ArticlePDF Available

A New Tropidurus (Tropiduridae) from the Semiarid Brazilian Caatinga: Evidence for Conflicting Signal between Mitochondrial and Nuclear Loci Affecting the Phylogenetic Reconstruction of South American Collared Lizards

Authors:

Abstract and Figures

Tropidurus Wied, 1825, is one of the most ubiquitous lizard genera distributed in open habitats of tropical and subtropical South America. Nevertheless, the broad representation of specimens of this group in scientific collections is hardly reflected in our knowledge of its taxo- nomic diversity. Most species currently assigned to Tropidurus began to be uncovered in the early 1980’s and additional populations in need of formal taxonomic treatment have been cata- loged ever since. Herein, we name Tropidurus sertanejo, n. sp., a new species of the T. torquatus group endemic to the semiarid Brazilian Caatinga. Tropidurus sertanejo, n. sp., is currently known from two isolated populations in the municipalities of Caetité and Ibotirama, State of Bahia, Brazil. This is the only species of the T. torquatus group lacking granular mite pockets on the lateral neck, and it is also diagnosable by having a conspicuous bronze-colored head, a light-brown dorsal body with small pale salmon spots, and small body size in comparison with most congeners. Phylogenetic analyses recovered a paraphyletic Tropidurus, but firmly sup- ported T. sertanejo, n. sp., as member of a monophyletic T. torquatus species group. Trees gener- ated by independent analyses of nuclear and mitochondrial sequence data conflicted with our total evidence phylogenetic hypotheses. Since topological disagreements were detected among phylogenetic trees resulting from maximum parsimony (MP) and maximum likelihood (ML) reconstructions, and MP analyses do not require distinct evolutionary models or partition schemes to be defined prior to conduction of phylogenetic reconstruction, these factors were considered unlikely to explain all the variation in the observed results, favoring the interpreta- tion of conflicting phylogenetic signal. Because detailed information on the distribution, popu- lation size, and ecological requirements of T. sertanejo, n. sp., are currently unavailable, we recommend the species to be listed as “data deficient” following the rules proposed by IUCN.
Content may be subject to copyright.
Copyright © American Museum of Natural History 2016 ISSN 0003-0082
AMERICAN MUSEUM NOVITATES
Number 3852, 66 pp. February 20, 2016
A new Tropidurus (Tropiduridae) from the semiarid
Brazilian Caatinga: evidence for conicting signal
between mitochondrial and nuclear loci aecting the
phylogenetic reconstruction of South American
collared lizards
ANDRÉ L.G. CARVALHO,1,2 MARCO A. SENA,3 PEDRO L.V. PELOSO,2,4
FABIO A. MAC HAD O,5 RACHEL MONTESINOS,3 HÉLIO R. SILVA,6
GWYNETH CAMPBELL,2 AND MIGUEL T. RODRIGUES3
ABSTRACT
Tro pidurus Wied, 1825, is one of the most ubiquitous lizard genera distributed in open
habitats of tropical and subtropical South America. Nevertheless, the broad representation of
specimens of this group in scientic collections is hardly reected in our knowledge of its taxo-
nomic diversity. Most species currently assigned to Tropidu r us began to be uncovered in the
early 1980’s and additional populations in need of formal taxonomic treatment have been cata-
loged ever since. Herein, we name Tropidurus sertanejo, n. sp., a new species of the T. torquatus
group endemic to the semiarid Brazilian Caatinga. Tr op idu ru s ser ta ne jo, n. sp., is currently
known from two isolated populations in the municipalities of Caetité and Ibotirama, State of
1 Richard Gilder Graduate School, American Museum of Natural History.
2 Division of Vertebrate Zoology (Herpetology), American Museum of Natural History.
3 Departamento de Zoologia, Instituto de Biociências, Universidade de São Paulo, São Paulo, Brasil.
4 Museu Paraense Emílio Goeldi, Coordenação de Zoologia, Belém, Brasil.
5 Departamento de Genética e Biologia Evolutiva, Instituto de Biociências, Universidade de São Paulo, São
Paulo, Brasil.
6 Departamento de Biologia Animal, Instituto de Biologia, Universidade Federal Rural do Rio de Janeiro,
Brasil.
2 AMERICAN MUSEUM NOVITATES NO. 3852
Bahia, Brazil. is is the only species of the T. torquatus group lacking granular mite pockets
on the lateral neck, and it is also diagnosable by having a conspicuous bronze-colored head, a
light-brown dorsal body with small pale salmon spots, and small body size in comparison with
most congeners. Phylogenetic analyses recovered a paraphyletic Tropidurus, but rmly sup-
ported T. se r ta n ej o, n. sp., as member of a monophyletic T. t or qu at u s species group. Trees gener-
ated by independent analyses of nuclear and mitochondrial sequence data conicted with our
total evidence phylogenetic hypotheses. Since topological disagreements were detected among
phylogenetic trees resulting from maximum parsimony (MP) and maximum likelihood (ML)
reconstructions, and MP analyses do not require distinct evolutionary models or partition
schemes to be dened prior to conduction of phylogenetic reconstruction, these factors were
considered unlikely to explain all the variation in the observed results, favoring the interpreta-
tion of conicting phylogenetic signal. Because detailed information on the distribution, popu-
lation size, and ecological requirements of T. sertanejo, n. sp., are currently unavailable, we
recommend the species to be listed as “data decient” following the rules proposed by IUCN.
INTRODUCTION
Tro pidur u s Wied, 1825, is one of the most ubiquitous lizard genera occupying open land-
scapes in tropical and subtropical South America (Carvalho, 2013). However, the numerous
eld observations and large number of specimens in scientic collections hardly translate into
a complete understanding of its phylogenetic relationships, taxonomic diversity, biogeography,
and evolutionary history (Carvalho, 2013; Carvalho et al., 2013). e monophyly and internal
relationships in Tropidur u s were not rigorously established until Frost et al. (2001) employed
molecular (mtDNA) and morphological characters—combining novel data with those from
Frost (1992) and Harvey and Gutberlet (2000)—to build a comprehensive phylogeny. at
study placed Uranoscodon as the sister taxon of all other tropidurines; recovered Plica, Uracen-
tron, and Strobilurus as the sister clade of Tro pidur u s ; erected a new genus Eurolophosaurus for
the former Tropidurus nanuzae group; and restricted Tro pidur u s to a monophyletic group that
predominantly occupies the open-dry South American diagonal, Amazonian savanna enclaves,
and large area of the Brazilian Atlantic coast (Rodrigues, 1987, 1988; Frost et al., 2001; Ávila-
Pires, 1995; Harvey and Gutberlet, 1998; Carvalho, 2013; Carvalho et al., 2013).
Currently, the genus comprises 25 nominal species in four species groups as per Frost et
al. (2001): (1) Trop idurus bogerti group, monotypic: T. b og er ti Roze, 1958; (2) Tropidurus
spinulosus group: T. ca llat he ly s Harvey and Gutberlet, 1998, T. guarani Alvarez et al., 1994,
T. melanopleurus Boulenger, 1902, T. spinulosus (Cope, 1862), and T. x anthochi lu s Harvey
and Gutberlet, 1998; (3) Tropidurus semitaeniatus group: T. helenae (Manzani and Abe,
1990), T. jaguaribanus Passos et al., 2011, T. pinima (Rodrigues, 1984), and T. semitaeniatus
(Spix, 1825); (4) Tro pidur us to rqu atus group: T. c at al an en si s Gudynas and Skuk, 1983, T.
chromatops Harvey and Gutberlet, 1998, T. cocorobensis Rodrigues, 1987, T. erythrocephalus
Rodrigues, 1987, T. etheridgei Cei, 1982, T. hispidus (Spix, 1825), T. hygomi Reinhardt and
Lütken, 1861, T. imbituba Kunz and Borges-Martins, 2013, T. insulanus Rodrigues, 1987, T.
itambere Rodrigues, 1987, T. montanus Rodrigues, 1987, T. mucujensis Rodrigues, 1987, T.
oreadicus Rodrigues, 1987, T. psammonastes Rodrigues et al., 1988, and T. torquatus (Wied,
2016 CARVALHO ET AL.: A NEW TROPIDURUS 3
1820). Over 70% of these taxa were named in the last 35 years, and this ascending, nonas-
ymptotic taxonomic curve suggests a promising future with respect to the number of Tropi-
durus species still to be uncovered (g. 1). Morphological variation indicates the existence
of species complexes under several nominal species in the genus (e.g., Vanzolini and Gomes,
1979; Vanzolini et al., 1980; Vanzolini, 1986; Rodrigues, 1987; Vitt and Caldwell, 1993; Vitt
et al., 1996; Vitt et al., 1997; Frost et al., 1998; Gainsbury and Colli, 2003; Valdujo et al., 2009;
Werneck and Colli, 2006; Werneck et al., 2015), although species delimitation based solely
on morphology has been proven insucient to elucidate diversity in several cases (Rodrigues,
1987; Frost et al., 1998; Werneck et al., 2015).
During an expedition undertaken in July 2009 for collection of amphibians and reptiles in
several sites in the State of Bahia, Brazil, some of us (A.L.G.C., H.R.S., and R.M.) collected a
few juvenile Tropidurus at Reserva Particular do Patrimônio Natural (RPPN) Fazenda Pé da
Serra, Serra do Arame, Municipality of Ibotirama. ese specimens possessed characters
unusual among Trop idurus such as the absence of mite pockets on the lateral neck, leading us
to suspect that they represented an unnamed species. We conducted a second expedition to
RPPN Fazenda Pé da Serra, which was focused on sampling additional specimens of the sus-
pected new taxon. is second expedition was carried out in July 2013 by A.L.G.C., P.L.V.P.,
and R.M., and resulted in the collection of mature individuals of three sympatric Tropidurus
species (g. 2). Tropidurus hispidus (Spix, 1825) was found around the margins of an articial
dam inside the reserve. Tropidurus pinima (Rodrigues, 1984) was collected from rock crevices
and while basking on large rock outcrops. e third species corresponded to the morphotype
sampled in 2009. Specimens were found using small rocks along trails that cut through the
sandy caatingas and dry forests of Serra do Arame. Aer observing that adults shared the same
1820
1830
1840
1850
1860
1870
1880
1890
1900
1910
1920
1930
1940
1950
1960
1970
1980
1990
2000
2010
5
10
15
20
25
NUMBER OF SPECIES
T. sertanejo, n. sp.
FIGURE 1. Taxonomic curve showing a steep, nonasymptotic increment in the number of species of the lizard
genus Tro pidurus described since 1820. Specimen of T. sertanejo, n. sp., MZUSP 104274 (allotype).
4 AMERICAN MUSEUM NOVITATES NO. 3852
unique combination of characters previously found in the juveniles, we conrmed the occur-
rence of an unnamed Tropidurus for that locality.
e new taxon is most similar to species of the T. torquatus species group, with a robust
body that is not attened dorsoventrally and the absence of a vertebral crest. It is easily diag-
nosable from other members of this group, however, by having a unique dorsal coloration
pattern and by lacking mite pockets laterally on the neck. During the investigation of its phy-
logenetic relationships we were able to identify samples with similar molecular prole, which
were originally collected by M.T.R. in the Municipality of Caetité, Bahia, in 1991. Morphologi-
cal analysis of the specimens from Caetité conrmed the presence of the diagnostic characters
and allowed the identication of this second population ~150 km to the south of Ibotirama.
Herein, we provide a detailed description of the species based on specimens from both locali-
FIGURE 2. Syntopic species of Tro pid urus found at the Reserva Particular do Patrimônio Natural Fazenda Pé
da Serra, Serra do Arame, Ibotirama, Bahia, Brazil, and their respective habitats: (A, B) T. sertanejo, n. sp.
(MZUSP 104274, allotype); (C, D) T. hispidus (MZUSP 104276); (E, F) T. pinima (MZUSP 104271).
2016 CARVALHO ET AL.: A NEW TROPIDURUS 5
ties and analyze its phylogenetic position, external morphology, morphometric prole, and
distribution. We conclude with a discussion of the impacts of our discoveries to the phyloge-
netic reconstruction of tropidurine lizards.
Material and Methods
Samples: Adult and juvenile specimens of Tr opidur us were collected at the Reserva Par-
ticular do Patrimônio Natural (RPPN) Fazenda Pé da Serra, Serra do Arame, Municipality of
Ibotirama, State of Bahia, Brazil (12° 08 45.21 S, 43° 03 20.83 W, WGS84 system; g. 3). Some
of us visited the area in two nonconsecutive years, the rst time between 22–23 July 2009
(A.L.G.C., H.R.S., and R.M.) and a second time in 28 July 2013 (A.L.G.C., P.L.V.P., and R.M.).
e specimens collected during the rst expedition were originally housed at the herpetological
collection of the Universidade Federal Rural do Rio de Janeiro (RU) and recently donated to
the Museu de Zoologia da Universidade de São Paulo (MZUSP). ose collected in 2013 were
directly deposited at MZUSP. All individuals were collected under permits 39914-3 and 10689-
1, granted by the Brazilian Ministério do Meio Ambiente (ICMBio–SISBIO).
Lizards were observed during the day along trails that cut through the caatingas of the
Serra do Arame. In total, 13 specimens were collected with the aid of rubber bands or nooses.
All specimens were euthanized with an overdose of 2% lidocaine, preserved with 10% unbuf-
fered formalin, then transferred to 70% ethyl alcohol solution. Before xation, we collected
FIGURE 3. Map on le shows the distribution of the Brazilian biomes and highlights the State of Bahia, pre-
dominantly covered by the semiarid Caatinga. Map on right (altimetric prole) shows the distribution of
Tropidurus sertanejo, n. sp.: northernmost dot indicates the type locality (RPPN Fazenda Pé da Serra, Serra
do Arame, Ibotirama, Bahia: 12° 08 45.21 S, 43° 03 20.83 W) and southernmost dot indicates the only known
additional locality of occurrence of the new species (Caetité, Bahia: 14° 04 17.82 S, 42° 29 48.33 W).
