No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Strategies and Challenges to Myocardial Replacement Therapy
Abstract
Significance:
This article outlines the advantages and limitations of the cell injection and patch approaches to cardiac regenerative therapy. If the field is to move forward, some fundamental questions require answers, including the limitations to the use of animal models for human cell-transplantation studies; the best way to measure success in terms of functional improvements, histological integration, electrical coupling, and arrhythmias; and where the cells should be applied for maximal benefit-the epicardium or the myocardium.
... In vitro, contractilities have been demonstrated with hydrogels, gels and solid scaffolds [35,36]. With respect to tissue sheet technology, thicker patches have been shown to necessitate the incorporation of gelatin hydrogels between layers, while long-term contractility in vitro is still a challenge [37]. ...
... For long-term contractility in vitro, angiogenesis and the tissue engineering of a thick contractile construct and in vivo transfer, solid scaffolds are superior to hydrogel or gels [35,36]. In this review, we emphasize the rationale for having a solid scaffold for engineering a contractile tissue in vitro and for cellular therapy. ...
... As with gels or hydrogels, the scaffold can be additionally cross-linked to increase its stiffness, control its biodegradability and maintain its architecture. For review [35,36]. Scaffolds frequently used in tissue engineering have compositions that mimic the composition of the native ECM of soft tissues (i.e., containing both collagen and elastin). ...
Currently, the clinical impact of cell therapy after a myocardial infarction (MI) is limited by low cell engraftment due to low cell retention, cell death in inflammatory and poor angiogenic infarcted areas, secondary migration. Cells interact with their microenvironment through integrin mechanoreceptors that control their survival/apoptosis/differentiation/migration and proliferation. The association of cells with a three-dimensional material may be a way to improve interactions with their integrins, and thus outcomes, especially if preparations are epicardially applied. In this review, we will focus on the rationale for using collagen as a polymer backbone for tissue engineering of a contractile tissue. Contractilities are reported for natural but not synthetic polymers and for naturals only for: collagen/gelatin/decellularized-tissue/fibrin/Matrigel™ and for different material states: hydrogels/gels/solids. To achieve a thick/long-term contractile tissue and for cell transfer, solid porous compliant scaffolds are superior to hydrogels or gels. Classical methods to produce solid scaffolds: electrospinning/freeze-drying/3D-printing/solvent-casting and methods to reinforce and/or maintain scaffold properties by reticulations are reported. We also highlight the possibility of improving integrin interaction between cells and their associated collagen by its functionalizing with the RGD-peptide. Using a contractile patch that can be applied epicardially may be a way of improving ventricular remodeling and limiting secondary cell migration.
... So, up-to-date cutting-edge nanotechnology aims to associate the use of biomaterials, as patches or injectable hydrogels, with the incorporation of CSCs. The use of these technologies for cardiac tissue regeneration is potentially advantageous because they could obtain a better engraftment of delivered stem cells, but to date several limits and critical issues remain to be resolved (Table 1) [58][59][60][62][63][64][65][66][67][68][69][70]. The main pending issues, concerning the use of biomaterials as patches or injectable hydrogels for cardiac regeneration are related to the complexity of heart microenvironment and pathophysiology following MI. ...
... Vascularization of engineered tissues in vitro and in vivo remains another key problem in the translation of engineered tissues to clinical practice [101]. To reduce these problems, thicker multiple-cell layered cardiac patches with integrated engineered vessels or a primitive vascular network able to anastomosing with host vessels have been introduced [65]. In this way, the oxygen diffusion was improved and a good nutrient apport to the encapsulated cells was guaranteed [102,103]. ...
... [58][59][60][62][63][64][65][66][67][68][69][70]. ...
Cardiovascular disease (CVD) remains the leading cause of death in Western countries. Post-myocardial infarction heart failure can be considered a degenerative disease where myocyte loss outweighs any regenerative potential. In this scenario, regenerative biology and tissue engineering can provide effective solutions to repair the infarcted failing heart. The main strategies involve the use of stem and progenitor cells to regenerate/repair lost and dysfunctional tissue, administrated as a suspension or encapsulated in specific delivery systems. Several studies demonstrated that effectiveness of direct injection of cardiac stem cells (CSCs) is limited in humans by the hostile cardiac microenvironment and poor cell engraftment; therefore, the use of injectable hydrogel or pre-formed patches have been strongly advocated to obtain a better integration between delivered stem cells and host myocardial tissue. Several approaches were used to refine these types of constructs, trying to obtain an optimized functional scaffold. Despite the promising features of these stem cells’ delivery systems, few have reached the clinical practice. In this review, we summarize the advantages, and the novelty but also the current limitations of engineered patches and injectable hydrogels for tissue regenerative purposes, offering a perspective of how we believe tissue engineering should evolve to obtain the optimal delivery system applicable to the everyday clinical scenario.
... Restricted myocardial regeneration after tissue damage and shortage of donor organs for cardiac transplantation are the principal constraints of conventional therapy. 1 As a result, at present, in regenerative medicine, cellular cardiomyoplasty is one of the promising therapeutic options, especially for the maintenance and repair of various cardiac disorders, such as post-infarction left ventricular remodelling, dilated cardiomyopathies, and concentric hypertrophy. [2][3][4][5][6][7][8][9][10] Preclinical and clinical studies have shown that whole marrow isolates and/or cultured somatic-derived stem and/or progenitor cells, e.g. mesenchymal stem cells (MSCs), endothelial progenitor cells (EPCs), as well as induced pluripotent stem cells (iPSCs), may possibly contribute to myocardial repair in vivo and alleviate cardiac symptoms, although the mechanisms for this remain obscure. ...
... 4,30 Recently, some newer therapeutic strategies have, however, been explored for augmenting and/or promoting the effects of cell-based therapy, one of them is genetic enhancement of stem cells. 5,6,9 As a result, combining stem cell therapy with gene therapy is a viable strategy for the prevention and treatment of cardiac dysfunctions. 31 Therefore, in this study, using mouse MI model, we investigated whether the engraftment, electrical connectivity, and reparative potency of hiPSC-derived CMs can be Using CDH2 plasmid (Addgene No. 38153), CDH2 insert was generated by PCR amplification with a pair of oligos (forward: 5 0 -tcctatctcccccataagagtttgagtcgactgatcaaaaaccggtatgtgccggatagcgggagcgct-3 0 , reverse: 5 0 -ctga agcttttctgtaatttacttatcgggaggaatcggtggcgcgccgtcatcacctccaccatacatgt-3 0 ) (Invitrogen) (for details, see the Supplementary material online). ...
Aims
In regenerative medicine, cellular cardiomyoplasty is one of the promising options for treating myocardial infarction (MI); however, the efficacy of such treatment has shown to be limited due to poor survival and/or functional integration of implanted cells. Within the heart, the adhesion between cardiac myocytes (CMs) is mediated by N-cadherin (CDH2) and is critical for the heart to function as an electromechanical syncytium. In this study, we have investigated whether the reparative potency of human-induced pluripotent stem cell-derived cardiac myocytes (hiPSC-CMs) can be enhanced through CDH2 overexpression.
Methods and results
CDH2-hiPSC-CMs and control wild-type (WT)-hiPSC-CMs were cultured in myogenic differentiation medium for 28 days. Using a mouse MI model, the cell survival/engraftment rate, infarct size, and cardiac functions were evaluated post-MI, at Day 7 or Day 28. In vitro, conduction velocities were significantly greater in CDH2-hiPSC-CMs than in WT-hiPSC-CMs. While, in vivo, measurements of cardiac functions: left ventricular (LV) ejection fraction, reduction in infarct size, and the cell engraftment rate were significantly higher in CDH2-hiPSC-CMs treated MI group than in WT-hiPSC-CMs treated MI group. Mechanistically, paracrine activation of ERK signal transduction pathway by CDH2-hiPSC-CMs, significantly induced neo-vasculogenesis, resulting in a higher survival of implanted cells.
Conclusion
Collectively, these data suggest that CDH2 overexpression enhances not only the survival/engraftment of cultured CDH2-hiPSC-CMs, but also the functional integration of these cells, consequently, the augmentation of the reparative properties of implanted CDH2-hiPSC-CMs in the failing hearts.
... Several review articles of the literature indicate the clinical success rates of anterior cervical fusion at one level are about 70% with a reoperation rate at the two-year follow-up of 10% [14]. The clinical results of anterior cervical discectomy and fusion (ACDF) decrease the more levels that are fused [15,16]. Another inherent problem with anterior cervical fusion is the failure of the fusion to heal. ...
... The surgical results of three-and four-level anterior cervical fusions are certainly less than the 65% success rate reported with fusion at a single level. Thus, patients with more than two levels of degenerative changes in their neck have very poor surgical options [15,16]. Performing CADR at more than two levels is unusual and would very rarely be covered under insurance benefits. ...
Objective: Millions of patients suffer chronic neck pain, headaches, inter-scapular pain, and radiating arm pain from degenerated cervical discs. Operative options include cervical disc fusion or cervical artificial disc replacement. Patients with more than two degenerated discs have minimal surgical options. Study Design: This is a prospective nonrandomized study of the two- year follow-up results of injecting bone marrow concentrate (BMC) into symptomatic degenerated cervical discs compared to five FDA studies comparing Cervical Artificial Disc Replacement (CADR) to Anterior Cervical Fusion (ACF). The BMC study is class two data. The FDA studies are class one data. Methods: There were 182 patients in the BMC study. The 30- minute procedure involved aspirating 55ml of bone marrow from the iliac wing, concentrating this via centrifugation to a volume of 3ml, and then injecting 0.5ml of the bone marrow concentrate into each abnormal cervical disc. The FDA studies involved 788 CADR and 671 ACF one level patients. There were 225 two-level CADR and 105 fusion patients. All the studies had a 2 -year follow-up. Inclusion/exclusion requirements were similar in all the studies. All of the studies similarly compared clinical outcomes. Results: The average NDI improved 63% and VAS 67% in the BMC study. All scores had a P-value of less than 0.001. There was no difference in the clinical results comparing one, two, three, four or five-disc levels injected. There were no injection complications, and no patient was made worse. The overall success in the CADR one level studies was 74% with a reoperation rate of 3%. The one level ACF had a success of 65.3%, and reoperation of 6.7%. The two-level CADR had a success of 69.7% and a reoperation rate of 3%. The ACF patients had a success of 37.4% and a reoperation rate of 11%. Conclusions: These results indicate a BMC injection may be a reasonable non-surgical option for patients with symptomatic degenerated cervical discs, especially in the multi-level abnormal disc patients.
... An alternative interventional approach involves stem cell therapy, such as cell injection into the myocardium. This approach is surgically less invasive, but has been shown to have low viability and weak host cell integration [51,[58][59][60]. Therefore, there is an urgent need to address these challenges to effective CVD treatment through the development of new therapeutic strategies. ...
... to 3D cardiovascular bioprinting, cell based regenerative therapies have been considered as an alternative, and useful strategy for the management of patient heart failure. These cell-based therapies have included: (i) direct injection, (ii) cell sheet engineering, (iii) 3D cell organoids, (iv) injectable hydrogels, (v) cardiac patches, and (vi) engineered scaffolds, among others [2,11,12,14,46,60,79]. Compared to these methods, 3D bioprinting can provide essential environmental parameters for expanding cell populations and influencing cell behaviors. ...
... Current therapies are with lower early mortality rates. Thus, the myocardial tissue regeneration with the application of stem cells is an effective therapeutic option [16]. The ability to improve cardiac function with the stem cell-based therapy needs to be further addressed [16]. ...
... Thus, the myocardial tissue regeneration with the application of stem cells is an effective therapeutic option [16]. The ability to improve cardiac function with the stem cell-based therapy needs to be further addressed [16]. A long-term retention within the injection site is necessary for a consistent benefit to treat myocardial infarction [17,18]. ...
Aim:
To investigate the survival of bone marrow mesenchymal stem cells (BMSCs) and the therapeutic effect for acute myocardial infarction (AMI) after co-transplantation with the functionalized self-assembling peptide nanofiber RAD/PRG or RAD/KLT.
Methods:
AMI of balb/c mice was induced. Mice were randomly divided into four groups, and received treatment of phosphate buffered saline (PBS) (Group A), GFP/Fluc-BMSCs (Group B), GFP/Fluc-BMSCs + RAD/PRG (Group C), and GFP/Fluc-BMSCs + RAD/KLT (Group D), respectively. Bioluminescence imaging (BLI) was performed on day 1 (d-1), d-4, d-7, d-10, and d-13 after transplantation. Magnetic resonance imaging (MRI) was performed at baseline (d-4 before transplantation) and d-29 after treatment. Mice were euthanized on d-29 following treatment. Paraffin sections were obtained from the top, mid and bottom part of the infarcted region along the long-axis of the heart. Hematoxylin and eosin (HE) staining and immunohistochemical staining were performed. The infarct ratio micro-vascular density (MVD) was quantified.
Results:
There was a significant higher of BLI signal intensity of BMSCs in Group C than that in Group B (d-4, 9713±320 vs. 8164±378, P=0.0008; d-7, 6489±241 vs. 5417±361, P=0.0026; d-10, 3768±255 vs. 0, P < 0.0001). The left ventricular ejection fraction (LVEF) via MRI examination was significantly improved in both Group C and Group D. Infarct ratio and MVD were significantly improved in both Group C and Group D.
Conclusion:
Our data highlights BMSCs combining functionalized self-assembling peptide nanofibers RAD/PRG or RAD/KLT as promising therapy for AMI.
... Another challenge of cell-based therapies in ischemic heart diseases is how to best retain the transplanted stem cells and improve their survival and efficacy in an ischemic heart [2,11,25,29]. There are two major categories for cell delivery for cell-based therapy: cell injection and cardiac patch. ...
... Stem cell therapy has enormous potential in cardiovascular regeneration, but there are many challenges to regenerate the injured or damaged heart, such as the best stem cell type(s) and methods for cell delivery, and the timing of administration [11]. Most of the literature reporting the use of stem cell therapies in ischemic heart disease have aimed at replacement of the infarcted tissue [5,8,20,39,51,55]. ...
