reaction
PET Polyethylene Terephtalate
PI3K Phosphoinositide 3-Kinase
REM Rapid Eye Movement
SLS Satisfaction with Life Scale
SNC Sistema Nervioso Central
SSC Síndrome de Sensibilidad Central
SNP Sistema Nervioso Periférico
TFN Tumor Necrosis Factor
VAS Visual Analogue Scale
WHR Waist-Hip Ratio
5
RESUMEN
La fibromialgia es un síndrome crónico de etiología desconocida que se
caracteriza por dolor musculo-esquelético generalizado que afecta entre el 2% y el
5% de la población mundial. Los síntomas principales de la fibromialgia son
fatiga, disminución de la condición física, sueño no reparador y depresión, entre
otros muchos. Así mismo, los pacientes con fibromialgia suelen tener problemas
de obesidad, siendo esto a su vez un factor de riesgo para sufrir varios problemas
cardiovasculares como hipertensión y mayor probabilidad de sufrir diabetes tipo
2. Estos síntomas pueden conllevar la disminución de la Calidad de Vida
Relacionada con la Salud y un nivel elevado de incapacidad.
A día de hoy aún no ha sido identificada una terapia estándar eficaz para
este síndrome. La mejor estrategia de tratamiento hasta la fecha ha sido una
terapia de carácter multidisciplinar basada en el tratamiento farmacológico, la
actividad física y la terapia psicológica. En los últimos años se ha empezado
también a evaluar la funcionalidad de ciertos alimentos con el objetivo de
complementar las actuales estrategias de lucha contra la fibromialgia.
Reishi es el nombre común de la seta producida por el hongo denominado
Ganoderma lucidum (Curt.: Fr.) P. Karst. Esta seta ha demostrado ser útil para
mejorar la calidad y cantidad de horas de sueño, elevar los niveles de defensas,
disminuir el peso, los niveles de colesterol, los niveles de triglicéridos, la tensión
arterial, los valores de glucosa y aumentar el rendimiento físico. Hasta la fecha,
según nuestro conocimiento, no ha sido realizado ningún estudio que evalúe los
efectos del reishi en personas con fibromialgia.
El objetivo principal del estudio ha sido evaluar la seguridad y los efectos
de 6 gramos de polvo micromolido de reishi suministrado por vía oral sobre las
6
siguientes variables: dolor, calidad del sueño e incapacidad de las pacientes con
fibromialgia. Secundariamente, se han evaluado los efectos de 6 gramos de polvo
micromolido de reishi en comparación con 6 gramos de harina de algarrobo
(Ceratonia siliqua) sobre las siguientes variables: felicidad, depresión, calidad de
vida relacionada con la salud, percepción de mejora, condición física, niveles de
glucosa, colesterol, triglicéridos en sangre, tensión arterial y composición
corporal.
Setenta personas con fibromialgia fueron reclutadas y sometidas a un
ensayo clínico aleatorizado con un grupo experimental y un grupo con placebo
activo para las variables dolor y sueño. Al grupo experimental se le suministró 2
dosis de 3 gramos de reishi al día, una durante el desayuno y la otra durante la
cena, durante 42 días. Al grupo con placebo activo se le suministró la misma dosis
de harina de algarrobo.
Los resultados han mostrado que 6 gramos de reishi al día disminuyen la
incapacidad provocada por la fibromialgia y mejoran las siguientes variables:
calidad del sueño, felicidad, percepción de mejora clínica global, resistencia
aeróbica, velocidad y flexibilidad de los miembros inferiores. Además, el reishi
podría también disminuir el grado de dolor de las personas con fibromialgia.
En conclusión, con este estudio se abre una nueva línea de investigación
en el tratamiento no farmacológico de la fibromialgia, ya que la ingesta de reishi
podría ser útil para luchar contra algunos de los síntomas de la fibromialgia,
pudiendo complementar las estrategias de lucha contra este síndrome.
Palabras clave: Fibromialgia; Dolor; Ganoderma lucidum; Ceratonia siliqua,
Medicina alternativa; Alimentos funcionales.
7
ABSTRACT
Fibromyalgia is a chronic syndrome of unknown etiology characterized by
widespread musculoskeletal pain which affects between 2% and 5% of the world
population. The main symptoms are fatigue, decreased physical fitness, poor sleep
and depression, among many others. Likewise, patients with fibromyalgia often
suffer obesity problems, that represent a risk factor for the onset of other
cardiovascular problems as hypertension and type 2 diabetes. These symptoms
can lead to decreased Health Related Quality of Life and a high level of
impediment.
To date, it has not been identified an effective treatment for this syndrome yet.
The best therapeutic strategy involves a multidisciplinary approach based on drug
treatment, physical activity and psychological therapy. Recent studies have also
started to assess functional food in order to complement the actual therapy.
Reishi is the common name of a mushroom produced by the fungus called
Ganoderma lucidum (Curt .: Fr.) P. Karst. This mushroom has proven to be useful
to improve the quality and quantity of sleep, raise the defense levels of the
organism, reduce cholesterol, triglycerides, glucose, weight and blood pressure
and, finally, increase physical performance. To date, to our knowledge, there are
no studies aimed to assess the effect of reishi on the fibromyalgic population.
The main objective of the study was to evaluate the effects of 6 grams of micro-
milled Ganoderma lucidum powder administered by oral route on the following
variables: pain, quality of sleep and the inability of patients with fibromyalgia.
Secondly, we have evaluated the effects of 6 grams of micro-milled Ganoderma
lucidum powder in comparison with 6 grams of Carob (Ceratonia siliqua) flour on
8
the following variables: happiness, depression, health related quality of life,
perception of improvement, fitness, blood glucose, cholesterol and triglycerides,
blood pressure and body composition.
Seventy fibromyalgic patients were included in a randomized clinical trial with an
experimental group and an active placebo group for the pain and sleep variables.
The experimental group toke 2 doses of 3 grams of reishi daily, one at breakfast
and another at dinner, for 42 days. The active placebo group toke the same dose of
carob flour.
Results showed that 6 daily grams of reishi decrease the impact of fibromyalgia
and improve the following variables: sleep quality, happiness, perception of
global clinical improvement, aerobic endurance, speed and flexibility of the lower
limb. In addition, reishi may lower pain level.
In conclusion, this study open a new line of investigation for the fibromyalgia
treatment, since the intake of reishi could complement the actual strategy to
combat the symptoms of fibromyalgia.
Keywords: Fibromyalgia; Pain; Ganoderma lucidum; Ceratonia siliqua;
Alternative medicine; Functional food.
9
RIASSUNTO
La fibromialgia è un sindrome cronico che provoca dolore muscolo-
scheletrico diffuso e generalizzato, le cui cause sono ad oggi ancora sconosciute.
Si stima che tra il 2 e il 5% della popolazione mondiale sia affetto dal
sindrome. I principali sintomi della malattia sono: fatica, diminuzione delle
capacità fisico-motorie, alterazioni del sonno e stadi depressivi. Inoltre, la
fibromialgia è spesso associate a problemi di obesità che a loro volta possono
causare gravi affezioni cardiovascolari come ipertensione e diabete tipo 2. Tutti
questi sintomi possono anche causare la diminuzione della qualità di vita associata
alla salute e provocare livelli elevati di incapacità psico-fisica.
Al giorno d’oggi non esiste ancora nessun trattamento efficace contro la
malattia. La strategia di lotta attuale prevede un approccio multidisciplinare basato
sull’utilizzo di farmaci, dell’attività fisica e della terapia psicologica.
Recentemente si è iniziato anche a studiare l’effetto degli alimenti funzionali con
il fine di complementare le attuali strategie di lotta contro i sintomi del sindrome.
Reishi è il nome comune del fungo appartenente alla specie Ganoderma
lucidum (Curt .: Fr.) P. Karst. Diversi studi scientifici hanno dimostrato che
questo fungo può migliorare la quantità e qualità del sonno, aumentare le difese
dell’organismo, ridurre i livelli di colesterolo, trigliceridi e glucosio nel sangue, il
peso corporale e la pressione sanguinea, e incrementare le performance fisiche.
Nonostante tutti i potenziali benefici del fungo verso le persone affette dal
sindrome, in base alle nostre conoscenze, non sono mai stati condotti studi per
valutare gli effetti del Ganoderma lucidum in pazienti con fibromialgia.
10
L’obiettivo principale di questa tesi è stato quello di valutare gli effetti
derivanti dall’ingestione giornaliera di 6 grammi di reishi amministrati per via
orale sul grado di dolore, la qualità del sonno e l’incapacità delle persone affette
da fibromialgia. Secondariamente sono stati valutati gli effetti di 6 grammi di
reishi in comparazione con 6 grammi di farina di carrubo (Ceratonia siliqua) sulle
seguenti variabili: felicità, depressione, qualità di vita relativa alla salute,
percezione di miglioramento globale, condizione fisica, livelli di glucosio,
colesterolo e trigliceridi nel sangue, composizione corporea e pressione
sanguinea.
Settanta pazienti affetti da fibromialgia sono stati sottomessi a uno studio
clinico randomizzato con gruppo sperimentale e gruppo placebo attivo per le
variabili dolore e sonno. Al gruppo sperimentale sono stati somministrati per via
orale 2 dosi al giorno di 3 grammi di reishi, una a colazione e un’altra a cena,
durante 42 giorni. Al gruppo placebo, invece, sono state somministrate le stessi
dosi di farina di carrubo.
I risultati hanno mostrato che 6 grammi al giorno di reishi possono aiutare
a combattere i sintomi della fibromialgia, visto che sono in grado di diminuire
l’impatto della fibromialgia e migliorare la qualità del sonno, la felicità, la
percezione di miglioramento globale, la resistenza aerobica, la velocità e la
flessibilità degli arti inferiori. Inoltre, il consumo di reishi potrebbe diminuire il
grado di dolore delle persone affette da fibromialgia.
In conclusione, questo studio apre una nuova linea di ricerca per il
trattamento della fibromialgia, visto che il consumo di reishi può essere utile per
integrare le attuali strategie di lotta contro alcuni dei suoi principali sintomi.
Parole chiave: Fibromialgia; Dolore; Ganoderma lucidum; Ceratonia siliqua,
Medicina alternativa; Alimenti funzionali.
11
INTRODUCCIÓN
1. La fibromialgia
La fibromialgia (FM) es un síndrome crónico de etiología desconocida que
se caracteriza por dolor musculo-esquelético generalizado, rigidez y sensibilidad a
la palpación en los puntos gatillos. El síndrome se manifiesta con una gran
variedad de síntomas, entre los cuales destacan: la fatiga persistente, el sueño no
reparador, la rigidez generalizada y los síntomas ansioso-depresivos. Se ha
estimado que aproximadamente entre un 2-5% de la población mundial padece
esta enfermedad. En España y en los países de la unión Europea se estima que
entre un 2,9-4,7% de la población padece FM [1].
El nombre deriva de la palabra latina "fibro" que significa (tejido fibroso)
y de las palabras griega "mio", que significa músculo o muscular y "algos", que
significa dolor. Gower fue el primero en utilizar el término “fibrositis” para
describir aquella inflamación que provocaba dolor muscular [2]. También Traut
utilizó el término “fibrositis” para describir el dolor musculo-esquelético
asociados a fatiga, sueño no reparador y sensibilidad en los puntos gatillos [3]. El
primer estudio clínico que tuvo también el mérito de llevar a la luz el problema
fue publicado por Yunus et al. [4]. En este estudio se demostró que los pacientes
que sufrían FM padecían s síntomas múltiples con respecto a los grupos de
control (dividido por edad, sexo y raza), entre los cuales se encontraban los
siguientes: dolor, sueño no reparador, cansancio, parestesia, síndrome del
intestino irritable, migrañas, y mayor sensibilidad en los puntos gatillos. Hench y
Mitler utilizaron por primera vez el término fibromialgia en el 1976 para
resaltar la existencia de fenómenos dolorosos musculares y la ausencia de signos
inflamatorios, con lo que se abandonó el término de fibrositis utilizado hasta
12
entonces [5, 6]. La existencia del síndrome fue definitivamente validada por el
estudio multicéntrico refrendado por el American College of Rheumatology
(ACR), donde se definieron los primeros criterios de diagnóstico que aún
permanecen vigentes. En 1992, en la Declaración de Copenhague [7], la FM fue
reconocida por la Organización Mundial de la Salud tipificándola con el código
M79.0 en el manual de Clasificación Internacional de Enfermedades (ICD-10) [8].
En 1994 la FM fue reconocida por la Asociación Internacional para el Estudio del
Dolor clasificándola con el código X33.X8a [9].
En el contexto nacional español, se publicó en el 2002 el primer
documento de consenso sobre el diagnóstico y tratamiento de la FM [10], en el
cual se define la FM como: “un estado doloroso generalizado no articular, que
afecta principalmente a las zonas musculares y raquis, y que presenta una
exagerada sensibilidad en múltiples puntos predefinidos”. Posteriormente, en el
2004, el Ministerio de Sanidad y Consumo publicó un documento de consenso
[12] en el que se marcan las directrices para:
- el correcto diagnóstico de la FM;
- el estudio de su impacto vital, familiar, laboral y sobre el sistema sanitario;
- las estrategias terapéuticas a utilizar.