6 AMERICAN MUSEUM NOVITATES NO. 3852
tissue samples (muscle) from the le thigh of four individuals and stored them in Eppendorf©
tubes containing absolute ethyl alcohol for subsequent molecular analyses. Additional ethanol-
preserved tissue samples (muscle, liver, or tail tips) of other species selected for phylogenetic
analyses were obtained from the Ambrose Monell Cryo Collection, American Museum of
Natural History (AMCC-AMNH), and Miguel Trefaut Rodrigues Tissue Collection, Instituto
de Biociências, Universidade de São Paulo (MTR-USP). irteen specimens originally collected
by M.T.R. in the municipality of Caetité, Bahia, in 1991, and housed at MZUSP, were also
examined for morphological descriptions and were incorporated in the type series. Tissue
samples associated to three of them were included in our phylogenetic analyses. See appendix
1 for a list of tissue samples, voucher specimens, and collection localities.
We determined the sex of the specimens based on the observation of colored patches of
glandular scales varying from yellow to black on the ventral side of thighs and precloacal ap
in males. Females lack ventral colored patches. Adult males have wider heads and thinner bod-
ies than females of the same body size. is is a common sexually dimorphic pattern observed
in Tro pidur u s that facilitates sex identication of adults (Pinto et al., 2005; Ribeiro et al., 2012).
Sex determination of juveniles is not as easy based on external morphology alone because
young individuals lack the attributes listed above. To avoid dissecting specimens included in
type series, we chose to forgo the sex determination of juveniles.
Taxonomic framework and morphological analysis: We performed morphological
and morphometric comparisons based on the primary analysis of 373 Trop i durus representing
all 15 valid species currently assigned to the T. t or qu at us group (Frost et al., 2001) plus 25
specimens of the new taxon. We also analyzed data compiled from the literature for scale
counts, morphometric measurements, and coloration (see below). Because several nominal
species represent unresolved cryptic species complexes, we opted for comparing exclusively
specimens from type localities and/or closely related populations. Although the number of
individuals considered for comparative analyses was reduced, this conservative approach
allowed us to assess morphological dierences among populations that unequivocally represent
valid nominal taxa, excluding those of uncertain taxonomic status.
Species comparisons and taxonomic placement followed the general framework pro-
posed by Frost et al. (2001), in addition to our own phylogenetic results. Morphological
comparisons among clades and species within clades followed Rodrigues (1987), Rodrigues
et al. (1988), and Harvey and Gutberlet (1998) for the T. torquatus species group; Rodrigues
(1984), Manzani and Abe (1990), and Passos et al. (2011) for the T. s em it ae ni at u s (Spix, 1825)
species group; Roze (1958) and Myers and Donnelly (2008) for T. b og e rt i Roze, 1958; and
Alvarez et al. (1994) (accepting the species rank proposed by Frost et al. [1998] for T. spinu-
losus (Cope, 1862) and T. gu aran i Alvarez et al., 1994) and Harvey and Gutberlet (1998) for
the T. spinulosus species group. All specimens used for comparisons are housed at the her-
petological collections of the American Museum of Natural History, New York (AMNH);
Museo de Historia Natural Alcide d’Orbigny, Cochabamba, Bolivia (MHNC); Museu de Zoo-
logia da Universidade de São Paulo, São Paulo, Brazil, (MZUSP); Universidade Federal do
Mato Grosso, Mato Grosso, Brazil (UFMT); and Universidade Federal do Rio Grade do Sul,
Porto Alegre, Brazil (UFRGS). A list of catalog numbers and collection localities of examined
2016 CARVALHO ET AL.: A NEW TROPIDURUS 7
specimens is available for download from the AMNH Digital Library Repository (http://
dx.doi.org/10.5531/sd.sp.16).
External morphology: We adopted the general terminology of Frost (1992) for descrip-
tion of morphological structures, but also adapted and extended protocols for scale counts and
scale nomenclature following Harvey and Gutberlet (1998) and others, as noted. e rostral is
conserved among Tropi durus, however, there is variation in the pattern of contact between
rostral and adjacent scales, i.e., postrostrals, supralabials, lorilabials, loreals, and nasal. Postros-
trals correspond to the series of scales bordering the rostral posteriorly and are divided or
undivided. e canthal ridge is covered with one or two (occasionally three or four) enlarged
canthals that contact anteriorly the nasal (or tiny scales surrounding the nasal) and grade pos-
teriorly into superciliaries. Counts of superciliaries included exclusively the row of elongate-
laminate overlapping scales beginning with the rst scale to ank the supraoculars. On the side
of the head, we distinguish loreals and lorilabials. e former corresponds to the scales on the
side of the head between nasal and preocular, below the canthals. e latter consists of scales
below loreals and subocular, and between these and supralabials. In contrast to the loreals
lorilabials are not adherent to the underlying periosteum and are easily lied by forceps or
dissecting needles (Etheridge and Williams, 1991). Supra- and infralabials were counted as the
sum of the enlarged scales that give shape to the superior and inferior lips, respectively. Reduced
(sometimes nearly granular) scales that follow the enlarged labials posteriorly to reach the end
of the rictus oris were considered separately.
Scales on the dorsal surface of the orbit are referred to as supraoculars. Two or three (occasion-
ally four) series of supraoculars are found, one row of enlarged scales positioned internally and one
or tow rows of smaller scales closer to the border of the orbit. Trop idurus have supraoculars bor-
dered by one or two rows of small angulate circumorbitals separating the former from the median
head shields. In between supraoculars and superciliaries one can nd a row of short semilaminate
scales. Temporals are located on the temporal region, in between the orbit and anterior border of
external ear, below the parietals and occipitals in lateral view. We distinguish infra- and supratem-
porals (generally slightly enlarged in relation to infratemporals), separated by a line drawn horizon-
tally at the level of the center of the pupil. Parietals are positioned behind supraoculars, separated
by a considerably enlarged interparietal bearing a visible pineal eye. One or a few rows of irregular
angulate scales referred to as occipitals separate interparietal from dorsals.
e general shape of the mental scale, positioned at the medial edge of the lower lip, is nearly
invariable in Tropidur us, but the length of its posterior end in relation to adjacent scales was con-
sidered. Chinshields (postmentals sensu Etheridge 1968, 1970) consist of paired series of enlarged
scales extending posteriorly from mental and contacting one more infralabials anterior to the rst
sublabial. Sublabials form a row of scales contacting the infralabials (Harvey and Gutberlet, 1998).
Species of the T. torquatus group as per Frost et al. (2001) lack a vertebral crest, resulting
in vertebrals and paravertebrals indistinguishable from other dorsals. erefore, scales covering
the dorsal surface of the body were considered altogether as dorsals and counted from the
posterior head scales (occipitals) in a straight line to the posterior edge of the hind limb where
dorsals grade into enlarged caudals. Ventrals were counted midway from a line corresponding
to the margin of the antegular fold to the anterior margin of hind legs. Following the same
8 AMERICAN MUSEUM NOVITATES NO. 3852
A
B
C
HDL FAL
AL
HW
SL
FOL
THL
SVL TL
HH
EOS
FIGURE 4. Measurements used for morphometric analyses of Trop idur us. Abbreviations: AL, arm length;
EOS, ear openingsnout distance; FAL, forearm length; FOL, foot length; HDL, hand length; HH, head
height; HW, head width; SL, shank length; SVL, snout-vent length; THL, thigh length; TL, tail length.
2016 CARVALHO ET AL.: A NEW TROPIDURUS 9
midline, we counted as cloacals the scales located in between the anterior margin of the hind
legs and the anterior margin of the cloaca. Scales were also counted around midbody, halfway
between the forelegs and hind legs. Supracarpals/tarsals and infracarpals/tarsals refer to scales
on the dorsum and palm of hands and feet, respectively. Subdigital lamellae were counted from
the digital articulation to, but not including, the ungual scale (noncarinate or lightly carinate
scale just proximal to the claw) in both ngers and toes. Scales covering the dorsum of the
ngers and toes are referred as supradigitals.
Harvey and Gutberlet (1998) explained that the “ash” coloration on the ventral surface of
the thighs and precloacal region of tropidurids results from pigment in the glandular scales.
Rows of glandular scales on the ventral side of the thigh were counted along the short axis of
the limb. Continuous rows of both fully and partially pigmented scales were counted. e same
applied to rows of glandular precloacal scales, counted along the midline of the cloacal ap.
We referred as caudal scales to those covering the dorsal, lateral, and ventral sides of the tail,
from the posterior edge of hind limbs to the tip of the tail. Dierences in shape and size of
caudal scales are noted accordingly.
Morphometrics: Eleven morphometric measurements from the right side of 239 adult
specimens (133 males and 106 females) were taken with aid of digital calipers (to the nearest 0.1
mm; g. 4): SVL (snout-vent length), from the tip of snout to the anterior margin of the cloaca;
HH (head height), from interparietal scale to gular region, measured with caliper positioned
frontally; HW (head width), distance between temporal regions, measured below the level of the
dorsal limit of ear opening; EOS (ear opening–snout distance) from tip of snout to the anterior
margin of ear opening; AL (arm length), from insertion of the arm to tip of humerus; FAL (fore-
arm length), from tip of proximal end of brachium to carpals; HDL (hand length) from carpals
to tip of longest digit (fourth), including the claw; THL (thigh length), from insertion of the leg
to distal end of thigh; SL (shank length), from proximal end crus to heel; FOL (foot length), from
heel to tip of longest digit (fourth), including the claw; TL (tail length), from anterior margin of
the cloaca to tip of the tail—taken exclusively from specimens with fully grown tails.
e mean, standard deviation, minimum, and maximum values were calculated for all mor-
phometric variables of each species. To identify outliers, we conducted a visual inspection of the
dispersion graphs constructed for each variable, plotted against SVL. e assumptions of normality
and variance homoscedasticity were tested using Shapiro-Wilk and Bartlett tests (Sokal and Rohlf,
1995). Because some variables did not show normal distribution and homoscedastic variance, all
morphometric measurements were log-transformed to meet these assumptions. Log-transformed
variables were double-checked and conrmed for normality and homoscedasticity.
To estimate TL for individuals with broken, regrown, or missing tails, we adopted a three-
step approach. First, we centered all variables by subtracting the group mean from each indi-
vidual morphometric measurement. Second, we performed a multiple linear regression (MLR)
between TL and all other mean-centered variables, employing the morphometric measure-
ments of all individuals with fully grown tails. We nally employed the MLR function calcu-
lated to estimate missing TL values, and group means were then added back to individual
values to obtain the nal TL estimates.
10 AMERICAN MUSEUM NOVITATES NO. 3852
We performed an exploratory analysis of morphometric variation employing a principal-
component analysis (PCA; covariance matrix), and tested for morphometric dierences among
species using multivariate analysis of variance (MANOVA) and linear discriminant analysis
(LDA). Because size accounted for a large portion of the variation summarized in the rst
principal component, we performed the Burnaby’s size-correction procedure (Burnaby, 1966)
by back-projecting the original log-transformed observations into a plane orthogonal to an
isometric vector (Somers, 1986) prior to recalculation of MANOVA and LDA. To assess accu-
racy of species reclassication, we repeated LDA employing a leave-one-out cross-validation
procedure and compared correct reclassication rates.
We used scores associated with PC1 as a proxy for size variation and tested for dierences in
size among species with analysis of variance (ANOVA) and a post hoc Tukey-Kramer test. All
morphometric analyses were carried out for adult males and females separately using the pack-
ages “nortest” (Gross, 2012), “car” (Fox and Weisberg, 2011), DTK (Lau, 2013), MASS (Venables
and Ripley, 2002), and Lattice (Sarkar, 2008) in “R” (version 3.0.2; R Core Team, 2013).
Meristics: Species description and taxonomic comparisons were based on a large number
of meristic characters. Statistical analyses were performed on six scale counts for all species of
the T. torquatus group: dorsal scales, gular scales, ventral scales, scales around midbody, tibial
scales, and subdigital lamellae on fourth toe. e distribution of these scale counts among spe-
cies was investigated to detect characters potentially useful to distinguish the new taxon from
other species and/or identify major species groups based on meristic characters. Because we
failed to identify any consistent correlation between SVL (as a proxy for age) and scales counts
(results not shown), we pooled juveniles, subadults, and adults of each species for subsequent
analyses. In total, we analyzed 337 specimens, including individuals of both sexes and all ages
(120 males, 141 females, and 76 undetermined).
e assumptions of normality and homoscedasticity of scale-count distributions were
tested using Shapiro-Wilk and Bartlett tests (Sokal and Rohlf, 1995). About 20% of the tests
rejected the null hypothesis of normality, yet no consistent pattern was identied with respect
to specic variables or taxa. In addition, the Barlett test rejected homoscedasticity of variances
among species for all variables analyzed. Because basic assumptions of parametric methods
were violated, we opted for a nonparametric multivariate analysis of variance to test for dier-
ences between species, sexes, and potential interaction between these factors (Anderson, 2001).
e signicance of the nonparametric MANOVA was based on 10,000 permutations. Because
LDA is robust to violation of assumptions of normality and homoscedasticity (Krzanowski,
1977), we employed this multivariate technique to investigate dierences in scale counts among
species, avoiding multiple pairwise comparisons. We repeated LDA employing a leave-one-out
cross-validation procedure and compared correct reclassication rates.
All statistical procedures were performed in “R” (version 3.0.2; R Core Team, 2013), as
described above, and with aid of the package “vegan” (Oksanen et al., 2015).