Ischemic heart disease is still the leading cause of death even with the advancement of pharmaceutical therapies and surgical procedures. Early vascularization in the ischemic heart is critical for a better outcome. Although stem cell therapy has great potential for cardiovascular regeneration, the ideal cell type and delivery method of cells have not been resolved. We tested a new approach of stem cell therapy by delivery of induced vascular progenitor cells (iVPCs) grown on polymer micro-bundle scaffolds in a rat model of myocardial infarction. iVPCs partially reprogrammed from vascular endothelial cells (ECs) had potent angiogenic potential and were able to simultaneously differentiate into vascular smooth muscle cells (SMCs) and ECs in 2D culture. Under hypoxic conditions, iVPCs also secreted angiogenic cytokines such as vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (bFGF) as measured by enzyme-linked immunosorbent assay (ELISA). A longitudinal micro-scaffold made from poly(lactic-co-glycolic acid) was sufficient for the growth and delivery of iVPCs. Co-cultured ECs and SMCs aligned well on the micro-bundle scaffold similarly as in the vessels. 3D cell/polymer micro-bundles formed by iVPCs and micro-scaffolds were transplanted into the ischemic myocardium in a rat model of myocardial infarction (MI) with ligation of the left anterior descending artery. Our in vivo data showed that iVPCs on the micro-bundle scaffold had higher survival, and better retention and engraftment in the myocardium than free iVPCs. iVPCs on the micro-bundles promoted better cardiomyocyte survival than free iVPCs. Moreover, iVPCs and iVPC/polymer micro-bundles treatment improved cardiac function (ejection fraction and fractional shortening, endocardial systolic volume) measured by echocardiography, increased vessel density, and decreased infarction size [endocardial and epicardial infarct (scar) length] better than untreated controls at 8 weeks after MI. We conclude that iVPCs grown on a polymer micro-bundle scaffold are new promising approach for cell-based therapy designed for cardiovascular regeneration in ischemic heart disease.
... When reviewing methods to introduce new CMs to the heart, two main delivery routes have been accomplished: transplantation via intramyocardial (or intra-scar) injection (as single-cell solution or small aggregates) and the epicardial application of preformed 3Dconstructs ( Figure 3). Both approaches carry their advantages and drawbacks (Feric and Radisic, 2016;Kadota and Shiba, 2019). Although efficacy was repeatedly proven in small animal models for both delivery approaches, the CM injection strategy has been mainly tested in NHP models (Tables 1, 2). ...
Non-human primates (NHP) are valuable models for late translational pre-clinical studies, often seen as a last step before clinical application. The unique similarity between NHPs and humans is often the subject of ethical concerns. However, it is precisely this analogy in anatomy, physiology, and the immune system that narrows the translational gap to other animal models in the cardiovascular field. Cell and gene therapy approaches are two dominant strategies investigated in the research field of cardiac regeneration. Focusing on the cell therapy approach, several xeno- and allogeneic cell transplantation studies with a translational motivation have been realized in macaque species. This is based on the pressing need for novel therapeutic options for heart failure patients. Stem cell-based remuscularization of the injured heart can be achieved via direct injection of cardiomyocytes (CMs) or patch application. Both CM delivery approaches are in the late preclinical stage, and the first clinical trials have started. However, are we already ready for the clinical area? The present review concentrates on CM transplantation studies conducted in NHPs, discusses the main sources and discoveries, and provides a perspective about human translation.
... In addition to its flexibility, our platform is easily customizable to targeted sample size, making it also suitable for research at the scale of whole tissue slices. The emergence of hiPSC-CMs and their potential as a tool to model arrhythmogenic diseases have been vastly discussed [57][58][59] and non-invasive methods for control and analysis of such samples are demanded. We used multicellular cardiac bodies made of aggregated hiPSC-CMs as a model to show that our system is able to fulfill this demand. ...
Optogenetics relies on dynamic spatial and temporal control of light to address emerging fundamental and therapeutic questions in cardiac research. In this work, a compact micro-LED array, consisting of 16 × 16 pixels, is incorporated in a widefield fluorescence microscope for controlled light stimulation. We describe the optical design of the system that allows the micro-LED array to fully cover the field of view regardless of the imaging objective used. Various multicellular cardiac models are used in the experiments such as channelrhodopsin-2 expressing aggregates of cardiomyocytes, termed cardiac bodies, and bioartificial cardiac tissues derived from human induced pluripotent stem cells. The pacing efficiencies of the cardiac bodies and bioartificial cardiac tissues were characterized as a function of illumination time, number of switched-on pixels and frequency of stimulation. To demonstrate dynamic stimulation, steering of calcium waves in HL-1 cell monolayer expressing channelrhodopsin-2 was performed by applying different configurations of patterned light. This work shows that micro-LED arrays are powerful light sources for optogenetic control of contraction and calcium waves in cardiac monolayers, multicellular bodies as well as three-dimensional artificial cardiac tissues.
... Over the past decades, stem cell-based therapy has become a promising strategy to treat MI with significant progress made in animal studies and clinical trials [4][5][6]. Among all types of stem cell under investigation, mesenchymal stem cells (MSCs) have garnered huge interest due to their easy isolation, high reproductive activity, differentiation capability and immunomodulatory properties [7, 8]. ...
Myocardial infarction (MI) is a major cause of morbidity and mortality in modern society. Over the past decades, mesenchymal stem cell (MSCs)-based therapy has shown promising results in the treatment of MI due to their unique properties of multi-differentiation ability, immune-privileged phenotype and paracrine activity. Recently, MSC-derived exosomes (MSC-EXO) have been proposed as a promising therapeutic strategy for MI with their ability to inhibit cardiomyocyte apoptosis and stimulate vascular angiogenesis. They also aid immunoregulation and rejuvenation of cardiomyocyte senescence by transporting their unique content such as proteins, lipids, and miRNAs. Compared with MSC transplantation, MSC-EXO administration has shown several advantages, including lower toxicity and immunogenicity and no risk of tumor formation. Nonetheless the potential mechanisms underlying MSC-EXO-based therapy for MI are not fully understood. In addition, lack of modification of MSC-EXOs can impact therapeutic efficacy. It is vital to optimize MSC-EXO and enhance their therapeutic efficacy for MI. We summarize the recent advances regarding biological characteristics, therapeutic potential and mechanisms, and optimal approaches to the use of MSC-EXOs in the treatment of MI.
... The high burden of both cardiac toxicity and lack of cardiac efficacy in pharmaceutical clinical trials or clinical use, as well as the low regenerative potential of the adult myocardium posttrauma, have led to a significant investment, in both innovation and funding, toward enabling cardiac tissue engineering for screening [7][8][9] and therapeutic goals [10][11][12] . Adult myocardium is a highly specialized tissue in structure, function, and metabolic profile, growing in complexity and metabolic profile through development and postnatal maturation [13][14][15] . ...
The development of induced-pluripotent stem cell (iPSC)-derived cell types offers promise for basic science, drug testing, disease modeling, personalized medicine, and translatable cell therapies across many tissue types. However, in practice many iPSC-derived cells have presented as immature in physiological function, and despite efforts to recapitulate adult maturity, most have yet to meet the necessary benchmarks for the intended tissues. Here, we summarize the available state of knowledge surrounding the physiological mechanisms underlying cell maturation in several key tissues. Common signaling consolidators, as well as potential synergies between critical signaling pathways are explored. Finally, current practices in physiologically relevant tissue engineering and experimental design are critically examined, with the goal of integrating greater decision paradigms and frameworks towards achieving efficient maturation strategies, which in turn may produce higher-valued iPSC-derived tissues.
... This is because of the limited capability of the heart to regenerate endogenously, and the lack of sufficient cells to repopulate the myocardium, post-injury. 1 In the current scenario, an injured myocardium cannot be reversed, and the few cardiomyocytes le in the injured site possess insufficient regeneration capacity for repairing the myocardium. Considering this factor, the focus of research has moved to the development of an efficient and promising approach to treat MI, which would address questions such as, how to prevent the loss of cardiomyocytes, how to improve their regenerative ability and how to reduce the size of the infarct. 2 A schematic representation of various advancements in translational cardiac regenerative therapies is shown in Fig. 1. 3 Particularly, stem cell therapy is one such promising approach, not only for MI, but for a large number of diseases. ...
The wide arena of applications opened by nanotechnology is multidimensional. It is already been proven that its prominence can continuously influence human life. The role of stem cells in curing degenerative diseases is another major area of research. Cardiovascular diseases are one of the major causes of death globally. Nanotechnology-assisted stem cell therapy could be used to tackle the challenges faced in the management of cardiovascular diseases. In spite of the positive indications and proven potential of stem cells to differentiate into cardiomyocytes for cardiac repair and regeneration during myocardial infarction, this therapeutic approach still remains in its infancy due to several factors such as non-specificity of injected cells, insignificant survival rate, and low cell retention. Attempts to improve stem cell therapy using nanoparticles have shown some interest among researchers. This review focuses on the major hurdles associated with cardiac stem cell therapy and the role of nanoparticles to overcome the major challenges in this field, including cell modulation, imaging, tracking and gene delivery.
... These include delivery of drugs, growth factors, cytokines and other molecules for myocardial regeneration or treatment [36,37]. However, due to inherent limitations with most treatment strategies such as lack of target specificity, low bioavailability, cardiac rejection while heart pumping, or non-specific distribution, the therapeutic effect is lessened [38]. The emerging studies on nanoparticles and targeted drug delivery systems have displayed promising results, however, their efficacy remains dependent on the drug binding capacity, solubility, nanoparticle degradability and plasma retention time [39]. ...
Congestive heart failure, a prominent cardiovascular disease results primarily from myocardial infarction or ischemia. Milrinone (MRN), a widely used clinical drug for heart failure, improves myocardial contractility and cardiac function through its inotropic and vasodilatory effects. However, lacking target specificity, it exhibits low bioavailability and lower body retention time. Therefore, in this study, angiotensin II (AT1) peptide conjugated human serum albumin nanoparticles (AT1-HSA-MRN-NPs) have been synthesized for targeted delivery of MRN to the myocardium, overexpressing AT1 receptors under heart failure. The NPs were surface functionalized through a covalent conjugation reaction between HSA and AT1. Nanoparticle size was 215.2±4.7 nm and zeta potential -28.8±2.7 mV and cumulative release of MRN was ~72% over 24 hrs. The intracellular uptake of nanoparticles and cell viability was studied in H9c2 cells treated with AT1-MRN-HSA-NPs vs the control non-targeted drug, MRN Lactate under normal, hypoxic and hypertrophic conditions. The uptake of AT1-HSA-MRN-NPs in H9c2 cells was significantly higher as compared to non-targeted nanoparticles, and the viability of H9c2 cells treated with AT1-MRN-HSA-NPs vs MRN Lactate was 73.4±1.4% vs 44.9±1.4%, respectively. Therefore, AT1-HSA-MRN-NPs are safe for in vivo use and exhibit superior targeting and drug delivery characteristics for treatment of heart failure.
... The copyright holder for this preprint (which this version posted July 23, 2021. ; https://doi.org/10.1101/2021.07.23.453538 doi: bioRxiv preprint specificity, low bioavailability, cardiac rejection while heart pumping, or non-specific distribution, the therapeutic effect is lessened 38 . The emerging studies on nanoparticles and targeted drug delivery systems have displayed promising results, however, their efficacy remains dependent on the drug binding capacity, solubility, nanoparticle degradability and plasma retention time 39 . ...
Congestive heart failure, a prominent cardiovascular disease results primarily from myocardial infarction or ischemia. Milrinone (MRN), a widely used clinical drug for heart failure, improves myocardial contractility and cardiac function through its inotropic and vasodilatory effects. However, lacking target specificty, it exhibits low bioavailability and lower body retention time. Therefore, in this study, angiotensin II (AT1) peptide conjugated human serum albumin nanoparticles (AT1-HSA-MRN-NPs) have been synthesized for targeted delivery of MRN to the myocardium, overexpressing AT1 receptors under heart failure. The NPs were surface functionalized through a covalent conjugation reaction between HSA and AT1. Nanoparticle size was 215.2±4.7 nm and zeta potential -28.8±2.7 mV and cumulative release of MRN was ~72% over 24 hrs. The intracellular uptake of nanoparticles and cell viability was studied in H9c2 cells treated with AT1-MRN-HSA-NPs vs the control non-targeted drug, MRN Lactate under normal, hypoxic and hypertrophic conditions. The uptake of AT1-HSA-MRN-NPs in H9c2 cells was significantly higher as compared to non-targeted nanoparticles, and the viability of H9c2 cells treated with AT1-MRN-HSA-NPs vs MRN Lactate was 73.4±1.4% vs 44.9±1.4%, respectively. Therefore, AT1-HSA-MRN-NPs are safe for in vivo use and exhibit superior targeting and drug delivery characteristics for treatment of heart failure.
... In the last few decades, engineered cardiac tissue scaffolds or cardiac patches have emerged as therapeutic candidates to substitute for damaged cardiac tissues as well as deliver regenerative factors after their epicardial implantation [3][4][5] . Cardiac patches were first investigated as a possible solution to cell injection challenges for cell therapy purposes [6] . ...
This work explores the epicardial implantation of acellular chitosan hydrogels in two murine models of cardiomyopathy, focusing on their potential to restore the functional capacity of the heart. Different chitosan hydrogels were generated using polymers of four degrees of acetylation, ranging from 2.5% to 38%, because the degree of acetylation affects their degradation and biological activity. The hydrogels were adjusted to a 3% final polymer concentration. After complete macromolecular characterization of the chitosans and study of the mechanical properties of the resulting hydrogels, they were sutured onto the surface of the myocardium, first in rat after four-weeks of coronary ligation (n=58) then in mice with cardiomyopathy induced by a cardiac-specific invalidation of serum response factor (n=20). The implantation of the hydrogels was associated with a reversion of cardiac function loss with maximal effects for the acetylation degree of 24%. The extent of fibrosis, the cardiomyocyte length-to-width ratio, as well as the genes involved in fibrosis and stress were repressed after implantation. Our study demonstrated the beneficial effects of chitosan hydrogels, particularly with polymers of high degrees of acetylation, on cardiac remodeling in two cardiomyopathy models. Our findings indicate they have great potential as a reliable therapeutic approach to heart failure.
