Content uploaded by Jörg Freyhof
Author content
All content in this area was uploaded by Jörg Freyhof on Feb 26, 2016
Content may be subject to copyright.
126
Accepted by R. Pethiyagoda: 29 Dec. 2015; published: 18 Feb. 2016
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2016 Magnolia Press
Zootaxa 4083 (1): 126
–
142
http://www.mapress.com/j/zt/
Article
http://doi.org/10.11646/zootaxa.4083.1.7
http://zoobank.org/urn:lsid:zoobank.org:pub:9F44BFDB-2A3A-4495-9AF6-8E3D60BAC5F4
Capoeta anamisensis, a new species from the Minab and Hasan Langhi River
drainages in Iran (Teleostei: Cyprinidae)
HALIMEH ZAREIAN
1
, HAMID REZA ESMAEILI
1
& JÖRG FREYHOF
2
1
Ichthyology Research Lab., Department of Biology, College of Sciences, Shiraz University, Shiraz, Iran.
E-mails: hresmaeili22@gmail.com; h.zareian@gmail.com
2
German Centre for Integrative Biodiversity Research (iDiv), Deutscher Platz 5a, 04103 Leipzig, Germany.
E-mail: joerg.freyhof@idiv.de
Abstract
Capoeta anamisensis, from the Minab and Hasal Langhi River drainages in southern Iran, belongs to the C. trutta species
group. Capoeta anamisensis is distinguished from other species of the C. trutta species group by the combination of the
following characters: flank silvery without black spots; 56–67 scales in total along the lateral series; 11–12 scales above
the lateral line and 21–25 gill rakers. Capoeta anamisensis is also distinguished from all other congeners in the Persian
Gulf basin by having four fixed, diagnostic nucleotide substitutions in the mtDNA COI barcode region and five fixed,
diagnostic nucleotide substitutions in the mtDNA cyt b region. The type of Capoeta barroisi persica is identified as an
aberrant individual of C. trutta and is considered as a synonym of that species.
Key words: Barcode region, Cytochrome b, freshwater fish, Middle East, Biodiversity
Introduction
Scrapers of the genus Capoeta are widespread from Western Anatolia to Central Asia. Levin et al. (2012) analysed
the phylogeny of Capoeta based on the complete mitochondrial gene for the cytochrome b sequences. They found
C. barroisi and C. turani to be closely related to C. trutta, forming a distinct species group, very well separated
from the other Capoeta species analysed. This group is called the C. trutta species group here. Capoeta trutta is
widespread in the Euphrates and Tigris drainages. Other species of the C. trutta group are C. barroisi, which is
endemic to the Orontes drainage in Syria and Turkey, and C. mandica from the Mond and Helleh River drainages
in the Iranian Persian Gulf basin. Capoeta mandica, originally described by Bianco & Bănărescu (1982) as a
subspecies of C. barroisi, was treated as a valid species by Özuluğ & Freyhof (2008). Turan et al. (2008) described
C. erhani from the Turkish Ceyhan River drainage and Özuluğ & Freyhof (2008) described C. turani from the
Turkish Seyhan River drainage: both also belong to the C. trutta species group.
Here we describe an additional species in the C. trutta species group from the Minab and Hasan Langhi River
drainages in southern Iran, which drains to the Straits of Hormuz, based on morphological and molecular
characters.
Material and methods
After anesthesia, the fish specimens were fixed in 10% formaldehyde and stored in 70% ethanol. The right pectoral
fin of each fish was removed and preserved in 96% ethanol for genetic analyses. Measurements were made with a
dial caliper and recorded to 0.1 mm. All measurements were made point to point (never by projections). Methods
for counts and measurements follow Kottelat & Freyhof (2007). Standard length (SL) is measured from the tip of
the snout to the end of the hypural complex. The length of the caudal peduncle is measured from behind the base of
the last anal-fin ray to the end of the hypural complex, at mid-height of the caudal-fin base. Lateral-line scales are
Zootaxa 4083 (1) © 2016 Magnolia Press
·
127
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
counted from the anteriormost scale (the first one to touch the cleitrum) to the posteriormost one (At the caudal-fin
base). Gill rakers are counted on the first gill arch. The last two branched rays articulating on a single
pterygiophore in the dorsal and anal fins are counted as "1½". Scales along the mid-lateral series are counted. The
holotype is included in the calculation of means and SD.
Abbreviations: SL, standard length; HL, lateral head length; K2P, Kimura 2-parameter. Collection codes: FSJF
Fischsammlung J. Freyhof, Berlin; IUSHM, Istanbul University, Science Faculty, Hydrobiology Museum, İstanbul;
SMF, Senkenberg Museum Frankfurt; ZFMK, Zoologisches Forschungsinstitut und Museum A. Koenig, Bonn;
ZHM, Zoologisches Institut der Universität Hamburg; ZM-CBSU, Zoological Museum of Shiraz University,
Collection of Biology Department, Shiraz.
DNA extraction and PCR. Genomic DNA was extracted using the Salt method (Bruford et al. 1992). The
standard vertebrate DNA barcode region of the COI (cytochrome c oxidase subunit 1) and cyt b (Cytochrome b)
regions were amplified using primer pairs named FishF1- (5'TCAACCAACCACAAAGACATTGGCAC3') and
FishR1-(5'TAGACTTCTGGGTGGCCAAAGAATCA3') (Ward et al. 2005) and L14724-(5'GTGACTTGAAAAA
CCACCGTTG3') and H15915-(5'CAACGATCTCCGGTTTAGAAGAC3') (Xiao et al. 2001) or GluF-
(5'AACCACCGTTGTATTCAACTACAA3') and H-15560 (5`TAGGCRAATAGGAARTATCA3`) (Machordom &
Doadrio 2001) respectively. Purification and sequencing of the PCR products were conducted at Macrogen Korea
Laboratories with the aforementioned primer pairs. New sequences from this study were combined with data from
previous studies obtained from the NCBI GenBank (Tables 1–2).
