ArticlePDF Available

Abstract and Figures

We describe a new species of Brachycephalus that is morphologically similar to the flea-toads B. didactylus, B. hermogenesi, and B. pulex. The new species occurs from the sea level up to 1000 m and it is widely distributed throughout southern Atlantic Forest. Brachycephalus sulfuratus sp. Nov. is distinguished from all of its congeners by the combination of the following characters: (1) small body size (SVL of adults: 7.4-8.5 mm for males and 9.0-10.8 mm for females); (2) "leptodactyliform" body; (3) pectoral girdle arciferal and less robust compared to the Brachycephalus species with "bufoniform" body; (4) procoracoid and epicoracoid fused with coracoid but separated from the clavicle by a large fenestrae; (5) toe I externally absent; toes II, III, IV, and V distinct; phalanges of toes II and V reduced; (6) skin smooth with no dermal ossifications; (7) in life, general background color brown with small dark-brown spots; skin of throat, chest, arms, and forearms with irregular yellow blotches; in ventral view, cloacal region of alive and preserved specimens surrounded by a dark-brown inverted v-shaped mark outlined with white; (8) advertisement call long, composed of a set of 4-7 highfrequency notes (6.2-7.2 kHz) repeated regularly.
Content may be subject to copyright.
40
Accepted by J. Padial: 15 Dec. 2015; published: 18 Feb. 2016
ZOOTAXA
ISSN 1175-5326 (print edition)
ISSN
1175-5334
(online edition)
Copyright © 2016 Magnolia Press
Zootaxa 4083 (1): 040
056
http://www.mapress.com/j/zt/
Article
http://doi.org/10.11646/zootaxa.4083.1.2
http://zoobank.org/urn:lsid:zoobank.org:pub:BC6C492F-57E4-4AF9-B5CA-BA74084CC6F0
A new species of flea-toad (Anura: Brachycephalidae) from southern Atlantic
Forest, Brazil
THAIS HELENA CONDEZ
1,4
, JULIANE PETRY DE CARLI MONTEIRO
1
, ESTEVÃO JASPER COMITTI
2
,
PAULO CHRISTIANO DE ANCHIETTA GARCIA
2
, IVAN BOREL AMARAL
3
& CÉLIO FERNANDO BAPTISTA HADDAD
1
1
Universidade Estadual Paulista Júlio de Mesquita Filho, Instituto de Biociências, Departamento de Zoologia, Av. 24-A, 1515, caixa
postal 199, 13506–900, Rio Claro, SP, Brazil
2
Universidade Federal de Minas Gerais, Instituto de Ciências Biológicas, Departamento de Zoologia, Laboratório de Herpetologia,
Av. Antônio Carlos, 6627, 31270–910, Belo Horizonte, MG, Brazil
3
Centro Nacional de Pesquisa e Conservação de Répteis e Anfíbios (RAN), Instituto Chico Mendes de Conservação da Biodiversidade
(ICMBio), Rua 229, 95, 74605–090, Goiânia, GO, Brazil
4
Corresponding author. E-mail: thacondez@gmail.com
Abstract
We describe a new species of Brachycephalus that is morphologically similar to the flea-toads B. didactylus, B. hermo-
genesi, and B. pulex. The new species occurs from the sea level up to 1000 m and it is widely distributed throughout south-
ern Atlantic Forest. Brachycephalus sulfuratus sp. nov. is distinguished from all of its congeners by the combination of
the following characters: (1) small body size (SVL of adults: 7.4–8.5 mm for males and 9.0–10.8 mm for females); (2)
“leptodactyliform” body; (3) pectoral girdle arciferal and less robust compared to the Brachycephalus species with “bu-
foniform” body; (4) procoracoid and epicoracoid fused with coracoid but separated from the clavicle by a large fenestrae;
(5) toe I externally absent; toes II, III, IV, and V distinct; phalanges of toes II and V reduced; (6) skin smooth with no
dermal ossifications; (7) in life, general background color brown with small dark-brown spots; skin of throat, chest, arms,
and forearms with irregular yellow blotches; in ventral view, cloacal region of alive and preserved specimens surrounded
by a dark-brown inverted v-shaped mark outlined with white; (8) advertisement call long, composed of a set of 4–7 high-
frequency notes (6.2–7.2 kHz) repeated regularly.
Key words: Brachycephalus, Psyllophryne, taxonomy
Resumo
Descrevemos uma nova espécie de Brachycephalus morfologicamente similar aos sapos-pulga B. didactylus, B. hermo-
genesi e B. pulex. A nova espécie ocorre desde o nível do mar até 1000 m de altitude e está amplamente distribuída no sul
da Mata Atlântica. Brachycephalus sulfuratus sp. nov. distingue-se das demais espécies do gênero pela combinação dos
seguintes caracteres: (1) pequeno tamanho (CRC dos adultos: 7.4–8.5 mm em machos e 9.0–10.8 mm em fêmeas); (2)
corpo “leptodactyliforme”; (3) cintura peitoral arcífera e menos robusta em comparação às espécies de Brachycephalus
cujo corpo é “bufoniforme”; (4) procoracóide e epicoracóide fusionados com o coracóide mas separados da clavícula por
uma grande fenestra; (5) artelho I externamente ausente; artelhos II, III, IV e V distintos; falanges reduzidas nos artelhos
II e V; (6) ausência de ossificação dérmica; (7) em vida, coloração geral marrom com pequenos pontos marrom escuros;
garganta, peito, braço e antebraço cobertos por manchas amarelas irregulares; em posição ventral, exemplares vivos e
preservados apresentam região cloacal circundada por mancha marrom escura com bordas brancas, em forma de v-inverti-
do; (8) canto de anúncio longo, composto por um conjunto de 4–7 notas de alta frequência (6.2–7.2 kHz) repetidas regu-
larmente.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
41
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
Introduction
The genus Brachycephalus is endemic to the Brazilian Atlantic Forest and currently comprises 29 species (Frost
2015). Species of Brachycephalus are leaf-litter dwellers and exhibit extremely small adult body sizes, with snout-
vent length usually less than 18 mm (Pombal 1999; Clemente-Carvalho et al. 2011). Due to their miniaturization,
species of Brachycephalus share several morphological characteristics, such as the loss of phalanges; a reduced
number of functional fingers and toes; the loss of bones in the skull such as the neopalatine and columellae;
coracoids, clavicle, and scapula completely ossified; and a gradient in the degree of mineralization of the skull and
post-cranial skeleton (Izecksohn 1971; Pombal et al. 1998; Yeh 2002; Clemente-Carvalho et al. 2009).
