Antifungal effects of undecylenic acid on the biofilm formation of Candida albicans

Abstract

Undecylenic acid can effectively control skin fungal infection, but the mechanism of its fungal inhibition is unclear. Hyphal growth of Candida albicans (C. albicans) and biofilm formation have been well recognized as important virulence factors for the initiation of skin infection and late development of disseminated infection. In this study, we seek to investigate antifungal mechanisms of undecylenic acid by evaluating the virulence factors of C. albicans during biofilm formation. We found that undecylenic acid inhibits biofilm formation of C. albicans effectively with optimal concentration above 3 mM. In the presence of this compound, the morphological transition from yeast to filamentous phase is abolished ultimately when the concentration of undecylenic acid is above 4 mM. Meanwhile, the cell surface is crumpled, and cells display an atrophic appearance under scanning electron microscopy even with low concentration of drug treatment. On the other hand, the drug treatment decreases the transcriptions of hydrolytic enzymes such as secreted aspartic protease, lipase, and phospholipase. Hyphal formation related genes, like HWP1, are significantly reduced in transcriptional level in drug-treated biofilm condition as well. The down-regulated profile of these genes leads to a poorly organized biofilm in undecylenic acid treated environment.

Full text

Original
©2016 Dustri-Verlag Dr. K. Feistle
ISSN 0946-1965
DOI 10.5414/CP202460
e-pub: February 23, 2016
*Dongmei Shi and Yaxin
Zhao contributed equally
to this work.
Received
July 1, 2015;
accepted
November 9, 2015
Correspondence to
Weida Liu, PhD
Department of Mycol-
ogy, Institute of
Dermatology, No. 12
Jiang Wangmiao Street,
Nanjing 210042,
Jiangsu, China
liumyco@hotmail.com
or
Dongmei Li, PhD
Department of Microbiol-
ogy/Immunology,
Georgetown University
Medical Center, 3900
Reservoir Road,
Washington D.C.,
20057, USA
dl33@georgetown.edu
Key words
Candida albicans – fatty
acids – undecylenic acid
– virulence factors – bio-
lm
Antifungal effects of undecylenic acid on the
biolm formation of Candida albicans
Dongmei Shi1,2, Yaxin Zhao3, Hongxia Yan2, Hongjun Fu2, Yongnian Shen1,
Guixia Lu1, Huan Mei1, Ying Qiu2, Dongmei Li4*, and Weida Liu1*
1Department of Mycology, Institute of Dermatology, Chinese Academy of Medical
Sciences & Peking Union Medical College, Nanjing, 2Department of Dermatology,
3Department of Pharmacy, Jining No. 1 People’s Hospital, Shandong, China, and
4Department of Microbiology/Immunology, Georgetown University Medical Center,
Washington DC, USA
Abstract. Undecylenic acid can effec-
tively control skin fungal infection, but the
mechanism of its fungal inhibition is unclear.
Hyphal growth of Candida albicans (C. al-
bicans) and biolm formation have been
well recognized as important virulence fac-
tors for the initiation of skin infection and
late development of disseminated infection.
In this study, we seek to investigate anti-
fungal mechanisms of undecylenic acid by
evaluating the virulence factors of C. albi-
cans during biolm formation. We found that
undecylenic acid inhibits biolm formation
of C. albicans effectively with optimal con-
centration above 3 mM. In the presence of
this compound, the morphological transition
from yeast to lamentous phase is abolished
ultimately when the concentration of undec-
ylenic acid is above 4 mM. Meanwhile, the
cell surface is crumpled, and cells display an
atrophic appearance under scanning electron
microscopy even with low concentration of
drug treatment. On the other hand, the drug
treatment decreases the transcriptions of hy-
drolytic enzymes such as secreted aspartic
protease, lipase, and phospholipase. Hyphal
formation related genes, like HWP1, are sig-
nicantly reduced in transcriptional level in
drug-treated biolm condition as well. The
down-regulated prole of these genes leads
to a poorly organized biolm in undecylenic
acid treated environment.
Introduction
Candida albicans (C. albicans) is the
most commonly encountered human fungal
pathogen that causes skin and deep mucosal
infection in generally healthy individuals or
elicits life-threatening infection in persons
with weakened immune systems [1, 2, 3, 4].
As there are only a small number of commer-
cial antifungal drugs available for dissemi-
nated candidiasis, the unavoidable reality is
that the tendency for drug-resistant C. albi-
cans increases [5]. Also, infection relapses
easily with currently widely-used antifungal
agents when treating cutaneous candidiasis.
Such topical formulas (ketoconazole as the
main ingredient) can cause itching and sting-
ing in local body sites and liver damage in
some occasions [6].
The second barrier in combating dissemi-
nated candidiasis is the formation of Candi-
da biolms, which can occur at various sites
of the human body and also on devices, such
as indwelling intravascular catheters, and
refractory to conventional antifungal agents
[7]. The biolm mode of growth has been
well described in C. albicans, so has been its
impact on the development of disseminated
candidiasis. Microorganisms prefer to live in
three-dimensional self-organized communi-
ties (biolms), which are known to protect
indwelling organisms from physical and
chemical torment including antifungals. In
general, pathogens in the biolm exhibit up
to a thousand-fold more tolerance to conven-
tional antimicrobial agents, and thus, they
are difcult to eradicate. Hence, discovery of
new antifungal agents is urgently needed to
cope with drug resistance evolution and bio-
lm concerns.
Using fatty acids as antifungal agents of-
fers some advantages over conventional anti-
fungal agents, including more specicity, less
drug resistance, lower risk of environmental
contamination, biodegradability, and bio-
compatibility. Fatty acids are organic acids
characterized by the existence of a carboxyl
group (-COOH) at one end and a methyl
group (-CH3) at the other end. Fatty acids in
International Journal of Clinical Pharmacology and Therapeutics, Vol. 54 – No. 5/2016 (343-353)

Shi, Zhao, Yan, et al. 344
the form of phospholipids are essential con-
stituents of the bi-layer of the cell membrane,
which functions to maintain cell integrity. The
antifungal activities of fatty acids have long
been recognized. For example, butyric acid (a
short chain of C4 fatty acid) inhibited fungal
germination in vitro [8]. Caprylic acid is the
C8 saturated fatty acid that has been admin-
istered as a healthy dietary supplement for
many years because it suppresses C. albicans
growth within the gut. In addition, linoleic
acid (18 : 2), a polyunsaturated fatty acid,
has antifungal activity against several plant
pathogenic fungi [9]. Apart from antifungal
activities, fatty acids also possess other thera-
peutic effects. For example, cleropyric acid (a
natural C18 fatty acid) has been demonstrated
to have antiplasmodial effects against Plas-
modium falciparum [10]. The application of
fatty acids to control plant fungal diseases has
even been proposed to replace chemical com-
pounds worldwide.