Molecular data analyses. Data processing and sequence assembly was done in BioEdit 7.2.5 (Hall 1999) and
MEGA6 (Tamura et al. 2013) was used to create a DNA sequence alignment by using ClustalW algorithm. No
indications of unexpected stop-codons or nuclear copies of mitochondrial fragments occurred in any sequence. All
generated DNA barcodes and cyt b are deposited in the NCBI GenBank given with their respective accession
numbers (Tables 1–2). The most appropriate sequence evolution model for the given data was determined with
Modeltest (Posada & Crandall 1998) as implemented in the MEGA6 software, treating gaps and missing data with
the partial deletion option under 95% site coverage cutoff. The model with the lowest BIC (Bayesian Information
Criterion) scores is considered to best describe the substitution pattern. To explore species phylogenetic affinities,
according to Modeltest we generated maximum likelihood phylogenetic trees with 10,000 bootstrap replicates in
RaxML software 7.2.5 (Stamatakis 2006) under the GTR+G model of nucleotide substitution, with fast bootstrap
and also Bayesian phylogenetic analysis (BI), using the Markov Chain Monte Carlo method (MCMC), with
6,000,000 generation under the most generalising model (GTR+G+I) using MrBayes 3.1.1 (Huelsenbeck &
Ronquist 2001). Screening for diagnostic nucleotide substitutions was performed manually from the sequence
alignment. Sequence divergence values between species were calculated using Kimura two Parameter (K2P)
distance model implemented in in MEGA6 (Tamura et al. 2013). As an appropriate outgroup to root the
constructed phylogenetic hypothesis, we included the distantly related Luciobarbus capito.
Results
We analysed COI and cyt b nucleotide sequences for a total of 70 and 40 individuals of 22 Capoeta species
respectively including 116 sequences from GenBank (Tables 1–2). Results of the Bayesian and Maximum
Likelihood analyses are shown in Figs. 1–2. The two different phylogenetic approaches produced almost identical
tree topologies which strongly support the view of Levin et al. (2012) and Geiger et al. (2014), that C. barroisi, C.
erhani, C. mandica, C. trutta and C. turani form one closely related group of species, being quite distantly related
to the other Capoeta species. Capoeta anamisensis also belongs to this species group (Figs. 1–2). The values of
K2P sequence in the COI barcode region show differences between 0.62% (C. anamisensis vs. C. trutta) and
1.51% (C. anamisensis vs. C. erhani) (Table 3). The values of K2P sequence in cyt b region show differences
between C. anamisensis and two other closely related species, C. trutta and C. mandica of 1.25% and 1.58%
respectively (Table 4). Tables 5–6 list the unique and diagnostic nucleotide substitutions found in the mtDNA COI
barcode region and cyt b respectively.
ZAREIAN ET AL.
128
·
Zootaxa 4083 (1) © 2016 Magnolia Press
TABLE 1. List of species used for molecular analysis for cyt b. Luciobarbus capito was considered as outgroup
(Reference: a: Present study and b: Levin et al. 2012).
Species Accession N. Reference Country Drainage or basin
C. aculeata KU312377 a Iran Kor
C. aculeata KU312378 a Iran Kor
C. anamisensis KU312379 a Iran Minab
C. anamisensis KU312380 a Iran Minab
C. anamisensis KU312381 a Iran Hasan Langi
C. antalyensis JF798269 b Turkey Boga Cayi
C. baliki JF798273 b Turkey Sakarya
C. baliki JF798275 b Turkey Iznik
C. barroisi JF798279 b Turkey Orontes
C. bergamae JF798280 b Turkey Bakircay
C. bergamae JF798281 b Turkey Koca
C. buhsei KU312369 a Iran Namak
C. buhsei KU312370 a Iran Namak
C. caelestis JF798286 b Turkey Goksu
C. caelestis JF798287 b Turkey Kargi
C. capoeta JF798302 b Armenia Aras
C. capoeta JF798296 b Armenia Aras
C. damascina JF798309 b Turkey Euphrates
C. damascina JF798307 b Turkey Yocalti
C. fusca KU312371 a Iran Lut
C. fusca KU312372 a Iran Lut
C. heratensis JF798317 b Turkmenistan Yanbash
C. heratensis JF798316 b Turkmenistan Murgab
C. kosswigi JF798322 b Turkey Van
C. kosswigi JF798323 b Turkey Van
C. mandica KU312375 a Iran Mond
C. mandica KU312376 a Iran Mond
C. mauricii JF798325 b Turkey Beysehir
C. mauricii JF798324 b Turkey Beysehir
C. saadii KU312373 a Iran Helleh
C. saadii KU312374 a Iran Mond
C. saadii JF798326 b Iran Kor
C. saadii JF798327 b Iran Minab
C. sieboldii JF798329 b Turkey Kizilirmak
C. sieboldii JF798330 b Turkey Yesilirmak
C. trutta JF798334 b Iran Karun
C. trutta JF798333 b Turkey Euphrates
C. trutta JF798332 b Iran Tigris
C. turani JF798335 b Turkey Seyhan
Luciobarbus capito JX987313 Unknown
Zootaxa 4083 (1) © 2016 Magnolia Press
·
129
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
TABLE 2. List of species used for molecular analysis for COI. Luciobarbus capito was considered as outgroup
(Reference: a: own study, b: Keskin & Atar 2013 and c: Geiger et al. 2015).
Species Accession N. Reference Country Drainage or basin
C. aculeata KU312345 a Iran Kor
C. aculeata KU312346 a Iran Kor
C. anamisensis KU312342 a Iran Minab
C. anamisensis KU312343 a Iran Minab
C. anamisensis KU312344 a Iran Minab
C. anamisensis KU312340 a Iran Hasan Langi
C. anamisensis KU312341 a Iran Hasan Langi
C. antalyensis KJ552850 c Turkey Aksu
C. antalyensis KJ553025 c Turkey Aksu
C. barroisi KJ553267 c Turkey Orontes
C. barroisi KJ553245 c Turkey Orontes
C. barroisi KJ552785 c Turkey Orontes
C. barroisi KJ552810 c Turkey Orontes
C. bergamae KJ553157 c Turkey Bakir
C. bergamae KJ552877 c Turkey Bakir
C. buhsei KU312349 a Iran Namak
C. buhsei KU312350 a Iran Namak
C. caelestis KJ553301 c Turkey Göksu
C. caelestis KJ553030 c Turkey Göksu
C. capoeta KC500371 b Turkey Karasu
C. capoeta KC500372 b Turkey Karasu
C. damascina KJ552868 c Turkey Seyhan
C. damascina KJ553114 c Syria Barada
C. damascina KJ553069 c Syria Barada
C. damascina KJ552939 c Syria Jordan
C. erhani KJ552767 c Turkey Ceyhan
C. erhani KJ553087 c Turkey Ceyhan
C. erhani KJ552806 c Turkey Ceyhan
C. erhani KJ553067 c Turkey Ceyhan
C. fusca KU312347 a Iran Lut
C. fusca KU312348 a Iran Lut
C. mandica KU312363 a Iran Mond
C. mandica KU312364 a Iran Mond
C. mandica KU312365 a Iran Mond
C. mandica KU312366 a Iran Mond
C. mandica KU312367 a Iran Mond
C. mandica KU312368 a Iran Mond
C. mauricii KJ552918 c Turkey Beyşehir
C. pestai KJ553304 c Turkey Egirdir
C. saadi KU312353 a Iran Hormuz
C. saadi KU312395 a Iran Maharlu
......continued on the next page
ZAREIAN ET AL.