Most species of Brachycephalus have restricted distributions along the main mountain ranges of the Atlantic
Forest, occurring at elevations of 600 to 1800 m (Clemente-Carvalho et al. 2011; Condez et al. 2014; Ribeiro et al.
2015). These species have generalized bufoniform morphology, most of them have conspicuous orange coloration,
and, in some cases, the skin containing toxic tetrodotoxin-like substances (Sebben et al. 1986; Pires et al. 2002,
2005; Hanifin 2010). Three species of Brachycephalus are known as flea-toads: B. didactylus (Izecksohn 1971), B.
hermogenesi (Giaretta & Sawaya 1998), and B. pulex (Napoli, Caramaschi, Cruz & Dias 2011); these species
exhibit “leptodactyliform” body, dull inconspicuous coloration, and the ability to jump longer distances (Verdade et
al. 2008; Napoli et al. 2011). In addition, these species have the smallest body sizes within Brachycephalus, with B.
didactylus and B. hermogenesi being considered among the ten smallest vertebrates in the world (Rittmeyer et al.
2012). These species have wide geographical and elevational ranges, occurring from sea level up to 1000 m at
several localities in the States of Paraná, São Paulo, Rio de Janeiro, Espírito Santo, and Bahia (Izecksohn 1971;
Giaretta & Sawaya 1998; Verdade et al. 2008; Oliveira et al. 2011; Oliveira et al. 2012). All of those characteristics
have been used to support a morphological distinction of the flea-toads from all the other species within
Brachycephalus (Verdade et al. 2008; Napoli et al. 2011).
Brachycephalus didactylus and B. hermogenesi were originally described under the no longer recognized
genus Psyllophryne. These two genera are now considered synonyms based on the shared omosternum in pectoral
girdle (Kaplan 2002). Molecular evidence also supports the synonymy, since flea-toads have found nested among
other species of Brachycephalus (Clemente-Carvalho et al. 2011; Padial et al. 2014).
Herein, we describe a new species of Brachycephalus that is morphologically similar to the flea-toads B.
didactylus, B. hermogenesi, and B. pulex. The new species is widely distributed in southern Atlantic Forest and its
diagnosis is based on external morphology, osteology of adults, and advertisement call.
Material and methods
Specimens were collected, anaesthetized and killed in 5% lidocaine, fixed in 10% formalin, and preserved in 70%
ethyl alcohol. Bone and cartilage were cleared and double-stained with alizarin red and alcian blue following
procedures modified from Taylor & Van Dyke (1985). Specimens used in the description are deposited in the Célio
F. B. Haddad (CFBH) amphibian collection, Departamento de Zoologia, I.B., Universidade Estadual Paulista, Rio
Claro, São Paulo, Brazil, and amphibian collection of Centro de Coleções Taxonômicas do Instituto de Ciências
Biológicas da Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, Minas Gerais, Brazil.
For morphometrics, a single person (T.H. Condez) took 14 measurements with a micrometric ocular fitted to a
stereomicroscope. The abbreviations are: SVL (snout–vent length); HL (head length; from tip of snout to angle of
jaw); HW (head width; greatest width of head located between angle of jaw); ND (nostril diameter); IND
(internostril distance; between inner margins of nostrils); ED (eye diameter); IOD (interorbital distance; between
anterior corners of eyes); END (eye–nostril distance; from anterior corner of the eye to posterior margin of nostril);
THL (thigh length); TBL (tibia length); FL (foot and tarsus length; from the longest toe to centrale plus tarsus
length); UAL (upper arm length); FAL (forearm length); and HAL (hand length; between the centrale and the
longest finger). Except for FL, which is modified to include tarsus length, all of these measurements follow
Duellman (1970), Cei (1980), and Heyer et al. (1990). These measures were chosen because they are informative
and currently adopted by taxonomists working with this group of species. To evaluate sexual dimorphism we tested
differences in body size between males and females using the Welch’s T-test in the R environment (R Development
Core Team 2015). Specimens examined are presented in the Appendix 1. For detailed comparisons of color in life
CONDEZ ET AL.
42
·
Zootaxa 4083 (1) © 2016 Magnolia Press
we analyzed the type series of the new species and 11 live specimens of B. hermogenesi from Picinguaba,
município de Ubatuba, State of São Paulo and Estação Biológica de Boracéia, município de Salesópolis, State of
São Paulo.
Calling males were recorded with a Marantz PMD-660 digital recorder coupled to an external unidirectional
Sennheiser ME-66 microphone. We analyzed 10–20 calls per individual using a sampling frequency rate of 44.1
kHz and 16-bit resolution in the mono pattern. Bioacoustic analyses were performed using the program Raven Pro
1.4 (Bioacoustics Research Program 2011). Audiospectrograms were produced with a fast Fourier transform of 256
points, overlap 50%, and hamming window type. Eleven advertisement call parameters were quantified using the
program: call duration (s); duration of the interval between calls (s); number of notes per call (notes/call); note
repetition rate (notes/s); note duration (ms); number of pulses per note (pulses/note); pulse repetition rate (pulses/
s); pulse duration (ms); and minimum, maximum, and dominant frequency (Hz).