... Moreover, there is no agreement on the optimal location for the patch implantation. 120 Furthermore, engineering of SB-CMTs that are compatible with the host myocardium and its complex microenvironment is not a trivial task. It is well known that the stiffness of the myocardium can change according to the developmental stage, age, and stage of the cardiac disease of the patient. ...
Cardiovascular diseases, including myocardial infarction (MI), persist as the leading cause of mortality and morbidity worldwide. The limited regenerative capacity of the myocardium presents significant challenges specifically for the treatment of MI and, subsequently, heart failure (HF). Traditional therapeutic approaches mainly rely on limiting the induced damage or the stress of the remaining viable myocardium through pharmacological regulation of remodeling mechanisms, rather than replacement or regeneration of the injured tissue. The emerging alternative regenerative medicine-based approaches have focused on restoring the damaged myocardial tissue with newly engineered functional and bioinspired tissue units. Cardiac regenerative medicine approaches can be broadly categorized into three groups: cell-based therapies, scaffold-based cardiac tissue engineering, and scaffold-free cardiac tissue engineering. Despite significant advancements, however, the clinical translation of these approaches has been critically hindered by two key obstacles for successful structural and functional replacement of the damaged myocardium, namely: poor engraftment of engineered tissue into the damaged cardiac muscle and weak electromechanical coupling of transplanted cells with the native tissue. To that end, the integration of micro- and nanoscale technologies along with recent advancements in stem cell technologies have opened new avenues for engineering of structurally mature and highly functional scaffold-based (SB-CMTs) and scaffold-free cardiac microtissues (SF-CMTs) with enhanced cellular organization and electromechanical coupling for the treatment of MI and HF. In this review article, we will present the state-of-the-art approaches and recent advancements in the engineering of SF-CMTs for myocardial repair.
... Other reasons for low integration could be due to the limitations of the animal models. Rats have much faster beating rates than humans (e.g., human CMs: 60-120 bpm; rodent: 350-600 bpm, hiPSC-ventricular: 40-80 bpm) [11,49,50]. The EhVHT in this study is made of human cells which is markedly different in species with the small animal model of rats. ...
Myocardial infarction (MI) is a primary cardiovascular disease threatening human health and quality of life worldwide. The development of engineered heart tissues (EHTs) as a transplantable artificial myocardium provides a promising therapy for MI. Since most MIs occur at the ventricle, engineering ventricular-specific myocardium is therefore more desirable for future applications. Here, by combining a new macroporous 3D iron oxide scaffold (IOS) with a fixed ratio of human pluripotent stem cell (hPSC)-derived ventricular-specific cardiomyocytes and human umbilical cord-derived mesenchymal stem cells, we constructed a new type of engineered human ventricular-specific heart tissue (EhVHT). The EhVHT promoted expression of cardiac-specific genes, ion exchange, and exhibited a better Ca²⁺ handling behaviors and normal electrophysiological activity in vitro. Furthermore, when patched on the infarcted area, the EhVHT effectively promoted repair of heart tissues in vivo and facilitated the restoration of damaged heart function of rats with acute MI. Our results show that it is feasible to generate functional human ventricular heart tissue based on hPSC-derived ventricular myocytes for the treatment of ventricular-specific myocardium damage.
Statement of significance
We successfully generated highly purified homogenous human ventricular myocytes and developed a method to generate human ventricular-specific heart tissue (EhVHT) based on three-dimensional iron oxide scaffolds. The EhVHT promoted expression of cardiac-specific genes, ion exchange, and exhibited a better Ca²⁺ handling behaviors and normal electrophysiological activity in vitro. Patching the EhVHT on the infarct area significantly improved cardiac function in rat acute MI models. This EhVHT has a great potential to meet the specific requirements for ventricular damages in most MI cases and for screening drugs specifically targeting ventricular myocardium.
... Similarly, pathophysiological studies using healthy and diseased human cells that may respond positively to ventricular assist should also be conducted. These future experiments, using systems like ours to evaluate hiPSC-CM tissue formation and electromechanical integration within biosynthetic scaffolds, will inform regenerative medicine practices that aim to restore myocardial function 63,76,77 . ...
Laboratory studies of the heart use cell and tissue cultures to dissect heart function yet rely on animal models to measure pressure and volume dynamics. Here, we report tissue-engineered scale models of the human left ventricle, made of nanofibrous scaffolds that promote native-like anisotropic myocardial tissue genesis and chamber-level contractile function. Incorporating neonatal rat ventricular myocytes or cardiomyocytes derived from human induced pluripotent stem cells, the tissue-engineered ventricles have a diastolic chamber volume of ~500 µl (comparable to that of the native rat ventricle and approximately 1/250 the size of the human ventricle), and ejection fractions and contractile work 50–250 times smaller and 10⁴–10⁸ times smaller than the corresponding values for rodent and human ventricles, respectively. We also measured tissue coverage and alignment, calcium-transient propagation and pressure–volume loops in the presence or absence of test compounds. Moreover, we describe an instrumented bioreactor with ventricular-assist capabilities, and provide a proof-of-concept disease model of structural arrhythmia. The model ventricles can be evaluated with the same assays used in animal models and in clinical settings.
... Tissue-engineered products, consisting of complex three dimensional structures, will likely require complex surgical procedures in order to implant a therapy into patients (Fabre et al. 2016;Feric and Radisic 2016). As with all surgical procedures, the riskto-benefit ratio in this instance must be carefully weighed up by the medical practitioner responsible for a patient. ...
A specific challenge to the translation of cell therapies and stem-cell derived products is the ability to develop and manufacture such products in a cost-effective, scalable and robust manner. To this end, this thesis investigates the creation and application of a set of computational tools designed to aid bioprocess design decisions for cell therapy and stem-cell derived research products. The decision-support tools comprise advanced bioprocess economics models with databases tailored to cellular products. These are linked to Monte Carlo simulation for uncertainty analysis and techniques to identify optimal bioprocess designs that include brute-force search algorithms, an evolutionary algorithm, and multi-attribute decision making analysis. A trio of industrially-relevant case studies is presented within this thesis, along with an additional study included in the appendices of this work, in order to demonstrate the applicability of the decisional tools to bioprocess design for different cell therapies (allogeneic, human embryonic stem cell-derived retinal pigment epithelial (RPE) cells for macular degeneration, allogeneic CAR-T cells for oncology) and induced pluripotent stem cells (iPSCs) for drug discovery applications. Questions tackled included manual versus automated production, costeffective inflection points of planar vs microcarrier-based bioprocess strategies, and the identification optimal process technologies for an allogeneic CAR-T cell therapy based on both qualitative and quantitative attributes. The analyses highlighted key bioprocess economic drivers and process bottlenecks. Furthermore, the Monte Carlo simulation technique was used in order to capture the effects of the inherent uncertainty associated with cell therapy bioprocessing on manufacturing costs and process throughputs. Future process improvements required to create financially feasible bioprocesses were also identified. This thesis presents the application of a series of decisional tools to bioprocess design problems and demonstrates how they can facilitate informed decisions regarding cost-effective process design in the cell therapy sector.
... Current advances in tissue engineering techniques made 3D cardiac tissue cultures feasible and potentially useful for pharmacological and clinical applications (Feric and Radisic, 2016;Kimbrel and Lanza, 2015;Li et al., 2017;Shinozawa et al., 2017;Weinberger et al., 2016). In addition, two-dimensional (2D) and 3D stem cell-derived CM cultures were used in a number of studies in order to address the immaturity of stem cell-derived CMs by employing a variety of biochemical and biophysical signals (Kosmidis et al., 2015;Jackman et al., 2016;Huebsch et al., 2016;Shen et al., 2017). ...
Cardiac hypertrophy accompanies many forms of cardiovascular diseases. The mechanisms behind the development and regulation of cardiac hypertrophy in the human setting are poorly understood, which can be partially attributed to the lack of a human cardiomyocyte-based preclinical test system recapitulating features of diseased myocardium. The objective of our study is to determine whether human embryonic stem cell-derived cardiomyocytes (hESC-CMs) subjected to mechanical stretch can be used as an adequate in vitro model for studying molecular mechanisms of cardiac hypertrophy. We show that hESC-CMs subjected to cyclic stretch, which mimics mechanical overload, exhibit essential features of a hypertrophic state on structural, functional, and gene expression levels. The presented hESC-CM stretch approach provides insight into molecular mechanisms behind mechanotransduction and cardiac hypertrophy and lays groundwork for the development of pharmacological approaches as well as for discovering potential circulating biomarkers of cardiac dysfunction.
... Heart transplantation is an effective treatment option for end-stage dilated cardiomyopathy. Although most patients enjoy an increased survival and show a higher quality of life after heart transplantation, complications such as rejection of the donor heart are still common [4]. Previous reports have shown that the prevalence of bradycardia, that needs to be treated by temporary pacing or other means of medication, is as high as 46%-50% [5][6][7]. ...
... Cell engraftment and survival have been improved by cardiac patch technologies. Engineered cardiac tissues by scaffolds are designed to facilitate cell assembly into the host myocardium and have enabled release of bioactive peptides or paracrine factors in a targeted and controlled manner (108). Furthermore, the majority of three-dimensional engineered cardiac tissues have been demonstrated beneficial and three-dimensional printed scaffolds have been used in vivo (109). ...
Pregestational maternal diabetes induces congenital heart defects (CHDs). Cardiac dysfunction after palliative surgical procedures contributes to the high mortality of CHD patients. Autologous or allogeneic stem cell therapies are effective for improving cardiac function in animal models and clinical trials. c-kit(+) cardiac progenitor cells (CPCs), the most recognized CPCs, have the following basic properties of stem cells: self-renewal, multicellular clone formation, and differentiation into multiple cardiac lineages. However, there is ongoing debate regarding whether c-kit(+) CPCs can give rise to sufficient cardiomyocytes. A new hypothesis to address the beneficial effect of c-kit(+) CPCs is that these cells stimulate endogenous cardiac cells through a paracrine function in producing a robust secretome and exosomes. The values of other cardiac CPCs, including Sca1(+) CPCs and cardiosphere-derived cells, are beginning to be revealed. These cells may be better choices than c-kit(+) CPCs for generating cardiomyocytes. Adult mesenchymal stem cells are considered immune-incompetent and effective for improving cardiac function. Autologous CPC therapy may be limited by the observation that maternal diabetes adversely affects the biological function of embryonic stem cells and CPCs. Future studies should focus on determining the mechanistic action of these cells, identifying new CPC markers, selecting highly effective CPCs and engineering cell-free products.Pediatric Research accepted article preview online, 10 October 2017. doi:10.1038/pr.2017.259.
... [161][162][163] Various studies and clinical trials have tested cardiac progenitor cells, bone marrow-derived stem cells, and pluripotent stem cells. 164 Frustratingly, these clinical interventions demonstrated safety but often failed to prove functional improvement. The mechanism underlying the potential effects of bone marrow-derived stem cells is unclear; the injected cells do not appear to remain in the cardiac tissue but may release paracrine factors and recruit cardiac progenitor cells. ...
Nonischemic dilated cardiomyopathy (DCM) often has a genetic pathogenesis. Because of the large number of genes and alleles attributed to DCM, comprehensive genetic testing encompasses ever-increasing gene panels. Genetic diagnosis can help predict prognosis, especially with regard to arrhythmia risk for certain subtypes. Moreover, cascade genetic testing in family members can identify those who are at risk or with early stage disease, offering the opportunity for early intervention. This review will address diagnosis and management of DCM, including the role of genetic evaluation. We will also overview distinct genetic pathways linked to DCM and their pathogenetic mechanisms. Historically, cardiac morphology has been used to classify cardiomyopathy subtypes. Determining genetic variants is emerging as an additional adjunct to help further refine subtypes of DCM, especially where arrhythmia risk is increased, and ultimately contribute to clinical management.
... Cardiac patch technologies have been investigated to improve cell engraftment and survival for optimal therapeutic benefit; however, the functional integration such as immediate electric-coupling with host myocardium remains to be elucidated. 137 Engineered cardiac patches by scaffold have enabled to release paracrine factors or bioactive peptides into targeted myocardium in a controlled manner. Intravenous cell injection into biventricular heart disease has been considered as inefficient because of the low cell retention and rapid diffusion to other organs during circulation; however, children with single ventricle physiology before stage 3 palliation may be applicable to this delivery approach because the venous return from inferior vena cava may directly supply into functional single ventricle and related coronary arteries. ...
Dramatic evolution in medical and catheter interventions and complex surgeries to treat children with congenital heart disease (CHD) has led to a growing number of patients with a multitude of long-term complications associated with morbidity and mortality. Heart failure in patients with hypoplastic left heart syndrome predicated by functional single ventricle lesions is associated with an increase in CHD prevalence and remains a significant challenge. Pathophysiological mechanisms contributing to the progression of CHD, including single ventricle lesions and dilated cardiomyopathy, and adult heart disease may inevitably differ. Although therapeutic options for advanced cardiac failure are restricted to heart transplantation or mechanical circulatory support, there is a strong impetus to develop novel therapeutic strategies. As lower vertebrates, such as the newt and zebrafish, have a remarkable ability to replace lost cardiac tissue, this intrinsic self-repair machinery at the early postnatal stage in mice was confirmed by partial ventricular resection. Although the underlying mechanistic insights might differ among the species, mammalian heart regeneration occurs even in humans, with the highest degree occurring in early childhood and gradually declining with age in adulthood, suggesting the advantage of stem cell therapy to ameliorate ventricular dysfunction in patients with CHD. Although effective clinical translation by a variety of stem cells in adult heart disease remains inconclusive with respect to the improvement of cardiac function, case reports and clinical trials based on stem cell therapies in patients with CHD may be invaluable for the next stage of therapeutic development. Dissecting the differential mechanisms underlying progressive ventricular dysfunction in children and adults may lead us to identify a novel regenerative therapy. Future regenerative technologies to treat patients with CHD are exciting prospects for heart regeneration in general practice.