Phylogenetic inference: To infer the phylogenetic relationships of the new species
within the T. torquatus group, we constructed a matrix composed of four mitochondrial (12S,
16S, CO1, Cyt b) and six nuclear loci (BACH1, kif24, NTF3, PRLR, PTPN, SNCAIP). In addi-
tion to seven samples corresponding to the new taxon, we included as ingroup all 15 valid
2016 CARVALHO ET AL.: A NEW TROPIDURUS 11
species currently assigned to the T. torquatus group as per Frost et al. (2001): T. catalanensis,
T. chromatops, T. cocorobensis, T. erythrocephalus, T. etheridgei, T. hispidus, T. hygomi, T. imbi-
tuba, T. insulanus, T. itambere, T. montanus, T. mucujensis, T. oreadicus, T. psammonastes, and
T. t or qu a tu s. We selected the stenocercine Stenocercus quinarius Nogueira and Rodrigues, 2006,
to root the tree, and the tropidurines Microlophus quadrivittatus (Tschudi, 1845), Plica plica
(Linnaeus, 1758), T. semitaeniatus (Spix, 1825), T. spinulosus (Cope, 1862), and Uranoscodon
superciliosus (Linnaeus, 1758) as additional outgroups.
Laboratory procedures: We extracted and isolated DNA from frozen ethanol-preserved
tissues (muscle, liver, or tail tips) using the Qiagen DNeasy kit following the manufacturer’s
guidelines. Polymerase chain reactions (PCR) for amplication of DNA fragments were carried
out in 25 μl reactions using Illustra PuRe Taq Ready-To-Go PCR Beads (GE Healthcare Life
Sciences). Primers and PRC parameters adopted for amplication and sequencing are listed in
table 1. PCR products were cleaned and desalted in an AMPure (Agencourt Biosciences Cor-
poration) reaction in a Beckman Coulter Biomek 2000 robot (“Becky”) or by hand. Cycle
sequencing using BigDye Terminators, v. 3.0 (Applied Biosystems) was run in 8 μL reactions,
adapting the protocol of Platt et al. (2007), and products were cleaned and desalted using
cleanSEQ (Agencourt Biosciences Corporation) in “Becky. Sequencing was performed in a
Roche ABI 3730 XL automated sequencer. Samples were sequenced in both directions to check
for sequencing errors and ambiguities. Sequence contigs were assembled and edited in Geneious
6.1.8 (Biomatters, www.geneious.com). Genbank accession numbers are given in appendix 2.
Alignment, model selection, and optimality criteria: Alignments were conducted
separately for each locus using the MAFFT (Katoh and Toh, 2008) plugin in Geneious 6.1.8
(Biomatters, www.geneious.com); we employed the 200 PAM (k = 2) scoring matrix, gap open
penalty 1.53, oset value 0.123 and used the “auto” function to select the best algorithm accord-
ing to data size. Subsequently, we concatenated the alignments in Sequence Matrix 1.8 (Vaidya
et al., 2011). All alignments produced in this study were made available for download from the
AMNH Digital Library Repository (http://dx.doi.org/10.5531/sd.sp.16).
To i n ve s t ig a te t he c on t r ib u ti o n /c o ni c t o f m i to c h on d ri a l a n d n u cl e a r l o c i d e te r m in i ng /
aecting phylogenetic reconstruction, we performed partial and total evidence analyses based
on dierent data sets: (1) mitochondrial loci concatenated, (2) nuclear loci concatenated, and
(3) mitochondrial plus nuclear loci concatenated; hereaer referred as mitochondrial, nuclear,
and total evidence data sets, respectively. Each dataset was phylogenetically analyzed under
maximum parsimony (MP) and maximum likelihood (ML). Analyses were based on the same
alignments and under the same treatment of gap characters (as missing data). Although we are
well aware that gap characters can be informative in a phylogenetic context—hypothesized to
represent natural length variation, i.e., insertion/deletion events (Giribet and Wheeler, 1999;
Simmons and Ochoterena, 2000)—we made a practical decision not to treat gap characters as
an additional state, to make the parsimony and maximum likelihood results more comparable
to each other, at least with respect of use of evidence. e issue of comparability among opti-
mality criteria and its implications are discussed thoroughly in Peloso et al. (2015).
Parsimony tree searches were carried out in TNT version 1.1 (Golobo et al., 2000). Heu-
ristic searches were based on a combination of the random addition of sequences algorithm
12 AMERICAN MUSEUM NOVITATES NO. 3852
TABLE 1. Primers and PCR proles for DNA amplication. Conditions for denaturation, annealing, and extension steps for each cycle, followed by
the number of cycles. All reactions included a 4 min initial denaturation at 94° C and a 6 min nal extension at 72° C. Mitochondrial sequences
encoding the mitochondrial genes 12S rDNA, 16S rDNA, COI and Cyt b, and nuclear genes BACH1, BNDF, kif24, MKL1, NTF3, PRLR, PTPN,
RAG1, and SNCAIP, were employed for phylogenetic analyses.
Gene Source Primer Direction Sequence (5–3)PCR Prole
mtDNA
12S Benavides et al. (2007) 12S.tPhe-22 Forward AAAGCACRGCACTGAAGATGC 95°(30)/50°(60)/72°(60) [35x]
12S Benavides et al. (2007) 12S.12e-987 Reverse GTRCGCTTACCWTGTTACGACT
16S Geurgas et al. (2008) 16S F Forward CTGTTTACCAAAAACATMRCCTYTAGC 95°(30)/45°(30)/72°(60) [35x]
16S Whiting et al. (2003) 16S R Reverse TAGATAGAAACCGACCTGGATT
CO1 Folmer et al. (1994) COI LCO1490 Forward GGTCAACAAATCATAAAGATATTGG 94°(60)/45°(60)/72°(75) [10x] +
94°(60)/50°(60)/72°(75) [35x]
Folmer et al. (1994) COI HCO2198 Reverse TAAACTTCAGGGACCAAAAAATCA
Cyt b Geurgas (unpubl.) Cyt b CitiTropi Forward TGAAAAACCAYCGTTATTCAAC 95°(30)/51°(30)/72°(1) [35x]
Cyt b Palumbi (1996) Cyt b V Reverse GGCGAATAGGAAGTATCATTC
Cyt b Geurgas (unpubl.) Cyt B LGL Forward GAAAAACCAYCGTTGTWATTCAACT 95°(30)/45°(30)/72°(60) [35x]
Cyt b Geurgas & Rodrigues (2010) H15149 Reverse TGCAGCCCCTCAGAATGATATTTGTCCTCA
nucDNA
BACH1 Portik et al. (2012) BACH1_f1 Forward GATTTGAHCCYTTRCTTCAGTTTGC 95°(15)/60°(30)/72°(60) [2x] +
Touchdown -2° [2x] +
95°(15)/50°(30)/72°(60) [30x]
BACH1 Portik et al. (2012) BACH1_r1 Reverse ACCTCACATTCYTGTTCYCTRGC
kif24 Portik et al. (2012) KIF24_f1 Forward SAAACGTRTCRCCMAAACGCATCC 95°(30)/63°(30)/72°(60) [10x]
+ 95°(30)/60°(30)/72°(60) [30x]
kif24 Portik et al. (2012) KIF24_r2 Reverse WGGCGTCTGRAAYTGCTGGTG
NTF3 Portik et al. (2012) NTF3_f1 Forward ATGTCCATCTTGTTTTATGTGATATTT 95°(15)/60°(30)/72°(60) [2x] +
Touchdown -2° [2x] +
95°(15)/50°(30)/72°(60) [30x]
NTF3 Portik et al. (2012) NTF3_r1 Reverse ACRAGTTTRTTGTTYTCTGAAGTC
PRLR Portik et al. (2012) PRLR_f1 Forward GACARYGARGACCAGCAACTRATGCC 95°(30)/45°(30)/72°(60) [35x]
PRLR Portik et al. (2012) PRLR_r3 Reverse GACYTTGTGRACTTCYACRTAATCCAT
PTPN Portik et al. (2012) PTPN12_f1 Forward AGTTGCCTTGTWGAAGGRGATGC 95°(30)/55°(30)/72°(60) [10x] +
95°(30)/52°(30)/72°(60) [30x]
PTPN Portik et al. (2012) PTPN12_r6 Reverse CTRGCAATKGACATYGGYAATAC
SNCAIP Portik et al. (2012) SNCAIP_f10 Forward CGCCAGYTGYTGGGRAARGAWAT 95°(15)/60°(30)/72°(60) [2x] +
Touchdown -2° [2x] +
95°(15)/50°(30)/72°(60) [30x]
SNCAIP Portik et al. (2012) SNCAIP_r13 Reverse GGWGAYTTGAGDGCACTCTTRGGRCT
2016 CARVALHO ET AL.: A NEW TROPIDURUS 13
(RAS) and subsequent rearrangement of branches through tree bisection-reconnection (TBR),
parsimony ratchet (Nixon, 1999), tree fusing (Golobo, 1999), and sectorial searches (Golobo,
1999) under driven searches. For each search the best solution was reached 500 times before
the search was stopped (command hits 500). In cases where more than one equally parsimoni-
ous MP tree was found, support values were plotted over a strict consensus tree summarizing
competing hypotheses.
We used PartitionFinder (version 1.1.1; Lanfear et al., 2012) to identify the optimal parti-
tion schemes for our data, and the best-t nucleotide substitution model for each partition. We
ran PartitionFinder allowing all available models of molecular evolution to be compared, and
used the “greedy search algorithm and linked branch lengths in calculations of likelihood
scores. Bayesian information criterion (BIC) was adopted for selecting among alternative par-
titioning strategies. ML tree searches were performed in Garli (version 2.1) using the molecu-
larevolution.org web platform (Zwickl, 2006; Bazinet et al., 2014). Starting tree topologies were
generated using the stepwise-addition algorithm and the number of attachment points evalu-
ated for each taxon to be added (attachmentspertaxon) was set to 57 (= two times the number
of taxa + 1), meaning that all attachment points were evaluated for each taxon. We performed
an adaptive best-tree search using a minimum of 10 replicates and determined the necessary
number of search replicates to perform by calculating the number of replicates needed to
recover the best topology with 0.95 probability. e relative support for each clade was assessed
through 1000 nonparametric bootstrap replicates (Felsenstein, 2004). We summarized boot-
strap results by plotting support values over the best tree using the Python package SumTrees
of the DendroPy phylogenetic computing library (Sukumaran and Holder, 2010).
SPECIES ACCOUNTS
TROPIDURIDAE BELL, 1843
TROPIDURUS WIED, 1825
Tropidurus sertanejo, n. sp.
Figures 1, 2, 5–8
Holotype: MZUSP 104273, adult male from Reserva Particular do Patrimônio Natural
Fazenda Pé da Serra, Serra do Arame, Municipality of Ibotirama, State of Bahia, Brazil, (12°
08 45.21 S, 43° 03 20.83 W, WGS84 system; ~507 m above sea level), collected by A.L.G.C.,
P.L.V.P., and R.M. in 28 July 2013.
Allotype: MZUSP 104274, adult female, collected with the holotype (12° 08 41.99 S, 43°
03 08.32 W, WGS84 system, ~516 m above sea level).
Parat y p e s : MZUSP 104272, juvenile, collected with the holotype (12° 08 41.99 S, 4 03
08.32 W, WGS84 system; ~516 m above sea level) by A.L.G.C., P.L.V.P., and R.M. on 28 July 2013.
MZUSP 105262 (= RU 6311), adult male, MZUSP 105263 (= RU 6312), adult female, MZUSP
105261 (= RU 6310) and MZUSP 105264–65 (= RU 6313–14), three juveniles, collected in the
type locality (12° 08 40.06 S, 43° 03 23.40 W, WGS84 system; ~490 m above sea level) by
14 AMERICAN MUSEUM NOVITATES NO. 3852
A.L.G.C., H.R.S., and R.M. on 22 July 2009. MZUSP 105266–69 (= RU 6353–6356): four juve-
niles, collected in the type locality (12° 08 40.06 S, 43° 03 23.40 W, WGS84 system; ~490 m
above sea level) by A.L.G.C., H.R.S., and R.M. on 22 July 2009. MZUSP 76048–49, 76055, three
adult males, MZUSP 76050-52, three adult females, MZUSP 76046–47, 76053–54, 76056–58,
seven juveniles collected in the municipality of Caetité, State of Bahia, Brazil (14° 04 17.82 S, 42°
29 48.33 W, WGS84 system; ~940 m above sea level), by M.T.R. on 19 September 1991.
Morphological diagnosis: Tropidurus sertanejo, n. sp., is diagnosed based on a combina-
tion of macrostructural characters7 suggested by Frost et al. (2001) as exclusive to Tro pidur u s :
skull not highly elevated at the level of the orbits; premaxilla not broad; nutritive foramina of
maxilla strikingly enlarged; lingual process of dentary present, extending over lingual dentary
process of coronoid; angular strongly reduced; medial centrale absent; ash” marks on under-
sides of thighs present; circumorbitals distinct from other small supraorbital scales; lateral fringe
not developed on both sides of fourth toes; enlarged middorsal scale row absent; and tail terete.
Frost et al. (2001) also listed the hemipenis attenuate without apical disks as characteristic of
Tro pidur u s , however the hemipenial morphology of T. s er t an ej o, n. sp., was not examined.
Tropidurus sertanejo, n. sp., is diagnosed as a member of the T. torquatus group by lacking
the enlarged middorsal scale row (well marked in species of the T. spinulosus group, especially
in males), by having black thigh ash marks (males of T. spinulosus group have yellow, pale, or
white ash marks), and by not being extremely attened dorsoventrally (as observed in species
of the T. semitaeniatus group and, more moderately, in T. bogerti).
Tropidurus sertanejo, n. sp., lacks granular mite pockets on the lateral neck. e oblique
neck fold of the species is covered with imbricate, smooth, mucronate scales, similar to but
smaller than temporals and dorsals (g. 8). e new species has deep, oblique axillary and wide
inguinal mite pockets, both coated with unpigmented diminutive granular scales. e bronze
head and light brown dorsal body decorated with small pale salmon spots constitute a unique
coloration pattern (gs. 2, 4–5). is exclusive combination of macroscopic attributes makes
T. sertanejo, n. sp., a rare example of easily diagnosable species within the T. torquatus group.
Comparison with other species: Tropidurus sertanejo, n. sp., is the only species of the
T. torquatus group lacking mite pockets on the lateral neck and could not be classied accord-
ing to the eight mite pockets patterns described by Rodrigues (1987). We amended that clas-
sication scheme by adding two patterns (I and J) to accommodate T. sertanejo, n. sp., and T.
psammonastes (g. 8; table 2). Tropidurus sertanejo, n. sp., is known to occur in sympatry with
only two other forms of the T. t or qu at us group: T. h is pi d us and T. a. etheridgei. However, those
species dier considerably with respect to number and morphology of their mite pockets.