130
·
Zootaxa 4083 (1) © 2016 Magnolia Press
TABLE 3: Estimates of evolutionary divergence over sequence pairs between species found in the COI barcode region
of the Capoeta trutta species group.
TABLE 2. (Continued)
Species Accession N. Reference Country Drainage or basin
C. saadi KU312359 a Iran Kor
C. saadi KU312354 a Iran Mond
C. saadi KU312355 a Iran Mond
C. saadi KU312358 a Iran Maharlu
C. saadi KU312356 a Iran Mond
C. saadi KU312357 a Iran Mond
C. saadii KU312362 a Iran Mond
C. saadii KU312360 a Iran Helleh
C. saadii KU312361 a Iran Helleh
C. tinca KJ553229 c Turkey Simav
C. tinca KJ553168 c Turkey Simav
C. trutta KU312351 a Iran Tigris
C. trutta KU312352 a Iran Tigris
C. trutta KU312385 a Turkey Tigris
C. trutta KU312384 a Turkey Tigris
C. trutta KU312383 a Turkey Tigris
C. trutta KU312382 a Turkey Tigris
C. trutta KU312386 a Iraq Tigris
C. trutta KU312389 a Turkey Euphrates
C. trutta KU312388 a Turkey Euphrates
C. trutta KU312387 a Turkey Euphrates
C. turani KJ553224 c Turkey Seyhan
C. turani KU312393 a Turkey Seyhan
C. turani KU312392 a Turkey Seyhan
C. turani KU312391 a Turkey Seyhan
C. turani KU312390 a Turkey Seyhan
C. turani KU312394 a Turkey Seyhan
Luciobarbus capito JX987313 Unknown
NC. anamisensis C. barroisi C. erhani C. mandica C. trutta
C. anamisensis 5
C. barroisi 41.08
C. erhani 3 1.51 1.08
C. mandica 6 0.94 0.80 1.32
C. trutta 10 0.62 0.57 1.00 0.43
C. turani 7 1.35 0.92 0.16 1.16 0.83
Zootaxa 4083 (1) © 2016 Magnolia Press
·
131
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
TABLE 4. Estimates of evolutionary divergence over sequence pairs between species found in the cytb gene sequences
of the Capoeta trutta species group.
FIGURE 1. Condensed Bayesian tree inferred from cyt b. Numbers right of the slash, indicate the posterior probabilities of the
Bayesian analysis, using MrBayes, while numbers left of the slash are the bootstrap support for 10,000 replicates in the
Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support for the node.
NC. anamisensis C. barroisi C. mandica C. trutta
C. anamisensis 3
C. barroisi 11.63
C. mandica 2 1.58 1.25
C. trutta 3 1.25 1.02 1.16
C. turani 1 1.77 0.69 1.68 1.25
ZAREIAN ET AL.
132
·
Zootaxa 4083 (1) © 2016 Magnolia Press
FIGURE 2. Condensed Bayesian tree inferred from COI sequences. Numbers left of the slash, indicate the posterior
probabilities of the Bayesian analysis, using MrBayes, while numbers right of the slash are the bootstrap support for 10,000
replicates in the Maximum Likelihood tree, using RaxML. Asterisks (*) indicate less than 50% Maximum Likelihood support
for the node.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
133
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
TABLE 5. Diagnostic nucleotide substitutions found in COI gene of Capoeta trutta species group. Nucleotide position
relative to Luciobarbus capito complete mitochondrial genome.
TABLE 6. Diagnostic nucleotide substitutions found in cyt b gene of Capoeta trutta species group. Nucleotide position
relative to Luciobarbus capito complete mitochondrial genome.
Capoeta anamisensis, new species
(Figs. 3–5)
Holotype. ZM-CBSU Z131, 144 mm SL; Iran: Hormuzgan prov.: Moradabad River at Ziarat Ali, Minab River
drainage, 27°45'47.6"N 57°14'31.8"E; H. R. Esmaeili, M. Masoudi, H. Mehraban, A. Gholamifard & S. Shabani,
10 Mar 2013.
Paratypes. All from Iran: Hormuzgan prov.: FSJF 3513; 3, 167–187 mm SL; ZM-CBSU Z126-130, 5, 134–
139 mm SL; ZM-CBSU Z132-134, 3, 147-164 mm SL; ZM-CBSU Z260, 1, 123 mm SL; same data as holotype.—
ZM-CBSU C402-403, 2, 91–96 mm SL; ZM-CBSU C405-411, 7, 62–88 mm SL; ZM-CBSU C415-416, 2, 54–66
mm SL; ZM-CBSU C418, 1, 62 mm SL; ZM-CBSU C422, 1, 55 mm SL; ZM-CBSU C426, 1, 101 mm SL; Siaho
River at Siaho, Hasan Langi River drainage, 27°45'35.8"N 56°32'18.7"E; H. R. Esmaeili & A. Teimori.
Material for molecular genetic analysis. ZM-CBSU M1416–1418; Moradabad River at Ziarat Ali,
27°45'47.6"N 57°14'31.8"E (Genbank accession numbers: COI: KU312342, KU312343, KU312344; cyt b:
KU312379, KU312380). ZM-CBSU M1475; Siaho River at Siaho, 27°50'4.44"N 56°28'25.90"E (Genbank
accession numbers: COI: KU312341; cyt b: KU312381). SMF 30860; Siaho River at Siaho, 27°50'4.44"N
56°28'25.90"E (Genbank accession numbers: COI: KU312340).