En España, actualmente, a los afectados por FM se les puede reconocer:
- la incapacidad temporal, por el médico facultativo;
- la incapacidad permanente de diversos grados, cuyo reconocimiento compete al
director de la delegación provincial competente del Instituto Nacional de la
Seguridad Social.
Según los criterios del ACR del 1990 el síndrome se diagnostica en
presencia de dolor difuso de más de 3 meses de evolución y sensibilidad al dolor
13
aumentada a la palpación digital en al menos 11 de 18 localizaciones anatómicas
propuestas [11]. La presión digital debe ejercerse con una fuerza aproximada de 4
kg/cm2. En base a estos criterios se ha estimado que 9 de cada 10 personas que
padecen FM son mujeres. En el 2010 el ACR ha propuesto unos nuevos criterios
de diagnóstico [12] que fueron sucesivamente modificados en el 2011 [13]. Si los
criterios del 1990 se basaban exclusivamente en el dolor, estos nuevos criterios se
centran también en la evaluación sistémica de los síntomas (figura 1). Teniendo
en cuenta los criterios del 2010 la prevalencia del síndrome entre mujeres y
hombres alcanza un equivalencia de 2:1 con respecto a los 9:1 anteriores [14].
14
Figura 1. Nuevos criterios de diagnóstico de la fibromialgia del 2010 [15]
1
.
1
Permiso otorgado por Elsevier Limited el 02 de octubre de 2015.
15
Un estudio estadounidense ha estimado que los costes directos de un
paciente que padece de FM grave pueden suponer un coste sanitario trimestral
extra de 2.329 dólares, mientras que los costes indirectos pueden llegar a los 8.285
dólares [16], por un total trimestral de 10.614 dólares que corresponden a 42.456
dólares anuales. Otro investigación hecha en España ha estimado que la FM
supone un coste sanitario extra de 5.010 euros/año por paciente [17].
Todavía no existe un tratamiento universalmente aceptado para la
reducción de los síntomas; la terapia que se ha visto más eficaz hasta la fecha
utiliza un enfoque interdisciplinario basado en la educación del paciente, el
ejercicio, las terapias conductuales y el consumo de ciertos fármacos como:
antidepresivos, inhibidores selectivos de la recaptación de neurotransmisores,
antidepresivos, antiinflamatorios, antiepilépticos, y relajantes musculares [18].
De esta breve introducción se puede ver que la FM representa un problema
sanitario con implicaciones socio-económicas muy relevantes que, actualmente, se
recomienda tratar a través de una estrategia multidisciplinar. En este sentido es
importante seguir investigando para buscar mejores estrategias de lucha contra
este síndrome.
1.1. Posibles causas y síntomas
Como ya se ha adelantado, para poder comprender mejor esta
investigación es necesario hacer un resumen sobre las posibles causas de la FM y
de sus síntomas.
A día de hoy la hipótesis más aceptada es considerar la FM un Síndrome
de Sensibilidad Central (SSC) [15]. En el 1994, por primera vez, Yunus engloba
en el SSC distintos procesos con características comunes [19]. Todos ellos eran de
causa desconocida, tenían una fisiopatología semejante y unos síntomas comunes.
16
Dentro de los SSC se incluyeron: la migraña o la cefalea tensional, el síndrome de
colon irritable, el síndrome de fatiga crónica, el síndrome de piernas inquietas y
los movimientos paradójicos de miembros inferiores, el síndrome de la
articulación témporo-mandibular, el síndrome químico múltiple, el síndrome
uretral femenino, la cistitis intersticial, la dismenorrea primaria, el dolor pélvico
crónico, el trastorno por estrés postraumático y la depresión [20]. Todas estas
compartían una serie de síntomas generales y crónicos: fatiga, alteraciones
cognitivas importantes (falta de concentración, memoria y lentitud mental),
infecciones, alteraciones gastro-intestinales, hipersensibilidad química, dolor y
alteraciones en el sueño. Estas manifestaciones eran también más frecuentes en
mujeres que en hombres y no se objetivaba patología estructural que las
justificara. En general, en los SSC existe una hiper-excitabilidad de las neuronas
del sistema nervioso central a los distintos estímulos periféricos como: dolor, olor,
ruidos, alimentos, productos químicos, campos electromagnéticos, cambios de
tiempo, estrés, infecciones, uso de fármacos, etc., que provoca una hiper-respuesta
a éstos, y que se mantiene en el tiempo a pesar de la desaparición del estímulo.
La FM ha sido clasificada como primaria y concomitante [21]. Se define
primaria cuando no hay otras manifestaciones que pueden haber contribuido a la
aparición del dolor. Mientras que se define concomitante cuando están presentes
otras condiciones médicas debilitantes que conjuntamente a la FM son las
responsables de causar el dolor o la fatiga, como por ejemplo: osteoartritis, artritis
reumatoide, lupus eritematoso o hipotiroidismo. No existen diferencias especificas
entre la FM primaria y secundaria. Se considera que el término “FM secundaria”
no se debería utilizar y se recomienda el uso del término “FM concomitante” [22].
17
Existen tres hipótesis sobre los mecanismos concomitantes que pueden
estar involucrados en la pato-etiología de la FM [15]:
- la sensibilización central;
- el fracaso de las vías descendentes inhibidoras (antinociceptivas);
- una disfunción de los receptores opioides mu, posiblemente involucrada con el
fracaso de las vías descendentes inhibidoras.
En conjunto estos factores provocarían un mantenimiento y un incremento
de la sensibilidad a la amplificación de los impulsos periféricos, produciéndose un
aumento progresivo de respuesta (fenómeno wind-up), así como su suma
temporal. La sensibilización central sería la responsable de la disminución de
umbrales a los distintos estímulos y por tanto del incremento de la sensibilidad,
provocando el fenómeno wind-up y el dolor persistente a pesar de haber retirado
el estímulo. El fenómeno wind-up puede ser además responsable de la hiper-
excitabilidad o exceso de respuesta a los distintos estímulos, ya sean dolorosos o
no dolorosos, y del aumento de la actividad espontánea. Esta sensibilización
mantenida va a provocar cambios en la neuroplasticidad, que se pueden apreciar
en pruebas de imagen como las resonancias magnéticas funcionales
2
. En el SSC
existe por tanto una desregulación neurosensorial que va a producir alteraciones
neuroendocrinas y del sistema inmunológico, desarrollándose un círculo vicioso
que es el origen de los múltiples síntomas y síndromes que aparecen en este
proceso. La cronificación del proceso dará lugar, entre otras, a un aumento del
estrés oxidativo y de los radicales libres, provocando un aumento de las sustancias
proinflamatorias e inmunológicas y disfunciones mitocondriales. Fruto de la
disfunción de todos estos sistemas íntimamente relacionados aparecerá una
2
http://www.shcmedical.es/es/sensibilidad-central (visitado el 20/10/2015)
18
sintomatología compleja y variada, ya que no hay órgano que se libre de la
regulación de estos sistemas. La riqueza sintomatológica de la FM, entonces, se
podría explicar por la desregulación que se produce a nivel del sistema nervioso
central (SNC), sistema inmunológico y sistema neuroendocrino.
Como ya hemos adelantado, el síndrome se caracteriza por dolor musculo-
esquelético generalizado persistente (más de 3 meses), rigidez y sensibilidad a la
palpación en los puntos gatillos. Otros síntomas muy comunes de la FM son:
cansancio, dificultades para dormir y sueño no reparador, parestesia, trastornos
psicológicos, problemas cognitivos y sensación de hinchazón de las extremidades
inferiores. Además, un reciente artículo ha evidenciado que la parestesia de los
miembros superiores, las hemorroides y la epistaxis se deberían considerar
también entre los síntomas asociado a la FM, secundariamente a la laxitud del
tejido conectivo [23]. El 50% de los afectados por FM reporta también neuritis,
incluyendo parestesia (52%) y dolor lancinante (50%). Son síntomas comunes
también el síndrome de las piernas inquietas (56%) y la migraña (60%) [24]. El
cansancio, desde un nivel moderado a grave se encuentra en un 75-90% de los
pacientes [4, 12]. Esto puede ser un síntoma secundario debido a la falta de sueño
y de condición física o factores psicológicos [4, 25]. El sueño no reparador es
asimismo un síntoma muy común. Aproximadamente el 75% de los pacientes que
sufren el síndrome tienen problemas de sueño [26, 27]. El cansancio por la
mañana está presente en el 75-90% de los pacientes [4, 12]. Los problemas del
sueño se combinan frecuentemente con insomnio, despertares nocturnos
múltiples, sueño ligero, síndrome de las piernas inquietas y movimientos
anormales de los miembros [22]. Los problemas del sueño suelen también estar
19
relacionados con los trastornos psicológicos, el cansancio y el dolor [4, 12, 22,
25].
Moldofsky notó unas variaciones diurnas en el grado de dolor. El grado de
dolor mayor se manifestaba a las primeras horas de la mañana, al final de la
mañana y por la tarde. Mientras que los pacientes se sentían mejor entre las 10 y
las 14 horas. También se han notado variaciones estacionales del dolor siendo la
primavera y el verano las estaciones donde el grado de dolor era menor [28]. Los
trastornos psicológicos han sido asimismo relacionados con el aumento del grado
de dolor [29].
Otros síntomas asociado a la FM suelen ser: migraña, síndrome de colon
irritable, síndrome de piernas inquietas, el síndrome uretral femenino, la cistitis
intersticial, desórdenes tiroideos (Hipotiroidismo) y dismenorrea primaria [12]. La
FM ha sido también asociada a otras patologías como la artritis reumatoide, la
osteoartritis, el lupus eritematoso y el síndrome de Sjögren. Aún se desconocen
los motivos de la concomitancia entre estos síntomas y la FM. Cabe también la
posibilidad que estos desordenes puedan ser el origen de los cambios
neuroplásticos que están involucrados en la sensibilidad central que causa la
amplificación de la señal del dolor en la FM [15].
2. El género Ganoderma
Reishi es el nombre común de la seta producida por el hongo denominado
Ganoderma lucidum (Curt.: Fr) P. Karst (figura 2 y 3).
20
Figura 2. Forma de cultivo y detalles macroscópicos del reishi.
A- Reishi silvestre en bosque templado caducifolio. B- Reishi cultivado. C- Detalles del carpóforo
(setas)
3
.
Figura 3. Detalles microscópicos del reishi3.
3
Permiso otorgado por Mundo Reishi el 22/10/2015.
21
El género Ganoderma, que pertenece a los hongos del orden poliporales,
es uno de los más amplios al contar con más de 250 especies reportadas en todo el
mundo, cuyas subdivisión taxonómica es aún hoy muy debatida [30]. La
metodología empleada en la taxonomía tradicional suele tomar en cuenta
características tales como: especificidad del hospedero, distribución geográfica y
rasgos morfológicos macroscópicos del cuerpo fructífero, incluyendo el color, la
forma del margen del píleo y la presencia o ausencia de estípite. Otras
características comúnemente consideradas como útiles en la identificación del
género son las siguientes: estructura microscópica de la corteza del píleo; forma,
textura y tamaño de las basidiosporas; presencia o ausencia de clamidosporas en
cultivos in vitro y reacción amiloide o dextrinoide en presencia del reactivo de
Melzer. Siguiendo un consenso ampliamente aceptado, el género Ganoderma
viene actualmente dividido en 2 subgéneros de acuerdo con la textura de la
cubierta superior de su basidiocarpo: subgénero Ganoderma, para los ejemplares
con basidiocarpo laqueados y subgénero Elfvingia (= Ganoderma applanatum)
para los no laqueados [31]. Aunque, no siempre la clasificación taxonómica
basada en características morfológicas permite discriminar con extrema seguridad
de qué especie se trata debido a la amplia variabilidad existente entre los
miembros del género (figura 4). De hecho, se han reportado que características
tradicionalmente consideradas como diagnósticas, tales como la forma del
basidiocarpo, el tamaño y forma de las basidiosporas y el color pueden depender
en gran medida de las condiciones ambientales en las que creció el hongo. Por
todos estos motivos, para identificar a nivel de especie es a veces necesario
recurrir a técnicas derivadas de la biología molecular.
22
Figura 4. Variabilidad morfológica del G. lucidum encontrada en varias
colecciones Chinas [32]
4
.
A: forma del sombrero; A-1: reniforme y cóncava; A-2: reniforme y convexa; A-3: circular y
convexa; A-4: circular y cóncava. B: longitud del pie; B-1: pie largo; B-2: pie corto. C: inserción
del pie; C-1: lateral; C-2: central. D: superficie del sombrero; D-1: con surcos radiales; D-2: con
zonas a surcos concéntricos. E: anchura del sombrero; E-1: de una capa fina; E-2: de más capas y
gorda. F: superficie de los poros; F-1: blanquilla; F-2: amarillenta. G: largor; G-1: corta, menor de
0.5 cm; G-2: larga, mayor de 1 cm. Barra de referencia: 1 cm en A-1, A-3, E-2, F-2, G-1 y G-2;
1.5 cm en A-2, A-4, B-2, C-1, C-2, D-1, D-2, E-1 y F-1; 2 cm en B-1.