One of the best-known antifungal fatty
acids is perhaps undecylenic acid, which is
a pyrolysis product of ricinoleic acid from
castor oil. Undecylenic acid has been used
as the effective ingredient in many topical
antifungal formulas (mostly at concentration
of 2%) for the treatment of dermatomycosis,
onychomycosis, and tinea pedis caused by
Trichophyton rubrum, Trichophyton menta-
grophytes, Epidermophyton inguinale, and
Microsporum audouini [11, 12]. Further-
more, undecylenic acid was noted for its in-
hibitory effects on C. albicans growth in the
human host and hyphal formation [12].
Although the detailed mechanisms of an-
tifungal activity of these fatty acids have not
yet been determined, it has been noted in a
previous study that the extracts of essential
oil from some plants rich in fatty acids are
able to inuence the enzymatic prole as
well as adhesive and invasive properties of
C. albicans [13]. Recently, studies on anti-
fungal activity of fatty acids have revealed
that fungal cell membrane is one of drug tar-
gets, suggesting that enzymes or metabolites
that are associated with lipid homeostasis
may be affected. In a viable cell, content and
type of fatty acid in yeast cell membranes are
well programmed for a suitable uidity to
carry on its biological functions. As soon as
the cell membrane homeostasis is disturbed,
the cell growth will be arrested, which may
lead to cell death when stress response mech-
anism fails. Apparently, the mode of action
of fatty acids on yeast cell membrane activ-
ity deserves further research for the develop-
ment of more potent antifungal analogues.
Various virulence factors, other than bio-
lm formation and lipid metabolism, have
been linked to C. albicans pathogenesis in
the hosts. These factors, for instance, are ad-
herence and secretion of hydrolytic enzymes,
including lipases, phospholipases, and se-
creted aspartyl proteinases [14, 15]. In addi-
tion, the capacity to transmit from yeast to
hyphal form in this pathogenic yeast [16, 17,
18], and the regulation and signaling path-
way for such morphogenesis also contribute
to its overall virulence [19, 20]. To explore
the possible modes of undecylenic acid,
we investigated the cell-membrane-related
virulence aspects of C. albicans under un-
decylenic acid treatment using the real-time
polymerase chain reaction (PCR), morpho-
logical, and physiological experiments. This
study conrms its antifungal activities and
lays the groundwork for developing the in-
fection-oriented drugs with different targets
of azoles.
Experiments
Strain, mediums, and chemicals
C. albican SC5314, a clinical strain
which is widely used in molecular analyses
and virulence studies in animal models, was
used for entire experiments in this study.
Yeast cells were maintained on yeast extract
peptone dextrose medium (YPD) agar plates
(20 g/L glucose, 10 g/L yeast extract, 20 g/L
peptone, 20 g/L agar) at room temperature.
The strains were stored on agar slants at 4 °C.
Yeast nitrogen base (YNB) medium is com-
posed of 10 g/L glucose, 6.7 g/L yeast nitro-
gen base. Undecylenic acid (Fluka-94192)
at working concentration of 1 – 5 mM was
purchased from Sigma-Aldrich (St. Louis,
MO, USA).
XTT assay of biolms
C. albicans were streaked on YPD agar
plates and incubated at 30 °C for 24 hours

Antifungal effects of undecylenic acid 345
prior to experiment. Culture was initiated
by transferring a loop-full of the cells into
20 mL of YNB glucose medium and then
grew for 48 hours at 30 °C. Cells were har-
vested, washed 3 times with sterilized water,
and diluted in RPMI-1640 medium (Life
Technologies, Carlsbad, CA, USA) to an
initial cell concentration of 1 × 106 cells/
mL. Each aliquot of 100 µL standardized
cell suspension was dispensed into a 96-well
Microtiter Microplate (Thermo Scientic,
New York, USA)) and incubated for 1 hour
at 37 °C to allow adherence of cells to the
surface. Wells were then washed twice with
sterilized water to remove nonadherent cells.
Mature biolms of C. albicans were formed
at 37 °C after 47 hours in the presence or
absence of undecylenic acid. The reduc-
tion of XTT (2, 3-bis (2-methoxy-4-nitro-
5-sulfophenyl)-5-[(phenylamino) carbonyl]
-2H- tetrazoliumhydroxide) (Sigma Aldrich)
was used to determine the yeast viability by
measuring the mitochondrial metabolic ac-
tivity of the biolms using optical density at
492 nm [21]. This experiment was conducted
twice on 2 different days, and 4 values were
obtained for each repetition (n = 8).
The mean and standard deviation (SD)
were calculated, and the student’s t-test was
used to determine the signicant difference
between data sets.
Biomass determination
20 mL of a standardized cell suspension
(1 × 106 cells/mL), prepared as described
above, were inoculated into Petri dishes con-
taining RPMI-1640 medium and allowed
to adhere to the surface for 1 hour at 37 °C.
Nonadherent cells were removed with steril-
ized water, and mature biolms were formed
in the presence of 1 – 5 mM undecylenic acid
at 37 °C for 47 hours. Untreated biolms
were used as controls. Mature biolms were
washed to remove nonadherent cells, scraped
off, and resuspended in sterilized water. Cells
were ltered on preweighed 0.2 µm cellulose
acetate lters (Whatman, Maidstone, UK).
The lters were dried at 37 °C for 48 hours,
and the biomass of each sample was then
determined. This experiment was carried
out twice, and the mean of biomass for each
sample was calculated.
Morphological examination
The standardized cell suspension (1 × 106
cells/mL), prepared in the same way as in
tetrazolium salt (XTT) assay, was added to
chamber slides (Nunc™ Lab-Tek™ Cham-
ber Slide System, Beijing, China)) contain-
ing silicone rubber disks (5.5 mm in diame-
ter) lled with 4 mL of RPMI-1640 medium.