Diagnosis. Capoeta anamisensis is the only species in the C. trutta species group having a plain silvery flank
without black spots (vs. black spots present in all other species). It is further distinguished from other species of the
C. trutta species group by a combination of characters. Capoeta anamisensis is distinguished from C. barroisi by
having fewer total lateral-line scales (56–67 vs. 76–84), fewer scales between dorsal-fin origin and lateral line (6–8
vs. 10–13) and by fewer scales between anal-fin origin and lateral line (6–8 vs. 10–13) (Tables 7–8) [our materials
and from Turan et al. 2008], and fewer gill rakers (21–25 vs. 26–29). Capoeta anamisensis is distinguished from C.
erhani and C. turani by having fewer scales in the lateral line (56–67 vs. 71–77 in C. erhani), no mid-dorsal keel on
the back (vs. prominent, elevated, mid-dorsal keel in C. erhani and C. turani) and fewer gill rakers (21–25 vs. 25–
30 in C. turani). Capoeta anamisensis is distinguished from C. trutta by having a shorter last unbranched dorsal-fin
ray (shorter than the head length vs. usually longer), fewer scales in the lateral line (56–67 vs. 64–84 [our material
COI N
5528
5558
5603
5651
5690
5708
5735
5774
5777
5792
5798
5861
5933
6035
C. anamisensis 5CGT AT AATCAAACT
C. barroisi 4CACAT GACT AGAT/CT
C. erhani 4CACGT GAT TGGGCC
C. mandica 6TACAT AG/ATT AGAT T
C. trutta 10- ACAT/CAAT TAGACT
C. turani 7CACGTGAT T GGGCT
cyt b N
14382
14550
14562
14565
14583
14673
14715
14727
14781
14787
14790
14793
14850
14928
14949
15020
15039
15075
15102
15117
C. anamisensis 3 GACAGTCTAGAT GAGC GCCA
C. barroisi 1 AGTAAT GCAAGTAGGC ATCA
C. mandica 2 AATGACGCGAGT GGGC GCCC
C. trutta 3 - GTAAT GCAGGTGGAT/CGCCA
C. turani 1 - GTAAT GCAAGCAAGT ATAA
ZAREIAN ET AL.
134
·
Zootaxa 4083 (1) © 2016 Magnolia Press
and Turan et al. 2008] and fewer scales between the anal-fin origin and the lateral line (6–8 vs. 8–11). Capoeta
anamisensis is also distinguished from all other species of the C. trutta species group by having four fixed,
diagnostic nucleotide substitutions in the mtDNA COI barcode region and five fixed, diagnostic nucleotide
substitutions in the mtDNA cyt b region.
TABLE 7. Lateral-line scale count in Capoeta trutta species group.
continued.
TABLE 8. Number of scales above lateral line (ALL)/ below lateral line (BLL) in Capoeta trutta species group.
continued.
Description. See Figures 3–5 for general appearance. Morphometric and meristic data are given in Tables 7–
10. Body moderately elongate and compressed laterally. Dorsal head profile straight. Predorsal profile slightly
convex, ventral profile straight or slightly convex. No elevated keel in front of dorsal-fin origin. Mouth small,
transverse and almost straight (Fig. 7). Lower jaw covered by a horny sheath, with a sharp edge, shape invariable.
Rostral cap well developed, partly overlapping upper lip. Upper and lower lips adnate to jaws. Only maxillary
barbel present, almost reaching vertical of anterior margin of eye. Dorsal fin with 3-4 simple and 8½–9½ branched
rays. Last unbranched ray thick, ossified, slightly shorter than first branched dorsal-fin ray, tip soft, serrated along
Species/count N 56585960616263646566676869
C. anamisensis 2211253 413 2
C. barroisi 12
C. erhani 20 1
C. mandica 16 21112112122
C. trutta 44 2 1315
Species/count N 7071727374757677787980818284
C. anamisensis 22
C. barroisi 12 1 242111
C. erhani 20 2252332
C. mandica 16
C. trutta 44422255324 2 1
above lateral line (ALL)
Species/count N 8 9 10 11 12 13 14 15 16 17 18
Capoeta anamisensis 20 14 6
Capoeta barroisi 12 5 3 4
Capoeta erhani 20 4 10 6
Capoeta mandica 11 1 10
Capoeta trutta 402117167 3 3
below lateral line (BLL)
Species/count N 6 7 8 9 10 11 12 13
Capoeta anamisensis 22 5 11 6
Capoeta barroisi 12 2712
Capoeta erhani 20 2 12 6
Capoeta mandica 11 4 5 2
Capoeta trutta 38 6 18 8 6
Zootaxa 4083 (1) © 2016 Magnolia Press
·
135
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
60–75% of its posterior margin (Fig. 8). Outer dorsal-fin margin straight. Dorsal-fin origin slightly in front of
vertical through pelvic-fin origin. Pectoral fin with 14–16 rays, tip slightly rounded, reaching to about 50–60% of
distance between pectoral and pelvic-fin origin. Pelvic fin with 7–8 rays, tip rounded, reaching to about 50–60% of
distance between pelvic-fin tip and anal-fin origin when folded down. Pelvic axillary lobe present. Anal fin with 3
simple and 5½–6½ branched rays, its posterior margin almost convex, not reaching to caudal-fin base. Caudal fin
deeply forked, its lobes pointed or rounded. Gill rakers 21–25 on outer side of first gill arch. Lateral line complete,
totally with 56–67 scales, 11–12 scale rows between lateral line and dorsal-fin origin, 6–8 scale rows between
lateral line and anal-fin origin, 10–13 between lateral line and pelvic-fin origin.
TABLE 9. Total gill raker counts of the first gill arch in Capoeta trutta species group.
TABLE 10. Morphometric data of C. anamisensis holotype, ZM-CBSU Z131, paratypes, ZM-CBSU Z126, (5), ZM-
CBSU Z132, (3).