Tropidurus hispidus has one mite pocket on the lateral neck, one deep and oblique granular
axillary mite pocket, and lacks an inguinal pocket. Tropidurus a. etheridgei has two mite
pockets on the lateral neck, and lacks both axillary or inguinal mite pockets, while T. sertanejo,
n. sp., lacks a mite pocket on the lateral neck and has both axillary and inguinal pockets well
developed and coated with granular scales.
7 Osteological characters were analyzed through digital inspection of the skeleton of the holotype via com-
puted tomography.
2016 CARVALHO ET AL.: A NEW TROPIDURUS 15
e state of conservation of old specimens sometimes precludes accurate identication of
the type and number of mite pockets on the lateral neck of specimens. erefore, checking for
the presence of axillary and inguinal granular pockets is an easy way to narrow down the
number of species for comparison. Tropidurus sertanejo, n. sp., shares both axillary and ingui-
nal mite pockets exclusively with T. e ry t hr oc ep h al us , T. montanus, and T. m uc uj en si s . ese
three forms are allopatric with respect to T. s er t an ej o, n. sp., and have distributions nearly
restricted to rocky elds known as campos rupestres, spread over the Espinhaço mountain
range, in the states of Minas Gerais and Bahia, Brazil (Rodrigues, 1987, 1988; Carvalho, 2013).
In terms of coloration, T. sertanejo, n. sp., has a bronze dorsal head, distinct from the intense
brick-reddish head coloration of T. erythrocephalus. e ventral side of its head is pale salmon,
and grades into a dark bronze throat, diering from the orange pigmentation covering the
throat and chest of T. erythrocephalus. Tropidurus sertanejo, n. sp., has a dotted dorsal pattern
somewhat similar to T. mucujensis, but the former is decorated with pale salmon spots on the
dorsum, while the dorsal color pattern in the latter is scattered with sky-blue spots against the
dark background of its dorsum and tail. Tropidurus sertanejo, n. sp., also lacks aculeate spines
on the lateral neck, a morphological attribute exclusive to T. mucujensis.
Description of holotype: Small species of Trop i durus, SVL 79.92 mm; head subtrian-
gular, length 29% of SVL and width 66% of head length; skull not compressed, not strongly
elevated at level of orbits; rostrum not noticeably shortened relative to most other species of
Tro pidur u s ; scales of frontonasal region not imbricating posteriorly, several lenticulate scale
organs present (scale organs randomly distributed on other areas of the head); rostral tall,
about three times as high as rst supralabial, slightly tumescent, contacting rst supralabials,
rst lorilabials, and three postrostrals; 1/2 postrostrals (i.e., right postrostral entire, le divided);
nasal single, higher than adjacent scales, separated from rostral by postrostral-lorilabial con-
tact; 5/6 enlarged supralabials followed by 3/3 smaller scales reaching the rictus oris, never
contacting subocular; nostril elliptical, occupying about one third of nasal, positioned poste-
riorly, directed dorsolaterally; 2/2 canthals between nasal and rst superciliary; anteriormost
canthal separated from supralabials by 1/1 rows of lorilabials and 1/1 rows of loreals; 8/9 lami-
nate superciliary scales weakly produced vertically; 1/1 dorsally keeled preoculars contacting
second canthal and 6/5 loreals; 1/1 dorsally keeled elongate suboculars separated from supra-
labials by one row of lorilabials; palpebrals granular; second row of palpebrals larger, with
developed scale organs; 3 rows of supraoculars, oblique internal row with 8/9, medial row with
6/4, external row with 8/8 small scales, the enlarged ones occupying up to two thirds, and two
posteriormost internal scales occupying the whole width of the supraocular area; 1/1 rows of
small, angulate circumorbitals; 1/1 rows of short semilaminate scales with lenticulate scale
organs linearly distributed along their dorsal face separating circumorbitals and superciliaries;
interparietal enlarged, about 1.2 times longer than wide; parietal eye visible, positioned medi-
ally on the posterior limit of the rst third of the interparietal scale; temporals imbricate,
keeled, larger than lateral neck scales and smaller than dorsals and parietals, scale organ posi-
tioned on the posterior end of the keel or next to the base of a slight mucron, keels more
pronounced on upper than lower temporals; ear shaped as inverted keyhole, canal deep, largest
16 AMERICAN MUSEUM NOVITATES NO. 3852
FIGURE 5. Holotype of Tropidurus sertanejo, n. sp. (MZUSP 104273): (A) head in dorsal view; (B) head in
ventral view showing intense pigmentation toward gular region; (C) head in lateral view; (D) dorsal body;
(E) ventral body showing the typical dark ash marks on the underside of the thighs and cloacal ap of
adult males.
2016 CARVALHO ET AL.: A NEW TROPIDURUS 17
FIGURE 6. Allotype of Tropidurus sertanejo, n. sp. (MZUSP 104274): (A) head in dorsal view; (B) head in
ventral view; (C) head in lateral view; (D) dorsal body illustrating the spotted pattern typical of the new
species; (E) ventral body showing the unpigmented underside of the thighs and cloacal ap characteristic
of females.
18 AMERICAN MUSEUM NOVITATES NO. 3852
diameter of ear opening 20% of ear
opening to snout distance; tympanum
semitranslucent, discretely iridescent
zones visible when exposed to direct
light; preauricular fringe consisting of
row of 6/6 smooth, lanceolate scales;
width of mental 70% of the width of
rostral; mental extending posteriorly to
the level of half of the adjacent infral-
abials; 5/5 enlarged infralabials fol-
lowed by 2/2 smaller scales reaching
the rictus oris; 4/4 angulate, enlarged
postmentals; 1/1 postmentals in con-
tact with rst infralabial; rst postmen-
tals not in contact; 9/9 sublabials; 46
gulars, imbricating posteriorly.
Vertebral crest absent; 84 dorsals;
76 scale rows around midbody; 72 ven-
trals; dorsals large, strongly keeled and
mucronate, particularly on the anterior
portion of the dorsum, aer the head;
keels on dorsal and caudal scales align
forming continuous longitudinal,
slightly oblique lines observable mac-
roscopically; posthumeral region with
small, smooth, nonmucrunate scales,
increasing in size, intensity of keels and
mucronation toward the anks; ven-
trals smooth, nonmucronate, imbricate,
about two thirds the size of dorsals;
ash marks on underside of thighs
formed by 3/3 rows of dark glandular
scales; 17 cloacal scales, cloacal ap
with 8 rows of dark precloacal glandu-
lar scales; supracarpal scales smooth,
rhomboidal; supratarsal scales smooth
toward nger V and keeled and mucro-
nate toward nger I, rhomboidal; both
supracarpals and supratarsals with
scale organ positioned on the distal end
of the scale or next to the base of the
mucron, when present; infracarpal and
A
B
C
FIGURE 7. (A) Dorsal, (B) ventral, and (C) lateral views of
the head of the holotype (MZUSP 104273), illustrating in
detail the scutellation of Tropidurus sertanejo, n. sp.
2016 CARVALHO ET AL.: A NEW TROPIDURUS 19
infratarsal scales carinate, tricarinate toward ngers
and toes; ngers and toes thin, cylindrical, slightly
compressed laterally; supradigital lamellae smooth,
rhomboidal, scale organ positioned on the distal
end of the scales; infradigital lamellae tricarinate
and mucronate, 14/14 under fourth nger, 20/20
under fourth toe, medial careen larger and more
projected than laterals; claws long, curved; preaxial
scales of forearm strongly keeled and mucronate
grading to smooth scales with no or short mucrons
on ventral and postaxial surfaces; scales on hind
limb decreasing in size toward ventral surface,
24/24 tibial scales, heavily keeled and mucronate;
dorsal body scales large, keeled, mucronate, grading
to scales up to 80% smaller at the level of ear open-
ing and neck; rictal, nuchal, postauricular, supraau-
ricular, dorsolateral, longitudinal neck, and
antegular fold absent; shallow postauricular depres-
sion present; oblique neck fold well marked and
covered with smooth, slightly mucronate, imbricate
scales, similar in shape, but smaller than dorsals
and temporals, not forming a mite pocket (i.e., lat-
eral neck fold not forming a pocket coated with
granular scales; see g. 8); antehumeral fold present
and well marked, coated with imbricate scales simi-
lar to those on lateral neck; gular fold incomplete
medially; axillary pocket deep and oblique, coated
with diminutive granular scales; inguinal pocket
wide, with granular scales similar to those in the
axillary pocket; tail compressed, tapering from the end of the rst third to become pointed;
second half of tail broken, separated from the rst half, tip regrown; caudal verticils absent;
scales of tail imbricate, keeled, mucronate, up to three times larger than dorsals; middorsal row
of caudal scales expanded, laterally deected, with strong and highly projected keels, forming
a caudal crest aer the rst third of the tail.
Coloration in life: Bronze coloration on the dorsal head encompassing the frontonasal,
supraocular, and parietal regions. Loreals and lorilabials transition from bronze to irregularly
brown-pigmented scales, with pale salmon or cream background toward labials. Labials cream;
infralabials slightly lighter than supralabials. Coloration of labials extends posteriorly forming
a light facial stripe that crosses the lower temporal region and reaches the preauricular fringe.
Inferior portion of preocular and subocular similar in coloration to lorilabials; uppermost,
keeled portion of both scales darker. Spot formed by 3–4 pale salmon angulate scales located
above the posterior limit of preocular, internally to preocular corner. First and second rows of
FIGURE 8. Lateral view of the neck of (A)
Tro pidu ru s psa mmo na ste s (AMNH 138852)
and (B) T. s e rt an ej o, n. sp. (holotype MZUSP
104273), illustrating the lateral mite pockets
associated with types I and J, respectively. See
table 2 for details on mite pocket patterns in
Tro pid urus .
20 AMERICAN MUSEUM NOVITATES NO. 3852
pale salmon palpebrals form a light ring around the eye, contrasting with the surrounding dark
brown granular scales. Upper temporal region light brown, grading into bronze coloration
toward the top of the head. Pupil circular. Iris turquoise green. Mental region cream to the level
of second pair of postmentals grading into salmon, decorated with 1–2 scales thick oblique
irregular dark-pigmented stripes directed posterolaterally. roat dark bronze with touches of
salmon, dark pigmentation coming from mental region forms a semireticulate pattern poste-
riorly, grading into a dark gular background that retains a bronze brightness in preservative.
Neck, dorsal body, and anks light brown with discrete bronze brightness, decorated with
pale salmon spots 1–3 scales in size, and sparser, randomly distributed smaller dark spots,
creating a side-to-side coarsely aligned light dotted pattern. Nuchal collar positioned at the
level of gular fold, complete ventrally, incomplete dorsally, formed by 3–4 rows of dark scales
extending dorsally to the uppermost limit of the ank, outlined by one row of cream scales
anteriorly and two rows posteriorly. Uppermost limits of anks with artichoke green brightness
along the second half of the body, toward the tail. Chest pigmented; irregular discontinuous
dark stripe positioned before the insertion of forearms, separated from nuchal collar by cream
stripe that outlines it posteriorly. Ventral ground coloration grayish cream with sparse light
brown pigmentation that faints toward the belly. Forearms light brown; small irregular dark
TABLE 2. Expanded classication of mite pockets of the Tropidurus torquatus species group. Types A–H are
treated in detail by Rodrigues (1987). We classify the mite pockets of T. psammonastes (originally described
by Rodrigues et al., 1988) as Type I, and describe for the rst time Type J as exclusive to T. sertanejo, n. sp.
Internal surfaces of antegular-oblique neck, axillary, and inguinal mite pockets are coated with diminutive
granular scales, unless noted.
Species Lateral neck Axillary Inguinal Type
T. catalanensis Two pockets, lower one poorly developed 2–3 shallow granular areas Present A
T. imbituba Two pockets 2–3 shallow granular areas Present A
T. torquatus Two pockets, posterior deeper 2–3 shallow granular areas Present A
T. cocorobensis Two shallow pockets Absent Absent B
T. etheridgei Two shallow pockets Absent Absent B
T. itambere One oblique, deep pocket Absent Present C
T. oreadicus One oblique, deep pocket Absent Absent D
T. hispidus One pocket Present Absent E
T. erythrocephalus One oblique, deep pocket Present Present F
T. montanus One oblique, deep pocket Present Present F
T. mucujensis One oblique, pocket Present Present F
T. chromatops Two enlarged subequal pockets Absent Absent G
T. hygomi Two oblique, deep pockets; anterior posi-
tioned more ventrally
Absent Absent G
T. insulanus One oblique, deep pocket Postaxilar, oblique,
extremely deep
Absent H
T. psammonastes Two pockets; the one anterior (positioned
more ventrally) with regular scales, the
posterior with granular scales
Absent Absent I
T. sertanejo, n. sp. Absent Present Present J
2016 CARVALHO ET AL.: A NEW TROPIDURUS 21
spots randomly spread over. Anterior plane of thighs light brown, posterior plane and shanks
artichoke green; small irregular dark spots randomly distributed. Supracarpal and supratarsal
regions light brownish bronze; digits light brown with touches of cream. Black femoral and
precloacal patches 22/21 and 16 scales long, respectively. Tail artichoke green grading into light
brown toward the tip, ventral side pale cream.
Coloration in preservative: Intense bronze coloration on the dorsal head faded. Head
and dorsal body brown. Oberhautchen on most dorsal and lateral scales lost, and with it the
dotted pattern of the holotype (dorsal pattern was preserved in the allotype, with pale cream
spots contrasting against the darker background; see g. 6). Pale longitudinal stripe below the
eyes extends from labials to preauricular fringe, and narrow dark interruptions formed by
pigmented vertical bars are more evident against the cream background. Mental region cream.