Cells were allowed to adhere for 1 hour at
37 °C. Nonadherent cells were removed us-
ing sterilized water, and mature biolms
were formed at 37 °C for 47 hours in the
presence of 1 – 5 mM of the undecylenic
acid, with appropriate controls. The silicone
rubber disks were removed and xed for 2
hours using 3% (v/v; 1.0 M) sodium phos-
phate buffered glutardialdehyde, followed
by xation with osmium tetroxide (1% m/v)
in the same buffered solution for 1 hour. The
disks were dehydrated in a series of ethanol
solutions (50%, 70%, and 95%) for 20 min-
utes, respectively, and absolute ethanol for
1 hour. Disk samples were then critical-point
dried, mounted, and coated with gold to
make them electrically conductive. Finally,
disk samples were visualized on a Shimadzu
SSX550 SEM (Tokyo, Japan) microscopy
according to the method of Van Wyk and
Wingeld [22].
RNA Extract
The yeast cell samples for RNA extrac-
tion were collected 47 hours after undecy-
lenic acid addition. Total RNA from clini-
cal samples was prepared using the Yeast
RNAiso Kit (Takara, Dalian, China), and
treated overnight with DNaseI (Takara), for
the complete digestion of any contaminated
DNA. Puried RNA from each sample was
conrmed to be DNA-free by the absence of
an amplied product after PCR (without real
time (RT)) using ACT1 (actin) primers.
Reverse transcription
cDNA for each gene was reverse-tran-
scribed from total RNA using Moloney Murine
leukemia virus reverse transcriptase (M-MLV
RT) (Takara). Primers used for measuring tran-
script levels for each gene were listed in Table 1.
Primers for each testing gene and the reference

Shi, Zhao, Yan, et al. 346
gene were designed using Primer Express soft-
ware (Applied Biosystems, Foster, CA, USA).
Full-length sequence of each gene was down-
loaded from the C. albicans genomic database
at www.candidagenome.org. The specicity of
each primer was checked by comparing its se-
quence to the C. albicans database using Basic
Local Alignment Search Tool (BLAST).
Real-time PCR
Real-time PCR reactions were performed
using an Agilent MX3000P Instrument and
SYBR Green Master Mix (Takara). The pro-
gram consisted of a denaturation step (95 °C
for 10 minutes), followed by 45 cycles of
touchdown PCR (10 seconds at 95°C, 5s at
the annealing temperature listed in Table 1,
and 10 seconds at 72 °C). A nal melting-
curve step (50 – 98 °C) was then followed by
a cooling step at 40 °C for 30 seconds. The
amplication process was monitored quan-
titatively by the DNA-binding dye-SYBR
green. The detection of amplied double-
stranded DNA and the melting analysis al-
lowed for the quantication of the copy of
cDNA templates.
Results
Inhibition of biolm formation by
undecylenic acid
XTT reduction assay is the test most
commonly used for quantitative measure-
ments of Candida biolm mass, growth, and
cell viability after drug treatment. The im-
plication of biolm in antifungal therapeu-
Table 1. Primers used in this study.
Gene
name
Primer sequences Gene
name
Primer sequences
SAP1 Forward 5-TCA ATCAATTTACTCTTCCATTTCTAA-
CA-3
Reverse 5-CCA GTA GCATTAACA GGAGTTTTAAT-
GACA-3
LIP1 Forward 5-ACAAATTCACTGGGATCAAGAG-3
Reverse 5-CAGTAACGTCCATGTCACTTAT-3
SAP2 Forward 5-AACAACAACCCACTAGACATCACC-3
Reverse 5-TGA CCATTAGTA ACTGGGAAT GCTT-
TAGGA-3
LIP2 Forward 5-TTTCCGACTTTGCTGTTCCAG-3
Reverse 5-CTTGGTCTTGTAAGCAGTATTAT-3
SAP3 Forward 5-CCTTCT CTAAAATTATGGATTGGAAC-3
Reverse 5-TTGATTTCA CCTTGG GGA CCA GTA ACA
TTT-3
LIP3 Forward 5-AGCTTTACAACAGGGGACTC-3
Reverse 5-CCTCACAATTGGGACCTGGT-3
SAP4 Forward 5-TTA TTTTTAGATATTGAGCCCACAGAA A-3
Reverse 5-GCCAGT GTCAAC AAT AAC GCT AAG TT-3
LIP4 Forward 5-TGATCAATTATATTGGTAAGCAC-3
Reverse 5-GAATATACTCATCCAAAAAGGA-3
SAP5 Forward 5-AGA ATTTCCCGTCGATGAGACTGG T-3
Reverse 5-CAA ATT TTG GGA AGT GCG GGA AGA-3
LIP5 Forward 5-ACGGTGTGCTCAACTATATCGG-3
Reverse 5-CAGCAATGGATGTTGTTCTCCAT-3
SAP6 Forward 5-CCC GTT TTGAAATTAAATATGCTGATGG-3
Reverse 5-GTC GTA AGG AGT TCT GGT AGC TTC G-3
LIP6 Forward 5-TTAAACCTGGTGCCAAAGCTG-3
Reverse 5- GTTCACCACCAGGGCATCGA-3
SAP7 Forward 5-GAA ATGCAA AGA GTATTAGAGTTATTA C-3
Reverse 5-GAATGATTT GGT TTA CAT-
CATCTTCAACTG-3
LIP7 Forward 5-TGGATGTTTATTTCCCATTTGCAG-3
Reverse 5- CATTTCTCAGTCAGTACTTCCGT-3
SAP8 Forward 5-GCC GTTGGT GCCAAATGGAATAGTTA-3
Reverse 5-ATT TGA CTT GAG CCA ACA GAA TGG T-3
LIP8 Forward 5-AGAGTGATACAGACAAAAAATCAG-3
Reverse 5- CACCATGATGCTGAATGGTCTT-3
SAP9 Forward 5-ATTTACTCCACAGTTTATATCACT-
GAAGGT-3
Reverse 5-CCACCAGAACCACCCTCAGTT-3
LIP9 Forward 5-TTTATAAAGTATGTGGGAGCTAG-3
Reverse 5-CACAACAAGGGCTTGGTCCTA-3
SAP10 Forward 5-CCCGGTATCCAATAGAATCGAA-3
Reverse 5-TCAGTGAATGTGACGAATTTGAAGA-3
LIP10 Forward 5-TTAAGCTCAGTGCTAGATCTAC-3
Reverse 5-GGGTTAACTTAGGATCGGGA-3
PLB1 Forward 5-CCT ATT GCC AAA CAA GCA TTG TC-3
Reverse 5-CCA AGC TAC TGA TTT CAC CTG CTC C-3
BCR1 Forward 5- GCATTGGTAGTGTGGGAAGTTTGAT-3
Reverse 5-AGAGGCAGAATCACCCACTGTTGTA-3
PLB2 Forward 5-GTG GGA TCT TGC AGA GTT CAA GC-3
Reverse 5-CTC AAA GCT CTC CCA TAG ACA TCT G-3
ALS1 Forward 5- CCAATTGCATTCAATGTTGGTGGAAC-3
Reverse 5- TGGATCAACGGTTGACTTTTCAAACT-3
HWP1 Forward 5-ACAACAGCCACAAGAACCTTGTGA-3
Reverse 5- AGGTTGAGGAGGATTGTCACAAGG-3
ALS3 Forward 5- CCACTTCACAATCCCCATC-3
Reverse 5-CAeGCAGTAGTAGTAACAGTAG-
TAGTTTCATC-3
ECE1 Forward 5-CTCCAGAATTCAACATGAA-3
Reverse 5- ATACCCATAATAATTCCAA-3
ACT1 Forward 5-GATTTTGTCTGAACGTGGTAACAG-3
Reverse 5-GGAGTTGAAAGTGGTTTGGTCAATAC-3

Antifungal effects of undecylenic acid 347
tic effects is associated with drug resistance
due to fungal matrix barrier around catheters
in clinical settings. In order to understand
whether undecylenic acid affects fungal ma-
trix formation, biolm formation was evalu-
ated by XTT assay and biolm mass mea-
surement. Meanwhile, the biolm structure
was revealed under SEM microscopy in the
presence of undecylenic acid.