Species/count N21222324252627282931
Capoeta anamisensis 2222873
Capoeta barroisi 12 3612
Capoeta erhani 20 7 10 2 1
Capoeta mandica 16 122218
Capoeta trutta 40119117541 1
Holotype Range Mean SD
Standard length (mm) 144 135–165 143 0.6
In percent of standard length
Head length 23.4 22.7–24.3 23.6 0.5
Body depth at dorsal-fin origin 23.1 22.4–25.6 24.1 1.2
Predorsal length 51.5 51.3–52.9 52.0 0.6
Postdorsal length 51.1 49.3–51.8 50.4 0.9
Preanal length 76.9 74.8–79.0 76.9 1.2
Prepelvic length 54.4 51.8– 55.3 53.8 1.0
Distance between pectoral and pelvic-fin origins 30.0 27.9–34.0 30.7 1.5
Distance between pelvic and anal-fin origins 23.6 22.5–26.3 24.5 1.2
Depth of caudal peduncle 11.0 9.9–11.1 10.5 0.4
Length of caudal peduncle 18.1 15.0–19.9 18.4 1.4
Dorsal-fin base length 13.6 13.0–14.2 13.4 0.3
Anal-fin base length 6.8 6.1–8.3 7.2 0.7
Pectoral-fin length 17.0 15.7–18.7 17.0 0.9
Pelvic-fin length 13.9 12.9–15.4 14.1 0.8
In percent of head length
Head depth at eye 51 50–57 53 2.6
Snout length 38 35–42 37 2.0
Postorbital distance 50 48–50 49 0.8
Interorbital width 40 35–40 39 1.8
Eye diameter 14 13–17 15 1.2
Maximum head width 58 53–61 58 2.5
Barbel length 10 9–17 13 3.3
ZAREIAN ET AL.
136
·
Zootaxa 4083 (1) © 2016 Magnolia Press
FIGURE 3. Capoeta anamisensis, ZM-CBSU Z131, holotype, 144 mm SL; Iran: Moradabad River.
FIGURE 4. Capoeta anamisensis, paratypes; a, ZM-CBSU Z128; 134 mm SL; b, ZM-CBSU Z132, 150 mm SL; c, ZM-CBSU
Z126, 134 mm SL; Iran: Moradabad River.
FIGURE 5. Capoeta anamisensis, ZM-CBSU Z260; 123 mm SL; Iran: Moradabad River.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
137
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
FIGURE 6. Dorsal view; a, C. anamisensis, ZM-CBSU Z128, 134 mm SL; Iran: Moradabad River; b, ZM-CBSU Z251, C.
trutta; 151 mm SL, Iran: Asgaran River; c, C. mandica, ZM-CBSU Z212; 118 mm SL, Iran: Qareh Aghaj River.
FIGURE 7. Mouth; a, C. anamisensis, ZM-CBSU Z128, 134 mm SL; Iran: Moradabad River; b, ZM-CBSU Z251, C. trutta;
151 mm SL, Iran: Asgaran River; c, C. mandica, ZM-CBSU Z212; 118 mm SL, Iran: Qareh Aghaj River.
Coloration. In ethanol: Plain yellowish, without colour pattern. In life: Dorsal and lateral head and flank
silvery, back pale grey or dark brown. Flanks with a pale and faint yellow stripe along lateral line. Ventral head and
body whitish. All fins creamy white. Pectoral- and pelvic-fin base orange or yellow and caudal-fin base dark grey
(Fig. 5).
Sexual dimorphism. Males with nuptial tubercles, absent in females. Tubercles on snout, sides of head, flank
and caudal peduncle. Few small tubercles on anal fin and base of pectoral, pelvic and caudal fins.
Distribution. Capoeta anamisensis is known from one headwater stream in the Minab River drainage and one
stream in the Hasan Langi River drainage (Fig. 9). The Minab and Hasan Langhi Rivers flow into the Strait of
Hormuz.
Etymology. Capoeta anamisensis refers to Anamis, the old name of Minab city and the Minab River. An
adjective.
Remarks. Capoeta anamisensis occurs in sympatry with C. saadii, a species closely related to C. damascina,
which is widespread in southern and central Iran (Alwan 2010; Levin et al. 2012). Capoeta anamisensis is
distinguished from C. saadii by having 21–25 gill rakers (vs. 12–17), 14–16 pectoral fin rays (vs. 17–20) and 7–8
pelvic fin rays (vs. 8–10).
All species of the C. trutta species group are strictly allopatric. The sequence divergence between these species
are very low, indicating that all are very closely related. All species of the C. trutta species group might form an
ZAREIAN ET AL.
138
·
Zootaxa 4083 (1) © 2016 Magnolia Press
evolutionary young clade but all are well diagnosed by morphological characters fulfilling the Evolutionary
Species Concept. See Mayden (2002) for a discussion and hierarchy of Species Concepts and Kottelat (1997) for
their application.
FIGURE 8. Capoeta anamisensis, ZM-CBSU Z127, 138 mm SL; last unbranched dorsal fin ray; Iran: Moradabad River.
Capoeta barroisi persica is an additional nominal name in the C. trutta species group. The identity of C. b.
persica has been already discussed by Özuluğ & Freyhof (2008), without conclusion. Capoeta b. persica was
described by Karaman (1969) based on a single individual from Lake Zarivar (Zariwar) in the River Tigris drainage
in Iran. Coad (2005) considered C. b. persica as a synonym of C. barroisi. Capoeta barroisi is endemic to the
Orontes and there are no confirmed records of that species from the Euphrates or Tigris drainages. Lake Zarivar is
strongly impacted by alien species and no Capoeta was found in the lake during a recent study (Esmaeili et al.
2011).
Since the study by Özuluğ & Freyhof (2008), we were able to examine many more individuals of C. barroisi
and C. trutta. Molecular data were published by Levin et al. (2012) and Geiger et al. (2014) as well as in this study.
Capoeta barroisi is distinguished from C. trutta by the length of the last unbranched dorsal-fin ray, which is shorter
than the head in C. barroisi (vs. longer in C. trutta). When more materials became available, individual fishes were
found in the Orontes as well as in the Tigris and Euphrates having the last unbranched dorsal-fin ray as long as the
head. In a few individuals from the Euphrates and Tigris, the last unbranched dorsal-fin ray was even shorter than
the head. One of these individuals (Genbank accession number: KU312382) could be sequenced and it grouped
together with syntopic C. trutta. One individual from the Orontes having the last unbranched dorsal-fin ray as long
as the head (Genbank accession number: KJ553267) grouped together with syntopic C. barroisi.