Postmental salmon background absent, dark pigmentation toward the throat preserved, with-
out the original bronze brightness. Nuchal collar well marked, but the row of pale salmon scales
outlining it became pale cream. Chest coloration persisted nearly unchanged. Ventral color-
ation preserved the grayish cream coloration, but ventral surfaces of forelimbs, hind limbs and
tail became slightly more pale cream. Artichoke green coloration of the posterior plane of
thighs and on shanks became brown, similar to dorsum. Artichoke green brightness along the
second half of the body toward the tail absent.
Morphometrics: Trop id ur us s er ta ne jo, n. sp., is one of the four smallest species in the T.
torquatus group, with adult males ranging from 60.09–79.92 mm SVL and females from 61.98
72.46 mm SVL. Reduced mean body size is also observed in T. h y go mi , T. m u cu je n si s , and T.
cocorobensis (g. 9; tables 3–4). Because PC1 held the majority of the explained variance and
*
**
*
Males
PC 1
T
. h
ygomi
T
. m
ucujensis
T
. cocorobensis
T
. insula
n
us
T
. er
ythrocephalus
T
. ethe
r
idgei
T
. itambere
T
. monta
n
us
T
. torquatus
T
. oreadicus
T
. chromatops
T
. psammonastes
T
. hispidus
T
. imbituba
T
. catalanensis
Females
PC 1
T
. h
ygomi
T
. m
ucujensis
T
. cocorobensis
T
. insula
n
us
T
. er
ythrocephalus
T
. ethe
r
idgei
T
. itambere
T
. torquatus
T
. monta
n
us
T
. chromatops
T
. psammonastes
T
. oreadicus
T
. hispidus
T
. catalanensis
T
. imbituba
T. sertanejo
T. sertanejo
0.6
0.4
0.2
0
-0.2
-0.4
0.4
0.2
0
-0.2
-0.4
FIGURE 9. Boxplot of PC1 generated by principal component analysis of log-transformed morphometric
variables as proxy for body size variation among Trop idur us species. Tropidurus sertanejo, n. sp., highlighted
in dark gray.
22 AMERICAN MUSEUM NOVITATES NO. 3852
TABLE 3. Mean ± standard deviation, minimum and maximum values of morphometric measurements (in millimeters) of adult males of the Tro pi-
durus torquatus species group. SVL, snout-vent length; HH, head height; HW, head width; EOS, ear opening–snout distance; AL, arm length; FAL,
forearm length; HDL, hand length; THL, thigh length; SL, shank length; FOL, foot length; TL, tail length. e number of individuals measured fol-
lowed by the number of individuals with fully grown tails. See Morphometrics in Material and Methods for details on statistical treatment of indi-
viduals with broken or missing tails.
Males NSVL TL HH EOS HW AL FAL HDL THL SL FOL
T. catalanensis 9 (5) 105.71 ±
11.91
156.90 ±
16.69
15.39 ±
2.04
26.21 ±
2.86
21.75 ±
2.72
18.51 ±
2.37
16.34 ±
2.43
19.92 ±
2.59
23.22 ±
2.95
26.12 ±
3.64
34.58 ±
3.07
(85.53–
121.79)
(138.00–
183.00)
(12.22–
17.72)
(21.93–
30.17)
(17.27–
25.07)
(14.37–
21.31)
(12.76–
21.48)
(14.37–
22.67)
(18.21–
26.71)
(22.05–
31.48)
(30.81–
38.75)
T. chromatops 2 (1) 91.14 ±
1.73
140.97 12.87 ±
1.02
21.63 ±
1.41
19.04 ±
1.21
15.21 ±
1.96
13.04 ±
0.93
15.20 ±
0.12
20.87 ±
0.49
18.29 ±
0.84
27.65 ±
1.03
(89.91–
92.36)
(12.15–
13.59)
(20.63–
22.63)
(18.18–
19.89)
(13.82–
16.59)
(12.38–
13.70)
(15.11–
15.28)
(20.52–
21.21)
(17.69–
18.88)
(26.92–
28.37)
T. cocorobensis 11
(7)
69.83 ±
4.75
102.65 ±
6.91
9.96 ±
1.20
17.05 ±
1.33
13.51 ±
1.20
12.42 ±
1.27
10.53 ±
0.74
13.21 ±
1.16
15.09 ±
1.15
18.04 ±
2.46
25.01 ±
1.14
(61.39–
74.59)
(94.44–
113.00)
(8.26–
12.14)
(15.37–
19.46)
(11.69–
15.84)
(10.77–
14.74)
(9.31–
11.91)
(10.99–
14.59)
(13.46–
17.45)
(13.56–
22.44)
(23.35–
26.92)
T. sertanejo, n. sp. 5 (3) 70.24 ±
9.03
112.83 ±
6.54
9.99 ±
1.28
17.83 ±
2.63
14.30 ±
2.47
12.08 ±
1.98
10.72 ±
1.96
11.68 ±
1.08
14.81 ±
2.35
15.95 ±
4.08
20.70 ±
2.38
(60.09–
79.92)
(105.48–
118.00)
(8.44–
11.19)
(14.54–
20.03)
(11.00–
16.55)
(9.85–
14.17)
(8.61–
12.72)
(10.70–
13.45)
(12.86–
18.47)
(10.91–
19.94)
(18.62–
24.72)
T. erythrocephalus 6 (3) 76.22 ±
5.97
120.25 ±
19.23
10.52 ±
0.67
19.10 ±
0.80
15.64 ±
1.33
12.52 ±
1.05
11.44 ±
0.66
13.66 ±
1.57
16.60 ±
1.26
18.42 ±
1.08
24.17 ±
2.18
(67.90–
84.20)
(99.00–
136.46)
(9.20–
10.99)
(18.07–
20.15)
(13.34–
17.46)
(10.95–
13.66)
(10.55–
12.48)
(11.94–
16.04)
(15.05–
18.49)
(17.23–
19.55)
(21.59–
27.85)
T. etheridgei 17
(8)
76.98 ±
9.18
117.91 ±
8.00
11.36 ±
1.57
19.46 ±
2.18
16.02 ±
2.37
12.86 ±
1.68
11.45 ±
1.17
13.78 ±
1.17
16.91 ±
2.24
18.16 ±
1.96
24.02 ±
1.80
(59.23–
96.48)
(103.79–
126.31)
(8.58–
14.37)
(15.31–
23.71)
(12.00–
20.23)
(9.00–
15.89)
(9.48–
13.32)
(10.50–
15.37)
(13.77–
22.27)
(14.46–
21.18)
(20.23–
27.55)
T. hispidus 6 (2) 103.30 ±
10.58
159.00 ±
28.28
14.52 ±
1.70
25.91 ±
2.83
21.51 ±
2.53
17.86 ±
1.62
16.65 ±
1.92
18.58 ±
1.84
22.34 ±
2.16
26.84 ±
3.61
30.98 ±
2.67
(84.82–
104.82)
(139.00–
179.00)
(12.01–
16.96)
(20.85–
28.47)
(16.78–
23.71)
(14.94–
19.31
(13.45–
18.88)
(15.27–
20.77)
(18.65–
24.74)
(20.55–
30.09)
(26.35–
34.43)
T. hygomi 14
(5)
62.36 ±
4.02
101.72 ±
8.48
10.49 ±
1.19
16.85 ±
1.11
13.45 ±
1.06
10.73 ±
1.41
9.93 ±
0.81
13.18 ±
0.97
14.47 ±
1.48
18.09 ±
2.61
25.86 ±
1.99
2016 CARVALHO ET AL.: A NEW TROPIDURUS 23
Males NSVL TL HH EOS HW AL FAL HDL THL SL FOL
(54.15–
67.30)
(94.00–
116.00)
(8.61–
13.28)
(15.13–
18.97)
(11.74–
14.97)
(8.41–
13.06)
(8.62–
11.51)
(12.00–
14.96)
(12.09–
16.69)
(13.31–
21.67)
(21.91–
28.44)
T. imbituba 10
(5)
102.87 ±
14.66
175.80 ±
14.46
14.54 ±
3.53
25.67 ±
4.54
20.78 ±
3.92
18.30 ±
2.59
15.66 ±
2.23
20.18 ±
2.30
23.31 ±
3.83
26.48 ±
4.41
34.70 ±
4.28
(76.00–
120.93)
(157.00–
191.00)
(9.39–
20.02)
(17.83–
32.82)
(14.97–
26.56)
(13.60–
21.36)
(11.87–
19.21)
(16.08–
23.36)
(17.70–
28.66)
(19.60–
32.30)
(26.61–
40.31)
T. insulanus 13
(7)
75.73 ±
6.92
104.57 ±
8.94
11.52 ±
1.22
19.01 ±
1.73
15.67 ±
1.41
13.21 ±
1.15
11.57 ±
1.13
13.30 ±
0.99
17.03 ±
2.12
19.04 ±
2.12
22.53 ±
1.49
(61.49–
86.18)
(93.00–
118.00)
(9.46–
13.26)
(15.92–
21.67)
(12.94–
13.43)
(11.52–
15.13)
(9.83–
13.74)
(11.38–
14.58)
(13.91–
20.14)
(15.18–
22.40)
(18.95–
24.29)
T. itambere 9 (2) 77.04 ±
7.35
105.73 ±
6.04
11.66 ±
1.48
19.88 ±
2.03
17.00 ±
1.58
13.39 ±
1.42
11.52 ±
1.22
14.47 ±
1.21
16.44 ±
1.47
18.14 ±
2.41
22.90 ±
1.75
(62.28–
84.77)
(101.46–
110.00)
(9.15–
14.05)
(16.37–
22.01)
(14.16–
19.05)
(11.23–
15.35)
(9.44–
13.19)
(12.64–
16.39)
(13.72–
18.12)
(12.72–
20.04)
(20.25–
25.56)
T. montanus 4 (2) 86.20 ±
16.26
125.00 ±
31.11
11.93 ±
3.13
21.29 ±
4.49
17.95 ±
4.44
14.63 ±
2.57
12.18 ±
2.08
15.96 ±
2.58
19.17 ±
4.24
19.99 ±
4.28
25.79 ±
3.70
(62.34–
98.72)
(103.00–
147.00)
(7.53–
14.25)
(14.73–
24.78)
(11.55–
21.34)
(10.91–
16.68)
(9.43–
13.97)
(12.45–
18.47)
(12.90–
22.05)
(14.18–
23.78)
(20.31–
28.17)
T. mucujensis 5 (2) 71.04 ±
3.44
107.50 ±
4.95
9.72 ±
0.32
17.15 ±
0.58
13.80 ±
1.09
11.24 ±
0.89
10.34 ±
0.56
12.65 ±
0.40
15.65 ±
0.76
16.78 ±
0.57
21.57 ±
0.68
(67.67–
75.32)
(104.00–
111.00)
(9.30–
10.17)
(16.25–
17.73)
(12.82–
15.57)
(10.04–
12.24)
(9.47–
10.79)
(12.16–
13.21)
(14.78–
16.80)
(16.06–
17.35)
(20.87–
22.43)
T. oreadicus 6 (4) 85.80 ±
4.79
141.25 ±
11.09
12.44 ±
1.14
20.90 ±
1.98
17.79 ±
1.48
14.84 ±
0.88
12.96 ±
1.30
16.75 ±
1.23
19.37 ±
1.88
21.33 ±
2.34
26.46 ±
1.85
(79.02–
91.63)
(127.00–
151.00)
(11.47–
14.42)
(18.83–
23.64)
(16.35–
19.86)
(13.90–
15.89)
(11.78–
14.96)
(15.48–
18.90)
(17.38–
22.14)
(17.06–
23.87)
(24.36–
29.25)
T. psammonastes 8 (2) 93.34 ±
4.60
142.50 ±
0.71
14.60 ±
1.15
23.47 ±
0.95
19.51 ±
0.75
16.23 ±
1.57
14.94 ±
1.23
17.89 ±
0.93
19.56 ±
2.54
24.87 ±
2.72
32.83 ±
2.19
(86.57–
99.06)
(142.00–
143.00)
(13.37–
16.15)
(22.10–
24.50)
(18.32–
20.47)
(13.34–
17.97)
(12.54–
16.58)
(16.74–
19.11)
(13.90–
21.76)
(19.43–
28.22)
(29.12–
35.81)
T. torquatus 8 (3) 85.65 ±
6.14
129.00 ±
10.00
13.14 ±
1.36
21.41 ±
1.86
17.11 ±
1.66
14.67 ±
1.43
13.27 ±
1.00
15.64 ±
1.10
18.39 ±
1.52
22.13 ±
1.54
27.87 ±
1.62
(74.40–
93.01)
(119.00–
139.00)
(10.58–
14.45)
(17.60–
23.38)
(14.14–
19.02)
(13.30–
17.22)
(11.77–
14.84)
(14.08–
17.77)
(16.49–
21.33)
(19.91–
24.04)
(25.65–
30.54)
24 AMERICAN MUSEUM NOVITATES NO. 3852
TABLE 4. Mean ± standard deviation, minimum and maximum values of morphometric measurements (in mm) of adult females of the Tropidurus
torquatus species group. SVL, snout-vent length; BH, body height; HH, head height; HW, head width; EOS, ear opening–snout distance; AL, arm
length; FAL, forearm length; HDL, hand length; THL, thigh length; SL, shank length; FOL, foot length; TL, tail length. e number of individuals
measured followed by the number of individuals with fully grown tails. See Morphometrics in Material and Methods for details on statistical treat-
ment of individuals with broken, regrown or missing tails.