... Los problemas anteriormente identificados muestran la necesidad de crear un andamio que luego de ser poblado con las células adecuadas permita establecer un acoplamiento celular electromecánico, una función contráctil estable y una vascularización funcional del corazón [45,46,47,48,49,50]. ...
This paper shown an update in the development of collagens for the manufacture of scaffold which are
used in tissue regeneration. The steps to obtain collagen scaffolds such as isolation, acid solubilization,
purification, precipitation, lyophilization and fibrillogenesis were described. As collagen sources, which
provide collagen, Type I such as skin and tendon of mammalians, fish, and birds were mentioned. The
physics-chemical characterization using several methods by electrophoresis analysis, scanning electron
microscopy, atomic force microscopy, Fourier Transform Infrared Spectroscopy (FT-IR), thermogravimet-ric and mechanical assay were described. These tests permits to know the behavior of scaffolds. Applied
cross-link method to improve physically stabilized to collagen were explained. Emphasis is placed on the
limitations encountered during cell therapies and on the restoration of myocardial tissue using scaffolding,
which are a challenge to be overcome by tissue engineering.
... This is an area of research that stem cell biology hopes to be able to impact through the use of iPSC technology that can be applied to include a range of factors such as age, sex, ethnicity, and healthy versus disease backgrounds. Currently stem cell resources are being expanded to better reflect population diversity, including a need to increase iPSC lines generated from that ethnically diverse population 47,48 . An associated challenge is in defining ethnicity itself, which is a self-designated description that does not account for geographical population expansion and inter-mixing Here we take advantage of replicate iPSC lines that behave differently in cardiomyocyte contractility versus other multi-lineage cell differentiations to perform data-rich bioinformatic and functional analysis that informs on cardiomyocyte contractility. ...
The realization of personalized medicine through human induced pluripotent stem cell (iPSC) technology can be advanced by transcriptomics, epigenomics, and bioinformatics that inform on genetic pathways directing tissue development and function. When possible, population diversity should be included in new studies as resources become available. Previously we derived replicate iPSC lines of African American, Hispanic-Latino and Asian self-designated ethnically diverse (ED) origins with normal karyotype, verified teratoma formation, pluripotency biomarkers, and tri-lineage in vitro commitment. Here we perform bioinformatics of RNA-Seq and ChIP-seq pluripotency data sets for two replicate Asian and Hispanic-Latino ED-iPSC lines that reveal differences in generation of contractile cardiomyocytes but similar and robust differentiation to multiple neural, pancreatic, and smooth muscle cell types. We identify shared and distinct genes and contributing pathways in the replicate ED-iPSC lines to enhance our ability to understand how reprogramming to iPSC impacts genes and pathways contributing to cardiomyocyte contractility potential.
... 1,2 Functionalengineered human myocardium may replace current nonhuman recombinant cell lines expressing cardiac ion channels for in vitro cardiotoxicity screening, 3 may be used for disease modeling, 4 or may be applied for regenerative purpose to treat cardiovascular diseases. 5 Several tissue engineering approaches have recently shown promise, including scaffold-free systems, 6 engineered synthetic scaffolds, 7 natural nonprotein scaffolds, 8 and natural protein polymers such as fibrin, [9][10][11][12][13][14][15] gelatin, 16 and collagen type I. [17][18][19][20][21][22][23][24][25][26] Among these approaches, collagen type I is attractive because it is the primary load-bearing protein in the heart; it transfers the force generated by cardiomyocytes, helps maintain cardiomyocyte alignment, and provides passive tension during diastole. [27][28][29] A major limitation in cardiac tissue engineering has been the lack of a suitable human cardiomyocyte source. ...
Backgrounds:
-Tissue engineering enables the generation of functional human cardiac tissue using cells derived in vitro in combination with biocompatible materials. Human induced pluripotent stem cell (hiPSC)-derived cardiomyocytes provide a cell source for cardiac tissue engineering; however, their immaturity limits their potential applications. Here we sought to study the effect of mechanical conditioning and electrical pacing on the maturation of hiPSC-derived cardiac tissues. METHODSS: -Cardiomyocytes derived from hiPSCs were used to generate collagen-based bioengineered human cardiac tissue. Engineered tissue constructs were subjected to different mechanical stress and electrical pacing conditions. RESULTSS: -The engineered human myocardium exhibits Frank-Starling-type force-length relationships. After 2 weeks of static stress conditioning, the engineered myocardium demonstrated increases in contractility (0.63±0.10 mN/mm(2) vs 0.055±0.009 mN/mm(2) for no stress), tensile stiffness, construct alignment, and cell size. Stress conditioning also increased SERCA2 expression, which correlated with a less negative force-frequency relationship. When electrical pacing was combined with static stress conditioning, the tissues showed an additional increase in force production (1.34±0.19 mN/mm(2)), with no change in construct alignment or cell size, suggesting maturation of excitation-contraction coupling. Supporting this notion, we found expression of RYR2 and SERCA2 further increased by combined static stress and electrical stimulation.
Conclusions:
-These studies demonstrate that electrical pacing and mechanical stimulation promote maturation of the structural, mechanical and force generation properties of hiPSC-derived cardiac tissues.
... However, species-species differences hinder their applicability as a model of human patients. For example, rodents have heart rates 3-10 times faster than humans [2], virtually no delayed rectifier potassium I Kr (human ether-a-gogo-related gene [hERG]) current, and animal ion channel expression and action potential profiles are generally distinct from those of humans [3]. Human-specific drug screening data have been obtained using primary heart cells and tissue, tumor-derived immortalized mammalian cardiac cell lines, and heterologous expression systems in which noncardiac cells (Chinese Hamster Ovary or Human Embryonic Kidney) are transfected to express an individual human ion channel, most commonly the hERG channel. ...
... Cardiovascular diseases are a main cause of death in the world and, following an injury such as myocardial infarction (MI), the heart undergoes substantial loss of cardiomyocytes which are replaced by collagen-rich non-functional scar tissue [1]. Driven by the limited success of cell-based therapies, biologists, physicians and engineers have joined efforts to develop tissue engineering approaches that resemble the myocardial structure and support the survival and integration of transplanted cells [2][3][4]. Although numerous natural and synthetic biomaterials have been experimentally tested in myocardial tissue engineering strategies, their limited capability to emulate the native extracellular matrix (ECM) microenvironment remains a major challenge. ...
A main challenge in cardiac tissue engineering is the limited data on microenvironmental cues that sustain survival, proliferation and functional proficiency of cardiac cells. The aim of our study was to evaluate the potential of fetal (E18) and adult myocardial extracellular matrix (ECM) to support cardiac cells. Acellular three-dimensional (3D) bioscaffolds were obtained by parallel decellularization of fetal- and adult-heart explants thereby ensuring reliable comparison. Acellular scaffolds retained main constituents of the cardiac ECM including distinctive biochemical and structural meshwork features of the native equivalents. In vitro, fetal and adult ECM-matrices supported 3D culture of heart-derived Sca-1+ progenitors and of neonatal cardiomyocytes, which migrated toward the center of the scaffold and displayed elongated morphology and excellent viability. At the culture end-point, more Sca-1+ cells and cardiomyocytes were found adhered and inside fetal bioscaffolds, compared to the adult. Higher repopulation yields of Sca-1+ cells on fetal ECM relied on β1-integrin independent mitogenic signals. Sca-1+ cells on fetal bioscaffolds showed a gene expression profile that anticipates the synthesis of a permissive microenvironment for cardiomyogenesis. Our findings demonstrate the superior potential of the 3D fetal microenvironment to support and instruct cardiac cells. This knowledge should be integrated in the design of next-generation biomimetic materials for heart repair.
... Despite the poor reproductive capacity of the myocardium, another possible avenue to therapy under consideration for dilated cardiomyopathy is transplantation of cardiac stem cells (19). Using cardiosphere derived cells, the team at Cedars of Lebanon has continued long term studies of mini pigs receiving allogeneic cells in myocardial infarction. ...
Purpose of review:
The article traces the pathways leading from viral infection of the heart by coxsackievirus B3 to autoimmune myocarditis in its various manifestations.
Recent findings:
Myocarditis can be induced by a number of different infectious agents and represents a significant cause of death especially in young individuals. Following infection, patients may develop lymphocytic, eosinophilic, or giant cell/granulomatous myocardial inflammation. It can lead to infectious dilated cardiomyopathy, a disease frequently requiring cardiac transplantation. Although acute viral myocarditis is frequently subclinical and recovery may be spontaneous, treatment of chronic myocarditis is currently unsatisfactory. Ongoing disease may be because of persistent virus in the heart or to immunopathic attack. Depending on the cause, treatment may be antiviral or immunosuppressive. Endomyocardial biopsy is proving of value in determining cause and deciding future therapy. A great deal of information about the pathogenesis of myocarditis has been gained from experimental models in rodents using heart disease induced by infection using coxsackievirus B3 or by immunization with cardiac myosin.
Summary:
Treatment of myocarditis is still problematic and may depend on etiologic diagnosis to distinguish infectious from immune-mediated disease. Both pathogenic mechanisms may co-occur in individual patients. In the future, treatment may depend upon endomyocardial biopsy, immunohistologic testing, improved imaging, and molecular genetic analysis for providing more precise diagnoses.
Cell-secreted nanovesicles of endosomal origin, called exosomes, are vital for mediating intracellular communication. As local or distal transporters of intracellular cargo, they reflect the unique characteristics of secretory cells and establish cell-specific interactions via characteristic surface proteins and receptors. With the advent of rapid isolation, purification, and identification techniques, exosomes have become an attractive choice for disease diagnosis (exosomal content as biomarkers), cell-free therapy, and tissue regeneration. Mesenchymal stem cell (MSC)-derived exosomes (MSC-exosomes) display angiogenic, immune-modulatory, and other therapeutic effects crucial for cytoprotection, ischemic wound repair, myocardial regeneration, etc. The primary focus of this review is to highlight the widespread application of MSC-exosomes in therapeutics, theranostics, and tissue regeneration. After a brief introduction of exosome properties, biogenesis, isolation, and functions, recent studies on therapeutic and regenerative applications of MSC-exosomes are described, focusing on bone, cartilage, periodontal, cardiovascular, skin, and nerve regeneration. Finally, the review highlights the theranostic potential of exosomes followed by challenges, summary, and outlook.
Safe and accurate in situ delivery of biocompatible materials is a fundamental requirement for many biomedical applications. These include sustained and local drug release, implantation of acellular biocompatible scaffolds, and transplantation of cells and engineered tissues for functional restoration of damaged tissues and organs. The common practice today includes highly invasive operations with major risks of surgical complications including adjacent tissue damage, infections, and long healing periods. In this work, a novel non‐invasive delivery method is presented for scaffold, cells, and drug delivery deep into the body to target inner tissues. This technology is based on acousto‐sensitive materials which are polymerized by ultrasound induction through an external transducer in a rapid and local fashion without additional photoinitiators or precursors. The applicability of this technology is demonstrated for viable and functional cell delivery, for drug delivery with sustained release profiles, and for 3D printing. Moreover, the mechanical properties of the delivered scaffold can be tuned to the desired target tissue as well as controlling the drug release profile. This promising technology may shift the paradigm for local and non‐invasive material delivery approach in many clinical applications as well as a new printing method – “acousto‐printing” for 3D printing and in situ bioprinting.
Cardiovascular diseases are the leading cause of death worldwide. Discovering new therapies to treat heart disease requires improved understanding of cardiac physiology at a cellular level. Extracellular vesicles (EVs) are plasma membrane-bound nano- and microparticles secreted by cells and known to play key roles in intercellular communication, often through transfer of biomolecular cargo. Advances in EV research have established techniques for EV isolation from tissue culture media or biofluids, as well as standards for quantitation and biomolecular characterization. EVs released by cardiac cells are known to be involved in regulating cardiac physiology as well as in the progression of myocardial diseases. Due to difficulty accessing the heart in vivo, advanced in vitro cardiac ‘tissues-on-a-chip’ have become a recent focus for studying EVs in the heart. These physiologically relevant models are producing new insight into the role of EVs in cardiac physiology and disease while providing a useful platform for screening novel EV-based therapeutics for cardiac tissue regeneration post-injury. Numerous hurdles have stalled the clinical translation of EV therapeutics for heart patients, but tissue-on-a-chip models are playing an important role in bridging the translational gap, improving mechanistic understanding of EV signalling in cardiac physiology, disease, and repair.
This article is protected by copyright. All rights reserved.
Biodegradable cardiac patch is desirable to possess mechanical properties mimicking native myocardium for heart infarction treatment. We fabricated a series of anisotropic and biodegradable polyurethane porous scaffolds via thermally induced phase separation (TIPS) and tailored their mechanical properties by using various polyurethanes with different soft segments and varying polymer concentrations. The uniaxial mechanical properties, suture retention strength, ball-burst strength, and biaxial mechanical properties of the anisotropic porous scaffolds were optimized to mechanically match native myocardium. The optimal anisotropic scaffold had a ball burst strength (20.7 ± 1.5 N) comparable to that of native porcine myocardium (20.4 ± 6.0 N) and showed anisotropic behavior close to biaxial stretching behavior of the native porcine myocardium. Furthermore, the optimized porous scaffold was combined with a porcine myocardium-derived hydrogel to form a biohybrid scaffold. The biohybrid scaffold showed morphologies similar to the decellularized porcine myocardial matrix. This combination did not affect the mechanical properties of the synthetic scaffold alone. After in vivo rat subcutaneous implantation, the biohybrid scaffolds showed minimal immune response and exhibited higher cell penetration than the polyurethane scaffold alone. This biohybrid scaffold with biomimetic mechanics and good tissue compatibility would have great potential to be applied as a biodegradable acellular cardiac patch for myocardial infarction treatment.