We conclude, that the relative length (in % HL) of the last unbranched dorsal-fin ray is overlapping and cannot
be used definitively to identify all individual fishes. The molecular differences between both ‘species’ are small
(0.57 % in COI, see Table 3) but consistent and both could be treated as a single species. However, fishes having a
long last unbranched dorsal-fin ray are rare in the Orontes (three out of about 200 individuals examined in the field
but not preserved) and fishes having a short last unbranched dorsal-fin ray are rare also in the Euphrates and Tigris
(four out of about 500 individuals examined in the field but not preserved). We treat C. trutta and C. barroisi as
Zootaxa 4083 (1) © 2016 Magnolia Press
·
139
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
separate species following the Evolutionary Species Concept (Mayden 2002), as the overlap in the length of the last
dorsal-fin ray is very small and individuals showing the character state of the other species are very rare.
The last unbranched dorsal-fin ray of the type of C. b. persica is shorter than the head (this was the principal
character by why Karaman (1969) described it as a subspecies of C. barroisi). It shows a few large brown blotches
(vs. many small black spots in C. barroisi and C. trutta). No other characters have been found to distinguish C. b.
persica from C. trutta. As only C. trutta has been confirmed from the Tigris River drainage, we identify C. barroisi
persica as an aberrant individual of C. trutta having a short last unbranched dorsal-fin ray and also an aberrant
colour pattern (see Özuluğ & Freyhof 2008 for details).
FIGURE 9. Iran: Moradabad River, type locality of C. anamisensis.
Comparative material.
Capoeta barroisi: FSJF 2455, 3, 127–168 mm SL; Turkey: Antakya prov.: Lake Kırıkhan Gölbaşı, River Orontes
drainage.—ZMH H4119, holotype of C. b. persica, about 187 mm SL; Iran: Lake Zariwar at Mariwan, 120 km
west of Sannandaj.—FSJF 2364, 2, 79, 155 mm SL; Turkey: Gaziantep prov.: River Karasu below Tahtaköprü
dam, 3651'7.20"N 3641'9.60"E.—FSJF 2704, 2, 126–202 mm SL; Syria: Lake Qattinah south east of Homs,
34°39'43''N 36°37'06''E.
Capoeta erhani: IUSHM 36400-106, 11, 72–109 mm SL; Turkey: Kahramanmaraş prov.: stream Çelik at road
south of Gölbaşı, 3737'25.80"N 3730'12.6"E.—FSJF 2456, 3, 143–170 mm SL; Turkey: Kahramanmaraş prov.:
stream Geçit on road from Kahramanmaraş to Andırın.—ZMH H3555, 8, 121–207 mm SL; Turkey:
Kahramanmaraş prov.: River Aksu 12 km south of Maraş [Kahramanmaraş].
Capoeta mandica: FSJF 2457, 5, 68–120 mm SL; Iran: Fars prov.: stream Rudbal south of Firuz Abad,
2841'60"N 5238'27"E 45’’E.—ZM-CBSU Z212-217, 6, 83–118 mm SL; Iran: Fars prov.: Qareh Aghaj River at
Kavar, 29°10'55.10"N 52°41'32.80"E.—ZM-CBSU Z235-245, 11, 82–130 mm SL; Iran: Fars prov.: Qareh Aghaj
River at Kuohmareh Sorkhi, 29°23'39.8"N 52°09'49.1"E.—ZM-CBSU Z246-254, 9, 92–108 mm SL; Iran: Fars
prov.: Kol River at Estahban, Eij, 28°58'16.8"N 54°23'25.8"E.—ZM-CBSU K983, 1, 99 mm SL; Iran: Bushehr
prov.: Mond River at Shonbeh, Darvishi Bridge, 28°17'46.1"N 51°47'02.90"E.
ZAREIAN ET AL.
140
·
Zootaxa 4083 (1) © 2016 Magnolia Press
Capoeta trutta: FSJF 2557, 1, 85 mm SL; Turkey: Adıyaman prov.: stream Eğri south of Adıyaman, tributary
to Atatürk reservoir, 3744'30"N 3820'6.48"E.—FSJF 2589, 19, 82–143 mm SL; IUSHM 27800-109, 9, 67–105
mm SL; Turkey: Adıyaman prov.: stream Çakal, 13 km west of Adıyaman, tributary to Atatürk reservoir,
3743'20.52"N 3809'55.20"E.—FSJF 2868, 1, 139 mm SL; Turkey Batman prov.: Tigris River 5 km west of
Hasankeyf, 3743'25.68"N 4121'37.80"E.—FSJF 2930, 1, 132 mm SL; Turkey: Gaziantep prov.: stream Merziman
at Bağtepe, 3743'20.52"N 3809'55.20"E.—ZM-CBSU E100-123, 23, 50–149 mm SL; Iran: Kermanshah prov.:
Gamasiab River, 34°23'31.0"N 47°42'57.5"E.—ZM-CBSU C453-164, 11, 67–177 mm SL; Iran: Khuzestan prov.:
Maroon River at Aghajari, 30°44'52.46"N 49°54'59.57"E.—ZM-CBSU Z251, 1, 151 mm SL, Iran: Kurdistan
prov.: Asgaran River at Asgaran; 35°05'07.1"N 46°55'21.5"E.
Capoeta turani: IUSHM 36300-100, holotype, 146 mm SL; IUSHM 36300-101, 9 paratyples, 107–151 mm
SL; FSJF 2356, 8, 105–129 mm SL, Turkey: Adana prov.: stream Çatkıt, south of Salbaş, lower part of River
Pozantı,3705'46.20"N 3507'1.20"E.—IUSHM 36300-94, 10, 74–91 mm SL; stream Üçürge at Karakuyu, a
tributary to Seyhan reservoir north of Adana, 3708'18.6"N 3508'31.8"E.—IUSHM 36300-105, 3, 43–67 mm SL;
stream Körkün at Karakuyu, a tributary to Seyhan reservoir north of Adana, 3709'10.44"N 35 09'38.22"E.