Entre los enfoques empleados para complementar la identificación
taxonómica de los hongos del género Ganoderma cabe mencionar el uso de
métodos basados en la amplificación de secuencias de ADN mediante la reacción
en cadena de la polimerasa (PCR, por sus siglas en inglés), especialmente aquellas
relacionadas con el análisis de la región espaciadora interna transcrita (ITS, por
sus siglas en inglés). Adicionalmente a los enfoques relacionados con el uso de
marcadores moleculares, también se han ensayado otras estrategias de
4
Creative Commons Attribution License.
23
identificación en este género, entre las que destacan: quimiotaxonomía basada en
el análisis del patrón de producción de metabolitos secundarios mediante HPLC y
ensayos inmunológicos tipo ELISA [33].
Dentro del subgénero Ganoderma han sido descritas diferentes especies
parecidas al G. lucidum y provenientes desde todo el mundo (figura 5),
incluyendo: Ganoderma multipileum, Ganoderma sichuanense y Ganoderma
lingzhi en Cina, Ganoderma resinaceum en Europa y Ganoderma oregonense,
Ganoderma sessile, Ganoderma tsugae y Ganoderma zonatum en Estados
Unidos [34]. Entre estas, el Ganoderma lucidum (GL), comúnmente llamado
língzhī en Cina y reishi en Japón, representa uno de los hongos medicinales más
importantes a nivel mundial [35]. Esta seta se utiliza desde hace más de 2000 años
en la medicina popular oriental para tratar diversas enfermedades, tales como:
hepatitis, hipertensión, hipercolesterolemia y cáncer gástrico [36]. Se cree que el
consumo regular de este hongo preserve la vitalidad humana y promueva la
longevidad [37, 38]. A día de hoy existen en el mercado diferentes productos
funcionales a base de GL para su utilización como anti-cancerígenos, anti-edad y
con funciones anti-micróbica y anti-viral entre otras [35].
24
Figura 5. Varias especies de Ganoderma en comercio
5
.
Ganoderma tsugae (a-d), Ganoderma japonicum (c), Ganoderma applanatum (d) y otras especies
de Ganoderma desconocidas (e y f) [39].
3. Reishi y fibromialgia
Estudios recientes han demostrado una serie de actividades biológicas del
reishi que podrían ayudar a aliviar y curar algunos de los síntomas típicos de la
FM. En particular el consumo de reishi podría ayudar a tolerar mejor el dolor [40,
41] que es el principal síntoma de la FM. Además, diferentes investigaciones han
demostrado que el consumo de reishi puede aumentar la calidad del sueño [42-
5
Permiso otorgado por the American Herbal Pharmacopoeia el 20 de octubre de 2015.
25
45], disminuir la sensación de cansancio [46] y, en general, mejorar el estado de
bienestar físico y consecuentemente la calidad de vida de las personas afectadas
de FM, gracias también a su actividad sobre el potenciamiento del sistema
inmunitario y de defensa celular [47]. De hecho, investigaciones tanto in vitro
como in vivo destacan que el consumo de reishi incrementa las defensas del
organismo [48-65], defiende las células gracias a su elevado contenido de factores
antioxidantes [48, 66-74], mejora el sistema circulatorio disminuyendo la
formación de trombos [75], ayuda a regular los niveles de azúcares y lípidos en la
sangre (glucosa, colesterol y triglicéridos) [76-80] y disminuye la presión
arterial [78, 81]. Las propiedades antioxidantes del GL, podrían jugar un papel
muy relevante para disminuir el impacto de la FM si se considera que un estudio
reciente ha subrayado que el estrés oxidativo podría tener un papel muy
importante en su patofiosologia [82]. Además, ha sido demostrado que el GL
puede aliviar los síntomas de la diabetes [83], que se considera una enfermedad
relacionada con la FM [84] y de otras enfermedades virales [85-89]. Asimismo,
otros autores señalan que la FM podría tener un desencadenante vírico [90-92].
Según nuestro conocimiento, a fecha de inicio de la presente tesis, no
había sido publicado ningún trabajo científico sobre los efectos del GL en
personas afectadas por FM. Sólo existían algunas referencias y citaciones en
páginas web no oficiales
6
,
7
,
8
.
6
http://www.healingwell.com/community/default.aspx?f=24&m=2261196 (visitado el
20/10/2015).
7
https://ganodermamasters.wordpress.com/2010/08/30/rheumatoid-arthritis-and-prozac (visitado el
20/10/2015).
8
http://www.fungihealth.com/medicinal-mushrooms-fibromyalgia (visitado el 20/10/2015).
26
3.1 Reishi y dolor
El dolor se define como una “experiencia sensorial y emocional
desagradable asociada con una lesión tisular real o potencial, o descrita como la
ocasionada por dicha lesión [93]”. Las alteraciones del procesamiento del
estímulo nociceptivo pueden además desencadenar:
- Una reducción del umbral del dolor: alodinia
- Una respuesta exaltada al estímulo nocivo: hiperalgesia
- Un aumento en la duración de la respuesta frente a una estimulación breve: dolor
persistente
- Una extensión del dolor y de la hiperalgesia a tejidos no lesionados: dolor
referido.
Todos estos fenómenos pueden persistir aunque haya desaparecido la
lesión periférica. El dolor no es un fenómeno pasivo de transferencia de
información desde la periferia a la corteza, sino un proceso activo generado en
parte en la periferia y en parte en el SNC, y susceptible de cambios en relación a
múltiples modificaciones neuronales (Neuroplasticidad). Woolf y colegas [94]
fueron los primeros en aportar evidencia de que un estímulo periférico podía
desencadenar un incremento sostenido de la excitabilidad central. La plasticidad
neuronal consiste por tanto, en la capacidad de las neuronas para cambiar su
estructura, su función, o su perfil génico [95]. Este fenómeno puede ocurrir a
todos los niveles neurales, tanto del SNC que del Sistema Nervioso Periférico
(SNP) [96].
El dolor puede clasificarse como agudo y crónico. El dolor agudo tiene
una función de protección biológica (alarma) y es la consecuencia inmediata de la
activación de los sistemas nociceptivos por la estimulación química, mecánica y
27
térmica de nociceptores específicos. El dolor crónico no tiene función protectora y
es un dolor persistente que puede autoperpetuarse por un tiempo prolongado
después de una lesión o incluso en ausencia de ella, y se asocia a importantes
síntomas psicológicos.
En función de los mecanismos fisiopatológicos involucrados, el dolor
puede diferenciarse en nociceptivo y neuropático. El dolor nociceptivo es la
consecuencia de una lesión somática o visceral. El dolor neuropático es el
resultado de una lesión y alteración de la transmisión de la información
nociceptiva a nivel de SNC y SNP.
Los nociceptores son terminaciones periféricas de las fibras aferentes
sensoriales primarias capaces de diferenciar entre estímulos inocuos y nocivos que
son transmitidos a través de las fibras aferentes sensoriales primarias hacia el
SNC. Se distinguen 3 tipos de nociceptores que se caracterizan por tener un
umbral de dolor diferente: cutáneos, músculo-articulares y viscerales. En el
recorrido de las neuronas primarias, las fibras aferentes de los nociceptores
alcanzan la médula espinal a través de las raíces dorsales, y terminan en la
sustancia gris del asta posterior medular. Las terminaciones centrales de estas
fibras liberan transmisores excitatorios (Sustancia P, glutamato y péptidos
relacionados con el gen de la calcitonina o CGRP en sus siglas en inglés) que
actúan sobre receptores específicos e inducen la despolarización de las neuronas
de segundo orden, transmitiéndose la información hacia los centros superiores
donde inducen respuestas vegetativas, motoras y emocionales (aparece el dolor).
La transmisión excitatoria va recibiendo la modulación de los sistemas
inhibitorios. Estos sistemas están formados por transmisores y receptores capaces
de disminuir la liberación de transmisores excitatorios y la excitabilidad neuronal.
28
Se activan a la vez por el estímulo doloroso y parecen actuar sinérgicamente con
el sistema excitatorio [97].
En este contexto, las propiedades analgésicas del GL se explicarían a
través de diferentes mecanismos de interacción en los sistemas involucrados en el
dolor. En particular, Han, (2010) [41] ha demostrado en ratones que los glicéridos
del GL son capaces de inhibir la formación de la Neurolisina, una enzima capaz
de inhibir la Neurotensina y la Dinorfina-A, 2 péptidos involucrados en la
modulación del dolor. El mismo estudio, a través del “Writhings test”, una prueba
que mide las contracciones dolorosas inducidas con ácido acético, ha demostrado
que los glicéridos del GL inhiben las constricciones abdominales de una manera
dependiente de la dosis proporcionada. Tales efectos se deberían a la interacción
de los glicéridos del GL con los mecanismos de estimulación periféricos en los
que estarían involucrados las prostaglandinas, unos mediadores celulares
implicados en la respuesta inflamatoria. En otros estudios, siempre a través del
“Writhings test”, se han demostrados las propiedades antinociceptivas de
diferentes compuestos del reishi, entre los cuales destacan: ácidos ganodéricos A,
B, G y H [40].
Un estudio efectuado para evaluar las propiedades del GL proveniente del
Sur de la India, ha demostrado que los extractos de micelio de GL eran más
eficaces en disminuir la respuesta inflamatoria en comparación con el Diclofenac,
un principio activo comúnmente utilizado como antiinflamatorio. Estos resultados
se obtuvieron a través de los test de la Carragenina y de la Formalina, que
representan 2 modelos útiles para evaluar respectivamente tanto el dolor agudo,
como el dolor crónico [98]. Volviendo al estudio de Han, a través del test de la
formalina y del test del plato caliente, una prueba donde se induce el dolor a
29
través del calor (Hot-Plate test), se demostró que los mecanismos antinociceptivos
del reishi se expresarían tanto a nivel del SNP como a nivel del SNC.
3.2 Reishi y sueño
Existen 2 tipos de sueño bien diferenciados: el sueño de movimientos
oculares rápidos, conocido como sueño REM (Rapid Eye Movement) o sueño
paradójico y el sueño de ondas lentas, también conocido como sueño No-REM
(Non Rapid Eye Movement), por contraposición al sueño REM. El sueño de
ondas lentas o No-REM lo componen cuatro estadios que se hallan relacionados
con los distintos grados de profundidad del sueño. Aparecen así, sucesivamente,
estadios 1 y 2 o de sueño superficial o ligero y estadios 3 y 4, que corresponden al
sueño de ondas lentas o profundo [99, 100]. Durante el sueño profundo disminuye
la frecuencia cardiaca, la tensión arterial y el flujo sanguíneo cerebral,
aumentando el flujo sanguíneo muscular y la secreción de la hormona del
crecimiento [101]. En un adulto normal, la duración del sueño REM ocupa entre
el 20 y el 25% del total del sueño [102], mientras que la fase no-REM se compone
del 75-80% del total de sueño, repartiéndose de la siguiente forma: 5% para el
estadio 1, 50% para el estadio 2 y 20% para los estadios 3 y 4. Cuando nos
dormimos, iniciamos el sueño en fase 1, que dura unos pocos minutos, seguido de
fase 2 y, posteriormente, pasamos a sueño profundo o lento, estadios 3 y 4. Este
período de sueño No-REM es seguido de un período REM, que en condiciones
normales no debe aparecer hasta transcurridos 60-90 minutos del comienzo del
estadio 1. Esta alternancia sueño No-REM - REM se sucede a lo largo de la noche
formando ciclos; cada uno de ellos dura 90-120 minutos y se repiten de 4 a 6
veces a lo largo de una noche.
30
La arquitectura del sueño puede verse modificada por diferentes factores:
la privación de sueño, la hora de inicio del sueño, la temperatura ambiental, la
contaminación lumínica, el consumo de tóxicos (café, alcohol, nicotina,
marihuana), la utilización de fármacos (benzodiacepinas, hipnóticos,
antidepresivos) y por la existencia de algunos trastornos del sueño y trastornos
médicos. Además, la proporción de cada estadio de sueño con relación al total del
sueño sufre variaciones importantes a lo largo de la vida. En las personas
mayores, el sueño es más fragmentado y se verifica un aumento del estadio 1 a
expensas del estadio 4 de sueño profundo. Además, se pierde la capacidad de
recuperación del sueño, es decir, la aparición de los largos períodos de sueño
ininterrumpido que presentan los sujetos más jóvenes después de períodos de
privación de éste. Por otro lado, el sueño REM se modifica poco con la edad y su
proporción permanece estable en los sujetos sanos hasta edades muy avanzadas.
Lo que se modifica es su distribución a lo largo de la noche: el primer sueño REM
de los ancianos es más duradero que en los jóvenes porque aparece más
precozmente [103].