We obtained tissue samples from five individuals of distinct populations of the new species (Appendix 2). We
extracted total genomic DNA from muscle samples conserved in 100% ethanol using the DNeasy extraction kit
(Qiagen, Valencia, CA, USA). For comparisons, we used a fragment of the 16S ribosomal RNA gene (746 bp) due
to the availability of sequences of this gene for other species of Brachycephalus. We performed polymerase chain
reactions (PCR) using PCR Master Mix (Fermentas) and the primers 12SM (GGCAAGTCGTAACATGGTAAG)
and 16SA (ATGTTTTTGGTAAACAGGCG), previously published in Darst & Cannatella (2004). Thermocycling
conditions for DNA amplification began with a denaturation at 94
o
C (5 min), followed by 35 cycles consisting of
denaturation at 94
o
C (1 min), annealing at 60–61
o
C (1 min), extension at 72
o
C (1 min), and a final step at 72
o
C
following the final cycle (5 min). PCR products were visualized in 1% agarose gels and purified using Exonuclease
and Shrimp Alkaline Phosphatase (Affimetrix/USB, Cleveland, OH). Sequencing (forward and reverse) was
performed by Macrogen Inc. (Seoul, Korea). Chromatograms were fully inspected, embedded primer sequences
were deleted, and forward and reverse strands were compared before assembling consensus sequences with
CodonCode Aligner 3.5 (Codon Code Corporation). We aligned sequences using ClustalW (Thompson et al. 1994)
in BioEdit software (Hall 1999).
We used the sequences obtained in this study in a phylogenetic analysis with the available sequences of 14
other Brachycephalus species, previously studied by Clemente-Carvalho et al. (2011) and Padial et al. (2014). Our
main objective was to test the congruence of molecular data with other evidence in grouping different and
geographically distant populations into a single species, an uncommon pattern within Brachycephalus, in which the
majority of the species is known only from the type locality (Clemente-Carvalho et al. 2015). We used
Ischnocnema parva (Girard 1853) to root the trees since the recent molecular studies have established Ischnocnema
as the sister group of Brachycephalus (Hedges et al. 2008; Pyron & Wiens 2011; Canedo & Haddad 2012; Padial et
al. 2014). Phylogenetic trees were obtained using maximum parsimony (MP). We used TNT 1.1 (Goloboff et al.
2008) with the implicit enumeration option and 1000 Jacknife replicates (Farris et al. 1996). All parameters for this
analysis were left at their default settings. The resulting topology was edited in Winclada (Nixon 1999–2002).
Additionally, we calculate the uncorrected pairwise genetic distances (p-distance) among individuals of the new
species and the morphologically related species (B. hermogenesi) using Mega 6 (Tamura et al. 2013). The number
of base differences between sequences was calculated considering the complete deletion of gaps and missing data.
Specimens used in molecular analyses and GenBank accession numbers are in the Appendix 2.
Description of the new species
Brachycephalus sulfuratus sp. nov.
Figures 1–3
Holotype. CFBH 39137, adult female, collected at Centro de Estudos e Pesquisas Ambientais da Univille, Vila da
Glória, Distrito do Saí (26°13'39"S, 48°41'31"W, 123 m above sea level, Datum WGS 84), município de São
Francisco do Sul, State of Santa Catarina, Brazil, on 14 November 2014, by T.H. Condez, J.P.C. Monteiro, and E.J.
Comitti.
Paratypes. CFBH 39138, cleared and double-stained adult male, and CFBH 39139, adult male, both collected
with the hotolype. CFBH 39140, adult female collected on 11 September 2014, CFBH 39329, adult female, and
Zootaxa 4083 (1) © 2016 Magnolia Press
·
43
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
CFBH 39331, adult male, collected on 31 July 2015, CFBH 39330 and 39332, adult females, collected on 01
August 2015, at the same locality as the holotype, by J.P.C. Monteiro and E.C. Nardin. CFBH 39142, adult male,
CFBH 39141 and 39144, adult females, CFBH 39143, cleared and double-stained adult male, collected on 04
December 2013, by T.H. Condez, J.P.C. Monteiro and E.J. Comitti, UFMG 17954 and 17955, adult females, CFBH
39407–39410 and UFMG 17956 and 17957, adult males, CFBH 39406, juvenile, collected on 28 August 2015, by
J.P.C. Monteiro and E.C. Nardin, at Morro do Cantagalo, Vila da Glória, Distrito do Saí (26°10'31"S, 48°42'44"W,
161 m above sea level, Datum WGS 84), município de São Francisco do Sul, State of Santa Catarina, Brazil. CFBH
39145–39147, adult females, collected at Castelo dos Bugres, Área de Proteção Ambiental Dona Francisca
(26°13'43"S, 49°03'27"W, 835 m above sea level, Datum WGS 84), município de Joinville, State of Santa Catarina,
Brazil, on 29 November 2013, by T.H. Condez, J.P.C. Monteiro, E.J. Comitti, I. Borel, P.D. Pinheiro, and P.C.A.
Garcia. CFBH 39148 and 39149, adult males, collected at Parque Estadual da Ilha do Cardoso (25°06'53"S,
47°55'40"W, 385 m above sea level, Datum WGS 84), município de Cananéia, State of São Paulo, on 19 December
2013, by T.H. Condez, L.N. Bandeira, and S. Pinheiro. CFBH 39150, adult female, collected at Morro do
Anhangava (25°22'51"S, 49°01'26"W, 915 m above sea level, Datum WGS 84), município de Quatro Barras, State
of Paraná, on 02 February 2012, by T.H. Condez, T.B. Rocha, and P.F. Colas-Rosas.