Capoeta saadii: ZM-CBSU Z136-146, 11, 78–121 mm SL; Iran: Fars prov.: Ghadamgah spring, Kor River at
Doroodzan, 30°15'11.4"N 54°25'32.2"E.—FSJF 2216, 15, 86–120 mm SL; Iran: Hormuzgan prov.: Rudan River
about 6 km northeast of Rudan, 2728'53.70"N 5715'53.70"E.—FSJF 2221, 1, 125 mm SL; Iran: Kerman prov.:
stream Baft about 5 km north of Baft, 29°15 '11.34 "N 56°37 '41.64 "E.—FSJF 2234, 5, 83–182 mm SL; Iran:
Kerman prov.: stream west of Ostoor, about 50 km east of Sirgan, 2918'4.74"N 5613'22.74"E.—FSJF 2242, 13,
72–86 mm SL; Iran: Fars prov.: spring Golabi, 35 km north of Darab, 2847'15.3"N 5422'19.26"E.—FSJF 2243, 3,
78–123 mm SL; Iran: Fars prov.: stream Forg, about 120 km south of Darab, 2822'44.1"N 5512'47.7"E.—FSJF
2250, 9, 155–192 mm SL; Iran: Fars prov.: Kor River about 73 km north of Shiraz, 3011'37.08"N 5227'56.7"E.—
FSJF 2251, 3, 128–191 mm SL; Iran: Fars prov.: spring Pirbanoo, about 10 km south of Shiraz, 2931'08.1"N
5227'55.98"E.
Material used in the molecular genetic analysis.
Capoeta aculeata: ZM-CBSU M1436-1437; Iran: Fars prov.: Kor River at Kamfirouz; 30°37'15.1"N 52°02'47.5"E
(Genbank accession numbers: COI: KU312345, KU312346).
Capoeta buhsei: ZM-CBSU M1299-1300; Iran: Albourz prov.: Kordan River at Karaj, 35°57'12.5"N
56°50'18.0"E (Genbank accession number: COI: KU312349, KU312350; cyt b: U312369, KU312370).
Capoeta fusca: ZM-CBSU M795-796; Iran: South Khorasan prov.: Sharif Abad Qanat at Birjand,
32°58'08.7"N 59°17'03.4"E (Genbank accession number: COI: KU312347, KU312348; cyt b: KU312371,
KU312372).
Capoeta mandica: ZM-CBSU M823; Iran: Fars prov.: Qareh Aghaj River at Firuzabad, 28°57'32.4"N
52°33'25.8"E (Genbank accession number: COI: KU312367, KU312376).—ZM-CBSU 1435; Iran: Fars prov.:
Qareh Aghaj River at Khaneh Zenian, 29°41'13.00"N 52°05'58.60"E (Genbank accession number: COI:
KU312368; cyt b: KU312375).—ZM-CBSU M827-828; Iran: Fars prov.: Mond River at Tange Mohr, 27°31'36''N
52°51'47''E (Genbank accession numbers: COI: KU312365, KU312366).—ZM-CBSU M829; Iran: Bushehr prov.:
Mond River at Darvishi Bridge in Shonbeh, 28°17'46.1"N 51°47'02.90"E (Genbank accession number: COI:
KU312364).—ZM-CBSU M833; Iran: Fars prov.: Qareh Aghaj River at Firouz Abad, 28°57'32.4"N 52°33'25.8"E
(Genbank accession number: KU312363).
Capoeta saadii: FSJF DNA-15; Iran: Fars prov.: spring Golabii, 35 km north of Darab, 2847'15.3"N
5422'19.26"E (Genbank accession number: COI: KU312353).—FSJF DNA-18 Iran: Fars prov.: spring Pirbanoo
about 10 km south of Shiraz, 2931'08.1"N 5227'55.98"E (Genbank accession number: COI: KU312395).—FSJF
DNA-22; Iran: Fars prov.: River Kor about 73 km north of Shiraz, 3011'37.08"N 5227'56.7"E (Genbank accession
number: COI: KU312359).—ZM-CBSU M822; Iran: Fars prov.: Qareh Aghaj River at Khafr, 2907'34.9"N
5251'24.9"E (Genbank accession number: COI: KU312362; cyt b: KU312374).—ZM-CBSU M825, M831; Iran:
Fars prov.: Helleh River at Kouhmareh Sorkhi, 2923'39.08"N 5209'49.1"E (GenBank accession numbers: COI:
KU312360, KU312361; cyt b: KU312373).—ZM-CBSU M157; Iran: Fars prov.: Saadii Tomb at Shiraz,
2937'20.88"N 5234'56.04"E (Genbank accession number: COI: KU312358).—ZM-CBSU M824; Iran: Fars prov.:
Qareh Aghaj River at FirouzAbad, 2953'90.50"N 5232'39.00"E (Genbank accession number: COI: KU312357).—
Zootaxa 4083 (1) © 2016 Magnolia Press
·
141
CAPOETA ANAMISENSIS, A NEW SPECIES FROM IRAN
ZM-CBSU M826; Iran: Fars prov.: Qareh Aghaj River at Firouz Abad, 28°57'32.4"N 52°33'25.8"E (Genbank
accession number: COI: KU312356).—ZM-CBSU M830; Iran: Fars prov.: spring Tazang at NazarAbad, about
2915'56.28"N 5312'50.10"E (Genbank accession number: COI: KU312355).—ZM-CBSU M832; Iran: Fars prov.:
Qareh Aghaj River at Firouzabad, 2953'90.5"N 5232'39.0"E (Genbank accession number: COI: KU312354).
Capoeta trutta: FSJF DNA-919; 3, Turkey: Adıyaman prov.: stream Çakal, 13 km west of Adıyaman, tributary
to Atatürk reservoir, 3743'20.52"N 3809'55.20"E. (Genbank accession numbers: COI: KU312387, KU312388,
KU312389). —FSJF DNA-1433; 4, Turkey: Batman prov.: Tigris River 5 km west of Hasankeyf, 3743'25.68"N
4121'37.80"E (Genbank accession numbers: COI: KU312382, KU312383, KU312384, KU312385).—FSJF DNA-
2269; 1, Iraq: Tabin river south of Zarbi, 35°48'32''N 45°01'20''E (Genbank accession number: COI:
KU312386).—ZM-CBSU M583, Iran: Ilam prov.: Gavi River at Mehran, 33°39'18.8"N 47°02 14.8"E (Genbank
accession number: COI: KU312351).—ZM-CBSU M593, Iran: Ilam prov.: 33°38'17.5"N 47°0130.1"E (Genbank
accession number: COI: KU312352).