Quantication of the biolm mass was
rst determined by dry weight analysis of
biolm from each of the drug-treated and un-
treated samples. As shown in Figure 1A, bio-
lm biomass production of C. albicans was
reduced dramatically when the concentra-
tions of undecylenic acid was above 3 mM.
On the other hand, the low concentration
of undecylenic acid (1 – 2 mM) exhibited
no effects on biolm formation. Compared
to untreated samples, the biomass yields in
the presence of 3 mM, 4 mM, and 5 mM
undecylenic acid resulted in a reduction of
circa 57%, 71%, and 84%, respectively. In
agreement with dry weight assay, we also ob-
served that the effective concentration of un-
decylenic acid was 3 – 5 mM in XTT assay.
As shown in Figure 1B, the percentage inhi-
bition rates for 3 mM, 4 mM, and 5 mM were
69%, 81%, and 92%, respectively. Again, C.
albicans biolm formation was not affected
by 1 mM and 2 mM undecylenic acid in XTT
assay; a reduction of only circa 2% and 5%,
respectively, was observed. The advantage
of XTT assay for the biolm quantication
is that it allows the visualization of cell vi-
ability at the same time. Therefore, the simi-
lar results from both C. albicans XTT assay
and biomass indicate that reductions of bio-
lm biomass in the presence of undecylenic
acid are due mainly to the inhibition of cell
proliferation. A slight “increased portion” of
biolm inhibition in XTT reduction assay
might reect a low-metabolic status under
this treatment since XTT assay is based on a
healthy mitochondrial metabolic status.
Inhibition of C. albicans hyphal
formation by undecylenic acid
The effect of undecylenic acid on biolm
biomass production was also examined under
Figure 1. Effects of undecylenic acid on biomass
(A) and mitochondrial metabolism (B) of C. albi-
cans biolms. Biolms were grown in the presence
of 1 – 5 mM of the fatty acids. Biolm dry weight
was determined on pre-weighed lters, and mi-
tochondrial activity was monitored using the XTT
assay. The percentage inhibition values were de-
termined compared to untreated controls. Results
are presented as mean ± SD (n = 6).
Figure 2. Effects of undecylenic acid on morphology of C. albicans under light microscope. C. albicans
biolms were treated with 0 – 5 mM concentration of the undecylenic acid (A, B, C, D, E, F, original mag-
nication, 100×).

Shi, Zhao, Yan, et al. 348
light microscopy. As shown in Figure 2, with
1 – 5 mM undecylenic acid treatment (Fig-
ure 2B – F), the mycelium growths were sig-
nicantly inhibited during biolm formation,
and the amount of yeast-like cells increased
when compared to the samples without drug
treatment. At 47 hours, the majority of the
cell population in the control biolm sample
was hyphal formed with a small amount of
yeast cells (0 mM undecylenic acid in Figure
2A). With 1 mM and 2 mM undecylenic acid
treatment, the proportion of laments in bio-
lm biomass declined as shown in Figure 2B
and C. The lamentous growth continued to
form less as drug concentration increased. At
3 mM undecylenic acid condition, less than
50% of cells were seen in biomass (Figure
2D), and there were almost no laments at
4 mM and 5 mM undecylenic acid condition
in Figure 2E and F. Most cells remained as a
yeast form, and some yeast cells are larger.
Under SEM, the cell walls on both yeast
cells and hyphal forms were smooth, and
surface structures were uniformly distributed
as indicated in Figure 3A in the absence of
undecylenic acid. By contrast, the fungal
cells were more shrinking and tortuous, and
the ne granules structure on cell surfaces of
yeast and lamentous cells (black arrow as
shown in Figure 3A) no longer existed when
treated with 1 mM or 4 mM undecylenic
acid (Figure 3B, C). Instead, cell surfaces
were piled up with many knob- or nubble-
like structures.
Inhibition of SAP and PLB ex-
pression by undecylenic acid
during biolm formation
Secreted aspartyl protease (SAP) is re-
sponsible for protein degradation, whereas
lipase (LIP) and phospholipase B (PLB)
decompose lipid and phospholipids, respec-
tively. To understand the effects of undecy-
lenic acid on the cell membrane secreted
hydrolytic protein, the expression levels of
SAP1-10 at 47 hour biolm samples during
the drug treatment were measured using real-
time PCRs.
For the SAP gene family, a total of 10
SAP genes (SAP1-SAP10) were studied in
biolm treated with undecylenic acid. Com-
pared to drug-free biolm samples, we found
Figure 3. Effects of undecylenic acid on the mor-
phology of C. albicans under SEM microscope. C.
albicans biolms were treated with 0 mM undecy-
lenic acid (A and B, original magnication, 5,000×),
1 mM undecylenic acid (C and D, original magni-
cation, 5,000×), and 6 mM undecylenic acid (E
and F, original magnication, 5,000×). (The arrow
indicates ne granules; bar: 5 µm).
Figure 4. Effects of undecylenic acid (3 mM) on
SAPs (A), PLBs (B), LIBs (C), and HWP1 (D) gene
expression of C. albicans biolms. The percentage
inhibition values were determined compared to un-
treated controls. Results are presented as mean ±
SD (n = 6).