En este contexto un estudio ha demostrado en ratas que el GL aumenta
significativamente el tiempo total de sueño y la fase de sueño no-REM en dosis de
80 mg/kg, sin influenciar la fase de sueño REM. Aunque los mecanismo de acción
del GL sobre el sueño no hayan sido aclarados, parece que sus efectos estarían
relacionados con el aumento de las citoquinas, unos mediadores inmunológicos
proteicos involucrado en la modulación del sueño [45]. Otro estudio con
ratones [104] ha demostrado que el GL disminuye la fase de latencia del sueño y
aumenta la duración de la fase de sueño ligero no-REM, sin influenciar la fase de
sueño REM. Estos efectos se deberían a su capacidad de estimular los receptores
31
de las benzodiacepinas, que a su vez están involucrados en la modulación de los
neurotransmisores GABAérgicos que regulan (inhiben) mecanismos de control
específicos de los impulsos excitatorios que llegan al SNC.
3.3 Reishi e incapacidad de pacientes con FM
La mejora de la incapacidad ocasionada por la FM por parte del reishi como
ya hemos adelantado, podría derivar de las múltiples actividades biológicas del
reishi que ayudarían a aliviar algunos de los síntomas típicos de la FM. Además
de disminuir el grado de dolor y favorecer la calidad del sueño, en la bibliografía
científica están bien documentadas toda una serie de propiedades que por sí
mismas o en combinación entre ellas podrían disminuir el nivel de incapacidad de
la FM. A continuación se enumeran algunas de ellas:
1. Las propiedades antioxidantes derivadas de las componentes
polifenólicas [70] y peptídicas [73] del reishi podrían ayudar a defender las
lulas de eventuales alteraciones del nivel de estrés oxidativo, tanto en
condiciones normales, como después de un esfuerzo físico prolongado.
2. La mejora del aporte de glucosa a los músculos podría permitir a las células
musculares responder mejor a los esfuerzos. Un estudio en ratas [105] ha
demostrado que el GL puede aumentar hasta 7 veces la actividad de las
fosfoinositol 3-quinasas (PI3K en sus siglas en inglés), una familia de enzimas
que regulan la absorción celular de la glucosa a través de una serie de eventos
de fosforilación. El mismo estudio ha demostrado también que el GL aumenta
la actividad del AMPK (proteína quinasa activada por adenosín monofosfato),
otro complejo enzimático involucrado en la absorción celular de la glucosa.
Estas mejoras se podrían deber también a la capacidad del reishi para
aumentar la producción de insulina, una hormona secretada por las células
32
beta de los islotes de Langerhans del páncreas, que interviene en el
aprovechamiento metabólico de los nutrientes, sobre todo con el anabolismo
de los glúcidos. El incremento en la formación de insulina se debería a que los
polisacáridos del reishi facilitan la entrada de Ca2+ en las células del
páncreas [106].
3. Fortalece el sistema inmunológico. Hasta la fecha han sido aisladas del GL
diferentes sustancias con propiedades inmunomoduladora. Estas incluyen
polisacáridos (en particular b-D-glucanos), proteínas (en particular LZ-8) y
triterpenoides [63]. Estos compuestos serían capaces de modular los
mecanismos de regulación involucrados en la activación, diferenciación y
proliferación de linfocitos T y B. Por ejemplo, ha sido demostrado que tanto la
proteína LZ-8 como la fracción polisacarídica del GL aumentan la
transcripción de las citocinas, [interleucina (IL)-2, IL-3, IL-4, interferón
(IFN)-γ y factor de necrosis tumoral (TNF-α en sus siglas en inglés] y de las
quimiocinas, moléculas proteicas que estimulan la actividad linfocitaria [62,
63, 107].
4. Todos estos mecanismos de acción podrían a su vez mejorar la condición
física de las personas con FM.
4. Otras propiedades del reishi
A continuación se resumen algunos de los otros efectos biológicos que han
sido descritos en las investigaciones sobre el reishi realizados hasta la fecha.
4.1 Efectos protectores
Estudios demuestran que el reishi posee capacidad protectora hacia
diferentes órganos y tejidos. En particular hay referencias que demuestran su
33
eficacia para proteger el hígado [108], el páncreas [109], los riñones [110-117] y
la retina [118].
4.2 Reishi y enfermedades
Hay numerosas investigaciones científicas que demuestran que el uso del
reishi, asociado con medicamentos o consumido sólo, pueda ayudar a prevenir y
aliviar los síntomas de diferentes enfermedades, como enfermedades
neurodegenerativas [119-127] y úlceras de estómago [128, 129].
4.3 Reishi y cáncer
Estudios in vitro e in vivo han demostrado que el consumo de reishi puede
ayudar a prevenir y/o combatir la aparición y las síntomas de cierto tipos de
cáncer, como el de próstata [130], de colon [131], de mama [132], de
pulmón [133], leucemias y linfomas [134].
5. Las moléculas bioactivas
Las propiedades del GL se deben a más de 400 moléculas biológicamente
activas contenida en el hongo que principalmente incluyen (tabla 1): polisacáridos
-D-glucanos), triterpenos (ácidos ganodericos A-Z), proteínas
inmunomoduladoras (Ling Zhi-8), nucleótidos, esteroles, esteroides, ácidos
grasos, y otros elementos menores [38, 47, 135-137].
Los mecanismos de acción involucrados son muy diversos [54, 138-159] y
comprenden:
- Activación de células involucradas en el sistema de defensa inmunitaria como:
células T, macrófagos y otras células killer que a su vez provocan la producción
de citoquininas, factores de necrosis tumoral (TNF) e interferón
- Inducción de apoptosis de las células cancerígenas (citotóxicos)
34
- Actividad antiangiogénica
- Inhibición de sustancias tóxicas o alergénicas
- Protección celular de la instauración de agentes virales como el virus del herpes
- Protección del ADN de agentes mutágenos
- Defensa contra los radicales libres
- Actividad anti-bacteriana y anti-fúngica
- Regulación hormonal
- Excreción de compuesto nocivo (efecto detoxificante).
35
Tabla 1. Efectos terapéuticos y moléculas bioactivas del G. lucidum [135]
9
Therapeutic Effects
Bioactive Compound
References
Immunomodulation:
Mitogenic activity,
Stimulation of immune
effector cells and
complement system
Protein LZ-8, - β-D-glucan,
Ganoderic acid
Kim et al., [30]; Zhang et al.,
[36]; Wang et al., [38]; Won et
al., [41]; Lee et al., [40]; Han et
al., [42]; Li et al., [43]; Oh et al.,
[44]; Tasaka et al., [48]; Yang
and Pai, [52]; Kino et al., [50]
Anti-Cancer, Anti-
Tumour, Chemo and
Radio Prevention
β-D-glucans,
heteropolysaccharides, glycopro-
teins, lanostanoid, 3-Β-hydroxyl-
26-oxo--β-lanosta-8,24-dien-11-
one, and steroid, ergosta-7,22-
diene-3-β,3-α,9-α-triol
Miyazaki and Nishijima, [53];
Usui et al., [54]; Usui et al., [55];
Sone et al., [56]; Kishida et al.,
[57]; Zhang et al., [58]; Cheong
et al., [59]; Wasser and Weis,
[19]
Anti-HIV-1 And Anti-
HIV-1-Protease
Triterpenoids: Lucidenic acid O
Sahar, [27]; Hobbs, [7];
McKenna, [8]; Gao, [10]; Min,
[29]
Anti-Diabetic
Glycans: Ganoderans B and D
Mohammad, et al., [80]; Wasser,
[4]; Hobbs, [7]; McKenna, [8];
Gao, [9]
Hepatoprotective
Ganoderic acids R and S and
ganosporeric acid A
Hirotani, [81]; Chen, [82]; Wang,
[83]; Gao, [11]
Anti-Inflammatory
Ganoderic Acid C, 3-oxo-5-α-
lanosta-8,24-dien-21-oic acid
Joseph et al., [84]; Horng-Huey
Ko et al., [85]; Lin et al., [86]
Anti-Allergic
Ganoderic acids C and D
Zhou, [20]; Liu, [18]; Smith, [16]
Anti-Androgenic
Ganoderol B
Liu et al., [92]; Fujita et al., [93];
Shimizu et al., [94]
Anti-Angiogenic activity
Ethanol extract (Compound not
reported)
Song, et al., [95]
Anti-Herpetic
Acidic protein bound
polysaccharides
Kim et al., [96]; Eo et al., [97];
Liu et al., [98]; Oh et al., [99]
Anti-Oxidant
Chloroform extract (Compound not
reported)
Karaman et al., [100]; Joseph et
al., [84]
Anti-Microbial: Anti-
Viral, Anti-Bacterial,
Anti-Fungal
Neutral protein bound
polysaccharide, Acidic protein
bound polysaccharide, ganodermin
Wasser, [4]; Stamets, [101];
Hobbs, [7]; McKenna, [8]; Gao,
[10]; Smith, [16]; Suay, [102];
Yoon, [103]; Sugiura and Ito,
[104]; Kim et al., [105]; Eo et al.,
2000 [107]; Eo et al., [106];
Wang and Ng, [108]
Estrogenic
Ethanol extract (Compound not
reported)
Shimizu et al., [94]
Anti-Mutagenic
Methanol extract (Compound not
reported)
Lakshmi et al., [109]
Anti-Ulcerogenic
Polysaccharides
Gao et al., [12]
Anti-Proliferative activity
Ganoderic acid T
Hong, [110]; Jiang, [111]; Hu,
[112]; Muller et al., [113]; Tang
et al., [114]
Cardiovascular and
Circulatory Functions
Powdered mycelium and water
extract of myce-lium (Compound
not reported)
Kabir, [115]; Soo, [116]; Lee,
[117]; Jin et al., [118]
9
Permiso otorgado por Bentham Science Publishers el 28 de septiembre de 2015.
36
6. Posología y contraindicaciones
A pesar de sus numerosas propiedades medicinales, el reishi no se
considera un fármaco y actualmente se vende principalmente como alimento o
integrador alimenticio. Además, el contenido de sustancias bioactivas casi nunca
se indica en la etiqueta y pueden variar mucho entre las diferentes fórmulas
comerciales. Por ejemplo, las diferencias en el contenido de polifenoles entre los
extractos de Ganoderma provenientes del micelio y los obtenidos por los
carpóforos varían de no detectable en el primer caso hasta 7,82% en el segundo,
mientras que los de polisacáridos pueden respectivamente variar del 1,1 al
29,7% [160]. Por este motivo, hasta la fecha, no ha sido posible formular una
dosis estándar de suministración. En general la seta puede ser suministrada como
extracto o entera, en diferentes fórmulas comerciales que utilizan tanto el micelio
fúngico como sus carpóforos y esporas o solo partes de estos, en diferentes
soluciones: concentrado de esporas, polvo seco, sopa, jarabe, té, café, tabletas,
cápsulas, etc. Chang (1994) sostuvo que la dosis mínima efectiva tenía que ser
superior o igual a 300 mg/día y que la eficacia se conseguía a partir de 5
g/día [161]. Los estudios en humanos han utilizado una dosis muy variable, entre
0,6 mg/día y 72 g/día de reishi por un periodo variable de 4 hasta 12 semanas. La
farmacopea de la República Popular de China cita una dosis de 6-12 g de polvo al
día [39].
Los estudios de toxicidad hechos con ratas, perros, y conejos no han
mostrado ningún signo de alteración a los órganos principales. Li et al. [149], en
un estudio de toxicidad aguda con cápsulas de esporas pulverizadas de GL,
encontraron que la dosis letal 50 (LD50) era mayor de 10 g/kg. Estudios de
37
toxicidad a largo plazo con ratas han mostrado que dosis de hasta 1,87 g/kg/día
durante 26 semanas no han dado origen a ningún efecto indeseado.
Por cuanto concierne a los efectos alergénicos, a pesar de que las esporas
de algunos basidiomicetes pueden tener efectos alérgicos, hasta la fecha no ha
sido demostrado ningún efecto adverso debido al consumo de reishi que, al revés,
se ha visto eficaz para aumentar la respuesta inmunitaria y para combatir algunas
alergias como la rinitis. En dosis oral de 1,5-9 g/día de extracto se han registrado
en ciertos pacientes síntomas como somnolencia, sed, enrojecimiento de la piel,
disentería, micción frecuente; estos efectos se debieron probablemente a los
efectos desintoxicantes del reishi.
Visto que el reishi refuerza el sistema inmunitario, se sugiere prestar
atención a los pacientes sujetos a terapias inmunosupresoras. Además, hay que
prestar atención en los pacientes a los cuales se le están suministrando o toman
cotidianamente fármacos anticoagulantes, como la aspirina o el Warfarin, debido
a que el reishi posee las mismas propiedades. Algunas investigaciones han
demostrado también que el reishi posee actividad sinérgicas en asociación con
algunos tratamientos antibióticos, como el Cefazolin utilizado contra Klebsiella
oxytoca ATCC 8724, Bacillus subtilis ATCC 6603, Staphylococcus aureus ATCC
25923, Escherichia coli ATCC 25933 y Salmonella typhi ATC [162].