Referred specimens. MZUSP 129855, juvenile, collected at Ilha do Cardoso (non-georeferenced data),
município de Cananéia, State of São Paulo, on 22 January 1979, by an unknown collector. ZUEC 16602, juvenile,
collected at Área de Proteção Ambiental de Guaratuba (25°47’ S, 48°54’ W, 291 m above sea level), município de
São José dos Pinhais, State of Paraná, on 18 January 2008, by A.K. Cunha and I. Soares.
FIGURE 1. Adult female of Brachycephalus sulfuratus sp. nov. in life. (A) Lateral and (B) ventral views. Holotype, CFBH
39137, from Centro de Estudos e Pesquisas Ambientais da Univille, Vila da Glória, distrito do Saí, município de São Francisco
do Sul, State of Santa Catarina, Brazil. SVL 9.8 mm. (Photo by T.H. Condez, 14 November 2014).
Diagnosis. Brachycephalus sulfuratus sp. nov. is a new species of flea-toad, distinguished from all its
congeners by the following combination of characters: (1) small body size (SVL of adults: 7.4–8.5 mm for males
and 9.0–10.8 mm for females); (2) “leptodactyliform” body; (3) pectoral girdle arciferal and less robust compared
to the Brachycephalus species with “bufoniform” body; (4) procoracoid and epicoracoid fused with coracoid but
separated from the clavicle by a large fenestrae; (5) toe I externally absent; toes II, III, IV, and V distinct; phalanges
of toes II and V reduced; (6) skin smooth with no dermal ossifications; (7) in life, general background color brown
with small dark-brown spots; skin of throat, chest, arms, and forearms with irregular yellow blotches; in ventral
view, cloacal region of alive and preserved specimens surrounded by a dark-brown inverted v-shaped mark
outlined with white; (8) advertisement call long, composed of a set of 4–7 high-frequency notes (6.2–7.2 kHz)
repeated regularly.
CONDEZ ET AL.
44
·
Zootaxa 4083 (1) © 2016 Magnolia Press
FIGURE 2. Preserved adult female of Brachycephalus sulfuratus sp. nov. in (A) dorsal and (B) ventral views. Holotype,
CFBH 39137. Scale bar 2 mm.
FIGURE 3. Adult female of Brachycephalus sulfuratus sp. nov. Holotype, CFBH 39137. (A) Dorsal and (B) lateral views of
head, (C) ventral view of left hand and (D) ventral view of left foot.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
45
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
Description of holotype. The holotype of Brachycephalus sulfuratus sp. nov. has a “leptodactyliform” body
(Figure 1 and 2); head wider than long, narrower than body; head length approximately 26% of SVL; snout long,
with length slightly short than the eye diameter, rounded in lateral and dorsal views (Figure 3A and 3B); nostrils
protuberant, directed anterolaterally; canthus rostralis distinct and straight; loreal region weakly concave; mouth
nearly sigmoid; eye slightly protruding in dorsal and lateral views, eye diameter 48% of HL; tympanum absent;
tongue longer than wide, posterior half not adherent to floor of mouth; choanae relatively small and round;
vomerine odontophores absent. Upper arm slightly shorter than forearm; length of upper arm plus forearm 43% of
SVL; hands approximately as long as upper arm; fingers II and III thin and distinct; finger I and IV very small,
vestigial; tip of fingers II and III slightly pointed; relative lengths of fingers II < III; metacarpal tubercles present,
outer large and rounded, inner thin and elongated; subarticular tubercles undefined in hand (Figure 3C). Tibia
shorter than thigh; total leg length 85% of SVL; foot length larger than thigh length; toe I externally absent; toes II,
III, IV, and V distinct; toes II and V reduced; tip of toes II and V slightly rounded, tip of toes III and IV pointed;
relative length of toes V< II < III < IV; metatarsal tubercles present, both oval, outer slightly larger than inner;
subarticular tubercles undefined in foot (Figure 3D). Skin smooth without dermal ossifications (Figure 2).
Measurements of holotype (in mm). SVL 9.8; HL 2.5; HW 2.7; ND 0.4; IND 1.0; ED 1.2; IOD 1.9; END 0.8;
THL 4.3; TBL 4.1; FL 6.3; AL 2.0; FAL 2.3; HAL 1.8.
Color of holotype in life. Dorsal coloration grey to brown covered with dark brown and red spots (Figure 1A).
The dark brown spots are concentrated on the head and medial portion of the dorsum, in which a large irregular
mark is distinguishable. The interorbital area exhibits a dark brown nearly v-shaped mark. Dorsal surfaces of arms
and legs exhibit dark brown blotches, which on the thigh and tibia resemble incomplete stripes. Above the cloacal
region, in dorsal view, there is a dark brown inverted m-shaped mark. A dark brown stripe extends laterally from
the tip of the snout to the flanks and the surface of thigh (Figure 1A). In lateral view, the tip of the snout and
posterior regions of maxilla and ocular globe present undefined yellow spots. The maxilla is dark brown with
distinct white spots. Ventral surface of body pale-brown, slightly transparent, with small dark brown spots and
white blotches (Figure 1B). Some yellow blotches are also spread among the gular region, arms, forearms, and
disposed in an inverted v-shape on the chest. In ventral view, the cloacal region is surrounded by an inverted v-
shaped dark brown mark with white borders. The pupil is black and the iris is golden.