Antifungal effects of undecylenic acid 349
that transcription levels of 8 genes in this
group were reduced with drug treatment. The
exceptions were SAP5 and SAP7. We found
no detectable level of either gene expression,
even in the control biolm samples. This re-
sult can be explained by the fact that SAP5
and SAP7 were expressed only in a low pH
environment. As shown in Figure 4A, the
repression scale varies with each SAP gene
(SAP1-SAP10). In the biolms with drug
addition, the expression levels of SAP9 and
SAP10 were down regulated substantially
(80% and 73% reduction, respectively); the
levels of SAP1, SAP2, and SAP3 were down-
regulated moderately (21%, 22%, and 21%
reduction, respectively); and the levels of
SAP4 and SAP6 were down-regulated even
more subtlety (11% and 9% reduction, re-
spectively). Finally, the expressional levels
of SAP8 in both drug-free and drug-treated
samples were the same. The signicant
changes of PLB1 were observed in biolm
formation in the presence of undecylenic
acid as shown in Figure 4B. On the other
hand, PLB2 gene transcriptional level re-
mained unchanged between drug-treated and
drug-free biolm samples; the PLB1 expres-
sion was reduced by 83% with drug treat-
ment compared to the control samples.
Ten LIP genes (LIP1-LIP10) were also
tested for their expressional behaviors during
the biolm formation. Apparently, this cate-
gory of gene family plays little role in bio-
lm formation. As Figure 4C indicated, only
4 genes (LIP4, LIP6, LIP8, and LIP9) were
detected in transcription level during biolm
formation. With undecylenic acid treatment,
LIP4 and LIP6 levels were increased by 11%
and 10%, respectively, while LIP4 and LIP6
transcriptional levels were the same as in the
drug-free biolm controls.
Expressional inhibition of biolm-
related genes by undecylenic acid
Besides the secreted cell surfaced pro-
teins that we mentioned above, a large num-
ber of cell surface proteins also contributed
to its invasive features such as adhesions
for tissue attachment and proteins for la-
mentous growth. Some of the cell surface
proteins have been implicated in C. albi-
cans biolm formation. The transcriptional
levels of HWP1, BCR1, ECE1, ALS1, and
ALS3 were monitored under undecylenic
acid treatment. The rst 3 genes (HWP1,
BCR1, and ECE1) encoded proteins that are
responsible for yeast/hyphal transition and
play important roles in biolm formation.
The morphological plasticity of C. albicans
is an essential determinant of pathogenicity,
and nonlamentous mutants are virulent or
weakly virulent. ALS1 and ALS3 are adhe-
sion-related genes, and their important roles
in fungal pathogenesis have been well estab-
lished.
The transcriptional level of the hyphal
wall protein1 (HWP1) was down-regulated
(80% reduction) in the biolm sample with
undecylenic acid treatment as shown in Fig-
ure 4D. In the presence of undecylenic acid,
two adhesions, ALS1 and ALS3, were also re-
duced transcriptionally by 71% and 65%, re-
spectively. In contrast, the expression of the
BCR1 was increased by 30% in undecylenic-
acid-treated biolm. However, the transcrip-
tion level of ECE1 remained unchanged in
biolms with or without drug treatment.
Discussion
Biolms are structured microbial com-
munities that adhere to solid surfaces. C. al-
bicans biolm formation plays an important
role in the infection process, especially the
development of disseminated candidiasis.
Undecylenic acid has been used successfully
to treat supercial fungal infections caused
by Candida spp. Recent evidence has shown
that this fatty acid extracted from castor oil
inhibits hyphal formation during infection in
the host. In this study, we demonstrated that
undecylenic acid at 3 – 5 mM concentrations
was an active agent that inhibits the trans-
formation of yeast to hyphal formation, in-
hibiting the biolm biomass and the biolm
formation of C. albicans. These results are in
agreement with a biolm study of Candida
using a polyunsaturated fatty acid from ma-
rine products [23].
In the presence of this compound, the in-
hibition of cell proliferation, reduction of la-
mentous formation, and even cell membrane
changes might all contribute to a reduced
and a poorly organized biolm. Under SEM,
the cells had overall deformed morphology.

Shi, Zhao, Yan, et al. 350
Meanwhile, the cell surfaces became rough,
and the ne granules disappeared. These big-
ger, knob-like structures on the cell surface
or around the cells suggest that cell mem-
brane integrity may be disturbed due to either
composition or structural changes. In fact, as
we discuss below, the transcription levels of
many cell membrane-related genes, such as
adhesins and secreated protein, are affected
during C. albicans biolm formation.
SAP family members are important viru-
lence factors of C. albicans, which have been
found to be related to biolm growth on mu-
cosal surfaces [19, 24]. In the presence of un-
decylenic acid, all SAPs (except SAP8) were
down-expressed in the biolm samples. The
repression levels for each gene vary, with
SAP9 and SAP10 being more pronounced,
followed by SAP1-3, SAP4, and SAP6. A
similar decreased SAPs-mechanism was also
noted in a uconazole study on biolm in-
hibition of C. albicans [25]. Although SAP
gene-specic function is still undertaking,
this gene family in general is well known as a
main contributor for protein degradation. The
higher secretions of SAPs have been found
while culturing C. albicans on an abiotic sur-
face [26]. For example, SAP2 has very broad
substrate specicity and can degrade many
human proteins including keratin, collagen,
and vimentin. Therefore, the ability of SAP2
to degrade these proteins may facilitate the
dissemination of C. albicans in the host via
the circulatory system. Other functions of
SAP gene are related to cell-cell adhesion
and hyphal formation. The expressions of
SAP4 to SAP6 have particularly been linked
to hyphal formation, which is a crucial step
in evading host immune defenses. Our ob-
servations are in agreement with such nd-
ings. The poorly developed hypha coped
with the down-regulated SAP4 and SAP6 in
drug-treated samples. Although evidence for
the roles of SAP7-10 in C. albicans patho-
genesis is still limited, they seemed not to
be related to the virulence directly. Unlike
other SAP gene products, SAP9 and SAP10
are GPI anchored proteins that play a role in
cell-surface integrity and are more positively
associated with the adhesion properties dur-
ing the biolm formation [27]. With the most
reduction SAP9 and SAP10 in our results,
the reduction of C. albicans biolm forma-
tion with undecylenic acid treatment might
be the consequence of less adhesion and hy-
phal formation due to less SAP9 and SAP10
or others.