38
OBJETIVOS
Objetivo principal
El objetivo principal del estudio ha sido evaluar la seguridad y los efectos
de 6 gramos de polvo micromolido de GL suministrado por vía oral en 2 dosis de
3 gramos, una durante el desayuno y otra durante la cena, sobre el dolor, la
calidad del sueño y la incapacidad de pacientes con FM. El grado de dolor se
evaluó a través de la Escala Visual Analógica del dolor (VAS) y por medio de la
pregunta específica del cuestionario de impacto de la FM revisado (cuestionario
FIQ-R). La incapacidad de la FM se evaluó con el cuestionario de impacto de la
FM (FIQ) y con el FIQ-R. Finalmente, la calidad del sueño se midió a través del
cuestionario 15D de Calidad de Vida Relacionada con la Salud (CVRS).
Objetivos secundarios
Los objetivos secundarios del estudio han sido comparar los efectos de 6
gramos de polvo micromolido de GL suministrados por vía oral en 2 dosis de 3
gramos, una durante el desayuno y otra durante la cena, con 6 gramos de harina de
algarrobo (Ceratonia siliqua) suministrados de la misma manera, sobre:
La felicidad a través del Cuestionario de Felicidad General (cuestionario
GHS) y la Escala de Satisfacción con la Vida (SLS).
La depresión evaluada con la Escala de Depresión Geriatrica (GDS).
La CVRS a través de cuestionarios SF-12v2.
La percepción de mejora con la Escala de Impresión Clínica Global
(GIIS).
39
La condición física por medio de las baterías de los estudios Exercise
Look After You (ELAY) y de la Red Española de Investigación en
Ejercicio Físico y Salud en Poblaciones Especiales (EXERNET).
Los niveles de glucosa, colesterol y triglicéridos en sangre mediante tiras
reactivas extrayendo la sangre de los capilares de las yemas de los dedos
de la mano.
La composición corporal por medio de un aparato de bioimpedancia
eléctrica.
La tensión arterial con un aparato de autoevaluación.
40
HIPÓTESIS
En base a la bibliografía consultada y citada anteriormente, las hipótesis
del presente estudio son:
Hipótesis principal
Seis gramos de polvo micromolido de GL diarios administrados por vía
oral son seguros y capaces de disminuir el nivel de dolor en personas con FM,
mejorando además la calidad del sueño y disminuyendo el nivel de incapacidad de
la FM.
Hipótesis secundarias
Hipótesis 1
Seis gramos de polvo micromolido de GL diarios administrados por vía
oral, en comparación con la ingesta de 6 gramos de harina de algarrobo, mejoran
la CVRS, el grado de felicidad y de satisfacción con la vida y, disminuyen la
depresión, produciendo en general una mejora global del estado de salud de las
personas con FM.
Hipótesis 2
Seis gramos de polvo micromolido de GL diarios administrados por vía
oral, en comparación con la ingesta de 6 gramos de harina de algarrobo, mejoran
la condición física de las personas con FM.
Hipótesis 3
Seis gramos de polvo micromolido de GL diarios administrados por vía
oral, en comparación con la ingesta de 6 gramos de harina de algarrobo, mejoran
la composición corporal, reduciendo los triglicéridos de la sangre y la presión
41
arterial de las personas con FM. Además, tras la aplicación de los 2 tratamientos
no habrá diferencias entre grupos en los niveles de glucosa y colesterol, ya que se
espera una disminución en ambos grupos de los niveles de glucosa y colesterol
con respeto a su línea base.
42
MATERIAL Y MÉTODOS
1. Diseño del estudio
Estudio controlado aleatorizado a doble ciego con grupo experimental y
grupo placebo activo.
2. Participantes
2.1 Criterios de inclusión
Según el cálculo muestral realizado se reclutaron 70 personas. Los criterios
de inclusión fueron los siguientes:
1. Haber sido diagnosticado por parte de un médico con el síndrome de FM y
cumplir con los criterios diagnósticos del American College of Rheumatology
del 1990. En base a estos se excluyeron los pacientes que no presentaban
sensibilidad al dolor en un mínimo de 11 de los 18 puntos gatillos. Este
parámetro fue evaluado con un algómetro Force Ten FDX (Wagner
Instrument) ejerciendo una presión de 4 kg/cm2.
2. Tener más de 18 años.
3. Comprender perfectamente las instrucciones de los instrumentos de
evaluación.
4. No estar embarazada o sospecha de embarazo.
5. No estar participando en otro estudio que pudiera influir en los resultados.
6. No variar las rutinas diarias durante la duración del estudio.
7. Tener capacidad de llevar el control de la toma de reishi de forma autónoma.
8. No sufrir diabetes (tanto tipo 1, tipo 2 o gestacional).
9. No tomar inmunosupresores.
10. No tomar una suplementación de vitamina C.
43
11. No tomar tratamiento anticoagulante.
12. Haber leído y firmado el consentimiento informado.
2.2 Cálculo de la muestra
Asumiendo una alternativa unilateral, para detectar diferencias de al menos
un 14% con una potencia del 85% y un α del 0,05, con una media en la
puntuación total del FIQ de 70,5 y una deviación estándar de 11,8 puntos, se
estimó que se necesitaban 2 grupos de 26 participantes [163]. Asumiendo una
muerte experimental final máxima del 25% de la muestra se reclutaron 35
participantes por cada grupo.
2.3 Lugar de obtención de la muestra y medición de datos
El estudio se llevó a cabo en Palencia, Salamanca y Chipiona. La muestra
se reclutó a través de las Asociaciones de FM de estas ciudades. Las mediciones
se realizaron en locales acondicionados para tal fin.
2.4 Características de la muestra y tipología de intervención
Se reclutaron un total de 70 pacientes, 67 mujeres y 3 hombres. De estos, 1
no aceptó participar después de leer el consentimiento informado, 1 no había sido
diagnosticado con FM, 1 persona no mostraba sensibilidad en al menos 11 de los
18 puntos gatillos y 3 participantes fueron excluidos porque sufrían diabetes. Al
final, un total de 64 mujeres participaron en el estudio, proporcionando su
consentimiento informado de acuerdo con la declaración de Helsinki. La muestra
se dividió en 2 grupos iguales de 32 mujeres cuya aleatorización se realizó
mediante una tabla de números aleatorios.
Se llevó a cabo un estudio doble ciego, en el que ni los sujetos de estudio
ni los evaluadores conocían el tratamiento que se le suministró a cada paciente.
44
Con el fin de garantizar el doble ciego, uno de los investigadores asignó el grupo
(experimental o control) a los participantes. Esta persona no participó ni en las
mediciones y tampoco en la codificación de los datos.
El grupo experimental recibió un tratamiento de 6 gramos de reishi en
polvo micromolido, administrado por vía oral. Se realizaron 2 tomas diarias de 3
gramos cada una (una toma durante el desayuno y otra durante la cena) durante 6
semanas. Al grupo placebo se le administró la misma dosis, pero de harina de
algarrobo (Ceratonia siliqua), una leguminosa con características similares al
reishi en cuanto a color y textura.
La empresa Mundo reishi proporcionó gratuitamente el reishi envasado en
frascos de 3 gramos de tereftalato de polietileno (PET), que fue analizado por el
grupo de trabajo de la Cátedra de Micología de la Universidad de Valladolid,
Campus de Palencia. Se realizaron los siguientes análisis del producto:
- Análisis nutricional: polisacáridos, glúcidos, grasas y aceites, proteínas, valores
calóricos.
- Análisis organolépticos: análisis visual, olfativo y gustativo.
- Análisis físico: densidad y tamaño de las partículas del polvo.
- Análisis microscópico: tamaño de molienda, grosor de hifas y tipo de sistema de
hifas, presencias de estructuras fúngicas (fibulas, basidios y cistidios).
- Análisis genético: mediante amplificación del ADN del GL por PCR y
comparación de las secuencias génicas con las bases de datos públicas
10
.
En las tablas de 2 a 7 se muestran las características del producto según los datos
obtenidos.
10
http://www.ncbi.nlm.nih.gov
45
El estudio se realizó en los meses de septiembre, octubre, noviembre,
diciembre de 2014 y enero de 2015.
2.5 El placebo activo
Según nuestros conocimientos, la Ceratonia siliqua (CS) no tiene ningún
efecto sobre el dolor y el sueño, pero sí que podría tener efectos sobre las
variables secundarias evaluadas en este estudio. En particular algunos estudios
han descrito sus posibles efectos sobre los niveles de colesterol y glucosa en la
sangre [164, 165]. Se ha sugerido también que podría mejorar la función
intestinal [166]. También han sido descritos posibles efectos antioxidantes [167] y
antidepresivos [168]. Por este motivo la CS representa un placebo activo para la
evaluación del dolor y del sueño que son las variables primarias de este estudio.
Los motivos por los cuales se ha escogido la harina de algarrobo como placebo
dependieron de las siguientes variables:
- Económicas: no fue posible encontrar ninguna empresa capaz de encapsular el
reishi micromolido a un precio que entrase en el presupuesto del estudio.
- Funcional: el número mínimo de cápsulas requeridas para encapsular 6 gramos
de reishi era muy alto. De hecho, aun utilizando cápsulas muy grandes, como las
del tipo 00 (con volumen de 0,91 ml), y considerando que el reishi tiene una
densidad de 0,32 g/cm3, se habrían necesitado al menos 3 cápsulas por gramo de
reishi, lo que hace un total de 18 cápsulas diarias, y esto sin contar el volumen
añadido ocupado por el anti-aglomerante necesario para el encapsulado. Además,
este tamaño habría sido de difícil ingestión por parte de los participantes. Por
estos motivos se escogió suministrar el producto como polvo tal cual, que
permitiese además evitar la ingesta de eventuales productos indeseados que
pueden derivar de las cápsulas.
46
- Temporal: no fue posible encontrar ninguna empresa capaz de efectuar la
preparación de las dosis dentro de la fecha en la que se había previsto el inicio de
la toma, que tenía que empezar antes que entrase el pleno invierno para evitar que
las condiciones climáticas influyeran sobre los resultados; siendo el invierno la
estación donde se presentan los mayores síntomas del dolor. Además, para
mantener y asegurar la frescura del producto, la elaboración de las tomas y la
organización del estudio tuvieron que hacerse al mismo tiempo.
- Organoléptica: según nuestro conocimiento la harina de algarrobo era el
producto comercial que más se parecía al reishi.
Por estos motivos se escogió la harina de algarrobo como placebo activo en este
estudio. En las tablas 8 y 9 se muestran las características generales del algarrobo.
Tabla 2. Clasificación taxonómica del G. lucidum
Reino
Fungi
División
Basidiomycota
Subdivisión
Agaricomycotina
Clase
Agaricomycetes
Subclase
Incertae sedis
Orden
Polyporales
Familia
Ganodermataceae
Género
Ganoderma
Especie
Ganoderma lucidum (Curtis) P. Karst.
Nombre común
Reishi, Língzhí, Mannentake, Yeongji, Kamuhro,
Michoacano, Pilz, Pipa
47
Tabla 3. Valor nutricional (por 100g) del G. lucidum utilizado en el estudio
Valor energético
214 kcal/876 kJ
Hidratos de carbono
- de los cuales azúcares
8,5 g
<1 g
Proteínas
9,18 g
Grasas totales
- de las cuales Saturadas
- de las cuales Monoinsaturadas
- de las cuales Poliinsaturadas
- de las cuales Ácidos grasos trans
1,24 g
0,23 g
0,465 g
0,543 g
<0,100 g
Humedad
13,90 g
Cenizas
1,04 g
Fibra Dietética
66,13 g
Sal
0,01 g
Tabla 4. Características organolépticas del G. lucidum utilizado en el estudio
Análisis visual
Polvo fino de color marrón intenso, muestra uniforme, sin
presencia de elementos de granulometría superior.
Análisis olfativo
- Olores: Ligeros toques de olor a madera, con
connotaciones terroso-fúngicas, y ligeros recuerdos a frutos
secos tostados.
- Aromas: Aromas de madera de frondosa, con matices de
sotobosque y humus.
Análisis gustativo
En boca muestra un ligero acidez con un amargor medio-
alto al final, con recuerdo fúngico y fondo de bosque.
Tabla 5. Características físicas del G. lucidum utilizado en el estudio
Tamaño de las partículas de
polvo
menor de 40µm
Densidad del polvo
0,32 g/cm3
48
Tabla 6. Características microbiológicas del G. lucidum utilizado en el estudioa
Sistema de hifas
Anfimitico
Fíbulas
Presentes
Esporas
Doble pared esporal
Tamaño de las partículas micromolidas
< 35 µm
Recuento de aerobios mesófilos (ufc/g)
90 (< 106)
Recuento de Escherichia coli (ufc/g)
< 10 (< 102)
Recuento de mohos y levaduras (ufc/g)
< 10 (< 104)
Recuento de bacterias coliformes (ufc/g)
< 10 (< 104)
Salmonella spp.
Ausente
Cadmio (mg/kg)
< 0,05 (< 0,10)
Plomo(mg/kg)
< 0,05 (< 0,10)
aEn paréntesis: límites impuesto por los Reg. 2073/2005/CE y 1881/2006/CE.