Color of holotype in preservative. General background color is pale-brown covered with small dark brown
dots (Figure 2); dorsum with dark brown marks on the ocular region, knees, and cloacal region; dark brown stripes
on dorsal surfaces of thigh, tibia, and foot; ventral surfaces of hands and feet with dark brown blotches; in ventral
view, cloacal region surrounded by an inverted v-shaped dark-brown mark.
Osteology. The cleared and double-stained material revealed the following characters in Brachycephalus
sulfuratus sp. nov. No hyperossification of the skull or skeleton. Nasals, sphenethmoid, frontoparietals, prootics,
and exoccipitals fused. Premaxillae broad, not fused medially; odontoids absent; alary process of premaxillae
distinct and separated from the nasal. Maxillae arched in ventral view; odontoids present. Quadratojugal and
pterygoid present. Vomer not fused medially, vomerine odontophores absent. Palatine absent. Parasphenoid and
sphenethmoid fused and robust. Squamosal elongated in lateral view, zygomatic ramus short and not ornamented.
Tympanic annulus absent. Mandible edentate. Pectoral girdle arciferal and less robust than in other
Brachycephalus; clavicle, coracoid, and scapula fused and completely ossified; procoracoid and epicoracoid fused
with coracoid, but separated from the clavicle by a large fenestrae; suprascapula expanded, anterior half ossified as
cleithrum; omosternum present and cartilaginous; sternum absent. Vertebral column composed of eight presacral,
non-imbricate vertebrae; hyperossification absent in the spinal processes of vertebrae; all presacral vertebrae with
transverse processes; transverse process of sixth presacral vertebra elongated but not ornamented. Humerus slightly
shorter than forearm; radius and ulna fused but distinguishable. Manus with distal carpals (I–IV) fused with
centrale; radiale and ulnare about the same size; one prepollical element; phalangeal formula 1–2–3–1; tips of
terminal phalangeal element of fingers I and IV falciform and tip of finger II and III pointed. Hindlimbs with tibia
and fibula fused but distinguishable, forming the tibiafibula; tibiafibula slightly shorter than femur; tibiale and
fibulare fused at their distal and proximal ends (medially not fused). Pes with distal tarsal element I, II, III present
and IV–V absent; centrale present. One very reduced prehallical element present; phalangeal formula 1–2–3–4–1;
tips of terminal phalangeal elements of toes I and V rounded; tips of the terminal phalangeal elements of toes II, III,
and IV arrow-shaped.
CONDEZ ET AL.
46
·
Zootaxa 4083 (1) © 2016 Magnolia Press
Advertisement call. The advertisement call of the new species is long, composed by the regular repetition of
five or six high-frequency pulsed notes (Figure 4). The call lasts 1.5–2.3 seconds (x
̄=1.8±0.2) and the interval
between calls is 3.1–7.4 seconds (x
̄=5.1±1.4). The call is composed of 4–7 notes (x
̄=5.3±0.9), repeated in a rate of
0.1–0.3 notes/second (x
̄=0.2±0.0). Notes last 131–233 milliseconds (x
̄=195±13) and present 7–11 pulses
(x
̄=8.8±1.3). Pulses last 20–30 milliseconds (x
̄=23.6±4.8) and are repeated at a rate of 6.1–12.3 pulses/second
(x
̄=9.3±1.8). The minimum frequency is 4.5–5.5 kHz (x
̄=4.9±0.3), the maximum frequency is 8.2–10.3 kHz
(x
̄=9.3±0.3), and the dominant frequency is 6.2–7.2 kHz (x
̄=6.7±0.3).
Va ri at io n . Morphometric variation is given in Table 1. In our sample, females are larger than males (SVL of
females x
̄=9.9 mm±0.4; SVL of males x
̄=8.0 mm±0.4, Welch’s t-test t = 10.2, df = 9.6, p < 0.01).
TABLE 1. Measurements in millimeters of the adults of type series of Brachycephalus sulfuratus sp. nov. Measurements
abbreviations are listed in the Material and Methods.
The dorsal pattern in life varies from gray or pale cream to dark and reddish-brown (Figure 5). Some
specimens have an irregular dark-brown mark on the middle of the dorsum (Figure 5C, E, and G). Some specimens
have two circular dark brown blotches on the dorsal region of the pelvic girdle (Figure 5E), sometimes continuing
the dark stripes of the thigh, tibia, and tarsus. The dark brown inverted m-shaped mark above the cloacal region
varies in size and darkness from individual to individual. The lateral dark-brown stripe is always present but can be
very noticeable (Figure 5C) or slightly distinct (Figure 5E). In addition to yellow blotches in lateral view, some
specimens also have red blotches on the dorsal surfaces of limbs (Figure 5C and 5G). The general ventral pattern is
brown, varying in the amount of white, yellow, and red blotches. The inverted v-shaped mark in the chest can be
discrete (Figure 5H) or dark brown accompanied by yellow and white blotches (Figure 5B, 5D, and 5F). In ventral
view, some individuals present the inverted v-shaped mark around the cloacal region, clearly distinguishable as
dark brown with white outline (Figures 5B and 5D), while in other specimens this mark is just slightly distinct
(Figure 5H).
We found slight structural and temporal differences in the advertisement call parameters among the three
analyzed localities, which are most probably related to intraspecific variation (Table 2). On average, the
advertisement calls of males from Castelo dos Bugres are longer when compared to the other two populations (p <
0.01, F = 12.86, TukeyHSD tests p = 0.02 and p < 0.01, respectively) and males from Parque Estadual da Ilha do
Cardoso had higher values on dominant and maximum frequencies (p < 0.01, F = 31, TukeyHSD tests p < 0.01). In
spite of these differences, the main call structure of B. sulfuratus sp. nov. is preserved and the range of divergent
call parameters overlapped among the analyzed populations (Table 2).