Congenital heart disease (CHD) affects a considerable number of children and adults worldwide. This implicates not only developmental disorders, high mortality, and reduced quality of life but also, high costs for the healthcare systems. CHD refers to a variety of heart and vascular malformations which could be very challenging to reconstruct the malformed region surgically, especially when the patient is an infant or a child. Advanced technology and research have offered a better mechanistic insight on the impact of CHD in the heart and vascular system of infants, children, and adults and identified potential therapeutic solutions. Many artificial materials and devices have been used for cardiovascular surgery. Surgeons and the medical industry created and evolved the ball valves to the carbon-based leaflet valves and introduced bioprosthesis as an alternative. However, with research further progressing, contracting tissue has been developed in laboratories and tissue engineering (TE) could represent a revolutionary answer for CHD surgery. Development of engineered tissue for cardiac and aortic reconstruction for developing bodies of infants and children can be very challenging. Nevertheless, using acellular scaffolds, allograft, xenografts, and autografts is already very common. Seeding of cells on surface and within scaffold is a key challenging factor for use of the above. The use of different types of stem cells has been investigated and proven to be suitable for tissue engineering. They are the most promising source of cells for heart reconstruction in a developing body, even for adults. Some stem cell types are more effective than others, with some disadvantages which may be eliminated in the future.
Extracellular matrix (ECM) scaffolds based on decellularized native tissue are predestined for applications in regenerative medicine due to their unique, naturally grown characteristics that cannot be replicated by any other biological or synthetic material. As a result of the immense progress that has been made in this field during the last decades, new therapeutic approaches are finding their way into the clinical routine in cardiovascular medicine; however, there are still some scientific challenges that need to be overcome in the future, such as the optimization and standardization of the decellularization process, the implementation of tissue and organ-specific culture environments and functional vascularization. Although, we are still far from generating fully fledged bioartificial substitutes due to the biological complexity, tissue engineering approaches may help to explore new paths that could help to regenerate diseased tissues and organs instead of replacing them. Suitable three-dimensional in vitro models, which can replicate native tissue with high fidelity, could help to understand disease processes and identify potential for regeneration. Functional bioartificial tissue constructs generated in vitro could support diseased tissue in vivo. Translation of these clinical models into clinical practice is one of the major challenges in modern medical research. © 2018, Springer Medizin Verlag GmbH, ein Teil von Springer Nature.
Oxygen deficiency after myocardial infarction (MI) leads to massive cardiac cell death. Protection of cardiac cells and promotion of cardiac repair are key therapeutic goals. These goals may be achieved by re-introducing oxygen into the infarcted area. Yet current systemic oxygen delivery approaches cannot efficiently diffuse oxygen into the infarcted area that has extremely low blood flow. In this work, we developed a new oxygen delivery system that can be delivered specifically to the infarcted tissue, and continuously release oxygen to protect the cardiac cells. The system was based on a thermosensitive, injectable and fast gelation hydrogel, and oxygen releasing microspheres. The fast gelation hydrogel was used to increase microsphere retention in the heart tissue. The system was able to continuously release oxygen for 4 weeks. The released oxygen significantly increased survival of cardiac cells under the hypoxic condition (1% O2) mimicking that of the infarcted hearts. It also reduced myofibroblast formation under hypoxic condition (1% O2). After implanting into infarcted hearts for 4 weeks, the released oxygen significantly augmented cell survival, decreased macrophage density, reduced collagen deposition and myofibroblast density, and stimulated tissue angiogenesis, leading to a significant increase in cardiac function.
The elucidation of factors that activate the regeneration of the adult mammalian heart is of major scientific and therapeutic importance. Here we found that epicardial cells contain a potent cardiogenic activity identified as follistatin-like 1 (Fstl1). Epicardial Fstl1 declines following myocardial infarction and is replaced by myocardial expression. Myocardial Fstl1 does not promote regeneration, either basally or upon transgenic overexpression. Application of the human Fstl1 protein (FSTL1) via an epicardial patch stimulates cell cycle entry and division of pre-existing cardiomyocytes, improving cardiac function and survival in mouse and swine models of myocardial infarction. The data suggest that the loss of epicardial FSTL1 is a maladaptive response to injury, and that its restoration would be an effective way to reverse myocardial death and remodelling following myocardial infarction in humans.
Engineering mature tissues requires a guided assembly of cells into organized three-dimensional (3D) structures with multiple cell types. Guidance is usually achieved by microtopographical scaffold cues or by cell-gel compaction. The assembly of individual units into functional 3D tissues is often time-consuming, relying on cell ingrowth and matrix remodeling, whereas disassembly requires an invasive method that includes either matrix dissolution or mechanical cutting. We invented Tissue-Velcro, a bio-scaffold with a microfabricated hook and loop system. The assembly of Tissue-Velcro preserved the guided cell alignment realized by the topographical features in the 2D scaffold mesh and allowed for the instant establishment of coculture conditions by spatially defined stacking of cardiac cell layers or through endothelial cell coating. The assembled cardiac 3D tissue constructs were immediately functional as measured by their ability to contract in response to electrical field stimulation. Facile, on-demand tissue disassembly was demonstrated while preserving the structure, physical integrity, and beating function of individual layers.
Heart disease remains a leading cause of mortality and a major worldwide healthcare burden. Recent advances in stem cell biology have made it feasible to derive large quantities of cardiomyocytes for disease modeling, drug development, and regenerative medicine. The discoveries of reprogramming and transdifferentiation as novel biological processes have significantly contributed to this paradigm. This review surveys the means by which reprogramming and transdifferentiation can be employed to generate induced pluripotent stem cell-derived cardiomyocytes (iPSC-CMs) and induced cardiomyocytes (iCMs). The application of these patient-specific cardiomyocytes for both in vitro disease modeling and in vivo therapies for various cardiovascular diseases will also be discussed. We propose that, with additional refinement, human disease-specific cardiomyocytes will allow us to significantly advance the understanding of cardiovascular disease mechanisms and accelerate the development of novel therapeutic options.
© 2015 The Authors. Published under the terms of the CC BY 4.0 license.
Cardiac tissue engineering is a promising approach to provide large-scale tissues for transplantation to regenerate the heart after ischemic injury, however, integration with the host myocardium will be required to achieve electromechanical benefits. To test the ability of engineered heart tissues to electrically integrate with the host, 10 million human embryonic stem cell (hESC)-derived cardiomyocytes were used to form either scaffold-free tissue patches implanted on the epicardium or micro-tissue particles (~1000 cells/particle) delivered by intramyocardial injection into the left ventricular wall of the ischemia/reperfusion injured athymic rat heart. Results were compared to intramyocardial injection of 10 million dispersed hESC-cardiomyocytes. Graft size was not significantly different between treatment groups and correlated inversely with infarct size. After implantation on the epicardial surface, hESC-cardiac tissue patches were electromechanically active, but they beat slowly and were not electrically coupled to the host at 4 weeks based on ex vivo fluorescent imaging of their graft-autonomous GCaMP3 calcium reporter. Histologically, scar tissue physically separated the patch graft and host myocardium. In contrast, following intramyocardial injection of micro-tissue particles and suspended cardiomyocytes, 100% of the grafts detected by fluorescent GCaMP3 imaging were electrically coupled to the host heart at spontaneous rate and could follow host pacing up to a maximum of 300-390 beats per minute (5-6.5 Hz). Gap junctions between intramyocardial graft and host tissue were identified histologically. The extensive coupling and rapid response rate of the human myocardial grafts after intramyocardial delivery suggest electrophysiological adaptation of hESC-derived cardiomyocytes to the rat heart's pacemaking activity. These data support the use of the rat model for studying electromechanical integration of human cardiomyocytes, and they identify lack of electrical integration as a challenge to overcome in tissue engineered patches.
One of the major challenges in producing large scale engineered tissue is the lack of ability to create large highly perfused scaffolds in which cells can grow at a high cell density and viability. Here, we explore 3D printed polyvinyl alcohol (PVA) as a sacrificial mould in a polymer casting process. The PVA mould network defines the channels and is dissolved after curing the polymer casted around it. The printing parameters determined the PVA filament density in the sacrificial structure and this density resulted in different stiffness of the corresponding elastomer replica. It was possible to achieve 80% porosity corresponding to about 150cm(2)/cm(3) surface to volume ratio. The process is easily scalable as demonstrated by fabricating a 75cm(3) scaffold with about 16,000 interconnected channels (about 1m(2) surface area) and with a channel to channel distance of only 78μm. To our knowledge this is the largest scaffold ever to be produced with such small feature sizes and with so many structured channels. The fabricated scaffolds were applied for in-vitro culturing of hepatocytes over a 12-day culture period. Smaller scaffolds (6×4mm) were tested for cell culturing and could support homogeneous cell growth throughout the scaffold. Presumably, the diffusion of oxygen and nutrient throughout the channel network is rapid enough to support cell growth. In conclusion, the described process is scalable, compatible with cell culture, rapid, and inexpensive.
Copyright © 2015. Published by Elsevier B.V.
Background
Stromal cell-derived factor-1 (SDF-1) promotes tissue repair through mechanisms of cell survival, endogenous stem cell recruitment, and vasculogenesis. Stromal Cell-Derived Factor-1 Plasmid Treatment for Patients with Heart Failure (STOP-HF) is a Phase II, double-blind, randomized, placebo-controlled trial to evaluate safety and efficacy of a single treatment of plasmid stromal cell-derived factor-1 (pSDF-1) delivered via endomyocardial injection to patients with ischaemic heart failure (IHF).
Methods
Ninety-three subjects with IHF on stable guideline-based medical therapy and left ventricular ejection fraction (LVEF) ≤40%, completed Minnesota Living with Heart Failure Questionnaire (MLWHFQ) and 6-min walk distance (6 MWD), were randomized 1 : 1 : 1 to receive a single treatment of either a 15 or 30 mg dose of pSDF-1 or placebo via endomyocardial injections. Safety and efficacy parameters were assessed at 4 and 12 months after injection. Left ventricular functional and structural measures were assessed by contrast echocardiography and quantified by a blinded independent core laboratory. Stromal Cell-Derived Factor-1 Plasmid Treatment for Patients with Heart Failure was powered based on change in 6 MWD and MLWHFQ at 4 months.
Results
Subject profiles at baseline were (mean ± SD): age 65 ± 9 years, LVEF 28 ± 7%, left ventricular end-systolic volume (LVESV) 167 ± 66 mL, N-terminal pro brain natriuretic peptide (BNP) (NTproBNP) 1120 ± 1084 pg/mL, MLWHFQ 50 ± 20 points, and 6 MWD 289 ± 99 m. Patients were 11 ± 9 years post most recent myocardial infarction. Study injections were delivered without serious adverse events in all subjects. Sixty-two patients received drug with no unanticipated serious product-related adverse events. The primary endpoint was a composite of change in 6 MWD and MLWHFQ from baseline to 4 months follow-up. The primary endpoint was not met (P = 0.89). For the patients treated with pSDF-1, there was a trend toward an improvement in LVEF at 12 months (placebo vs. 15 mg vs. 30 mg ΔLVEF: −2 vs. −0.5 vs. 1.5%, P = 0.20). A pre-specified analysis of the effects of pSDF-1 based on tertiles of LVEF at entry revealed improvements in EF and LVESV from lowest-to-highest LVEF. Patients in the first tertile of EF (<26%) that received 30 mg of pSDF-1 demonstrated a 7% increase in EF compared with a 4% decrease in placebo (ΔLVEF = 11%, P = 0.01) at 12 months. There was also a trend towards improvement in LVESV, with treated patients demonstrating an 18.5 mL decrease compared with a 15 mL increase for placebo at 12 months (ΔLVESV = 33.5 mL, P = 0.12). The change in end-diastolic and end-systolic volume equated to a 14 mL increase in stroke volume in the patients treated with 30 mg of pSDF-1 compared with a decrease of −11 mL in the placebo group (ΔSV = 25 mL, P = 0.09). In addition, the 30 mg-treated cohort exhibited a trend towards improvement in NTproBNP compared with placebo at 12 months (−784 pg/mL, P = 0.23).
Conclusions
The blinded placebo-controlled STOP-HF trial demonstrated the safety of a single endocardial administration of pSDF-1 but failed to demonstrate its primary endpoint of improved composite score at 4 months after treatment. Through a pre-specified analysis the STOP-HF trial demonstrates the potential for attenuating LV remodelling and improving EF in high-risk ischaemic cardiomyopathy. The safety profile supports repeat dosing with pSDF-1 and the degree of left ventricular remodelling suggests the potential for improved outcomes in larger future trials.
The primary function of vascular networks is to transport blood and deliver oxygen and nutrients to tissues, which occurs at the interface of the microvasculature. Therefore, the formation of the vessels at the microcirculatory level, or angiogenesis, is critical for tissue regeneration and repair. Current strategies for vascularization of engineered tissues have incorporated multi-disciplinary approaches including engineered biomaterials, cells and angiogenic factors. Pre-vascularization of scaffolds composed of native matrix, synthetic polymers, or other biological materials can be achieved through the use of single cells in mono or co-culture, in combination or not with angiogenic factors or by the use of isolated vessels. The advance of these methods, together with a growing understanding of the biology behind vascularization, has facilitated the development of vascularization strategies for engineered tissues with therapeutic potential for tissue regeneration and repair. Here, we review the different cell-based strategies utilized to pre-vascularize engineered tissues and in making more complex vascularized cardiac tissues for regenerative medicine applications.
Copyright © 2015. Published by Elsevier B.V.
Cardiovascular diseases remain the leading cause of death globally. Since the adult heart lacks the capacity to regenerate, loss of myocardium following myocardial infarction is irreversible and ultimately leads to failure to maintain cardiac function. In order to repopulate the areas of cell loss in the damaged hearts for restoration of cardiac function, cell transplantation/replacement has been extensively investigated. Recently, biomaterials have emerged as an approach to improve delivery and viability of cells for the regeneration of the damaged heart. Here we review the most common approaches in hydrogel-based cardiac tissue regeneration with particular focus on the implementation of hydrogels to improve cell delivery.
Comparative studies suggest that stem cells committed to a cardiac lineage are more effective for improving heart function than those featuring an extra-cardiac phenotype. We have therefore developed a population of human embryonic stem cell (ESC)-derived cardiac progenitor cells.