Females NSVL TL HH EOS HW AL FAL HDL THL SL FOL
T. catalanensis 16 (8) 80.04 ±
10.91
116.76 ±
16.37
9.88 ±
1.47
18.62 ±
2.45
14.95 ±
2.21
13.27 ±
1.99
11.27 ±
1.43
15.45 ±
1.89
16.75 ±
2.39
18.45 ±
2.88
26.15 ±
2.68
(61.23–
102.18)
(93.00–
135.00)
(7.43–
12.63)
(14.70–
23.62)
(11.50–
19.11)
(9.88–
17.34)
(8.97–
14.22)
(12.57–
19.37)
(13.34–
21.98)
(15.12–
25.06)
(22.19–
31.33)
T. chromatops 2 (1) 75.20 ±
3.66
80.19 11.07 ±
0.21
18.37 ±
0.16
14.82 ±
0.07
12.71 ±
2.42
10.87 ±
0.74
12.68 ±
0.47
16.45 ±
0.93
16.85 ±
2.90
22.20 ±
0.91
(72.61–
77.79)
(10.92–
11.22)
(18.26–
18.48)
(14.77–
14.87)
(11.00–
14.42)
(10.34–
11.39)
(12.34–
13.01)
(15.79–
17.11)
(14.80–
18.90)
(21.55–
22.84)
T. cocorobensis 4 (4) 62.66 ±
2.33
85.25 ±
4.99
7.97 ±
0.50
14.57 ±
0.70
11.32 ±
0.69
11.21 ±
1.10
9.09 ±
0.64
12.13 ±
1.19
12.40 ±
1.05
15.84 ±
0.64
21.34 ±
0.78
(60.27–
65.37)
(78.00–
89.00)
(7.45–
8.42)
(13.99–
15.56)
(10.30–
11.80)
(9.74–
12.36)
(8.18–
9.68)
(10.54–
13.07)
(10.89–
13.27)
(14.89–
16.28)
(20.71–
22.47)
T. s er t a ne j o, n. sp. 3 (2) 63.37 ±
1.72
79.74 ±
4.00
8.88 ±
0.12
15.69 ±
0.83
12.49 ±
0.41
10.20 ±
0.43
8.64 ±
0.32
10.61 ±
0.45
12.97 ±
1.32
13.13 ±
2.21
17.76 ±
0.43
(61.98–
65.29)
(76.91–
82.57)
(8.74–
8.98)
(15.19–
16.64)
(12.05–
12.85)
(9.70–
10.49)
(8.44–
9.00)
(10.16–
11.06)
(11.45–
13.85)
(11.34–
15.60)
(17.32–
18.17)
T. erythrocephalus 3 (2) 64.95 ±
0.91
88.50 ±
3.54
8.38 ±
0.30
15.56 ±
0.25
12.24 ±
0.27
10.36 ±
0.37
9.31 ±
0.24
11.59 ±
0.58
13.99 ±
0.53
15.43 ±
0.52
19.25 ±
0.40
(64.08–
65.90)
(86.00–
91.00)
(8.05–
8.65)
(15.28–
15.77)
(11.96–
12.50)
(10.13–
10.79)
(9.07–
9.55)
(10.92–
11.93)
(13.62–
14.60)
(14.83–
15.79)
(18.87–
19.66)
T. etheridgei 13 (6) 67.66 ±
7.57
92.19 ±
6.27
9.42 ±
1.07
16.26 ±
1.45
13.15 ±
1.95
11.35 ±
1.07
10.14 ±
0.75
12.52 ±
1.30
13.99 ±
1.64
15.75 ±
1.60
21.47 ±
1.33
(59.54–
86.28)
(83.50–
103.00)
(8.04–
11.41)
(13.83–
19.22)
(10.70–
17.40)
(9.84–
12.72)
(9.10–
11.94)
(10.38–
14.77)
(11.71–
16.26)
(13.19–
18.67)
(19.60–
23.45)
T. hispidus 9 (5) 76.10 ±
11.18
113.00 ±
10.05
9.73 ±
1.15
18.20 ±
2.16
14.92 ±
1.77
12.67 ±
1.92
12.05 ±
1.81
14.22 ±
1.74
16.13 ±
2.38
18.80 ±
2.46
23.76 ±
2.54
(59.83–
92.62)
(98.00–
125.00)
(8.12–
11.19)
(15.33–
21.88)
(12.25–
17.86)
(9.75–
15.66)
(9.52–
14.82)
(11.90–
16.44)
(12.81–
19.90)
(15.15–
21.75)
(20.18–
26.93)
T. hygomi 10 (6) 52.85 ±
4.08
81.11 ±
13.72
7.77 ±
0.65
13.64 ±
0.79
10.43 ±
0.72
8.73 ±
0.68
8.06 ±
0.52
10.53 ±
0.61
12.19 ±
0.88
15.35 ±
2.65
21.11 ±
0.84
2016 CARVALHO ET AL.: A NEW TROPIDURUS 25
Females NSVL TL HH EOS HW AL FAL HDL THL SL FOL
(48.08–
60.38)
(64.00–
95.46)
(6.66–
8.74)
(12.59–
14.73)
(9.45–
11.50)
(7.84–
9.65)
(7.17–
8.91)
(9.50–
11.33)
(11.06–
14.13)
(12.64–
22.05)
(19.57–
22.11)
T. imbituba 4 (3) 83.12 ±
12.07
113.33 ±
10.02
10.21 ±
1.04
19.31 ±
2.59
14.92 ±
1.60
14.27 ±
2.08
12.48 ±
1.74
16.72 ±
2.80
18.40 ±
2.47
20.51 ±
2.66
27.92 ±
2.92
(70.16–
99.05)
(102.00–
121.00)
(9.38–
11.65)
(16.83–
22.95)
(13.90–
17.28)
(11.82–
16.89)
(11.16–
15.04)
(13.37–
19.58)
(15.63–
21.26)
(17.74–
23.82)
(25.19–
32.06)
T. insulanus 12 (4) 63.82 ±
6.33
93.58 ±
8.77
8.50 ±
0.90
15.24 ±
1.27
12.49 ±
1.28
10.45 ±
1.45
9.79 ±
0.99
11.09 ±
1.12
13.19 ±
1.32
15.55 ±
1.76
18.51 ±
1.15
(52.65–
77.12)
(83.00–
103.00)
(6.94–
9.50)
(13.52–
17.64)
(10.76–
15.40)
(8.04–
12.99)
(8.01–
11.23)
(8.60–
12.85)
(11.20–
14.76)
(12.26–
18.07)
(16.35–
20.54)
T. itambere 4 (2) 71.39 ±
8.47
86.50 ±
9.19
9.45 ±
1.64
17.09 ±
1.32
14.50 ±
0.58
11.36 ±
0.67
10.73 ±
0.54
12.20 ±
1.06
14.70 ±
1.13
16.42 ±
1.55
19.26 ±
1.58
(58.88–
77.43)
(80.00–
93.00)
(7.39–
10.85)
(15.14–
18.07)
(13.89–
15.26)
(10.77–
12.29)
(9.99–
11.23)
(11.10–
13.28)
(13.10–
15.57)
(14.77–
18.19)
(17.30–
20.64)
T. montanus 4 (2) 74.71 ±
8.97
93.63 ±
13.26
9.23 ±
1.31
17.29 ±
1.77
14.40 ±
1.62
12.33 ±
1.26
10.87 ±
1.23
13.97 ±
1.59
16.23 ±
1.32
17.27 ±
2.23
22.04 ±
1.77
(63.43–
83.40)
(84.25–
103.00)
(7.84–
10.71)
(15.42–
19.14)
(12.32–
15.80)
(11.41–
14.18)
(9.58–
12.54)
(12.38–
16.08)
(14.71–
17.50)
(15.56–
20.51)
(20.59–
24.60)
T. mucujensis 3 (1) 60.81 ±
1.71
76.00 7.88 ±
0.36
14.72 ±
0.39
12.05 ±
0.72
9.84 ±
1.19
9.22 ±
1.07
10.95 ±
0.47
13.23 ±
1.10
14.22 ±
0.46
18.80 ±
1.21
(59.17–
62.59)
(7.59–
8.29)
(14.42–
15.16)
(11.58–
12.88)
(8.91–
11.19)
(8.36–
10.41)
(10.45–
11.37)
(12.21–
14.39)
(13.71–
14.60)
(18.06–
20.20)
T. oreadicus 7 (6) 71.83 ±
6.71
113.17 ±
12.01
10.07 ±
0.54
17.23 ±
1.30
14.46 ±
0.95
12.19 ±
1.46
11.61 ±
1.37
13.05 ±
1.62
15.41 ±
1.43
17.60 ±
1.41
21.91 ±
1.50
(62.28–
81.75)
(97.00–
127.00)
(9.37–
10.72)
(15.24–
19.43)
(13.09–
16.26)
(10.27–
14.19)
(9.94–
14.04)
(10.38–
14.85)
(13.90–
17.94)
(15.65–
19.39)
(19.73–
24.51)
T. psammonastes 4 (1) 71.06 ±
7.41
107.00 8.93 ±
1.10
17.42 ±
1.48
14.17 ±
1.45
11.74 ±
1.39
11.37 ±
0.63
14.46 ±
1.03
14.85 ±
1.25
17.67 ±
1.81
25.28 ±
1.38
(61.67–
79.52)
(7.98–
10.51)
(15.44–
18.83)
(12.35–
15.75)
(9.77–
12.90)
(10.60–
12.04)
(12.93–
15.13)
(13.20–
15.98)
(15.75–
20.04)
(23.54–
26.91)
T. torquatus 7 (3) 68.70 ±
8.65
91.33 ±
2.52
8.92 ±
1.32
16.51 ±
1.91
12.97 ±
1.39
11.96 ±
1.66
10.10 ±
1.21
14.16 ±
2.66
14.68 ±
2.22
17.56 ±
3.07
24.07 ±
3.21
(60.16–
80.39)
(89.00–
94.00)
(7.69–
11.00)
(14.61–
19.59)
(11.50–
14.97)
(10.14–
14.28)
(8.73–
11.76)
(10.28–
18.09)
(12.11–
17.88)
(14.79–
22.70)
(19.42–
28.38)
26 AMERICAN MUSEUM NOVITATES NO. 3852
showed positive weights on all variables, it was interpreted as a general measure of size. Although
size variation is nearly continuous among Trop idurus species (g. 9), ANOVA showed a signi-
cant dierence in mean body size (males: df = 15, sum sq = 6.45, mean sq = 0.43, F value = 23.31,
p < 0.001; females: df = 15, sum sq = 2.52, mean sq = 0.17, F value = 10.05, p < 0.001). Tropidurus
sertanejo, n. sp., diered statistically from larger species; pairwise comparisons indicated that
males of the new species dier from T. c at a la ne n si s, T. h is p id us , T. i mb it ub a , T. o re ad ic u s, T.
psammonastes, and T. t o rq ua tu s , while females dier from T. c at al a ne ns i s, T. h is pi d us , and T.
imbituba (mean body size comparisons for all species pairs shown in appendix 3).
Although MANOVA has identied statistical dierences among species centroids (males:
df = 15, Wilks’ λ = 0.0022, approx. F = 5.7780, dfnun = 165, dfden = 977.2494, p < 0.001; females:
df = 15, Wilks’ λ = 0.0031, approx. F = 4.0070, dfnun = 165, dfden = 727.0808, p < 0.001), PCA
plots showed large morphometric overlap for all species analyzed (g. 10; table 5). e high
morphological similarity was statistically conrmed by the low discrimination power of the
LDA. e assignment of individuals to species using the LDA function showed 77.44% and
86.67% success rate based on males and females, respectively. ese values dropped to 57.14%
and 51.43% when the leave-one-out cross-validation procedure was implemented (appendices
4–5). Size-free LDA showed even lower reclassication rates, with 64.6% and 76.19% correct
assignment of individuals. e cross-validation procedure resulted in 42.11% and 46.67% cor-
rect reclassications (appendices 6–7).
ese results indicate that the morphometric prole of the T. t or qu at u s species group is
highly conserved, and body size is an important variable promoting discrimination among spe-
cies (table 5). For T. se r t an ej o, n. sp., elimination of isometric size resulted in signicant decrease
in reclassication success from 60% to 20% in the cross-validation LDA for males and 33% to 0%
for females. Males of T. s er t an ej o , n. sp., were frequently misclassied as T. e th e ri d ge i , T. h is p id u s,
or T. i mb it ub a , and females as T. et h er i dg e i, T. er y th ro c ep h al us , or T. in su l an us (appendices 6–7).
e size-free LDA for both sexes indicated that FOL is the most important attribute explaining
dierences in shape among species. However, the plots of FOL against SVL (not shown) suggest
a common allometric trend for all Tropidu r u s species, except for T. h yg o mi and, to lesser degree,
T. c oc o ro be n si s, which have feet proportionally larger with respect to body size (tables 3–4).
erefore, dierences in the proportions of FOL in relation to SVL can only be used to discrimi-
nate T. s e rt a ne jo , n. sp., from two of the four smallest species of the T. t or qu a tu s group. Foot
length in T. se r ta n ej o, n. sp., corresponded to 26.41%–32.18% of snout-vent length in males and
26.53%–29.32% in females, while values between 32.51%–40.82% and 32.49%–34.56%, and
35.11%–48.42% and 36.01%–44.30%, were observed for males and females of T. c o co ro b en si s and
T. h y go mi , respectively. Body size and foot length were useful variables distinguishing T. s e r ta ne j o,
n. sp., from the largest and smallest species of the T. t or qu at u s group, respectively, but morpho-
metric attributes alone were insucient to separate it from middle-sized forms of the group.
Additional morphological attributes are needed to unambiguously distinguish T. s e r ta ne j o, n. sp.,
from most congeners; see “Comparison with other species.