Tabla 7. Características genéticas del G. lucidum utilizado en el estudio
Secuencia
GAGGAAGTAAAAGTCGTAACAAGGTTTCCGTAGGTGAAC
CTGCGGAAGGATCATTATCGAGTTCTGACTGGGTTGTAGC
TGGCCTTCCGAGGCACGTGCACGCCCTGCTCATCCACTCT
ACACCTGTACTTACTGTGGGTTTCAGATCTGTGAAGCGTG
CCCCTTGCGGGGCTTCGTGAAGCGCGTCTGYGCCTGCGTT
TATCACAAACTCTATAAAGTATTAGAATGTGTATTGCGAT
GTAACGCATCTATAAAACTTTCAGCAACGGATCTCTTGGC
TCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTA
ATGTGAATYGCAGAATTCAGYGAATCATCGAATCTTTGAA
CGCACCTTGCGCTCCTTGGTATCGAGGAGCATGCCTGTTT
GAGTGTCATGAAATCTTCAACCTACAAGCCTTTGCGGTTT
GTAGGCTTGGACTTGGAGGCTTGTCGGCCSTTYGTCGGTC
GGCTCCTCTTAAATGCATTAGCTTGATCCTGCGGATCGGC
TCTCGGTGTGATAATGTCTACGCCGCGACCGTGAAGCGTT
TGGCGAGCTTCTAACCGTCTTCGCTTGAAGACAGCTTTAT
GACCTCTGACCTCAAATC
Resultado del análisis BLAST11
99% de similitud con Ganoderma lucidum
(Curtis) P. Karst (611 de 617 bases idénticas,
por ejemplo con AM269773).
11
http://www.ncbi.nlm.nih.gov
49
Tabla 8. Clasificación taxonómica de la Ceratonia siliqua
Reino
Plantae
División
Magnoliophyta
Clase
Magnoliopsida
Subclase
Rosidae
Orden
Fabales
Familia
Fabaceae
Subfamilia
Caesalpinioideae
Tribu
Cassieae
Subtribu
Ceratoniinae
Género
Ceratonia
Especie
Ceratonia siliqua
Nombre común
Algarrobo, Algarroba.
Tabla 9. Valor nutricional (por 100g) de la Ceratonia siliqua
Valor energético
290 kcal/1214 kJ
Hidratos de carbono
71,4 g
Proteínas
5,9 g
Grasas totales
1,2 g
Humedad
10,7 g
Cenizas
2,7 g
Fibra Dietética
8,2 g
50
3. Medidas principales y secundarias
La presente tesis es una parte del estudio registrado en el Australian New
Zealand Clinical Trials Registry (ANZCTR) con ID: ACTRN12614001201662.
Las variables analizadas en el estudio se muestran en la tabla 4. Se realizó una
medición inicial, previa al tratamiento con reishi, y una medición final tras 6
semanas de tratamiento. Para la variable del dolor se hizo también un seguimiento
donde se tomaron los datos a través de la escala de autoevaluación durante 3
semanas después de haber finalizado el tratamiento.
3.1 Medidas principales
3.1.1 Variables sociodemográficas y otras
Con el objetivo de caracterizar la muestra se recogieron los siguientes
datos: fecha de nacimiento, sexo, estado civil, peso, altura, año de inicio y
diagnóstico de la FM.
3.1.2 Dolor, sueño e incapacidad de la fibromialgia
El dolor se evaluó a través de un cuadernillo de autoevaluación donde el
participante tuvo que apuntar en una Escala Visual Analógica el dolor que sentía
en ese día [169, 170], una vez por la mañana, nada más levantarse antes del
tratamiento, y otra por la noche justo después del tratamiento. Así mismo, tanto el
dolor como la incapacidad se midieron por medio del Cuestionario de Impacto de
la Fibromialgia (CIF) y del Cuestionario de impacto de la Fibromialgia revisado
(CIFR). El CIF consiste en 20 preguntas, perteneciendo las 10 primeras a una
única dimensión. La puntuación total del cuestionario está comprendida entre el 0
y el 100 siendo el 0 ninguna incapacidad a causa de la FM y el 100 la máxima
incapacidad a causa de la FM [163]. El CIFR contiene 21 ítems que hacen
51
mención a síntomas o problemas que ha tenido en los últimos 7 días con una
escala de respuesta que va de 0 a 10 en cada pregunta, donde el 0 es la ausencia
del problema y el 10 la mayor intensidad del problema. El cuestionario se
compone de 3 dominios: el primero que contiene los 9 primeros ítems es el de
“Función”, el segundo que contiene 2 ítems es “Impacto global” y el tercero que
tiene 10 ítems es “Gravedad de los síntomas”. La principal diferencia con el CIF
radica en que el tercer dominio incluye 4 preguntas nuevas relacionadas con la
memoria, la sensibilidad, el equilibrio y la sensibilidad a ruidos fuertes, luces
brillantes, olores y temperaturas frías [171, 172]. Finalmente, el sueño se evaluó
utilizando el cuestionario 15D de CVRS. Esta herramienta consta de 15
dimensiones con 5 grados de respuesta en cada dimensión. Como resultado
obtiene una medida final que va de 0 a 1, donde el 0 es la peor calidad de vida
posible y el 1 la mejor [173, 174].
3.2 Medidas secundarias
3.2.1 Felicidad
Para evaluar la felicidad se utilizó, antes y después del tratamiento, el
Cuestionario de Felicidad General (GHS en sus siglas en inglés) [175] y la Escala
de Satisfacción con la Vida (SLS en sus siglas en inglés) [176].
3.2.2 Depresión
La depresión se evaluó con la Geriatric Depression Scale (GDS) ya que
presenta una ventaja importante respecto al más utilizado en FM, el Beck’s
Depression Inventory (BDI), al estar menos enfocada en los síntomas somáticos
de la enfermedad [177, 178]. Esta escala consiste en 15 preguntas sobre cómo se
52
ha sentido el sujeto en los últimos 14 días, cuyas respuestas se limitan a “sí” o
“no”.
3.2.3 Calidad de Vida Relacionada con la Salud
La CVRS se evaluó a través del cuestionario SF-12v2: es la versión
abreviada del cuestionario SF-36 y contiene 12 preguntas. Está compuesto por 8
dimensiones (función física, rol físico, dolor corporal, salud general, vitalidad,
función social, rol emocional, salud mental) y por 2 componentes resumen, el
componente físico y el mental. Cada una de estas dimensiones, así como los
componentes puntúan de 0 a 100, donde el 0 es el peor estado de salud y el 100 el
mejor. Este cuestionario permite obtener un índice de utilidades a través del SF-
6D contenido en el mismo, el índice del SF-6D está comprendido entre 0 y 1,
donde el 0 es el peor estado de salud posible y el 1 el mejor [179].
3.2.4 Percepción de mejora
La percepción de mejora se midió a través de la Escala de Impresión
Clínica Global (GIIS) [180], que utiliza un único ítem en una escala de Likert de 8
valores desde 0 (no evaluado) hasta 7 (mucho peor).
3.2.5 Condición física
Se realizaron las pruebas de las baterías de condición física de los estudios
Exercise Look After You (ELAY) [181] y de la Red Española de Investigación en
Ejercicio Físico y Salud en Poblaciones Especiales (EXERNET) [182], y otros
test.
Los test de la batería ELAY fueron los siguientes:
- Fuerza de prensión manual: se utilizó el test de fuerza de prensión manual de
Rodriguez et al. [183, 184]. Este test consiste en evaluar la fuerza de las 2 manos
53
a través del dinamómetro manual digital (TKK 5401 Model; Tokyo, Japan). La
evaluación consiste en realizar 2 intentos con cada mano de forma alternativa y
posteriormente se realiza la suma de los mejores resultados de cada mano como
índice de fuerza de prensión manual.
- Flexibilidad: se utilizaron el test “Chair Sit-and-Reach [185] para el tren
inferior y el test “Back Scratch [186]para el tren superior. En el test “Chair Sit-
and-Reach” se evalúa la distancia que es capaz de alcanzar una persona con su
mano. Para ello se sienta la persona en una silla y manteniendo la pierna
totalmente extendida intenta llegar lo más lejos posible con la punta de sus dedos
orientados éstos hacia la punta de su pie. La punta del pie es considerado el 0 y
con una regla se mide la diferencia entre la punta del pie y la punta de los dedos
de la mano. Si la persona no es capaz de llegar a la punta del pie los valores serán
negativos, si por el contrario supera la punta de los pies los resultados serán
positivos. El test “Back Scratch” consiste en fijar un brazo detrás de la espalda por
debajo del cuello con la palma de la mano mirando hacia fuera, una vez fijado este
brazo se intenta llegar con el otro brazo lo más lejos posible por detrás de la
espalda y la palma de la mano mirando hacia la espalda. El 0 se corresponde con
la punta del dedo corazón de la mano fijada atrás por debajo del cuello. Si la
persona no consigue llegar a tocarse con la punta de los dedos corazones el
resultado será negativo y se corresponderá con la distancia entre estos dedos
evaluada mediante una regla. Si los dedos de la persona se sobrepasan los
números serán positivos y el resultado será la distancia entre estos dedos evaluada
mediante una regla.
54
- Timed Up-and-Go test (TUG): la prueba se efectúa pidiendo a los pacientes
levantarse, caminar 3 metros y volver atrás a la posición de partida en el menor
tiempo posible [187].
- Test de 6 minutos caminando [186]: se pide a los sujetos que caminen durante 6
minutos a buen ritmo en un pasillo de 20 metros, midiendo la distancia recorrida
en ese tiempo.
Los test de la batería EXERNET fueron los siguientes:
- Fuerza de extremidades superiores: se utilizó el test “Arm Curl Test” [188]. Este
test consiste en medir el número de flexo-extensiones que el participante es capaz
de ejecutar en un máximo de 30 segundos, sentado en una silla y sosteniendo una
mancuerna de 2,5 kg (mujeres) o 4 kg (hombres), una vez con cada brazo.
- Test de fuerza para las extremidades inferiores: se utilizó el Stand-Up [189]
Test. Este test cosiste en levantarse y sentarse en una silla el número máximo de
veces en 30 segundos.
- Velocidad: se utilizó el test “Brisk Walking Test” [190]. Este test consiste en
medir el tiempo que cada participante emplea en recorrer 20 m caminando. Se
realizan 2 repeticiones con un minuto de descanso entre ambas. Se registra el
resultado mejor.
- Alcance funcional: se utilizó el test “Functional Reach Test [191]”. El
participante se coloca al lado de una pared con los brazos a 90 grados del tronco
que tendrán que alcanzar la máxima distancia frontal y permaneciendo en esa
posición por algunos segundos, sin alterar su base de sustentación. Se registra la
distancia máxima alcanzada perpendicularmente a la pared.
Además se sometieron los pacientes a los siguientes test:
55
- Equilibrio: se midió por medio del aparato Biodex Balance System. Esta
máquina es un dispositivo multiaxial que mide objetivamente la capacidad del
individuo para estabilizarse. Se trata de una plataforma circular con capacidad
para hacerse inestable y moverse libremente en los ejes anteroposterior y
mediolateral [192]. Esta máquina proporciona feedback visual de la posición del
centro de presiones en cada instante del tiempo. Las puntuaciones se obtienen
mediante el índice de estabilidad general, el cual evalúa las desviaciones del
centro de presiones respecto al centro de la plataforma, por lo que una mayor
puntuación indica un peor equilibrio. Se realizó el protocolo M-CTSIB específico
de este instrumento, que incluye equilibrio con y sin feedback visual y con
superficie estable e inestable sobre foam.
- Fuerza-resistencia de la musculatura del tronco: se realizó un test de resistencia
abdominal y de la musculatura del tronco sobre una esterilla. La fuerza resistencia
de la musculatura flexora del tronco se mide pidiendo a los sujetos que se tumben
en posición supina y que levanten sus extremidades inferiores con una flexión de
90º de cadera y rodilla. Para evaluar la resistencia de los músculos extensores, los
sujetos se tumban en pronación. En ambos casos, se les pide a los sujetos que
alejen los hombros del suelo mediante una flexión o una extensión del tronco. Los
sujetos deben aguantar en esa posición el máximo tiempo posible, no excediendo
los 5 minutos [193].
- Familiarización: antes de cada sesión se proced a una fase de
calentamiento donde se explicó al participante la modalidad de ejecución del test
con prueba específica antes de su efectuación.
56
3.2.6 Composición corporal, tensión arterial y niveles de glucosa, colesterol y
triglicéridos en la sangre.
Se evaluaron los siguientes parámetros de composición corporal:
- Peso total y masa grasa o masa libre de grasa: estos valores se obtuvieron tanto
para el cuerpo completo como para los distintos segmentos corporales, a través
del aparato de bioimpedancia eléctrica “TANITA” (BioLógica Tecnología médica
S.L.).
- Niveles de glucosa, colesterol y triglicéridos: mediante las tiras reactivas
Accutrend con el aparato Accutrend GCT extrayendo la sangre de los capilares de
las yemas de los dedos de la mano.