Undifferentiated human ESCs (I6 line) were amplified and cardiac-committed by exposure to bone morphogenetic protein-2 and a fibroblast growth factor receptor inhibitor. Cells responding to these cardio-instructive cues express the cardiac transcription factor Isl-1 and the stage-specific embryonic antigen SSEA-1 which was then used to purify them by immunomagnetic sorting. The Isl-1(+) SSEA-1(+) cells were then embedded into a fibrin scaffold which was surgically delivered onto the infarct area in a 68-year-old patient suffering from severe heart failure [New York Heart Association [NYHA] functional Class III; left ventricular ejection fraction (LVEF): 26%]. A coronary artery bypass was performed concomitantly in a non-infarcted area. The implanted cells featured a high degree of purity (99% were SSEA-1(+)), had lost the expression of Sox-2 and Nanog, taken as markers for pluripotency, and strongly expressed Isl-1. The intraoperative delivery of the patch was expeditious. The post-operative course was uncomplicated either. After 3 months, the patient is symptomatically improved (NYHA functional Class I; LVEF: 36%) and a new-onset contractility is echocardiographically evident in the previously akinetic cell/patch-treated, non-revascularized area. There have been no complications such as arrhythmias, tumour formation, or immunosuppression-related adverse events.
This observation demonstrates the feasibility of generating a clinical-grade population of human ESC-derived cardiac progenitors and combining it within a tissue-engineered construct. While any conclusion pertaining to efficacy would be meaningless, the patient's functional outcome yet provides an encouraging hint. Beyond this case, the platform that has been set could be useful for generating different ESC-derived lineage-specific progenies.
Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2015. For permissions please email: journals.permissions@oup.com.
Various combinations of cardiogenic transcription factors, including Gata4 (G), Hand2 (H), Mef2c (M) and Tbx5 (T), can reprogram fibroblasts into induced cardiac-like myocytes (iCLMs) in vitro and in vivo. Given that optimal cardiac function relies on distinct yet functionally interconnected atrial, ventricular and pacemaker (PM) cardiomyocytes (CMs), it remains to be seen which subtypes are generated by direct reprogramming and whether this process can be harnessed to produce a specific CM of interest. Here, we employ a PM-specific Hcn4-GFP reporter mouse and a spectrum of CM subtype-specific markers to investigate the range of cellular phenotypes generated by reprogramming of primary fibroblasts. Unexpectedly, we find that a combination of four transcription factors (4F) optimized for Hcn4-GFP expression does not generate beating PM cells due to inadequate sarcomeric protein expression and organization. However, applying strict single-cell criteria to GHMT-reprogrammed cells, we observe induction of diverse cellular phenotypes, including those resembling immature forms of all three major cardiac subtypes (i.e. atrial, ventricular and pacemaker). In addition, we demonstrate that cells induced by GHMT are directly reprogrammed and do not arise from an Nxk2.5(+) progenitor cell intermediate. Taken together, our results suggest a remarkable degree of plasticity inherent to GHMT reprogramming and provide a starting point for optimization of CM subtype-specific reprogramming protocols.
Pluripotent stem cells provide a potential solution to current epidemic rates of heart failure by providing human cardiomyocytes to support heart regeneration. Studies of human embryonic-stem-cell-derived cardiomyocytes (hESC-CMs) in small-animal models have shown favourable effects of this treatment. However, it remains unknown whether clinical-scale hESC-CM transplantation is feasible, safe or can provide sufficient myocardial regeneration. Here we show that hESC-CMs can be produced at a clinical scale (more than one billion cells per batch) and cryopreserved with good viability. Using a non-human primate model of myocardial ischaemia followed by reperfusion, we show that that cryopreservation and intra-myocardial delivery of one billion hESC-CMs generates extensive remuscularization of the infarcted heart. The hESC-CMs showed progressive but incomplete maturation over a 3-month period. Grafts were perfused by host vasculature, and electromechanical junctions between graft and host myocytes were present within 2 weeks of engraftment. Importantly, grafts showed regular calcium transients that were synchronized to the host electrocardiogram, indicating electromechanical coupling. In contrast to small-animal models, non-fatal ventricular arrhythmias were observed in hESC-CM-engrafted primates. Thus, hESC-CMs can remuscularize substantial amounts of the infarcted monkey heart. Comparable remuscularization of a human heart should be possible, but potential arrhythmic complications need to be overcome.
Direct reprogramming of adult somatic cells into alternative cell types has been shown for several lineages. We previously showed that GATA4, MEF2C, and TBX5 (GMT) directly reprogrammed nonmyocyte mouse heart cells into induced cardiomyocyte-like cells (iCMs) in vitro and in vivo. However, GMT alone appears insufficient in human fibroblasts, at least in vitro. Here, we show that GMT plus ESRRG and MESP1 induced global cardiac gene-expression and phenotypic shifts in human fibroblasts derived from embryonic stem cells, fetal heart, and neonatal skin. Adding Myocardin and ZFPM2 enhanced reprogramming, including sarcomere formation, calcium transients, and action potentials, although the efficiency remained low. Human iCM reprogramming was epigenetically stable. Furthermore, we found that transforming growth factor β signaling was important for, and improved the efficiency of, human iCM reprogramming. These findings demonstrate that human fibroblasts can be directly reprogrammed toward the cardiac lineage, and lay the foundation for future refinements in vitro and in vivo.
Mouse embryonic stem (ES) cells are isolated from the inner cell mass of blastocysts, and can be preserved in vitro in a naive inner-cell-mass-like configuration by providing exogenous stimulation with leukaemia inhibitory factor (LIF) and small molecule inhibition of ERK1/ERK2 and GSK3β signalling (termed 2i/LIF conditions). Hallmarks of naive pluripotency include driving Oct4 (also known as Pou5f1) transcription by its distal enhancer, retaining a pre-inactivation X chromosome state, and global reduction in DNA methylation and in H3K27me3 repressive chromatin mark deposition on developmental regulatory gene promoters. Upon withdrawal of 2i/LIF, naive mouse ES cells can drift towards a primed pluripotent state resembling that of the post-implantation epiblast. Although human ES cells share several molecular features with naive mouse ES cells, they also share a variety of epigenetic properties with primed murine epiblast stem cells (EpiSCs). These include predominant use of the proximal enhancer element to maintain OCT4 expression, pronounced tendency for X chromosome inactivation in most female human ES cells, increase in DNA methylation and prominent deposition of H3K27me3 and bivalent domain acquisition on lineage regulatory genes. The feasibility of establishing human ground state naive pluripotency in vitro with equivalent molecular and functional features to those characterized in mouse ES cells remains to be defined. Here we establish defined conditions that facilitate the derivation of genetically unmodified human naive pluripotent stem cells from already established primed human ES cells, from somatic cells through induced pluripotent stem (iPS) cell reprogramming or directly from blastocysts. The novel naive pluripotent cells validated herein retain molecular characteristics and functional properties that are highly similar to mouse naive ES cells, and distinct from conventional primed human pluripotent cells. This includes competence in the generation of cross-species chimaeric mouse embryos that underwent organogenesis following microinjection of human naive iPS cells into mouse morulas. Collectively, our findings establish new avenues for regenerative medicine, patient-specific iPS cell disease modelling and the study of early human development in vitro and in vivo.
Somatic cells can be inefficiently and stochastically reprogrammed into induced pluripotent stem (iPS) cells by exogenous expression of Oct4 (also called Pou5f1), Sox2, Klf4 and Myc (hereafter referred to as OSKM). The nature of the predominant rate-limiting barrier(s) preventing the majority of cells to successfully and synchronously reprogram remains to be defined. Here we show that depleting Mbd3, a core member of the Mbd3/NuRD (nucleosome remodelling and deacetylation) repressor complex, together with OSKM transduction and reprogramming in naive pluripotency promoting conditions, result in deterministic and synchronized iPS cell reprogramming (near 100% efficiency within seven days from mouse and human cells). Our findings uncover a dichotomous molecular function for the reprogramming factors, serving to reactivate endogenous pluripotency networks while simultaneously directly recruiting the Mbd3/NuRD repressor complex that potently restrains the reactivation of OSKM downstream target genes. Subsequently, the latter interactions, which are largely depleted during early pre-implantation development in vivo, lead to a stochastic and protracted reprogramming trajectory towards pluripotency in vitro. The deterministic reprogramming approach devised here offers a novel platform for the dissection of molecular dynamics leading to establishing pluripotency at unprecedented flexibility and resolution.
In a cell-free approach to regenerative therapeutics, transient application of paracrine factors in vivo could be used to alter the behavior and fate of progenitor cells to achieve sustained clinical benefits. Here we show that intramyocardial injection of synthetic modified RNA (modRNA) encoding human vascular endothelial growth factor-A (VEGF-A) results in the expansion and directed differentiation of endogenous heart progenitors in a mouse myocardial infarction model. VEGF-A modRNA markedly improved heart function and enhanced long-term survival of recipients. This improvement was in part due to mobilization of epicardial progenitor cells and redirection of their differentiation toward cardiovascular cell types. Direct in vivo comparison with DNA vectors and temporal control with VEGF inhibitors revealed the greatly increased efficacy of pulse-like delivery of VEGF-A. Our results suggest that modRNA is a versatile approach for expressing paracrine factors as cell fate switches to control progenitor cell fate and thereby enhance long-term organ repair.
Human pluripotent stem cells (PSCs) are a leading candidate for cell-based therapies because of their capacity for unlimited self renewal and pluripotent differentiation. These advances have recently culminated in the first-in-human PSC clinical trials by Geron, Advanced Cell Technology and the Kobe Center for Developmental Biology for the treatment of spinal cord injury and macular degeneration. Despite their therapeutic promise, a crucial hurdle for the clinical implementation of human PSCs is their potential to form tumors in vivo. In this Perspective, we present an overview of the mechanisms underlying the tumorigenic risk of human PSC-based therapies and discuss current advances in addressing these challenges.
Although induced pluripotent stem (iPS) cells are indistinguishable from ES cells in their expression of pluripotent markers,
their differentiation into targeted cells is often limited. Here, we examined whether the limited capacity of iPS cells to
differentiate into neural lineage cells could be mitigated by improving their base-line level of pluripotency, i.e. by converting them into the so-called “naive” state. In this study, we used rabbit iPS and ES cells because of the easy availability
of both cell types and their typical primed state characters. Repeated passages of the iPS cells permitted their differentiation
into early neural cell types (neural stem cells, neurons, and glial astrocytes) with efficiencies similar to ES cells. However,
unlike ES cells, their ability to differentiate later into neural cells (oligodendrocytes) was severely compromised. In contrast,
after these iPS cells had been converted to a naive-like state, they readily differentiated into mature oligodendrocytes developing
characteristic ramified branches, which could not be attained even with ES cells. These results suggest that the naive-like
conversion of iPS cells might endow them with a higher differentiation capacity.
Heart disease remains a leading cause of death worldwide. Owing to the limited regenerative capacity of heart tissue, cardiac regenerative therapy has emerged as an attractive approach. Direct reprogramming of human cardiac fibroblasts (HCFs) into cardiomyocytes may hold great potential for this purpose. We reported previously that induced cardiomyocyte-like cells (iCMs) can be directly generated from mouse cardiac fibroblasts in vitro and vivo by transduction of three transcription factors: Gata4, Mef2c, and Tbx5, collectively termed GMT. In the present study, we sought to determine whether human fibroblasts also could be converted to iCMs by defined factors. Our initial finding that GMT was not sufficient for cardiac induction in HCFs prompted us to screen for additional factors to promote cardiac reprogramming by analyzing multiple cardiac-specific gene induction with quantitative RT-PCR. The addition of Mesp1 and Myocd to GMT up-regulated a broader spectrum of cardiac genes in HCFs more efficiently compared with GMT alone. The HCFs and human dermal fibroblasts transduced with GMT, Mesp1, and Myocd (GMTMM) changed the cell morphology from a spindle shape to a rod-like or polygonal shape, expressed multiple cardiac-specific proteins, increased a broad range of cardiac genes and concomitantly suppressed fibroblast genes, and exhibited spontaneous Ca(2+) oscillations. Moreover, the cells matured to exhibit action potentials and contract synchronously in coculture with murine cardiomyocytes. A 5-ethynyl-2'-deoxyuridine assay revealed that the iCMs thus generated do not pass through a mitotic cell state. These findings demonstrate that human fibroblasts can be directly converted to iCMs by defined factors, which may facilitate future applications in regenerative medicine.
Directed differentiation protocols enable derivation of cardiomyocytes from human pluripotent stem cells (hPSCs) and permit engineering of human myocardium in vitro. However, hPSC-derived cardiomyocytes are reflective of very early human development, limiting their utility in the generation of in vitro models of mature myocardium. Here we describe a platform that combines three-dimensional cell cultivation with electrical stimulation to mature hPSC-derived cardiac tissues. We used quantitative structural, molecular and electrophysiological analyses to explain the responses of immature human myocardium to electrical stimulation and pacing. We demonstrated that the engineered platform allows for the generation of three-dimensional, aligned cardiac tissues (biowires) with frequent striations. Biowires submitted to electrical stimulation had markedly increased myofibril ultrastructural organization, elevated conduction velocity and improved both electrophysiological and Ca(2+) handling properties compared to nonstimulated controls. These changes were in agreement with cardiomyocyte maturation and were dependent on the stimulation rate.
The protocol described here efficiently directs human pluripotent stem cells (hPSCs) to functional cardiomyocytes in a completely defined, growth factor- and serum-free system by temporal modulation of regulators of canonical Wnt signaling. Appropriate temporal application of a glycogen synthase kinase 3 (GSK3) inhibitor combined with the expression of β-catenin shRNA or a chemical Wnt inhibitor is sufficient to produce a high yield (0.8-1.3 million cardiomyocytes per cm(2)) of virtually pure (80-98%) functional cardiomyocytes in 14 d from multiple hPSC lines without cell sorting or selection. Qualitative (immunostaining) and quantitative (flow cytometry) characterization of differentiated cells is described to assess the expression of cardiac transcription factors and myofilament proteins. Flow cytometry of BrdU incorporation or Ki67 expression in conjunction with cardiac sarcomere myosin protein expression can be used to determine the proliferative capacity of hPSC-derived cardiomyocytes. Functional human cardiomyocytes differentiated via these protocols may constitute a potential cell source for heart disease modeling, drug screening and cell-based therapeutic applications.