PLB (phospholipase B) and LIP (lipase)
gene families are also associated with bio-
lm growth on mucosal surfaces. Our results
indicated that transcriptional level of PLB1
from mature biolms under drug treatment
was reduced (75% reduction), but the tran-
script of PLB2 was the same as biolm with-
out drug treatment. PLB1p, but not PLB2p,
is an important virulence factor of C. albi-
cans, which is closely associated with host
tissue invasiveness [28, 29]. C. albicans mu-
tants lacking PLB1 are attenuated at patho-
genesis in both infant mouse model and
candidiasis murine model. Furthermore, the
transcriptional level of PLB1 was higher in
the antifungal drug environment in the previ-
ous report [30]. The reduction of PLB1 in our
results is in contrast to other antifungal drugs,
indicating that undecylenic acid may interfere
with PLB1 substrate metabolism directly or
indirectly. However, the exact role of phos-
pholipase on biolm formation needs to be
further claried.
Fatty acid as substrate and product of
lipase metabolism can induce lipase pro-
duction in microorganisms. Given that un-
decylenic acid is a fatty acid analog that is
supposed to interfere with fatty acid metabo-
lism, it is surprising to see that only a few
LIP genes were affected in this study. Only
4 lipase gene transcripts (LIP4, 6, 8, and 9)
were detected among the 10 LIP genes we
tested. Lipase, which catalyzes both the hy-
drolysis and synthesis of triacylglycerols, in
an important virulence factor [31]. The li-
pase-encoding genes LIP1 to LIP10 of C. al-
bicans have been heterogeneously expressed
in baker yeast, but lipolytic activities were
detected only when LIP4, LIP6, LIP8, and
LIP10 were coexpressed. The role of other
LIP genes is not clear. In our experiments,
LIP4 and LIP6 transcriptional levels were
down-regulated subtlety in the presence of
undecylenic acid, while genes transcriptional
levels of LIP8 and LIP9 remained unchanged
with or without drug treatment. The expla-
nation for such weak reduction of LIP4 and
LIP6 indicates that undecylenic acid may not
be a proper substrate for the C. albicans li-
pase family during biolm formation under
this experimental condition. It will be inter-

Antifungal effects of undecylenic acid 351
esting to compare LIP gene transcripts in the
skin samples after drug treatment, since we
assume that the lipid substrates on the skin
surface are different from those in this ex-
perimental environment.
A number of studies have demonstrated
that the expression of HWP1 (hyphal wall
protein) and of genes belonging to the ALS
(agglutinin-like sequence) are often associ-
ated with hyphal development and yeast ad-
hesion to epithelial cells, promoting biolm
formation. Undecylenic acid can effectively
inhibit hyphal population during biolm for-
mation, which may also be due to the signi-
cant down-regulation of HWP1 expression
in this study. HWP1 is a well-known hypha-
specic gene that encodes a fungal cell wall
protein, responsible for hyphal development
and yeast adhesion to epithelial cells required
for biolm formation [32, 33, 26]. Although
ECE1 was also recognized as a hyphal-in-
duced gene [19], no change in ECE1 level
with undecylenic acid treatment was seen in
biolm formation. Obviously, the defect of
hyphal formation in undecylenic acid envi-
ronment is independent of ECE1 gene.
ALS1 and ALS3 are members of the ag-
glutinin-like sequence (ALS) gene family en-
coding cell-wall glycoproteins for adhesion to
other cells or to the carrier surface [2, 24, 34].
Hence, it is possible that these adhesins are
important for nutrient acquisition in host and
in vitro grown biolms, although this hypoth-
esis requires further investigation. The gene
transcripts of ALS1 and ALS3 declined signi-
cantly during biolm formation in drug-treat-
ed samples, suggesting that the reduction of
adhesion capacity of C. albicans occurred in
biolm formation. ALS genes may be targeted
by undecylenic acid treatment.
Transcription factor (BCR1) is required
for biolm formation in C. albicans [35].
BCR1 governs biolm and acts as a posi-
tive regulator for hyphal-specic adhesions
(ALS1, ALS3) and cell-wall proteins HWP1.
Unexpectedly, with the reduced expressions
of ALS1, ALS3, and HWP1, we observed
an up-regulation of BCR1 in biolm sam-
ples with drug treatment. There should be
other alternative regulation mode, or signal
transduction pathway involvement under
this condition. In fact, Bcr1p regulates the
opaque cell lamentation in C. albicans via
the cAMP-signaling pathway [36]. Whether
undecylenic acid regulates the expressions of
HWP1 and ALSs directly or through Bcr1p
needs to be investigated further.
Antifungal mechanism that aims at mor-
phologic changes of C. albicans has attracted
a great attentions of researchers. The ability
of C. albicans to switch from yeast to elon-
gated laments is essential for its pathogen-
esis. The latter is thought to be a necessary
process for tissue invasion. In C. albicans,
the transition from yeast to laments is regu-
lated by multiple signals such as tempera-
ture, pH, serum, nutrition, and other envi-
ronmental cues. Several virulence factors,
such as Hwp1p and Als3p, are involved in
this switching course. ALS (agglutinin-like
sequence) gene family are often associated
with hyphal development into yeast adhesion
to epithelial cells, and promoting biolm for-
mation. Our results showed that undecylenic
acid can effectively abolish yeast to hyphal
transition and inhibit hyphal population dur-
ing biolm formation, which may also be
due to the signicant down-regulation of
HWP1 expression in this study. HWP1 is a
well-known hypha-specic gene that en-
codes a fungal cell wall protein, responsible
for hyphal development and yeast adhesion
to epithelial cells required for biolm forma-
tion [32, 33, 26]. Although ECE1 was also
recognized as a hyphal-induced gene [19],
no change in ECE1 level with undecylenic
acid treatment was seen in biolm formation.
Obviously, the defect of hyphal formation in
undecylenic acid environment is indepen-
dent of ECE1 gene.
ALS1 and ALS3 are members of the ag-
glutinin-like sequence (ALS) gene family en-
coding cell-wall glycoproteins for adhesion to
other cells or to the carrier surface [2, 24, 34].
Hence, it is possible that these adhesins are
important for nutrient acquisition in host and
in vitro grown biolms, although this hypoth-
esis requires further investigation. The gene
transcripts of ALS1 and ALS3 declined signi-
cantly during biolm formation in drug-treat-
ed samples, suggesting that the reduction of
adhesion capacity of C. albicans occurred in
biolm formation. ALS genes may be targeted
by undecylenic acid treatment.