- Tensión arterial: se midió con el aparato de autoevaluación “LogikoDigit” de la
Real Fuzzy Technology.
- Índice Cintura-Cadera: este índice se emplea frecuentemente en la literatura
científica como un indicador de salud y de riesgo cardiovascular, entre otros.
Consiste en medir con una cinta métrica el perímetro de la cintura y dividir por el
perímetro de la cadera [194].
3.3 Medidas de seguridad
Con el fin de detectar eventuales efectos indeseados se realizó un
seguimiento telefónico semanal de los pacientes. Además se les proporcionó un
cuadernillo donde apuntar la aparición de síntomas indeseados que pudieran estar
relacionados con la toma suministrada.
57
Tabla 10. Herramientas y cronograma de las medidas de la presente tesis
Tipo de evaluación
Screening
Línea
base
Tratamiento
Post-tratamiento
(a las 6 semanas)
Consentimiento informado
X
MEDIDAS PRIMARIAS
Cuestionario de variables sociodemográficas
X
Dolor, Sueño e Incapacidad:
- Presión puntos gatillo
X
X
- Escala Visual Analógica del dolora
X
- Cuestionario 15D
X
X
- Cuestionarios CIF, CIFR
X
X
MEDIDAS SECUNDARIAS
Calidad de Vida Relacionada con la salud:
cuestionarios SF-12v2
X
X
Depresión: cuestionario GDS
X
X
Felicidad: cuestionario felicidad general y escala
satisfacción vida
X
X
Condición física-Familiarización
X
X
Condición física-Batería ELAY:
- Test de prensión manual
X
X
- Flexibilidad: test “Chair Sit-and-Reach” y “Back
Scratch”
X
X
- Timed Up-and-Go test
X
X
- Test de 6 minutos caminando
X
X
Condición física Batería EXERNET
- Fuerza de extremidades superiores: Arm Curl
Test
X
X
-Fuerza de extremidades inferiores: Stand-Up test
X
X
- Velocidad: Brisk Walking Test
X
X
- Alcance funcional: Functional Reach Test
X
X
- Equilibrio: protocolo M-CTSIB del sistema
Biodex Balance
X
X
- Fuerza-resistencia musculatura tronco: test de
resistencia sobre esterilla
X
X
Composición corporal: bioimpedancia eléctrica,
glucemia, colesterol y triglicéridos, tensión arterial
y índice cintura-cadera
X
X
Impresión Clínica Global: Escala de Impresión
Clínica Global
X
aRelativamente a esta medida se hizo también un seguimiento del dolor durante 3 semanas después de
haber finalizado el tratamiento.
58
4. Método estadístico utilizado
Los 2 grupos se caracterizaron calculando sus medias y desviación
estándar para variables descriptivas.
El test t de Student para muestras independientes se utilizó para calcular
las diferencias entre las líneas base de los 2 grupos. Este test se utilizó también
para comparar las diferencias en el grado de dolor obtenido a través de la Escala
Analógica Visual entre los 2 grupos después del tratamiento.
El test de Kolmogorov-Smirnov se utilizó para calcular la distribución de
los datos con la significatividad de Lilliefors.
La prueba t se utilizó para estimar las diferencias de ambos grupos con
respecto a su línea base.
El análisis de la varianza (ANOVA en sus siglas en inglés) para medidas
repetidas fue utilizado para calcular el efecto del tratamiento entre los 2 grupos.
La eficacia del tratamiento fue evaluada para las variables no continuas
GDS (cut-off=5 puntos [178]) y SWLS (cut-off=20 puntos [176]). Fue también
calculado el número necesario para el tratamiento (95% CI) con el programa
QuickCalcs (GraphPad software). El GL se escogió como unidad de tratamiento.
Para todas las variables se efectuaron 2 análisis diferentes. Un análisis de
eficacia (Efficacy analysis) que inclu todas las medidas de los participantes que
acabaron el estudio y que tomaron al menos el 80% de las dosis, y un análisis de
intento de tratamiento (Intent-to-Treat analysis), con todos los participantes que
fueron inicialmente aleatorizados (n=64), incluyendo los que no acabaron el
tratamiento. Durante estos análisis se imputaron los valores perdidos utilizando el
valor medio obtenido por el grupo de pertenencia para la variable específica.
59
El nivel de significatividad se estableció en p<0,05. Todos los análisis se
llevaron a cabo con el programa estadístico SPSS (versión 21) y con
Microsoft Office Excel 2007.
5. Aspectos éticos
El estudio ha sido aprobado por el Comité de bioética y bioseguridad de la
Universidad de Extremadura (número de registro 91/2014) con fecha del 27 de
Octubre de 2014. El estudio se llevó a cabo siguiendo las normas deontológicas
reconocidas por la Declaración de Helsinki (52ª Asamblea General Edimburgo,
Escocia, Octubre 2000), las normas de buena práctica clínica y cumpliendo la
legislación vigente y la normativa legal vigente española. Antes de comenzar, se
explicó detalladamente a los participantes el estudio que se pretendía realizar y se
pidió la conformidad previa por medio de la firma del consentimiento informado
en el que se detallaban por escrito todas las fases del estudio que fue previamente
registrado en el Australian New Zealand Clinical Trials Registry (ANZCTR) con
ID numero: ACTRN12614001201662.
60
RESULTS
1. Safety and effects of G. lucidum on pain, sleep and impact on fibromyalgia
A total of 70 people were assessed for eligibility. Five people did not meet with de
inclusion criteria because they were not diagnosticated with fibromyalgia (FM) or
in other case they suffer from diabetes. One person did not participate for personal
reasons. At the final, 64 participant was randomly allocated in 1 of the 2 group.
One participant decided not to start the treatment after allocation, while another
was lost at the follow-up because it was impossible to find her. Of the 62
participant remaining, 10 decided to stop the treatment. A total of 52 participants
took at least 80% of the treatment, which means 81% of the initial sample.
Number of participants who decided to stop treatment was 5 for both groups
(table 11). Total abandons percentage due to treatment was less than 16%.
Table 11: Symptoms of participants who did not complete the minimum 80% of
the treatment
GLG
CSG
Ingested
doses
Symptoms
30
30
50
52
58
3
4
26
32
67,5
Total
GLG
Total
CSG
Agitation
x
0
1
Dehydratation and swelling
x
0
1
Diarrhea
x
x
x
2
1
Dyspepsia
x
1
0
Headache
x
0
1
Meteorism
x
x
1
1
Nausea and vomiting
x
x
x
x
x
x
x
3
4
Itching and irritation
x
0
1
Stomach problems (pain, acidity,
burning, cramp and not specified
discomfort)
x
x
x
x
x
x
x
x
x
5
4
Hypertension
x
0
1
GLG: Ganoderma lucidum Group; CSG: Ceratonia siliqua Group.
61
Two participants completed the treatment, but were excluded because they began
to receive other non usual care therapies during the treatment. A total of 50
patients were evaluated in the efficacy analysis (figure 6).
Figure 6. Flow diagram of participants.
62
Descriptive statistics are shown in table 12. As can be observed, no statistically
significant differences were shown between the 2 groups at baseline.
Table 12. Characteristics of women with FM from both groups at baseline
GLG (n=26)
CSG (n=24)
P*
Age (years)
56.19 (7.97)
53.74 (11.50)
.382
Height (cm)
157.08 (4.55)
156.29 (6.08)
.541
Weight (kg)
64.26 (9.67)
61.30 (13.24)
.411
Date when FM symptoms started
1994 (11.86)
1992 (12.56)
.601
Date of diagnosis
2006 (6.56)
2003 (7.02)
.935
Muscle mass (%)
61.97 (7.17)
64.82 (8.58)
.245
Fat mass (%)
34.81 (7.51)
32.24 (7.75)
.285
BMI (kg/m2)
26.05 (3.75)
25.06 (4.75)
.522
15D total score (0 worst; 1 best)
0.64 (0.12)
0.69 (0.09)
.092
FIQ score (0 best; 100 worst)
63.64 (21.77)
59.47 (13.74)
.427
FIQ-R score (0 best; 100 worst)
56.37 (18.64)
53.69 (16.54)
.594
Values expressed as mean (SD); GLG: Ganoderma lucidum Group; CSG: Ceratonia siliqua
Group; FM: Fibromyalgia. BMI: Body Mass Index; FIQ: Fibromyalgia Impact Questionnaire. *p
value of the Student´s t test.
Results of the efficacy analysis can be seen in table 13. After the 6-week
treatment, no statistically significant differences were observed in the pain level
between the Ganoderma lucidum Group (GLG) and the active placebo group or
Ceratonia siliqua Group (CSG), both for self reported pain and FIQ-R dimension.
Evolution of self-reported pain every day at morning can be seen in figure 7.
Statistically significant differences between the 2 groups were observed in 6
particular days (4 days during treatment, namely, 6th, 8th, 28th, and 30th; and 2
days after treatment, i.e. 1st and 5th). GLG has showed statistically significant
difference with respect its base-line in 23 of 42 days treatment, while CSG in 7
days of 42.
63
Statistically significant difference in favor of GLG in the FIQ score (p=.046) was
observed. The treatment effect of this measure was -11.65, which means an effect
higher than 18%. The GLG intra-group analysis (compared to the group baseline)
revealed an improvement higher than 37% (p<.01). Table 13 also shows that GLG
significantly improved every assessed outcome compared to baseline, including
pain dimension in the FIQ questionnaire while CSG did not.
64
Table 13. Effects of 6 weeks of treatment on pain, impact of fibromyalgia and HRQoL. Efficacy analysis
GLG (n=26)
CSG (n=24)
Mean (SD) at
baseline
Mean (SD) after
treatment
Pa
Mean (SD) at
baseline
Mean (SD) after
treatment
Pa
Pb
Effect size
Treatment effect
(95% CI)
Pain reported during
treatment*
54.39 (20.93)
43.91 (26.92)
.034
59.32 (26.83)
48.77 (27.27)
.052
.993
<0.001
0.07 (-15.50 to 15.64)
Pain assessed by FIQ-R
7.15 (2.09)
4.92 (2.62)
<.01
7.17 (1.6)
6.33 (2.10)
.084
.053
0.212
-1.39 (-8.49 to 0.69)
FIQ total score
63.64 (21.77)
40.21 (21.92)
<.01
59.47 (13.74)
47.69 (16.25)
<.01
.046
0.593
-11.65 (-23.04 to -0.24)
FIQ-R total score
56.37 (18.64)
39.67 (20.28)
<.01
53.69 (16.55)
43.51 (13.17)
<.01
.195
0.379
-6.52 (-2.82 to 0.02)
Function domain
14.26 (6.05)
10.58 (6.60)
<.01
13.71 (6.25)
11.90 (6.92)
.276
.347
0.274
-1.87 (-16.50 to 3.46)
Overall impact domain
9.85 (6.16)
6.31 (5.66)
.011
9.21 (5.76)
6.42 (4.09)
.059
.696
0.114
-0.75 (-5.84 to 2.09)
Symptom domain
32.27 (8.71)
22.79 (10.08)
<.01
30.77 (7.55)
25.19 (5.85)
<.01
.094
0.493
-3.9 (-4.56 to 3.07)
15D total score
0.64 (0.12)
0.75 (0.11)
<.01
0.69 (0.09)
0.76 (0.10)
<.01
.130
0.445
0.04 (-0.01 to 0.09)
HRQoL: Health-related quality of life; FIQ: FIbromyalgia Impact Questionnaire; GLG: Ganoderma lucidum Group; CSG: Ceratonia siliqua Group; ap of t-test; bp-values of
analysis of variance for repeated measures to compare differences between groups after treatment; CI: confidence interval; *Sample size were n=23 for GLG and n=22 for CSG.
65
Figure 7. Pain reported every day at morning by the 2 groups.
GLG: Ganoderma lucidum Group; CSG: Ceratonia siliqua Group. AT: After the end of the treatment. *: Significant improvement in the GLG relative to the CSG (p<.05);
†: Significant improvement in the GLG relative to the baseline (p<.05); Δ: Significant improvement in the CSG relative to the baseline (p<.05).
66
Figure 8 shows the score for each of the 10 FIQ items of both groups at baseline
and after treatment. Significant improvement in the GLG relative to CSG was
observed for "do Job" and "work missed". Within-group analysis revealed a
significant change from baseline to after-treatment in all 10 items for GLG, while
CSG significantly improved "pain", "fatigue", "rested", "stiffness", and
"depression".
Figure 8. Fibromyalgia Impact Questionnaire (FIQ) profile for G. lucidum Group
(GLG; n=26) and C. siliqua Group (CSG; n=24) at baseline and after treatment.
*:Significant improvement in the GLG relative to the CSG (p<.05); †:Significant improvement in
the GLG relative to the baseline (p<.05); Δ:Significant improvement in the CSG relative to the
baseline (p<.05).