Efficient cardiac regeneration postinfarction (MI) requires the replacement of lost cardiomyocytes, formation of new coronary vessels and appropriate modulation of the inflammatory response. However, insight into how to stimulate repair of the human heart is currently limited. Using the embryonic paradigm of regeneration, we demonstrated that the actin-binding peptide thymosin β4 (Tβ4), required for epicardium-derived coronary vasculogenesis, can recapitulate its embryonic role and activate quiescent adult epicardial cells (EPDCs). Once stimulated, EPDCs facilitate neovascularization of the ischemic adult heart and, moreover, contribute bona fide cardiomyocytes. EPDC-derived cardiomyocytes structurally and functionally integrate with resident muscle to regenerate functional myocardium, limiting pathological remodeling, and effecting an improvement in cardiac function. Alongside pro-survival and anti-inflammatory properties, these regenerative roles, via EPDCs, markedly expand the range of therapeutic benefits of Tβ4 to sustain and repair the myocardium after ischemic damage.
Heart malformations are common congenital defects in humans. Many congenital heart defects involve anomalies in cardiac septation or valve development, and understanding the developmental mechanisms that underlie the formation of cardiac septal and valvular tissues thus has important implications for the diagnosis, prevention and treatment of congenital heart disease. The development of heart septa and valves involves multiple types of progenitor cells that arise either within or outside the heart. Here, we review the morphogenetic events and genetic networks that regulate spatiotemporal interactions between the cells that give rise to septal and valvular tissues and hence partition the heart.
Transplantation studies in mice and rats have shown that human embryonic-stem-cell-derived cardiomyocytes (hESC-CMs) can improve the function of infarcted hearts, but two critical issues related to their electrophysiological behaviour in vivo remain unresolved. First, the risk of arrhythmias following hESC-CM transplantation in injured hearts has not been determined. Second, the electromechanical integration of hESC-CMs in injured hearts has not been demonstrated, so it is unclear whether these cells improve contractile function directly through addition of new force-generating units. Here we use a guinea-pig model to show that hESC-CM grafts in injured hearts protect against arrhythmias and can contract synchronously with host muscle. Injured hearts with hESC-CM grafts show improved mechanical function and a significantly reduced incidence of both spontaneous and induced ventricular tachycardia. To assess the activity of hESC-CM grafts in vivo, we transplanted hESC-CMs expressing the genetically encoded calcium sensor, GCaMP3 (refs 4, 5). By correlating the GCaMP3 fluorescent signal with the host ECG, we found that grafts in uninjured hearts have consistent 1:1 host–graft coupling. Grafts in injured hearts are more heterogeneous and typically include both coupled and uncoupled regions. Thus, human myocardial grafts meet physiological criteria for true heart regeneration, providing support for the continued development of hESC-based cardiac therapies for both mechanical and electrical repair.
Unique insights for the reprograming of cell lineages have come from embryonic development in the ascidian Ciona, which is dependent upon the transcription factors Ci-ets1/2 and Ci-mesp to generate cardiac progenitors. We tested the idea that mammalian v-ets erythroblastosis virus E26 oncogene homolog 2 (ETS2) and mesoderm posterior (MESP) homolog may be used to convert human dermal fibroblasts into cardiac progenitors. Here we show that murine ETS2 has a critical role in directing cardiac progenitors during cardiopoiesis in embryonic stem cells. We then use lentivirus-mediated forced expression of human ETS2 to convert normal human dermal fibroblasts into replicative cells expressing the cardiac mesoderm marker KDR(+). However, although neither ETS2 nor the purported cardiac master regulator MESP1 can by themselves generate cardiac progenitors de novo from fibroblasts, forced coexpression of ETS2 and MESP1 or cell treatment with purified proteins reprograms fibroblasts into cardiac progenitors, as shown by the de novo appearance of core cardiac transcription factors, Ca(2+) transients, and sarcomeres. Our data indicate that ETS2 and MESP1 play important roles in a genetic network that governs cardiopoiesis.
Since human embryonic stem cells were first differentiated to beating cardiomyocytes a decade ago, interest in their potential applications has increased exponentially. This has been further enhanced over recent years by the discovery of methods to induce pluripotency in somatic cells, including those derived from patients with hereditary cardiac diseases. Human pluripotent stem cells have been among the most challenging cell types to grow stably in culture, but advances in reagent development now mean that most laboratories can expand both embryonic and induced pluripotent stem cells robustly using commercially available products. However, differentiation protocols have lagged behind and in many cases only produce the cell types required with low efficiency. Cardiomyocyte differentiation techniques were also initially inefficient and not readily transferable across cell lines, but there are now a number of more robust protocols available. Here, we review the basic biology underlying the differentiation of pluripotent cells to cardiac lineages and describe current state-of-the-art protocols, as well as ongoing refinements. This should provide a useful entry for laboratories new to this area to start their research. Ultimately, efficient and reliable differentiation methodologies are essential to generate desired cardiac lineages to realize the full promise of human pluripotent stem cells for biomedical research, drug development, and clinical applications.
Reverse engineering of biological form and function requires hierarchical design over several orders of space and time. Recent advances in the mechanistic understanding of biosynthetic compound materials, computer-aided design approaches in molecular synthetic biology and traditional soft robotics, and increasing aptitude in generating structural and chemical microenvironments that promote cellular self-organization have enhanced the ability to recapitulate such hierarchical architecture in engineered biological systems. Here we combined these capabilities in a systematic design strategy to reverse engineer a muscular pump. We report the construction of a freely swimming jellyfish from chemically dissociated rat tissue and silicone polymer as a proof of concept. The constructs, termed 'medusoids', were designed with computer simulations and experiments to match key determinants of jellyfish propulsion and feeding performance by quantitatively mimicking structural design, stroke kinematics and animal-fluid interactions. The combination of the engineering design algorithm with quantitative benchmarks of physiological performance suggests that our strategy is broadly applicable to reverse engineering of muscular organs or simple life forms that pump to survive.
Cardiac tissue engineering is a promising therapeutic strategy for severe heart failure. However, conventional tissue engineering methods by seeding cells into biodegradable scaffolds have intrinsic limitations such as inflammatory responses and fibrosis arising from the degradation of scaffolds. On the other hand, we have developed cell sheet engineering as a scaffold-free approach for cardiac tissue engineering. Confluent cultured cells are harvested as an intact cell sheet using a temperature-responsive culture surface. By layering cardiac cell sheets, it is possible to form electrically communicative three-dimensional cardiac constructs. Cell sheet transplantation onto damaged hearts in several animal models has revealed improvements in heart functions. Because of the lack of vasculature, the thickness of viable cardiac cell sheet-layered tissues is limited to three layers. Pre-vascularized structure formation within cardiac tissue and multi-step transplantation methods has enabled the formation of thick vascularized tissues in vivo. Furthermore, development of original bioreactor systems with vascular beds has allowed reconstruction of three-dimensional cardiac tissues with a functional vascular structure in vitro. Large-scale culture systems to generate pluripotent stem cell-derived cardiac cells can create large numbers of cardiac cell sheets. Three-dimensional cardiac tissues fabricated by cell sheet engineering may be applied to treat heart disease and tissue model construction.
Copyright © 2015. Published by Elsevier B.V.
Engineering functional human cardiac tissue that mimics the native adult morphological and functional phenotype has been a long held objective. In the last 5 years, the field of cardiac tissue engineering has transitioned from cardiac tissues derived from various animal species to the production of the first generation of human engineered cardiac tissues (hECTs), due to recent advances in human stem cell biology. Despite this progress, the hECTs generated to date remain immature relative to the native adult myocardium. In this review, we focus on the maturation challenge in the context of hECTs, the present state of the art, and future perspectives in terms of regenerative medicine, drug discovery, preclinical safety testing and pathophysiological studies.
Copyright © 2015 Elsevier B.V. All rights reserved.
Paracrine-acting proteins are emerging as a central mechanism by which bone marrow cell-based therapies improve tissue repair and heart function after myocardial infarction (MI). We carried out a bioinformatic secretome analysis in bone marrow cells from patients with acute MI to identify novel secreted proteins with therapeutic potential. Functional screens revealed a secreted protein encoded by an open reading frame on chromosome 19 (C19orf10) that promotes cardiac myocyte survival and angiogenesis. We show that bone marrow-derived monocytes and macrophages produce this protein endogenously to protect and repair the heart after MI, and we named it myeloid-derived growth factor (MYDGF). Whereas Mydgf-deficient mice develop larger infarct scars and more severe contractile dysfunction compared to wild-type mice, treatment with recombinant Mydgf reduces scar size and contractile dysfunction after MI. This study is the first to assign a biological function to MYDGF, and it may serve as a prototypical example for the development of protein-based therapies for ischemic tissue repair.
Human induced pluripotent stem cells (hiPSCs) hold promise for myocardial repair following injury, but preclinical studies in large animal models are required to determine optimal cell preparation and delivery strategies to maximize functional benefits and to evaluate safety. Here, we utilized a porcine model of acute myocardial infarction (MI) to investigate the functional impact of intramyocardial transplantation of hiPSC-derived cardiomyocytes, endothelial cells, and smooth muscle cells, in combination with a 3D fibrin patch loaded with insulin growth factor (IGF)-encapsulated microspheres. hiPSC-derived cardiomyocytes integrated into host myocardium and generated organized sarcomeric structures, and endothelial and smooth muscle cells contributed to host vasculature. Trilineage cell transplantation significantly improved left ventricular function, myocardial metabolism, and arteriole density, while reducing infarct size, ventricular wall stress, and apoptosis without inducing ventricular arrhythmias. These findings in a large animal MI model highlight the potential of utilizing hiPSC-derived cells for cardiac repair.
Copyright © 2014 Elsevier Inc. All rights reserved.
Despite advances in coronary artery disease treatment and prevention, myocardial damage due to acute myocardial infarction (MI) remains a major cause of morbidity and mortality in the population. Cell-based clinical trials to treat MI have focused on cells derived from the bone marrow or those potentially possessing functional similarities such as skeletal myoblasts or cardiac progenitors isolated from heart biopsies. Any benefits provided by these cells in improving heart function, left ventricular ejection fraction, or extending life expectancy after MI have been credited mostly to paracrine effects. Functional restoration of damaged myocardium will require a functional cell type with similar phenotype and characteristics of the damaged tissue that can also integrate, survive, and electrically couple to the host. Human pluripotent stem cells (hPSCs) have the ability to differentiate into multiple cell types of the adult body. hPSC-derived cardiomyocytes represent a promising target population for cell-based therapies for MI because they are scalable and the product can be defined with a specific set of release criteria. The purpose of this article is to review the rationale for cell therapy in heart disease, discuss the properties of hPSC cardiomyocytes that define their usefulness for regenerative therapy, consider manufacturing issues and preclinical investigation, and finally examine the steps required to establish effective clinical implementation. Pluripotent stem cell-derived cardiomyocyte-based therapies have enormous potential to revolutionize the management of heart disease; expedient but careful development is needed to ensure that this potential is fully realized.
Copyright © 2014 Canadian Cardiovascular Society. Published by Elsevier Inc. All rights reserved.
Background:
Cell therapies offer the potential to improve cardiac function after myocardial infarction. Although injection of single-cell suspensions has proven safe, cell retention and survival rates are low. Tissue-engineered grafts allow cell delivery with minimal initial cell loss and mechanical support to the heart. However, graft performance cannot be easily compared, and optimal construct thickness, vascularization, and survival kinetics are unknown.
Methods and results:
Cardiac tissue slices (CTS) were generated by sectioning mouse hearts (n=40) expressing firefly luciferase and green fluorescent protein into slices of defined size and thickness using a vibrating blade microtome. Bioluminescence imaging of CTS transplanted onto hearts of immunodeficient mice demonstrated survival of ≤30% of transplanted cells. Cardiac slice perfusion was re-established within 3 days, likely through anastomosis of pre-existing vessels with the host vasculature and invasion of vessels from the host. Immunofluorescence showed a peak in cell death 3 days after transplantation and a gradual decline thereafter. MRI revealed preservation of contractile function and an improved ejection fraction 1 month after transplantation of CTS (28±2% CTS versus 22±2% control; P=0.05). Importantly, this effect was specific to CTS because transplantation of skeletal muscle tissue slices led to faster dilative remodeling and higher animal mortality.
Conclusions:
In summary, this is the first study to use CTS as a benchmark to validate and model tissue-engineered graft studies. CTS transplantation improved cell survival, established reperfusion, and enhanced cardiac function after myocardial infarction. These findings also confirm that dilative remodeling can be attenuated by topical transplantation of CTS but not skeletal muscle tissue grafts.
Cardiovascular disease is the leading cause of death in the developed world, and as such there is a pressing need for treatment options. Cardiac tissue engineering emerged from the need to develop alternative sources and methods of replacing tissue damaged by cardiovascular diseases, as the ultimate treatment option for many who suffer from end-stage heart failure is a heart transplant. In this review we focus on biomaterial approaches to augmenting injured or impaired myocardium, with specific emphasis on: the design criteria for these biomaterials; the types of scaffolds - composed of natural or synthetic biomaterials or decellularized extracellular matrix - that have been used to develop cardiac patches and tissue models; methods to vascularize scaffolds and engineered tissue; and finally, injectable biomaterials (hydrogels) designed for endogenous repair, exogenous repair or as bulking agents to maintain ventricular geometry post-infarct. The challenges facing the field and obstacles that must be overcome to develop truly clinically viable cardiac therapies are also discussed. Copyright © 2014 John Wiley & Sons, Ltd.