Males (n = 13) Females (n = 13)
x
̄SD Range x
̄SD Range
SVL 8.0 0.4 7.4–8.5 9.9 0.4 9.0–10.8
HL 2.1 0.1 2.0–2.3 2.5 0.1 2.3–2.8
HW 2.4 0.2 1.9–2.7 2.9 0.3 2.4–3.8
ND 0.3 0.0 0.3–0.3 0.4 0.0 0.3–0.4
IND 1.0 0.0 0.9–1.0 1.1 0.0 1.0–1.1
ED 1.1 0.1 1.0–1.2 1.2 0.1 1.1–1.4
IOD 1.7 0.1 1.6–1.9 2.0 0.1 1.9–2.3
END 0.7 0.1 0.6–0.7 0.8 0.1 0.7–0.9
THL 3.9 0.2 3.6–4.2 4.6 0.2 4.2–4.9
TBL 3.5 0.1 3.4–3.8 4.2 0.2 3.8–4.5
FL 5.5 0.3 4.9–6.0 6.4 0.3 6.0–7.0
UAL 1.7 0.1 1.5–1.8 2.0 0.1 1.8–2.1
FAL 2.0 0.1 1.7–2.1 2.3 0.1 2.1–2.3
HAL 1.5 0.1 1.4–1.7 1.8 0.1 1.6–1.9
Zootaxa 4083 (1) © 2016 Magnolia Press
·
47
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
FIGURE 4. Advertisement call of Brachycephalus sulfuratus sp. nov, voucher specimen CFBH 39148, recorded at Parque
Estadual da Ilha do Cardoso, município de Cananéia, State of São Paulo, 19 December 2013, 14:25 p.m., air temperature 25°C,
air relative humidity 87%. (A) Oscillogram (above) and spectrogram (below) of three consecutive calls, (B) oscillogram
(above) and spectrogram (below) of one call composed by the repetition of six notes, and (C) oscillogram (above) and
spectrogram (below) of one pulsed note.
CONDEZ ET AL.
48
·
Zootaxa 4083 (1) © 2016 Magnolia Press
FIGURE 5. Color variation in Brachycephalus sulfuratus sp. nov. (A) Dorsolateral and (B) ventral views of CFBH 39148,
adult male, from município de Cananéia, State of São Paulo. (C) Dorsolateral and (D) ventral views of CFBH 39142, adult
male, from município de São Francisco do Sul, State of Santa Catarina. (E) Dorsolateral and (F) ventral views of CFBH 39138,
adult male, from município de São Francisco do Sul, State of Santa Catarina. (G) Dorsolateral and (H) ventral views of CFBH
39145, adult female, from município de Joinville, State of Santa Catarina.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
49
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
TABLE 2. Numerical parameters of the advertisement call of Brachycephalus sulfuratus sp. nov. from: (A) Centro de
Estudos e Pesquisas Ambientais da Univille, Vila da Glória, distrito do Saí, município de São Francisco do Sul, State of
Santa Catarina, Brazil (4 individuals, 35 calls and 168 notes analyzed); (B) Castelo dos Bugres, Área de Proteção
Ambiental Dona Francisca, município de Joinville, State of Santa Catarina, Brazil (2 individuals, 17 calls and 96 notes
analyzed); (C) Parque Estadual da Ilha do Cardoso, município de Cananéia, State of São Paulo, Brazil (5 individuals, 43
calls and 221 notes analyzed). For each parameter we present the x
̄ ± standard deviation, followed by minimum and
maximum values in brackets.
continued.
Comparisons with other species. Brachycephalus sulfuratus sp. nov. shares the diminutive size and reduced
number of functional toes with other species of Brachycephalus. The texture of the skin of the head and dorsum of
B. sulfuratus sp. nov. is smooth, and without dermal ossification. This characteristic distinguishes the new species
from B. ephippium, B. garbeanus, and B. margaritatus, all of which have the largest SVLs in the genus (pers.
observation) and the most extreme condition of hyperossification, as revealed by the presence of a dorsal bony
shield (Clemente-Carvalho et al. 2009). Brachycephalus sulfuratus sp. nov. also differs from B. alipioi, B.
atelopoide, B. bufonoides, B. crispus, B. guarani, B. nodoterga, B. pitanga, B. vertebralis and B. toby, species with
intermediate condition of hyperossification of the skull and skeleton (Clemente-Carvalho et al. 2009; Haddad et al.
2010; Pombal 2010; Clemente-Carvalho et al. 2012; Condez et al. 2014). The lack of hyperossification is shared
among the new species and B. auroguttatus, B. boticario, B. brunneus, B. didactylus, B. ferruginus, B.
fuscolineatus, B. hermogenesi, B. izecksohni, B. leopardus, B. mariaterezae, B. olivaceus, B. pernix, B. pombali, B.
pulex, B. quiririensis, B. tridactylus, and B. verrucosus (Clemente-Carvalho et al. 2009; Napoli et al. 2011; Ribeiro
et al. 2015; Pie & Ribeiro 2015). Except for B. didactylus, B. hermogenesi, B. pulex, and B. sulfuratus sp. nov., all
of these species have a “bufoniform” body and in most of them the body background color is orange. The flea-
toads, B. didactylus, B. hermogenesi, B. pulex, and B. sulfuratus sp. nov., have the smallest SVLs within the genus,
a “leptodactyliform” body, and a brown general background color (pers. observation). The main morphological
differences among these species are related to the loss of phalangeal elements and the reduced number of toes.
Brachycephalus sulfuratus sp. nov. has the toe I externally absent and toes II, III, IV, and V distinct and functional.