Meristics: All meristic variables showed continuous variation and large overlap among spe-
cies (g. 11; table 6). Tro pi du ru s s er ta ne jo , n. sp., had intermediate scale counts and overlapped
all other species considerably in number of dorsals, ventrals, gulars, and midbody scales. e
2016 CARVALHO ET AL.: A NEW TROPIDURUS 27
number of tibials and subdigital lamellae on fourth toe were the only variables useful for separat-
ing T. s er t an e jo , n. sp., from other congeners. However, T. c oc or ob e ns is , T. i mb it u ba , and T.
psammonastes were the only species whose number of tibials or subdigital lamellae was nearly or
totally nonoverlapping with T. s e rta n ej o, n. sp. (g. 11; table 6). Nonparametric MANOVA
detected statistical dierences in scale counts among species and between sexes, but most of the
variance was explained by the former factor (table 7). e absence of interaction between species
and sex allowed us to pool individuals of both sexes for the subsequent LDA. LDA conrmed
that scale counts are highly similar within the T. t or qu at u s group and meristic variables are not
eective in separating most species. e overall reclassication success of the LDA function was
68.84%, and this value dropped to 62.61% when applying the leave-one-out cross-validation
procedure. LD1 and LD2 showed large overlap among T. s e r ta ne j o, n. sp., and most other species,
except for T. c at al a ne n si s , T. c o co ro b en s is , T. h yg o mi , T. i mb it u ba , T. p s am mo n as te s , and T. t o r-
quatus (g. 12; table 8). e LDA function had an overall reclassication success of 42.86% for
specimens of T. s e r ta ne j o, n. sp., and this value dropped to 38.10% when adopting the leave-one-
out cross-validation procedure (appendix 8).
e number of subdigitial lamellae on fourth toe had the strongest contribution on both
LD1 and LD2, yet not allowing complete separation of any species in both axes. By plotting
LD1 against LD2 we were able to identify two species groups that diered in number of scales.
e rst group included the psammophilous species T. c oc o ro be n si s, T. h y go mi , and T. ps a mm on -
astes, characterized by a higher number of subdigital lamellae in relation to the number of
dorsals and ventrals. e second included all other species with a relatively lower number of
subdigital lamellae. We observed that species with proportionally larger feet had higher num-
bers of subdigital lamellae on the fourth toe (Pearson correlation: males: r = 0.634, p = 0.008;
LD1
LD2
LD1
LD2
PC1
PC2
Males
PC1
PC2
Females
T. catalanensis
T. chromatops
T. cocorobensis
T. erythrocephalus
T. etheridgei
T. hispidus
T. hygomi
T. imbituba
T. insulanus
T. itambere
T. montanus
T. mucujensis
T. oreadicus
T. psammonastes
T. torquatus
T. sertanejo, n. sp.
2
0
-2
-4
-6 -4 -2 0 2 46
2
0
-2
-4
-6 -4 -2 0246
-0.4 -0.2 0 0.2 0.4 0.6 -0.4 -0.2 00.2 0.4
0.2
0.1
0
0.1
0.2
0.2
0.1
0
0.1
0.2
FIGURE 10. Scatterplot of PC1 and PC2 generated by the principal component analyses and LD1 and
LD2 generated by the size-free discriminant analyses performed on the log-transformed morphometric
variables of Tropi dur u s . Trop idur us s er tan ejo, n. sp., highlighted in dark gray. See table 5 for correspond-
ing summary statistics.
28 AMERICAN MUSEUM NOVITATES NO. 3852
TABLE 5. Summary of the principal component analyses and size free linear discriminant analyses performed with 11 morphometric measurements
of male and female Tropidurus. PC, component loadings; LD, discriminant coecients, EVL, eigenvalues; SD, standard deviations; % Variance, per-
centage of explained variances.
PCA males LDA males PC females LDA females
PC 1 PC 2 PC 3 LD 1 LD 2 LD 3 PC 1 PC 2 PC 3 LD 1 LD 2 LD 3
SVL 0.0776 -0.0133 0.0069 25.1473 -24.2023 -57.2868 0.0654 -0.0140 0.0009 -10.4295 30.8564 32.6393
TL 0.0769 0.0114 0.0202 32.2194 57.2225 2.2264 0.0578 0.0175 0.0032 21.4519 13.5833 -19.6751
HH 0.0761 -0.0140 -0.0179 4.4342 15.8745 2.3209 0.0492 -0.0248 -0.0012 11.2080 -10.7702 -19.0909
EOS 0.0751 -0.0115 -0.0002 -16.3122 -3.5051 2.4427 0.0556 -0.0088 -0.0018 -29.2811 -62.6398 15.4347
HW 0.0805 -0.0219 0.0002 -3.7256 -3.1726 29.2168 0.0603 -0.0197 -0.0024 -0.9361 -2.4714 12.6218
AL 0.0829 -0.0043 0.0019 -3.1297 -9.6830 -11.4690 0.0680 0.0002 -0.0048 -3.0283 5.6695 9.7620
FAL 0.0792 -0.0021 -0.0129 7.3692 -16.3779 4.1252 0.0598 -0.0021 -0.0212 25.2093 5.3082 0.5515
HDL 0.0738 0.0165 0.0156 4.5895 -31.2816 19.5853 0.0680 0.0135 0.0194 7.2029 8.7570 11.4582
THL 0.0781 -0.0095 0.0104 6.0288 3.8402 2.2947 0.0620 -0.0095 0.0094 1.7758 -15.2921 -5.7569
SL 0.0797 0.0263 -0.0285 -3.6199 0.6071 -5.5096 0.0490 0.0300 -0.0266 -11.8232 -6.7053 0.9865
FOL 0.0656 0.0274 0.0068 -48.7706 6.7943 -17.9010 0.0512 0.0217 0.0206 -60.7071 6.3094 1.4817
EVL 0.0652 0.0029 0.0022 5.7391 3.8563 2.3697 0.0381 0.0032 0.0021 5.9391 3.2744 2.6569
SD 0.2553 0.0543 0.0465 2.3956 1.9638 1.5394 0.1951 0.0569 0.0456 2.4370 1.8095 1.6300
%
Variance
86.84 3.93 2.87 29.63 19.91 12.24 78.18 6.64 4.26 32.75 18.05 14.65
2016 CARVALHO ET AL.: A NEW TROPIDURUS 29
FIGURE 11. Boxplot showing variation in scale counts among Trop idu r us species (ordinated by mean): (Tca t )
T. c at al an en s is , (Tchr) T. c hr om at op s , (Tc o c ) T. c oc o ro be ns i s, (Ter y ) T. e r yt hr o ce ph al u s, (Te t h ) T. e t he ri d ge i,
(is) T. h is p id us , (yg) T. h yg o mi , (Timb) T. i mb it ub a, (Tins) T. i ns ul an u s, (Tita) T. i ta mb er e, (Tmon ) T.
montanus, (Tmu c) T. mucujensis, (To r e ) T. oreadicus, (Tpsa) T. psammonastes, (Tser) T. sertanejo, n. sp. (high-
lighted in dark gray.), (Ttor) T. torquatus.
**
**
*
*
*
*
*
This
Tpsa
Tore
Tins
Tita
Tser
Tery
Thyg
Tcoc
Teth
Tmon
Tmuc
Tchr
Timb
Ttor
Tcat
60 70 80 90 100 110 120
DORSALS
This
Tita
Tore
Tins
Thyg
Tpsa
Tser
Tery
Teth
Tcoc
Tmuc
Tmon
Tchr
Timb
Ttor
Tcat
60 80 100 120
VENTRALS
Thyg
This
Tpsa
Tore
Tcoc
Tery
Tita
Tins
Tser
Teth
Ttor
Tmon
Tchr
Tmuc
Timb
Tcat
60 70 80 90
GULARS
Thyg
This
Tcoc
Tery
Tpsa
Tore
Teth
Tins
Tchr
Tmuc
Tser
Tita
Tmon
Ttor
Timb
Tcat
35 40 45 50 55 60
MIDBODY
Tita
This
Tser
Tins
Tore
Tpsa
Teth
Tchr
Tmuc
Tery
Tmon
Thyg
Ttor
Tcat
Tcoc
Timb
15 20 25 30
TIBIALS
Tita
Tser
Teth
Tore
Tins
This
Tery
Tmon
Tmuc
Tchr
Ttor
Timb
Tcat
Thyg
Tpsa
Tcoc
15 20 25 30
SUBDIGITAL LAMELLAE
*
**
*
*
*
*
*
**
*
*
*
*
*
*
*
**
* *
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
*
30 AMERICAN MUSEUM NOVITATES NO. 3852
TABLE 6. Mean ± standard deviation, minimum and maximum values of scale counts of males (M),
females (F), and juveniles, subadults and adults whose sex could not be determined based on external mor-
phology plus males and females (All) of the Tr opi du ru s to rq uat us species group.
Species Sex NDorsals Ventrals Gulars Midbody Tibials Subdigital
lamellae
T. catalanensis All 80 111.99 ± 8.59
(92–132)
80.04 ± 5.36
(71–97)
50.90 ± 4.01
(41–60)
105.44 ± 8.33
(89–126)
27.50 ± 1.81
(23–32)
26.15 ± 1.88
(22–30)
M 13 105.38 ± 4.96
(94–110)
78.62 ± 3.91
(71–87)
51.15 ± 3.21
(46–59)
97.38 ± 6.53
(89–106)
27.62 ± 2.14
(24–32)
26.38 ± 2.10
(22–30)
F 47 113.21 ± 8.48
(96–132)
80.91 ± 5.91
(71–97)
50.91 ± 4.56
(41–60)
107.34 ± 7.14
(97–126)
27.43 ± 1.92
(23–31)
25.89 ± 1.91
(22–30)
T. chromatops All 4 101.25 ± 3.86
(97–105)
75.00 ± 2.58
(72–78)
44.75 ± 2.50
(42–48)
92.25 ± 3.59
(87–95)
24.50 ± 1.29
(23–26)
23.00 ± 2.45
(20–26)
M 2 101 ± 5.66
(97–105)
75.00 ± 4.24
(72–78)
45.00 ± 4.24
(42–48)
91.00 ± 5.66
(87–95)
24.50 ± 2.12
(23–26)
24.50 ± 2.12
(23–26)
F 2 101.5 ± 3.54
(99–104)
75.00 ± 1.41
(74–76)
44.50 ± 0.71
(44–45)
93.50 ± 0.71
(93–94)
24.50 ± 0.71
(24–25)
21.50 ± 2.12
(20–23)
T. cocorobensis All 16 91.06 ± 5.48
(84–101)
67.31 ± 3.77
(61–74)
39.50 ± 2.42
(35–43)
84.50 ± 4.23
(78–92)
28.56 ± 1.90
(25–31)
27.88 ± 2.13
(22–31)
M 10 88.3 ± 3.47
(84–95)
66.70 ± 2.95
(61–71)
39.20 ± 2.3
(36–43)
82.20 ± 3.01
(78–86)
28.60 ± 1.78
(26–31)
28.40 ± 1.26
(27–30)
F 6 95.67 ± 5.28
(87–101)
68.33 ± 5.01
(61–74)
40.00 ± 2.76
(35–42)
88.33 ± 3.01
(84–92)
28.5 ± 2.26
(25–31)
27.00 ± 3.03
(22–31)
T. s er t an e jo , n. sp.All 21 86.48 ± 7.78
(73–103)
71.10 ± 5.81
(60–80)
45.33 ± 3.4
(40–53)
78.38 ± 6.82
(65–89)
21.90 ± 1.37
(20–25)
20.48 ± 1.72
(18–23)
M 5 80.60 ± 4.28
(75-84)
68.60 ± 6.31
(62–76)
43.20 ± 2.59
(40–46)
76.00 ± 3.94
(72–82)
22.00 ± 1.41
(21–24)
20.00 ± 1.22
(19–22)
F 3 93.33 ± 7.37
(85–99)
73.00 ± 11.27
(60–80)
46.67 ± 3.06
(44–50)
84.67 ± 6.66
(77–89)
23.33 ± 1.53
(22–25)
21.67 ± 2.31
(19–23)
T. e r yt hr o ce ph a lu s All 15 87.07 ± 4.64
(80–96)
67.67 ± 4.92
(62–80)
39.80 ± 3.14
(35–46)
81.47 ± 6.32
(66–93)
25.60 ± 1.96
(22–29)
21.80 ± 0.56
(21–23)
M 6 83.67 ± 2.42
(80–86)
67.67 ± 3.93
(62–73)
39.33 ± 3.83
(35–46)
76.17 ± 5.64
(66–80)
25.67 ± 2.16
(23–29)
22.00 ± 0.63
(21–23)
F 6 90.00 ± 2.97
(86–95)
66.33 ± 4.23
(62–74)
40.50 ± 2.81
(37–45)
85.50 ± 3.94
(82–93)
25.83 ± 1.72
(24–28)
21.67 ± 0.52
(21–22)
T. etheridgei All 19 90.84 ± 5.70
(81–105)
71.63 ± 4.78
(64–79)
43.47 ± 3.81
(36–48)
88.58 ± 6.28
(80–103)
24.05 ± 2.27
(19–28)
20.53 ± 1.43
(18–24)
M 8 90.12 ± 4.85
(85–100)
73.62 ± 5.07
(67–79)
44.62 ± 3.38
(38–48)
87.88 ± 5.57
(81–100)
24.00 ± 1.07
(23–26)
20.88 ± 1.36
(19–23)
F 7 92.71 ± 7.78
(81–105)
71.57 ± 3.60
(67–77)
43.14 ± 5.11
(36–48)
89.86 ± 8.47
(80–103)
24.86 ± 2.79
(20–28)
20.57 ± 1.62
(19–24)
T. hispidus All 20 67.95 ± 6.61
(57–88)
61.85 ± 4.70
(54–73)
38.85 ± 2.85
(35–46)
65.80 ± 7.68
(57–90)
20.30 ± 1.81
(16–23)
21.75 ± 1.48
(19–25)
M 7 66.57 ± 5.38
(57–72)
60.71 ± 2.81
(57–66)
37.29 ± 1.80
(35–40)
61.86 ± 3.34
(57–66)
20.14 ± 1.77
(18–23)
22.00 ± 1.91
(19–25)
F 10 69.20 ± 7.90
(60–88)
62.60 ± 6.19
(54–73)
40.30 ± 3.13
(36–46)
70.10 ± 8.63
(62–90)
20.30 ± 1.95
(16–23)
21.50 ± 1.18
(19–23)
T. hygomi All 23 80.78 ± 4.88
(72–90)
59.74 ± 3.60
(52–66)
38.39 ± 3.07
(33–46)
83.00 ± 5.61
(72–96)
27.35 ± 3.32
(21–34)
27.17 ± 1.77
(23–30)
M 11 81.27 ± 4.71
(72–88)
60.91 ± 3.21
(54–66)
38.73 ± 3.20
(34–46)
79.00 ± 3.77
(72–84)
28.55 ± 3.42
(23–34)
27.64 ± 2.06
(23–30)
F 8 81.38 ± 5.63
(75–90)
58.75 ± 3.81
(52–63)
38.00 ± 3.78
(33–45)
88.00 ± 4.84
(81–96)
26.88 ± 3.31
(21–30)
27.25 ± 1.39
(26–30)
2016 CARVALHO ET AL.: A NEW TROPIDURUS 31
Species Sex NDorsals Ventrals Gulars Midbody Tibials Subdigital
lamellae
T. imbituba All 16 103.81 ± 7.12
(88–114)
77.75 ± 6.17
(65–86)
50.06 ± 4.93
(39–59)
99.19 ± 11.60
(70–122)
29.31 ± 2.57
(25–33)
26.12 ± 2.13
(21–29)
M 10 103.40 ± 5.66
(93–110)
78.90 ± 5.22
(69–86)
50.00 ± 3.43
(45–57)
96.80 ± 6.05
(86–106)
29.30 ± 2.67
(25–33)
26.60 ± 1.65
(24–29)
F 4 107.75 ± 6.85
(98–114)
79.5 ± 5.92
(73–85)
50.75 ± 4.27
(46–56)
110.25 ± 8.42
(102–122)