Transcription factor (BCR1) is required
for biolm formation in C. albicans [35].
BCR1 governs biolm and acts as a posi-
tive regulator for hyphal-specic adhesions

Shi, Zhao, Yan, et al. 352
(ALS1, ALS3) and cell-wall proteins HWP1.
Unexpectedly, with the reduced expressions
of ALS1, ALS3, and HWP1, we observed
an up-regulation of BCR1 in biolm sam-
ples with drug treatment. There should be
other alternative regulation mode, or signal
transduction pathway involvement under
this condition. In fact, Bcr1p regulates the
opaque cell lamentation in C. albicans via
the cAMP-signaling pathway [36]. Whether
undecylenic acid regulates the expressions of
HWP1 and ALSs directly or through Bcr1p
needs to be investigated further.
Undecylenic acid reduces lamented cells
ratio even at low concentration (1 mM). This
morphological inhibition increased in a dose-
dependent manner, as shown in Figure 2, no
hyphal cells are seen in the presence of 4 mM
or 5 mM undecylenic acid. Apart from phase
switching defects, undecylenic acid also
causes a deformed cell surface of C. albicans
under microscopy even at 1 mM dose. These
ultrastructural changes on both yeast and la-
ment cell surfaces may be the direct cause of
the biolm disintegration. The atrophic exte-
rior appearance may indicate an accelerated
process for cell death occurring under undec-
ylenic acid treatment. The inhibitory effects
on hyphal formation, adhesion, secretions of
protease and phospholipase of C. albicans
provided by undecylenic acid suggest that the
effectiveness of this compound is attained by
interfering with cell-surface-associated patho-
genic aspects, which may be caused by a fail-
ure to maintain the membrane homeostasis
in this organism. A detailed analysis of cell
membrane composition in further studies will
assist in testing this hypothesis.
In conclusion, fatty acids are poten-
tial antifungal drugs, especially long-chain
unsaturated fatty acids. Undecylenic acid
showed anti-C. albicans effects during bio-
lm formation. Our experiments suggested
that multiple mechanisms are involved in its
antifungal effects, such as the inhibition of
mitochondrial activity, transcriptional regu-
lation of the cell membrane virulent factors,
and biolm formation. The repression of
cell surface virulent factors and the arrest of
lamentous growth induced by undecylenic
acid might be caused by a disturbance of the
membrane uidity; this could be due to the
similarity in the structure of undecylenic acid
to that of the cell membrane of fatty acids.
Conict of interests
The authors have no conict of interests
in connection with this study.
Acknowledgments
This work was supported by grants from
the National Natural Science Foundation of
China (NM. 81401653) and the National
Key Basic Research Program of China (NM
2013CB531605) and funded by Jiangsu Pro-
vincial Special Program of Medical Science
(BL2012003).
Reference
[1] Antony G, Saralaya V, Gopalkrishna Bhat K,
Shalini Shenoy M, Shivananda PG. Effect of phe-
notypic switching on expression of virulence fac-
tors by Candida albicans causing candidiasis in
diabetic patients. Rev Iberoam Micol. 2009; 26:
202-205. CrossRef PubMed
[2] Abaci O. Investigation of extracellular phospholi-
pase and proteinase activities of Candida species
isolated from individuals denture wearers and ge-
notypic distribution of Candida albicans strains.
Curr Microbiol. 2011; 62: 1308-1314. CrossRef
PubMed
[3] Gaffen SL, Hernández-Santos N, Peterson AC.
IL-17 signaling in host defense against Candida
albicans. Immunol Res. 2011; 50: 181-187.
CrossRef PubMed
[4] Hiller E, Zavrel M, Hauser N, Sohn K, Burger-
Kentischer A, Lemuth K, Rupp S. Adaptation, ad-
hesion and invasion during interaction of Candida
albicans with the host--focus on the function of
cell wall proteins. Int J Med Microbiol. 2011;
301: 384-389. CrossRef PubMed
[5] Chai X, Yu S, Jiang Y, Zou Y, Wu Q, Zhang D, Ji-
ang Y, Cao Y, Sun Q. Design, synthesis, and bio-
logical evaluation of novel 1, 2, 4-triazole deriva-
tives as antifungal agent. Arch Pharm Res. 2012;
35: 1895-1901. CrossRef PubMed
[6] Liu J, Warshaw EM. Allergic contact dermatitis
from ketoconazole. Cutis. 2014; 94: 112-114.
PubMed
[7] Lattif AA, Mukherjee PK, Chandra J, Swindell K,
Lockhart SR, Diekema DJ, Pfaller MA, Ghannoum
MA. Characterization of biolms formed by Can-
dida parapsilosis, C. metapsilosis, and C. orthopsi-
losis. Int J Med Microbiol. 2010; 300: 265-270.
CrossRef PubMed
[8] Noverr MC, Huffnagle GB. Regulation of Candi-
da albicans morphogenesis by fatty acid metabo-
lites. Infect Immun. 2004; 72: 6206-6210. Cross-
Ref PubMed
[9] Borst A, Fluit AC. High levels of hydrolytic en-
zymes secreted by Candida albicans isolates in-
volved in respiratory infections. J Med Microbiol.
2003; 52: 971-974. CrossRef PubMed
[10] Ayyash M, Algahmi A, Gillespie J, Oelkers P.
Characterization of a lysophospholipid acyltrans-

Antifungal effects of undecylenic acid 353
ferase involved in membrane remodeling in Can-
dida albicans. Biochim Biophys Acta. 2014;
1841: 505-513. CrossRef PubMed
[11] Cutler JE. Putative virulence factors of Candida
albicans. Annu Rev Microbiol. 1991; 45: 187-218.
CrossRef PubMed
[12] Calderone RA, Fonzi WA. Virulence factors of
Candida albicans. Trends Microbiol. 2001; 9:
327-335. CrossRef PubMed
[13] Budzyńska A, Sadowska B, Więckowska-Szakiel
M, Różalska B. Enzymatic prole, adhesive and
invasive properties of Candida albicans under the
inuence of selected plant essential oils. Acta
Biochim Pol. 2014; 61: 115-121. PubMed
[14] Dabas N, Morschhäuser J. A transcription factor
regulatory cascade controls secreted aspartic pro-
tease expression in Candida albicans. Mol Micro-
biol. 2008; 69: 586-602. CrossRef PubMed
[15] de Vasconcellos AA, Gonçalves LM, Del Bel Cury
AA, da Silva WJ. Environmental pH inuences
Candida albicans biolms regarding its structure,
virulence and susceptibility to uconazole. Mi-
crob Pathog. 2014; 69-70: 39-44. CrossRef
PubMed
[16] McLain N, Ascanio R, Baker C, Strohaver RA,
Dolan JW. Undecylenic acid inhibits morphogen-
esis of Candida albicans. Antimicrob Agents Che-
mother. 2000; 44: 2873-2875. CrossRef PubMed
[17] Fanning S, Xu W, Solis N, Woolford CA, Filler SG,
Mitchell AP. Divergent targets of Candida albi-
cans biolm regulator Bcr1 in vitro and in vivo.