Capoeta turani: FSJF DNA-1308; 5, Turkey: Adana prov.: stream Çatkıt, south of Salbaş, lower part of River
Pozantı, 3705'46.20"N 3507'1.20"E (Genbank accession numbers: COI: KU312390, KU312391, KU312392,
KU312393, KU312394).
Acknowledgments
We are pleased to thank M. Özuluğ (IUSHM) and R. Thiel (ZMH) for allowing JF to examine materials under their
care, M. Geiger (ZFMK) and N. Alwan (SMF) for supporting us with sequences, A. Gholamhosseini, A. Teimori,
M. Masoudi, H. Mehraban & M. Razbani for their help during field work and G. Sayyadzadeh for her help in
photography. We also thank A. Gholamhosseini for help in sequences analysing. The research work was funded by
the Shiraz University and was approved by the Ethics Committee of Biology Department (ECBD-SU-909789) and
is a result of the FREDIE project, supported by the Leibniz Association Joint Initiative for Research and Innovation
(SAW).
Literature cited
Alwan, N. (2010) Systematics, taxonomy, phylogeny and zoogeography of the Capoeta damascina species complex (Pisces:
Teleostei: Cyprinidae) inferred from comparative morphology and molecular markers. PhD Thesis Dissertation. Frankfurt
University, Frankfurt, 264 pp.
Bianco, P.G. & Banarescu, P. (1982) A contribution to the knowledge of the Cyprinidae of Iran (Pisces, Cypriniformes).
Cybium, 6, 75–96.
Esmaeili, H.R., Gholamifard, A. & Freyhof, J. (2011) Ichthyofauna of Zarivar Lake (Tigris River basin, Iran) with the first
records of Hemiculter leucisculus and Alburnus hohenackeri in the Tigris basin. Electronic Journal of Ichthyology, 7, 1–6.
Geiger, M., Herder, F., Monaghan, M., Almada, V., Barbieri, R., Bariche, M., Berrebi, P., Bohlen, J., Casal-Lopez, M.,
Delmastro, G., Denys, G., Dettai, A., Doadrio, I., Kalogianni, E., Kärst, H., Kottelat, M., Kovacic, M., Laporte, M.,
Lorenzoni, M., Marcic, Z., Özulug, M., Perdices, A., Perea, S., Persat, H., Porcellotti, S., Puzzi, C., Robalo, J., Sanda, R.,
Schneider, M., Slechtova, V., Stumboudi, M., Walter, S. & Freyhof, J. (2014) Spatial heterogeneity in the Mediterranean
Biodiversity Hotspot affects barcoding accuracy of its freshwater fishes. Molecular Ecology Resources, 14 (6), 1210–
1221.
http://dx.doi.org/10.1111/1755-0998.12257
Hall, T.A. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series, 41, 95–98. [London]
Huelsenbeck, J.P. & Ronquist, F. (2001) MrBayes: Bayesian inference of phylogeny. Bioinformatics, 17, 754–755.
http://dx.doi.org/10.1093/bioinformatics/17.8.754
Mayden, R.L. (2002) On biological species, species concepts and individuation in the natural world. Fish and Fisheries, 3,
171–196.
http://dx.doi.org/10.1046/j.1467-2979.2002.00086.x
Kottelat, M. (1997) European freshwater fishes. An heuristic checklist of the freshwater fishes of Europe (exclusive of former
USSR), with an introduction for non-systematists and comments on nomenclature and conservation. Biologia, Bratislava,
Section. Zoology, 52 (suppl. 5), 1–271.
Kottelat, M. & Freyhof, J. (2007) Handbook of European Freshwater Fishes. Kottelat, Cornol, Switzerland and Freyhof,
Berlin, Germany. xiii + 646 pp.
ZAREIAN ET AL.
142
·
Zootaxa 4083 (1) © 2016 Magnolia Press
Levin, B.A., Freyhof, J., Lajbner, Z., Perea, S., Abdoli, A., Gaffaroğlu, M., Özulug, M., Rubenyan, H.R., Salnikov, V.B. &
Doadrio, I. (2012) Phylogenetic relationships of the algae scraping cyprinid genus Capoeta (Teleostei: Cyprinidae).
Molecular Phylogenetics and Evolution, 62, 542–549.
http://dx.doi.org/10.1016/j.ympev.2011.09.004
Machordom, A. & Doadrio, I. (2001) Evidence of a Cenozoic Betic–Kabilian Connection Based on Freshwater Fish
Phylogeography (Luciobarbus, Cyprinidae). Molecular Phylogenetics and Evolution, 18, 252–263.
http://dx.doi.org/10.1006/mpev.2000.0876
Özulug, M. & Freyhof, J. (2008) Capoeta turani, a new species of barbel from River Seyhan, Turkey (Teleostei: Cyprinidae).
Ichthyological Exploration of Freshwaters, 19, 289–296.
Posada, D. & Crandall, K.A. (1998) MODELTEST: testing the model of DNA substitution. Bioinformatics, 14, 817–818.
http://dx.doi.org/10.1093/bioinformatics/14.9.817
Stamatakis, A. (2006) RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed
models. Bioinformatics, 22, 2688–2690.
http://dx.doi.org/10.1093/bioinformatics/btl446
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis
Version 6.0. Molecular Biology and Evolution, 30, 2725–2729.
http://dx.doi.org/10.1093/molbev/mst197
Turan, D., Kottelat, M. & Ekmekci, G. (2008) Capoeta erhani, a new species of cyprinid fish from the Ceyhan River, Turkey
(Teleostei: Cyprinidae). Ichthyological Exploration of Freshwaters, 19, 263–270.
Ward, R.D., Zemlak T.S., Innes, H.B., Last, R.P. & Hebert, P.D.N. (2005) DNA barcoding Australia’s fish species.
Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 360 (1462), 1847–1857.
http://dx.doi.org/10.1098/rstb.2005.1716
Xiao, W., Zhang, Y. & Liu, H. (2001) Molecular systematics of Xenocyprinae (Teleostei: Cyprinidae): taxonomy,
biogeography, and coevolution of a special group restricted in East Asia. Molecular Phylogenetics and Evolution, 18, 163–
173.
http://dx.doi.org/10.1006/mpev.2000.0879