FIQ
67
The 15D profiles for both groups at baseline and after treatment can be seen in
figure 9. Significant improvement between groups was observed in dimensions
"sleep" and "move". Significant improvement in the GLG relative to baseline was
observed in 6 of the 15 dimensions, namely "sleep", "usual activities", "mental
function", "discomfort", "depression", "distress", and "vitality"; while CSG
significantly changed in 4 of the 15 dimensions, i.e. "depression", "distress",
"vitality", and "sex".
Figure 9. 15D profile for G. lucidum Group (GLG; n=26) and C. siliqua Group
(CSG; n=24) at baseline and after treatment.
*:Significant improvement in the GLG relative to the CSG (p<.05); †:Significant improvement in
the GLG relative to the baseline (p<.05); Δ:Significant improvement in the CSG relative to the
baseline (p<.05).
15D
68
Intent-to-treat analysis is shown in table 14. Statistically significant
difference was observed in the overall domain of FIQ-R (p=.048), in favor to
GLG. Within-group improvement were observed for GLG in all variables except
in pain reported during treatment. Similar results were found for the CSG,
improving all variables compared to the baseline, with the exception of the FIQ-R
function domain.
69
Table 14. Effects of 6 weeks of treatment on pain, impact of fibromyalgia and HRQoL. Intent-to-treat analysis
GLG (n=32)
CSG (n=32)
Mean (SD) at
baseline
Mean (SD) after
treatment
Pa
Mean (SD) at
baseline
Mean (SD) after
treatment
Pa
Pb
Effect
size
Treatment effect
(95% CI)
Pain reported during
treatment
52.40 (18.50)
44.88 (27.22)
.109
54.19 (26.66)
44.06 (24.59)
.028
.104
0.683
2.61 (-2.31 to -0.07)
Pain assessed by FIQ-R
7.44 (2.00)
5.22(2.48)
<.01
6.84(1.67)
5.81 (2.22)
<.01
.539
0.038
-1.19 (-10.05 to 15.25)
FIQ total score
65.49 (20.03)
43.11 (21.50)
<.01
59.60 (13.68)
46.68 (16.41)
<.01
.499
0.054
-9.46 (-19.10 to 0.17)
FIQ-R total score
58.49 (17.78)
42.67 (20.03)
<.01
51.87 (16.95)
42.31 (14.24)
<.01
.383
0.136
-6.26 (-14.56 to 2.04)
Function domain
15.20 (5.95)
11.66 (6.51)
<.01
13.60 (5.98)
11.87 (7.00)
.191
.283
0.269
-1.81 (-5.02 to 1.42)
Overall impact domain
10.03 (5.84)
7.14 (6.05)
.013
8.69 (5.49)
6.09 (4.47)
.027
.048
0.853
-0.29 (-3.43 to 2.84)
Symptom domain
33.27 (8.39)
23.88 (9.64)
<.01
29.58 (8.27)
24.35 (6.18)
<.01
.539
0.038
-4.16 (-8.07 to -0.24)
15D total score
0.63 (0.11)
0.74 (0.11)
<.01
0.69 (0.09)
0.75 (0.09)
<.01
.413
0.109
0.05 (-0.01 to 0.09)
HRQoL: Health-related Quality of Life; FIQ: FIbromyalgia Impact Questionnaire; GLG: Ganoderma lucidum Group; CSG: Ceratonia siliqua Group; ap of t-test; bp-values of
analysis of variance for repeated measures to compare differences between groups after treatment; CI: confidence interval.
70
2. Effects of G. lucidum on happiness, depression, HRQoL and global
improvement
From the 50 participants who complied with the inclusion criteria as reported in
figure 6, 1 participant belonging to the CSG was not able to complete the General
Happiness Scale (GHS, n=49) and the Satisfaction with Life Scale (SLS, n=49)
while 3, 2 belonging to the CSG and 1 to the GLG, were not able to complete
Geriatric Depression Scale (GDS, n=47), in all case due to emotional impairment.
Effects of GL and CS on depression and happiness are shown in table 15.
Following the 6-week treatment period, a statistically significant difference in
happiness using GHS was observed between the 2 groups (p<.05). The paired t
test revealed a significant enhancement in GHS score (p<.01) in the GLG,
whereas no statistically significant change was found in CSG. No statistically
significant difference was found between groups in satisfaction with life (assessed
using SLS) and depression (assessed using GDS). However, the paired t test
revealed a significant enhancement in both outcomes in GLG, whereas no
statistically significant change was observed in CSG.
Number-needed-to-treat analysis for GDS was 4. This means that about 1 of 4
patients was benefited from the treatment. In SLS this number was 3, meaning
that about 1 of 3 patients was benefited from the treatment.
Perception of treatment efficacy was significantly better in GLG than in CSG
(p<.05) as can be seen in the GIIS score. However, no statistically significant
differences in any dimension of SF-12 were observed between the 2 groups (table
16 and 17).
71
Table 15. Effects of 6-week treatment with G. lucidum or C. siliqua on happiness,
depression, satisfaction with life and GIIS in women with fibromyalgiaa
Baseline
(mean ± SD)
After 6 weeks’
treatment
(mean ± SD)
Pb
Treatment effect. mean
(95% CI)
pc
EFFICACY
GHS
GLG (n= 26)
3.83 ± 1.57
4.67 ± 1.44
.009
0.66 (from 0.01 to 1.32)
.048
CSG (n= 23)
4.55 ± 1.10
4.74 ± 0.93
.428
SLS
GLG (n= 26)
16.58 ± 7.28
19.27 ± 7.17
.003
2.69 (from 0.46 to 5.85)
.092
CSG (n= 23)
19.13 ± 7.34
19.13 ± 7.31
.326
GDS
GLG (n= 25)
7.60 ± 3.39
5.36 ± 3.94
.001
-1.51 (from -3.51 to 0.48)
.134
CSG (n= 22)
6.55 ± 3.12
5.81 ± 3.74
.379
GIIS
GLG (n= 26)
NA
2.54 ± 1.45
NA
NA
.037
CSG (n= 24)
NA
3.46 ± 1.59
INTENT-TO-TREAT (n=64; GLG=32; CSG=32)
GHS
GLG
4.00 ± 1.64
4.69 ± 1.45
.007
0.52 (from 0.048 to 1.09)
.072
CSG
4.43 ± 1.25
4.59 ± 1.14
.305
SLS
GLG
17.22 ± 7.17
19.60 ± 7.35
.003
3.35 (from 0.62 to 6.09)
.017
CSG
19.00 ± 6.80
18.03 ± 6.90
.326
GDS
GLG
7.25 ± 3.45
5.60 ± 4.14
.007
-0.93 (from -3.67 to 0.23)
.082
CSG
6.31 ± 3.01
6.38 ± 4.14
.927
aValues are expressed in points. bp of t-test. cp-values of analysis of variance for repeated
measures to compare difference between groups after 6 weeks treatment; GDS, Geriatric
Depression Scale; GHS, General Happiness Scale; SLS, Satisfaction with Life Scale; GIIS:
Global Impression of Improvement Scale; GLG, Ganoderma lucidum Group; CSG, Ceratonia
siliqua Group; NA: Not Applicable.
72
Table 16. Effects of 6-week treatment with Ganoderma lucidum or Ceratonia
siliqua on HRQoL in women with fibromyalgia. Efficacy analysisa
Baseline
(mean ± SD)
After 6 weeks’
treatment (mean ±
SD)
pb
Treatment effect. mean
(95% CI)
pc
SF12v2 (n=50; GLG=26; CSG=24)
PHYSICAL FUNCTION
GLG
39.42 ± 37.53
47.12 ± 31.09
.175
5.61 (from -10.48 to 21.70)
.487
CSG
41.67 ± 24.08
43.75 ± 35.55
.723
PHYSICAL ROLE
GLG
52.88 ± 31.29
62.50 ± 28.06
.106
1.8 (from -14.76 to 18.37)
.828
CSG
46.35 ± 22.57
54.17 ± 27.00
.200
BODILY PAIN
GLG
40.38 ± 39.42
56.73 ± 29.63
.047
10.10 (from -9.64 to 29.84)
.309
CSG
40.63 ± 31.98
46.88 ± 25.87
.283
GENERAL HEALTH
GLG
17.50 ± 22.55
30.00 ± 25.22
.015
4.58(from -9.13 to 18.29)
.505
CSG
27.08 ± 22.98
35.00 ± 21.37
.118
VITALITY
GLG
30.77 ± 31.07
38.46 ± 32.58
.319
-7.93 (from -26.88 to 11.02)
.404
CSG
26.04 ± 23.86
41.67 ± 20.41
.008
SOCIAL FUNCTIONING
GLG
51.92 ± 37.36
72.11 ± 38.94
.030
13.94 (from -10.23 to 38.11)
.252
CSG
56.25 ± 37.77
62.50 ± 36.11
.450
EMOTIONAL ROLE
GLG
61.06 ± 28.79
75.48 ± 26.81
.033
5.57 (from -12.52 to 23.66)
.539
CSG
59.90 ± 27.82
68.75 ± 26.58
.174
MENTAL HEALTH
GLG
39.90 ± 25.25
59.61 ± 25.32
.001
6.17 (from -7.61 to 19.95)
.373
CSG
47.91 ± 19.39
61.46 ± 17.64
.008
STANDARDIZED PHYSICAL COMPONENT
GLG
34.31 ± 9.89
37.31 ± 10.70
.104
2.24 (from -2.88 to 7.37)
.383
CSG
34.55 ± 7.48
35.31 ± 9.21
.681
STANDARDIZED MENTAL COMPONENT
GLG
39.46 ± 10.57
46.33 ± 13.20
.011
-0.06 (from -6.66 to 6.65)
.987
CSG
39.83 ± 9.65
46.76 ± 9.54
.003
aValues are expressed in points. bp of t-test. cp-Values of analysis of variance for repeated measures to
compare difference between groups after 6 weeks treatment. SF12v2, short-form health survey 12 version
2; GLG, Ganoderma lucidum Group; CSG, Ceratonia siliqua Group.
73
Table 17. Effects of 6-week treatment with Ganoderma lucidum or Ceratonia
siliqua on HRQoL in women with fibromyalgia. Intent-to-treat analysisa
Baseline
(mean ± SD)
After 6 weeks’
treatment (mean ±
SD)
pb
Treatment effect. mean
(95% CI)
pc
SF12v2 (n=64; GLG=32; CSG=32)
PHYSICAL FUNCTION
GLG
36.72 ± 35.35
42.19 ± 30.74
.256
-0.78 (from -15.96 to 14.39)
.918
CSG
38.28 ± 26.93
44.53 ± 34.63
.301
PHYSICAL ROLE
GLG
49.22 ± 30.44
60.16 ± 27.39
.029
-0.39 (from -15.90 to 15.12)
.960
CSG
42.19 ± 26.13
53.52 ± 25.84
.073
BODILY PAIN
GLG
37.50 ± 37.57
50.78 ± 33.29
.051
0.78 (from -16.30 to 17.87)
.927
CSG
35.94 ± 29.74
48.44 ± 25.35
.030
GENERAL HEALTH
GLG
17.66 ± 22.40
26.25 ± 25.93
.051
-0.94 (from -12.69 to 10.81)
.874
CSG
22.66 ± 22.14
32.19 ± 21.06
.026
VITALITY
GLG
28.13 ± 28.93
35.94 ± 31.07
.217
-6.25 (from -21.53 to 9.03)
.417
CSG
26.56 ± 22.84
40.63 ± 20.82
.004
SOCIAL FUNCTIONING
GLG
54.69 ± 35.03
71.09 ± 36.54
.038
9.38 (from -11.41 to 30.16)
.371
CSG
54.69 ± 35.03
61.72 ± 35.35
.331
EMOTIONAL ROLE
GLG
58.98 ± 29.99
73.83 ± 27.38
.009
3.13 (from -13.90 to 20.15)
.715
CSG
58.20 ± 29.72
69.928 ± 26.15
.087
MENTAL HEALTH
GLG
37.89 ± 24.28
55.47 ± 27.30
.000
5.85 (from -5.46 to 17.18)
.305
CSG
48.83 ± 18.06
60.55 ± 17.13
.004
STANDARDIZED PHYSICAL COMPONENT
GLG
33.51 ± 9.22
35.73 ± 10.60
.154
-0.55 (from -5.28 to 4.18)
.817
CSG
32.59 ± 8.39
35.36 ± 8.94
.137
STANDARDIZED MENTAL COMPONENT
GLG
38.93 ± 10.49
45.61 ± 13.26
.003
0.63 (from -5.22 to 6.47)
.832
CSG
40.44 ± 9.70
46.50 ± 9.58
.006
aValues are expressed in points. bp of t-test. c p-Values of analysis of variance for repeated measures to
compare difference between groups after 6 weeks treatment. SF12v2: Short-Form Health Survey 12
version 2; GLG: Ganoderma lucidum group; CSG: Ceratonia siliqua Group.
74
3. Effects of G. lucidum on physical fitness
Efficacy analysis for physical fitness were performed with a total of 48 women,
25 belonging to GLG and 23 belonging to CSG, because in comparison with the
50 participants analyzed as shown in figure 6, 1 woman did not show up when
m