This condition is very distinct from B. pulex, which presents toes I, II, and V absent, and toes III and IV distinct and
functional (Napoli et al. 2011). Brachycephalus didactylus is easily distinguished from B. sulfuratus sp. nov. by
having toe I absent, toes II, III, and IV distinct and functional, and toe V vestigial (Izecksohn 1971). Toes of B.
hermogenesi have the same configuration as B. sulfuratus sp. nov. (see Giaretta & Sawaya 1998). According to the
original description of B. hermogenesi the tip of toe II is pointed, which could be considered distinct from the new
species. However, after analyzing several individuals of both species we conclude that this character is variable
(being rounded or slightly pointed) and not informative.
The general color of Brachycephalus sulfuratus sp. nov. in life and preservative is very distinct from all
Call (s) Interval (s) Notes/call Notes/s Note (ms) Pulses/ note
A 1.7±0.1 4.5±1.7 4.9±0.4 0.2±0.1 177±12 8.25±0.8
(1.5–1.8) (3.1–7.4) (4–6) (0.2–0.3) (131–205) (7–9)
B 2.2±0.1 5.9±0.8 5.6±0.6 0.2±0.1 202±14 8.5±1.5
(2.1–2.3) (5.2–6.7) (5–7) (0.1–0.2) (180–233) (7–10)
C 1.8±0.1 5.2±1.2 5.1±0.5 0.2±0.1 206±10 9.4±1.2
(1.7–2.1) (3.7–7.0) (4–6) (0.1–0.2) (171–228) (8–11)
Pulses/s Pulse (ms) Min Freq (Hz) Max Freq (Hz) Dom Freq (Hz)
A 9.1±0.9 25±5 4.9±0.3 9.1±0.2 6.6±0.1
(8.5–10.7) (20–30) (4.5–5.2) (9.0–9.4) (6.5–6.7)
B 7.6±1.4 20±0 5.1±0.4 8.2±0.0 6.4±0.2
(6.1–9.0) (20–20) (4.7–5.5) (8.2–8.2) (6.2–6.6)
C 10.1±1.9 24±5 5.0±0.3 9.9±0.3 6.9±0.2
(7.7–12.3) (20–30) (4.5–5.4) (9.4–10.3) (6.7–7.2)
CONDEZ ET AL.
50
·
Zootaxa 4083 (1) © 2016 Magnolia Press
currently known species of Brachycephalus, except for the flea-toads B. didactylus, B. hermogenesi, and B. pulex.
These species exhibit a brown general body color with variable dorsal and ventral patterns of dark ornamentation
(Izecksohn 1971; Giaretta & Sawaya 1998; Napoli et al. 2011). The m-shaped mark around the cloacal opening in
dorsal view, the ventral inverted v-shaped mark in the chest, and variable patterns of stripes on the legs are shared
among the four species.
The new species differs from B. didactylus, B. hermogenesi, and B. pulex by having (in life) yellow blotches on
the ventral surfaces of the throat, chest, arms, and forearms. Another small differences among the flea-toads relate
to the x-shaped dorsal mark, which is diagnostic for B. pulex (Napoli et al. 2011) and can be slightly visible in B.
didactylus (Izecksohn 1971) and some B. hermogenesi specimens (Giaretta & Sawaya 1998). In the specimens of
B. sulfuratus sp. nov. the irregular mark on the middle of the dorsum and the two circular dark blotches on the
dorsal view of pelvic girdle are coincident with the x-shaped dorsal mark, though in this species this mark is not
clearly distinguished. Another remarkable feature of the new species is the singular inverted v-shaped mark around
the cloacal region in ventral view (Figure 6A), which is not clearly distinguishable in B. pulex (Napoli et al. 2011)
and generally rounded and not ornamented in B. didactylus (Izecksohn 1971) and B. hermogenesi (Giaretta &
Sawaya 1998; Figure 6C). The ornamented marks around the cloacal region of B. sulfuratus sp. nov. are usually
sharper when compared to B. hermogenesi (Figure 6). The m-shaped mark around the cloacal opening, which is
dark and defined in B. sulfuratus sp. nov. (Figure 6B), is present but not clearly defined in B. hermogenesi (Figure
6D).
The main structure of the advertisement call of B. sulfuratus sp. nov. is exceptional within Brachycephalus. It
differs greatly from B. ephippium, B. pitanga, and B. crispus because it is composed of a set of 4–7 high-frequency
notes (dominant frequency = 6.7 kHz), repeated regularly. In B. ephippium, B. pitanga, and B. crispus, the
advertisement call is short and simple, characterized by one low-frequency note (dominant frequencies around 5.0
kHz) with 5–20 pulses (Pombal et al. 1994; Araújo et al. 2012; Condez et al. 2014). In the same way, the
advertisement call of B. sulfuratus sp. nov. also differs from that of B. tridactylus, which is composed of a set of 1–
3 lower frequency notes (dominant frequency = 4.8 kHz) with 1–3 pulses (Garey et al. 2012). The advertisement
call of B. hermogenesi is the most similar to the new species, being quite similar in frequency (dominant frequency
= 6.8 kHz), which are the highest recorded for the genus. However, the advertisement call of B. hermogenesi can be
simple or composed of 2–7 shorter notes with 1–3 pulses (Verdade et al. 2008).
FIGURE 6. Ornamented marks in the cloacal region of Brachycephalus sulfuratus sp. nov. and the morphologically related
species Brachycephalus hermogenesi. (A) Ventral view highlighting the inverted v-shaped mark and (B) detail of the cloacal
opening in B. sulfuratus sp. nov. (CFBH 39332). (C) Ventral view and (D) detail of the cloacal opening in B. hermogenesi
(AAGUFU 0181). Scale bar 2mm.