Eukaryot Cell. 2012; 11: 896-904. CrossRef
PubMed
[18] Fan Y, He H, Dong Y, Pan H. Hyphae-specic
genes HGC1, ALS3, HWP1, and ECE1 and rele-
vant signaling pathways in Candida albicans. My-
copathologia. 2013; 176: 329-335. CrossRef
PubMed
[19] Ene I V, Bennett RJ. Hwp1 and related adhesins
contribute to both mating and biolm formation in
Candida albicans. Eukaryot Cell. 2009; 8: 1909-
1913. CrossRef PubMed
[20] Dwivedi P, Thompson A, Xie Z, Kashleva H, Gan-
guly S, Mitchell A P, Dongari-Bagtzoglou A. Role
of Bcr1-activated genes Hwp1 and Hyr1 in Can-
dida albicans oral mucosal biolms and neutro-
phil evasion. PLoS ONE. 2011; 6: e16218. Cross-
Ref PubMed
[21] Kuhn DM, Balkis M, Chandra J, Mukherjee PK,
Ghannoum MA. Uses and limitations of the XTT
assay in studies of Candida growth and metabo-
lism. J Clin Microbiol. 2003; 41: 506-508. Cross-
Ref PubMed
[22] Navarro-Rosinés P, Roux C, Bellemère A. [Ultra-
structure of Weddellomyces epicallopisma (Do-
thideales, Dacampiaceae, Ascomycota), especial-
ly of its ascospores]. C R Acad Sci III. 2001; 324:
443-451. CrossRef PubMed
[23] Thibane VS, Kock JL, Ells R, van Wyk PW, Pohl
CH. Effect of marine polyunsaturated fatty acids
on biolm formation of Candida albicans and
Candida dubliniensis. Mar Drugs. 2010; 8: 2597-
2604. CrossRef PubMed
[24] Nailis H, Kucharíková S, Ricicová M, Van Dijck
P, Deforce D, Nelis H, Coenye T. Real-time PCR
expression proling of genes encoding potential
virulence factors in Candida albicans biolms:
identication of model-dependent and -indepen-
dent gene expression. BMC Microbiol. 2010; 10:
114. CrossRef PubMed
[25] Mores AU, Souza RD, Cavalca L, de Paula e Car-
valho A, Gursky LC, Rosa RT, Samaranayake L P,
Rosa EA. Enhancement of secretory aspartyl pro-
tease production in biolms of Candida albicans
exposed to sub-inhibitory concentrations of uco-
nazole. Mycoses. 2011; 54: 195-201. CrossRef
PubMed
[26] Mendes A, Mores AU, Carvalho A P, Rosa RT, Sa-
maranayake L P, Rosa EA. Candida albicans bio-
lms produce more secreted aspartyl protease
than the planktonic cells. Biol Pharm Bull. 2007;
30: 1813-1815. CrossRef PubMed
[27] Albrecht A, Felk A, Pichova I, Naglik JR, Schaller
M, de Groot P, Maccallum D, Odds FC, Schäfer
W, Klis F, Monod M, Hube B. Glycosylphosphati-
dylinositol-anchored proteases of Candida albi-
cans target proteins necessary for both cellular
processes and host-pathogen interactions. J Biol
Chem. 2006; 281: 688-694. CrossRef PubMed
[28] Fu Y, Ibrahim AS, Fonzi W, Zhou X, Ramos C F,
Ghannoum MA. Cloning and characterization of a
gene (LIP1) which encodes a lipase from the
pathogenic yeast Candida albicans. Microbiology.
1997; 143: 331-340. CrossRef PubMed
[29] Gonçalves LM, Del Bel Cury AA, Sartoratto A,
Garcia Rehder VL, Silva WJ. Effects of undecyle-
nic acid released from denture liner on Candida
biolms. J Dent Res. 2012; 91: 985-989. Cross-
Ref PubMed
[30] Sanglard D, Coste A, Ferrari S. Antifungal drug
resistance mechanisms in fungal pathogens from
the perspective of transcriptional gene regulation.
FEMS Yeast Res. 2009; 9: 1029-1050. CrossRef
PubMed
[31] Guan G, Xie J, Ta o L, Nobile CJ, Sun Y, Cao C,
Tong Y, Huang G. Bcr1 plays a central role in the
regulation of opaque cell lamentation in Candida
albicans. Mol Microbiol. 2013; 89: 732-750.
CrossRef PubMed
[32] Hoover CI, Jantapour MJ, Newport G, Agabian
N, Fisher SJ. Cloning and regulated expression of
the Candida albicans phospholipase B (PLB1)
gene. FEMS Microbiol Lett. 1998; 167: 163-169.
CrossRef PubMed
[33] Jackson BE, Wilhelmus KR, Hube B. The role of
secreted aspartyl proteinases in Candida albicans
keratitis. Invest Ophthalmol Vis Sci. 2007; 48:
3559-3565. CrossRef PubMed
[34] Murzyn A, Krasowska A, Stefanowicz P, Dziad-
kowiec D, Łukaszewicz M. Capric acid secreted by
S. boulardii inhibits C. albicans lamentous
growth, adhesion and biolm formation. PLoS
ONE. 2010; 5: e12050.CrossRef PubMed
[35] Nas T, Kalkanci A, Fidan I, Hizel K, Bolat S, Yol -
bakan S, Yilmaz E, Ozkan S, Kustimur S. Expres-
sion of ALS1, HWP1 and SAP4 genes in Candida
albicans strains isolated from women with vagini-
tis. Folia Microbiol (Praha). 2008; 53: 179-183.
PubMed
[36] Nobile CJ, Andes DR, Nett JE, Smith FJ, Yu e F,
Phan QT, Edwards JE, Filler SG, Mitchell AP.
Critical role of Bcr1-dependent adhesins in C. al-
bicans biolm formation in vitro and in vivo.
PLoS Pathog. 2006; 2: e63.CrossRef PubMed