The discovery of human pluripotent stem cells (hPSCs), including both human embryonic stem cells and human-induced pluripotent stem cells, has opened up novel paths for a wide range of scientific studies. The capability to direct the differentiation of hPSCs into functional cardiomyocytes has provided a platform for regenerative medicine, development, tissue engineering, disease modeling, and drug toxicity testing. Despite exciting progress, achieving the optimal benefits has been hampered by the immature nature of these cardiomyocytes. Cardiac maturation has long been studied in vivo using animal models; however, finding ways to mature hPSC cardiomyocytes is only in its initial stages. In this review, we discuss progress in promoting the maturation of the hPSC cardiomyocytes, in the context of our current knowledge of developmental cardiac maturation and in relation to in vitro model systems such as rodent ventricular myocytes. Promising approaches that have begun to be examined in hPSC cardiomyocytes include long-term culturing, 3-dimensional tissue engineering, mechanical loading, electric stimulation, modulation of substrate stiffness, and treatment with neurohormonal factors. Future studies will benefit from the combinatorial use of different approaches that more closely mimic nature's diverse cues, which may result in broader changes in structure, function, and therapeutic applicability.
The engineering of 3-dimensional (3D) heart muscles has undergone exciting progress for the past decade. Profound advances in human stem cell biology and technology, tissue engineering and material sciences, as well as prevascularization and in vitro assay technologies make the first clinical application of engineered cardiac tissues a realistic option and predict that cardiac tissue engineering techniques will find widespread use in the preclinical research and drug development in the near future. Tasks that need to be solved for this purpose include standardization of human myocyte production protocols, establishment of simple methods for the in vitro vascularization of 3D constructs and better maturation of myocytes, and, finally, thorough definition of the predictive value of these methods for preclinical safety pharmacology. The present article gives an overview of the present state of the art, bottlenecks, and perspectives of cardiac tissue engineering for cardiac repair and in vitro testing.
A vital challenge in complex organ manufacturing is to vascularize large combined tissues. The aim of this study is to vascularize in vitro an adipose-derived stem cell (ADSC)/fibrin/collagen incorporated three-dimensional (3D) poly(d,l-lactic-co-glycolic acid) (PLGA) scaffold (10 × 10 × 10 mm(3) ) with interconnected channels. A low-temperature 3D printing technique was employed to build the PLGA scaffold. A step-by-step cocktail procedure was designed to engage or steer the ADSCs in the PLGA channels towards both endothelial and smooth muscle cell lineages. The combined system had sufficient mechanical properties to support the cell/fibrin/collagen hydrogel inside the predefined PLGA channels. The ADSCs encapsulated in the fibrin/collagen hydrogel differentiated to endothelial and smooth muscle cell lineage, respectively, corresponding to their respective locations in the construct and formed vascular-like structures. This technique allows in vitro vascularization of the predefined PLGA channels and provides a choice for complex organ manufacture. Copyright © 2014 John Wiley & Sons, Ltd.
Background: Human induced pluripotent stem cell (h-iPSC)-derived cardiac myocytes are a unique model in which to study human myocyte function and dysfunction, especially from patients with genetic disorders. They are also considered a major advance for drug safety testing. However, these cells have considerable unexplored potential limitations when applied to quantitative action potential (AP) analysis. One major factor is spontaneous activity, and resulting variability and potentially anomalous behavior in AP parameters.
To demonstrate the effect of using an in silico interface to electronically express IK1, a major component lacking in h-iPSC-derived cardiac myocytes.
An in silico interface was developed to express synthetic IK1 in cells under whole cell voltage clamp.
Electronic IK1 expression established a physiological resting potential, eliminated spontaneous activity, reduced spontaneous early and delayed after depolarizations, and decreased AP variability. Initiated APs had the classic rapid upstroke and spike and dome morphology consistent with data from freshly isolated human myocytes, and the readily recognizable repolarization attributes of ventricular and atrial cells. Application of 1 µM BayK-8644 resulted in anomalous AP shortening in h-iPSC-derived cardiac myocytes. When IK1 was electronically expressed, BayK-8644 lengthened the AP, consistent with existing results on native cardiac myocytes.
Electronic expression of IK1 is a simple and robust method to significantly improve the physiological behavior of the AP and electrical profile of h-iPSC-derived cardiac myocytes. Increased stability enables this preparation to be used for controlled quantitative analysis of AP parameters e.g., drug responsiveness, genetic disorders, and dynamic behavior restitution profiles.
To report full 1-year results, detailed magnetic resonance imaging (MRI) analysis, and determinants of efficacy in the prospective randomized controlled CADUCEUS trial.
Cardiosphere-derived cells (CDCs) exert regenerative effects at 6 months in the CADUCEUS trial. Complete results at the final 1 year endpoint are unknown.
Autologous CDCs (12.5-25x10(6)) grown from endomyocardial biopsies were intracoronarily infused in 17 patients with left ventricular (LV) dysfunction 1.5-3 months post-myocardial infarction (MI) (plus n=1 infused off-protocol 14 months post-MI). Eight patients were followed as routine-care controls.
In 13.4 months of follow-up, safety endpoints were equivalent between groups. At 1 year, MRI revealed that CDC-treated patients had smaller scar size compared to controls. Scar mass decreased and viable mass increased in CDC-treated subjects but not controls. The single subject infused 14 months post-MI responded similarly. CDC therapy led to improved regional function of infarcted segments compared to controls. Scar shrinkage correlated with increase in viability and with improvement in regional function. Scar reduction correlated with baseline scar size but not with history of temporally remote MI or time from MI to infusion. The changes in LVEF in CDC-treated subjects were consistent with the natural relationship between scar size and EF post-MI.
Intracoronary administration of autologous CDCs did not raise significant safety concerns. Preliminary indications of bioactivity include decreased scar size, increased viable myocardium and improved regional function of infarcted myocardium at 1 year post-treatment. These results, which are consistent with therapeutic regeneration, merit further investigation in future trials.
CADUCEUS; NCT00893360.
Despite significant therapeutic advances, the prognosis of patients with heart failure (HF) remains poor, and current therapeutic approaches are palliative in the sense that they do not address the underlying problem of the loss of cardiac tissue. Stem cell-based therapies have the potential to fundamentally transform the treatment of HF by achieving what would have been unthinkable only a few years ago-myocardial regeneration. For the first time since cardiac transplantation, a therapy is being developed to eliminate the underlying cause of HF, not just to achieve damage control. Since the initial report of cell therapy (skeletal myoblasts) in HF in 1998, research has proceeded at lightning speed, and numerous preclinical and clinical studies have been performed that support the ability of various stem cell populations to improve cardiac function and reduce infarct size in both ischemic and nonischemic cardiomyopathy. Nevertheless, we are still at the dawn of this therapeutic revolution. Many important issues (eg, mechanism(s) of action of stem cells, long-term engraftment, optimal cell type(s), and dose, route, and frequency of cell administration) remain to be resolved, and no cell therapy has been conclusively shown to be effective. The purpose of this article is to critically review the large body of work performed with respect to the use of stem/progenitor cells in HF, both at the experimental and clinical levels, and to discuss current controversies, unresolved issues, challenges, and future directions. The review focuses specifically on chronic HF; other settings (eg, acute myocardial infarction, refractory angina) are not discussed.
Background:
Human embryonic stem cells (hESCs) can be efficiently and reproducibly directed into cardiomyocytes (CMs) using stage-specific induction protocols. However, their functional properties and suitability for clinical and other applications have not been evaluated.
Methods and results:
Here we showed that CMs derived from multiple pluripotent human stem cell lines (hESC: H1, HES2) and types (induced pluripotent stem cell) using different in vitro differentiation protocols (embryoid body formation, endodermal induction, directed differentiation) commonly displayed immature, proarrhythmic action potential properties such as high degree of automaticity, depolarized resting membrane potential, Phase 4- depolarization, and delayed after-depolarization. Among the panoply of sarcolemmal ionic currents investigated (I(Na)(+)/I(CaL)(+)/I(Kr)(+)/I(NCX)(+)/I(f)(+)/I(to)(+)/I(K1)(-)/I(Ks)(-)), we pinpointed the lack of the Kir2.1-encoded inwardly rectifying K(+) current (I(K1)) as the single mechanistic contributor to the observed immature electrophysiological properties in hESC-CMs. Forced expression of Kir2.1 in hESC-CMs led to robust expression of Ba(2+)-sensitive I(K1) and, more importantly, completely ablated all the proarrhythmic action potential traits, rendering the electrophysiological phenotype indistinguishable from the adult counterparts. These results provided the first link of a complex developmentally arrested phenotype to a major effector gene, and importantly, further led us to develop a bio-mimetic culturing strategy for enhancing maturation.
Conclusions:
By providing the environmental cues that are missing in conventional culturing method, this approach did not require any genetic or pharmacological interventions. Our findings can facilitate clinical applications, drug discovery, and cardiotoxicity screening by improving the yield, safety, and efficacy of derived CMs.
Human pluripotent stem cell derived cardiomyocytes (hPS-CM) may offer a number of advantages over previous cardiac models, however questions of their immaturity complicate their adoption as a new in vitro model. hPS-CM differ from adult cardiomyocytes with respect to structure, proliferation, metabolism and electrophysiology, better approximating fetal cardiomyocytes. Time in culture appears to significantly impact phenotype, leading to what can be referred to as early and late hPS-CM. This work surveys the phenotype of hPS-CM, including structure, bioenergetics, sensitivity to damage, gene expression, and electrophysiology, including action potential, ion channels, and intracellular calcium stores, while contrasting fetal and adult CM with hPS-CM at early and late time points after onset of differentiation.
In mammals, enlargement of the heart during embryonic development is primarily dependent on the increase in cardiomyocyte numbers. Shortly after birth, however, cardiomyocytes stop proliferating and further growth of the myocardium occurs through hypertrophic enlargement of the existing myocytes. As a consequence of the minimal renewal of cardiomyocytes during adult life, repair of cardiac damage through myocardial regeneration is very limited. Here we show that the exogenous administration of selected microRNAs (miRNAs) markedly stimulates cardiomyocyte proliferation and promotes cardiac repair. We performed a high-content microscopy, high-throughput functional screening for human miRNAs that promoted neonatal cardiomyocyte proliferation using a whole-genome miRNA library. Forty miRNAs strongly increased both DNA synthesis and cytokinesis in neonatal mouse and rat cardiomyocytes. Two of these miRNAs (hsa-miR-590 and hsa-miR-199a) were further selected for testing and were shown to promote cell cycle re-entry of adult cardiomyocytes ex vivo and to promote cardiomyocyte proliferation in both neonatal and adult animals. After myocardial infarction in mice, these miRNAs stimulated marked cardiac regeneration and almost complete recovery of cardiac functional parameters. The miRNAs identified hold great promise for the treatment of cardiac pathologies consequent to cardiomyocyte loss.
Cardiac progenitor cells (CPCs) are multipotent cells that may offer tremendous potentials for the regeneration of injured myocardium. To expand the limited number of CPCs for effective clinical regeneration of myocardium, it is important to understand their proliferative potentials. Single-cell based assays were utilized to purify c-kit(pos) CPCs from human and mouse hearts. MicroRNA profiling identified eight differentially expressed microRNAs in CPCs from neonatal and adult hearts. Notably, the predicted protein targets were predominantly involved in cellular proliferation-related pathways. To directly test this phenotypic prediction, the developmental variance in the proliferation of CPCs was tested. Ki67 protein expression and DNA kinetics were tested in human and mouse in vivo CPCs, and doubling times were tested in primary culture of mouse CPCs. The human embryonic and mouse neonatal CPCs showed a six-fold increase in Ki67 expressing cells, a two-fold increase in the number of cells in S/G2-M phases of cell cycle, and a seven-fold increase in the doubling time in culture when compared to the corresponding adult CPCs. The over-expression of miR-17-92 increased the proliferation in adult CPCs in vivo by two-fold. In addition, the level of retinoblastoma-like 2 (Rb12/p130) protein was two-fold higher in adult compared to neonatal-mouse CPCs. In conclusion, we demonstrate a differentially regulated cohort of microRNAs that predicts differences in cellular proliferation in CPCs during postnatal development and target microRNAs that are involved in this transition. Our study provides new insights that may enhance the utilization of adult CPCs for regenerative therapy of the injured myocardium.
In recent years, prominent roles for microRNAs (miRNAs) have been uncovered in several cardiovascular disorders. The ability to therapeutically manipulate miRNA expression and function through systemic or local delivery of miRNA inhibitors, referred to as antimiRs, has triggered enthusiasm for miRNAs as novel therapeutic targets. Here, we focus on the pharmacokinetic and pharmacodynamic properties of current antimiR designs and their relevance to cardiovascular indications, and evaluate the opportunities and obstacles associated with this new therapeutic modality.
Rationale:
Cardiomyocytes (CMs) differentiated from human pluripotent stem cells (PSCs) are increasingly being used for cardiovascular research, including disease modeling, and hold promise for clinical applications. Current cardiac differentiation protocols exhibit variable success across different PSC lines and are primarily based on the application of growth factors. However, extracellular matrix is also fundamentally involved in cardiac development from the earliest morphogenetic events, such as gastrulation.
Objective:
We sought to develop a more effective protocol for cardiac differentiation of human PSCs by using extracellular matrix in combination with growth factors known to promote cardiogenesis.
Methods and results:
PSCs were cultured as monolayers on Matrigel, an extracellular matrix preparation, and subsequently overlayed with Matrigel. The matrix sandwich promoted an epithelial-to-mesenchymal transition as in gastrulation with the generation of N-cadherin-positive mesenchymal cells. Combining the matrix sandwich with sequential application of growth factors (Activin A, bone morphogenetic protein 4, and basic fibroblast growth factor) generated CMs with high purity (up to 98%) and yield (up to 11 CMs/input PSC) from multiple PSC lines. The resulting CMs progressively matured over 30 days in culture based on myofilament expression pattern and mitotic activity. Action potentials typical of embryonic nodal, atrial, and ventricular CMs were observed, and monolayers of electrically coupled CMs modeled cardiac tissue and basic arrhythmia mechanisms.
Conclusions:
Dynamic extracellular matrix application promoted epithelial-mesenchymal transition of human PSCs and complemented growth factor signaling to enable robust cardiac differentiation.