29.25 ± 2.75
(26–32)
26.00 ± 2.16
(23–28)
T. insulanus All 23 79.74 ± 3.76
(74–87)
70.30 ± 3.47
(62–75)
44.43 ± 3.20
(39–49)
74.96 ± 5.79
(66–89)
22.00 ± 1.28
(20–25)
21.65 ± 1.34
(19–24)
M 11 78.27 ± 2.49
(74–82)
70.45 ± 3.30
(63–75)
45.55 ± 3.47
(40–49)
71.09 ± 2.70
(66–76)
21.55 ± 0.93
(20–23)
21.64 ± 1.29
(19–24)
F 9 81.44 ± 3.88
(75–87)
71.11 ± 3.18
(64–75)
44.33 ± 2.35
(41–48)
79.00 ± 6.14
(71–89)
23.00 ± 1.00
(22–25)
22.33 ± 0.71
(22–24)
T. itambere All 16 74.62 ± 9.51
(55–95)
67.69 ± 7.88
(55–90)
45.38 ± 3.24
(39–50)
78.00 ± 10.34
(55–99)
18.25 ± 1.57
(15–21)
19.00 ± 2.13
(14–22)
M 9 70.56 ± 7.37
(55–80)
65.11 ± 4.43
(55–70)
45.11 ± 3.82
(39–50)
75.56 ± 10.24
(55–89)
18.22 ± 1.64
(15–21)
19.11 ± 1.54
(17–21)
F 4 86.00 ± 6.38
(81–95)
77.50 ± 9.00
(70–90)
47.00 ± 1.83
(45–49)
88.25 ± 7.46
(82–99)
19.00 ± 1.41
(18–21)
20.50 ± 1.29
(19–22)
T. montanus All 29 98.28 ± 10.70
(79–121)
74.10 ± 6.45
(64–91)
46.24 ± 3.75
(38–52)
89.28 ± 9.27
(75–114)
26.59 ± 1.80
(23–30)
22.14 ± 1.87
(17–25)
M 5 94.40 ± 8.41
(89–109)
72.00 ± 4.85
(64–76)
46.40 ± 2.07
(44–49)
83.40 ± 3.78
(80–89)
27.80 ± 1.92
(25–30)
23.00 ± 1.22
(22–25)
F 16 99.44 ± 11.34
(79–119)
75.75 ± 7.43
(66–91)
46.25 ± 4.36
(38–52)
92.06 ± 10.32
(77–114)
26.69 ± 1.66
(23–30)
21.81 ± 1.72
(18–25)
T. mucujensis All 15 97.6 ± 4.72
(90–108)
75.53 ± 3.83
(69–82)
45.00 ± 2.04
(42–51)
90.33 ± 7.76
(75–102)
24.80 ± 2.37
(21–29)
22.53 ± 1.88
(19–25)
M 5 96.80 ± 4.55
(90–102)
75.40 ± 5.22
(69–82)
45.60 ± 3.29
(43–51)
84.20 ± 7.19
(75–94)
25.80 ± 2.95
(21–29)
22.20 ± 2.77
(19–25)
F 3 99.33 ± 2.08
(97–101)
75.67 ± 2.08
(74–78)
43.67 ± 1.53
(42–45)
92.00 ± 9.17
(82–100)
22.67 ± 0.58
(22–23)
22.33 ± 2.31
(21–25)
T. oreadicus All 13 78.15 ± 4.02
(69–85)
66.46 ± 3.60
(62–76)
42.00 ± 2.04
(38–46)
72.38 ± 6.09
(66–88)
22.62 ± 2.53
(20–28)
21.31 ± 1.18
(19–23)
M 5 75.80 ± 4.76
(69–82)
65.20 ± 2.17
(62–68)
42.00 ± 1.58
(40–44)
69.40 ± 2.19
(66–72)
23.20 ± 2.28
(21–27)
21.00 ± 1.41
(19–22)
F 6 79.17 ± 2.04
(77–82)
67.83 ± 4.79
(62–76)
42.50 ± 2.59
(38–46)
74.33 ± 7.50
(68–88)
21.83 ± 3.13
(20–28)
21.33 ± 1.21
(20–23)
T. psammonastes All 11 82.55 ± 3.78
(77–90)
63.73 ± 40
(57–70)
41.18 ± 3.43
(34–46)
70.27 ± 6.57
(60–79)
23.36 ± 1.63
(21–26)
27.73 ± 2.80
(24–33)
M 6 82.50 ± 1.87
(80–85)
63.50 ± 3.33
(58–68)
40.17 ± 3.66
(34–45)
65.50 ± 4.76
(60–74)
23.67 ± 2.07
(21–26)
29.50 ± 2.26
(26–33)
F 3 85.33 ± 5.69
(79–90)
64.00 ± 6.56
(57–70)
42.00 ± 3.00
(39–45)
76.67 ± 2.52
(74–79)
23.33 ± 1.15
(22–24)
24.67 ± 1.15
(24–26)
T. torquatus All 16 106.19 ± 8.77
(92–126)
73.94 ± 4.81
(70–88)
47.88 ± 5.18
(42–60)
104.00 ± 9.99
(88–122)
27.38 ± 1.86
(23–30)
25.50 ± 1.59
(22–28)
M 7 99.57 ± 4.86
(92–108)
71.71 ± 2.06
(70–75)
44.86 ± 2.27
(42–48)
95.86 ± 4.95
(88–101)
27.00 ± 1.29
(26–29)
25.00 ± 1.15
(23–26)
F 7 112.71 ± 7.83
(104–126)
77.14 ± 5.64
(71–88)
51.57 ± 5.77
(45–60)
110.71 ± 8.08
(97–122)
28.57 ± 1.27
(26–30)
26.00 ± 1.91
(22–28)
32 AMERICAN MUSEUM NOVITATES NO. 3852
females: r = 0.509, p = 0.044). Positive associations between body size and other meristic vari-
ables were similarly expected, but we failed to nd signicant correlations between SVL and
number of dorsal, ventral, gular, and midbody scales. ese results are in agreement with our
previous observations that SVL and scales counts lack consistent correlation within species
(results not shown), suggesting that the number of scales is determined from birth and shows
no signicant ontogenetic, static, or interspecic allometric trends. Although meristic variables
are commonly used to distinguish lizard species, our results showed that we cannot rely on
scale counts to separate T. sertanejo, n. sp., from most species of the T. torquatus group.
Etymology: e species name, sertanejo, is to be treated as an indeclinable word. In Por-
tuguese, sertanejo is an adjective that alludes to interior or rural areas. It is also used as a noun
to refer to the people born in the sertão. In current times, the term sertão is mostly used to
refer to the dry areas of northeastern Brazil dominated by the Caatinga biome, where T. ser-
tanejo, n. sp., occurs. Naming T. sertanejo, n. sp., we aim to honor all men and women who
bravely thrive in the historically neglected semiarid Brazilian Caatinga.
Geographic distribution and conservation status: Tropidurus sertanejo, n. sp., is
endemic to the semiarid Brazilian Caatinga and known exclusively from two localities in the
State of Bahia, northeastern Brazil. e rst is the RPPN Fazenda Pé da Serra, Serra do
Arame, Municipality of Ibotirama, a private natural reserve located in the western portion
of the state. e second is the Municipality of Caetité, approximately 150 km south of Iboti-
rama (g. 3). Although Tropidurus sertanejo, n. sp., has part of its distribution covered by a
small protected area (total area of the RPPN Fazenda Pé da Serra: 12.59 km2; Portaria IBAMA
60-92/N), the fact that only one additional (disjunct) population is known from Caetité
represents a critical conservation issue. However, since actual distribution limits, population
size, and local abundance of T. sertanejo, n. sp., are unknown, the data currently available
allow us to recommend its classication only as “data decient” according to the criteria
proposed by IUCN (2001). In addition to conrming the unique identity of the Caatinga
herpetofauna (Rodrigues, 2003; Rodrigues et al., 2003; Carvalho et al., 2013; Guedes et al.,
2014), the discovery of T. sertanejo, n. sp., calls attention to the need of extensive mapping
of lizard populations within the biome. It also corroborates the existence of higher taxonomic
diversity in Tropidurus (Carvalho, 2013), and makes clear that besides cryptic species even
easily diagnosable taxa still remain to be described in this group (A.L.G. Carvalho, unpub-
lished data; M.A. Sena, unpublished data).
Ecological remarks: At the RPPN Fazenda Pé da Serra, Municipality of Ibotirama, T.
sertanejo, n. sp., occurs in syntopy with T. pi n im a and T. hispidus, although these species exhibit
distinct spatial niches and have not been observed using the same microhabitats. With a com-
mon behavior found among species of the T. se m it ae ni a tu s group, T. p i ni ma was observed using
rock crevices in large rock outcrops. Several individuals, including up to ve juveniles, were
seen basking on the same rock surfaces. Tropidurus hispidus was observed exclusively around
an articial dam inside the RPPN Fazenda Pé da Serra, and seemed limited to rocks and con-
crete structures in the area. e distribution of this species in the region is apparently limited
to human-modied areas, and it remains unclear whether its occurrence is opportunistic or
2016 CARVALHO ET AL.: A NEW TROPIDURUS 33
the species is established in localities apart from those sampled during our visits to the reserve.
Several adult males and females were observed basking on the walls of the dam, and hiding in
cracks or underneath concrete structures during the hottest periods of the day. A few meters
south of the main river that crosses the RPPN Fazenda Pé da Serra, we observed T. sertanejo,
n. sp., using small to middle-sized rocks (~40–120 cm) on trails that cut through sandy areas
covered with dry forests and caatingas (g. 2). e local distribution of the new species seems
to be determined by the presence of both rocks on sandy soils, rather than each of these ele-
ments individually. Tr op idur us sertan ej o, n. sp., was never observed using branches or tree
trunks, but we conrmed it uses holes underneath rocks as shelters. As we approached the
lizards, they ed to the surrounding bushes and remained motionless on the leaf litter where
their coloration served as camouage. When threatened, they also ed to their shelters and hid
for a few minutes until returning to their original location on the rocks. In general, the lizards
returned to the very same rocks even aer being approached several times, which suggests that
they defend their territories and have small home ranges of a few square meters. Tropidurus
sertanejo, n. sp., is diurnal and active individuals were observed until sunset (approximately 6
p.m.). Nothing is known about its diet. e large extension of the natural landscapes suggests
that T. sertanejo, n. sp., occurs in contiguous areas along the Serra do Arame. However, addi-
tional eldwork is needed to determine its actual distribution limits and ecological require-
ments at the type locality. Specimens of T. sertanejo, n. sp., from Caetité were active on rocky
outcrops emerging from a wide plateau of white sands covered by dense thickets of low vegeta-
tion. Cactaceae, Bromeliaceae, Velloziaceae, and Euphorbiaceae compose the dominant plant
cover at the rocky areas. When approached, lizards took refuge in rock crevices among the
vegetation. e species is sympatric but never syntopic with a still undescribed species of Euro-
lophosaurus (see Passoni et al., 2008) and with another relative of the T. torquatus group pre-
liminarily identied as T. a. etheridgei. e latter two species were never observed on rocks.
ey occupy exclusively the adjacent sandy soil areas, moving among thickets of vegetation
separated by variable extensions of bare sand.
PHYLOGENETICS
Alignment and partitioning: Alignments of four mitochondrial and six nuclear loci
included 19–28 species (69%–100%), with average taxon coverage of 25.9 terminals (92.5%).
TABLE 7. Summary of the results of the nonparametric MANOVA performed on six meristic variables of
Tropidurus.
df SSq MS Fmodel R2p
Species 15 147408.3479 9827.2232 69.9178 0.7395 < 0.001
Sex 2 6376.6231 3188.3115 22.6839 0.0320 < 0.001
Species : Sex 28 4638.2541 165.6519 1.1786 0.0233 0.2197
Residuals 291 40901.1725 140.5539 0.2052
Tot a l 336 199324.3976 1
34 AMERICAN MUSEUM NOVITATES NO. 3852
Number of aligned sites varied from 477–1211 per locus, summing up to 7098 characters.
Of those, 4977 were conserved among all species, 2078 were variable, and 1159 were parsi-
mony informative; singletons totaled 917 sites (table 9). e proportion of parsimony-infor-
mative sites over the total number of aligned sites varied from 19.78%–32.32% to
4.93%–21.10% among mitochondrial and nuclear loci, respectively. Numbers of parsimony-
informative characters were up to 6.5 times higher in mitochondrial loci when compared
with nuclear fragments.
BIC analyses favored ve distinct partitions of the mitochondrial and nuclear data sets, and
10 partitions of the total evidence data set. e number of models of nucleotide evolution
selected varied from three to seven depend