Zootaxa 4083 (1) © 2016 Magnolia Press
·
51
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
Natural history. Specimens were found amidst the leaf-litter in ombrophilous forests. In spite of the wide
geographic and elevational distribution, specimens were found in very similar environmental conditions. All
localities are remnants of primary forests in coastal mountain ranges and a dense layer of roots and leaf-litter
generally covers the forest floor. All captured specimens were found in the rainy season, during the day, at air
temperatures of 20–26°C. Males were found calling under the leaf-litter on cloudy and rainy days. The
reproductive activity seems to occur throughout the year.
Distribution. The new species occurs in the States of São Paulo, Paraná, and Santa Catarina and it is
apparently widely distributed, occurring from the sea level up to 1000 m (Figure 7).
FIGURE 7. Distribution of Brachycephalus sulfuratus sp. nov. along the States of São Paulo (SP), Paraná (PR), and Santa
Catarina (SC), Brazil. The star represents the type-locality at município de São Francisco do Sul (SC) and circles represent the
paratypes occurrence. The referred specimen from São José dos Pinhais (PR), not included as paratype, is represented by the
triangle.
Etymology. The specific name sulfuratus refers to the adjective derived from the Latin word sulfur, for the
chemical element. The adjective is used in reference to the yellow-lemon blotches on the pectoral skin of the new
species.
Molecular analysis. The implicit enumeration search resulted in two most parsimonious trees of 842 steps,
conflicting only in the internal relationships among B. sulfuratus sp. nov. specimens and the position of B. alipioi
within the group of species that present the intermediate condition of hyperossification (B. alipioi, B. pitanga, B.
vertebralis, B. nodoterga, and B. toby). Our topology is congruent with the previous phylogenetic hypotheses in
recovering two major sister clades (Figure 8; see Clemente-Carvalho et al. 2011; Padial et al. 2014). One clade is
composed of species distributed in southern Atlantic Forest (B. izecksohni, B. brunneus, B. ferruginus, B. pombali,
and B. pernix), and the other is composed of species from northern Atlantic Forest (B. didactylus, B. ephippium, B.
garbeanus, B. alipioi, B. nodoterga, B. pitanga, B. vertebralis, and B. toby). The flea-toads B. didactylus, B.
CONDEZ ET AL.
52
·
Zootaxa 4083 (1) © 2016 Magnolia Press
hermogenesi, and B. sulfuratus sp. nov. were not recovered as a clade. Brachycephalus didactylus is nested among
the species from the second major clade, while the position of B. hermogenesi and B. sulfuratus sp. nov. was not
resolved. The populations of the new species are clustered in a monophyletic group. Despite of the uncertainty of
the position of B. hermogenesi, the genetic distances between this species and B. sulfuratus sp. nov. range from
0.169–0.170 (average = 0.170, SD = 0), corroborating the distinction between these two species. We found also
low genetic distances among the analyzed specimens of B. sulfuratus sp. nov., with maximum values
corresponding to 0.001 between the specimen from Parque Estadual da Ilha do Cardoso and the other three
specimens.
FIGURE 8. Topology of one of the two most parsimonious trees (of 842 steps) for the genus Brachycephalus. Branch lengths
correspond to the number of unambiguous parsimony transformations. Numbers close to nodes are Jackknife absolute
frequencies. Nodes without values indicate frequencies above 70%. See Appendix 2 for DNA sequences included in this
analysis.
Remarks. Brachycephalus has been a target species for herpetological surveys of mountainous areas in the
Atlantic Forest due to its restricted geographic distribution and the extraordinary number of species that are
expected to be discovered (Ribeiro et al. 2015; Pie & Ribeiro 2015). Even so, the diminutive size, inconspicuous
color and discrete habits of flea-toads, seem to have hampered a better understanding of their species diversity.
Interestingly, and unlike most other known species within this genus, flea-toads can be widely distributed.
Brachycephalus didactylus and B. hermogenesi are known from more than five localities (see Appendix 1), and
cover a wide elevational gradient ranging from the sea level up to 1000 m (Izecksohn 1971; Pimenta et al. 2007;
Verdade et al. 2008; Oliveira et al. 2012). In the same way, B. sulfuratus sp. nov. is known from six localities and
its distribution also covers a wide elevational gradient. Brachycephalus pulex, the northernmost species, is an
exception among flea-toads, being known only from type locality at 840 meters above sea level (Napoli et al.
2011).
Despite recent advances in the taxonomy of Brachycephalus, the knowledge of the natural history and
distribution of most species is still rudimentary. Advertisement calls are available for only six species (Condez et
al. 2014), to which we added the distinctive call of B. sulfuratus sp. nov. We also analyzed variation in temporal
and spectral parameters among populations of the new species, which will provide useful comparative data for
future taxonomic work. Besides the data provided herein for the new species, analyses of intraspecific variation in
osteology, external morphology, and gene sequences, in species of Brachycephalus with spatially discontinuous
Zootaxa 4083 (1) © 2016 Magnolia Press
·
53
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
distribution had only been provided for B. ephippium (Clemente-Carvalho et al. 2008) and B. nodoterga
(Clemente-Carvalho et al. 2015).
Acknowledgements
We are grateful to E.C. Nardin, L.N. Bandeira, P.D. Pinheiro, P.F. Colas-Rosas, S.C.P. Pinheiro and T.B. Rocha for
assistance in fieldwork, and L.R. Malagoli for assistance in the laboratory. We thank A.T. Silva, J. Zina and S.C.P.
Pinheiro for invaluable information about specimens from Ilha do Cardoso. We are indebted to J. Somera for the
line drawings. We thank Ministério do Meio Ambiente (SISBIO 23501–1/2010), Fundação Florestal de São Paulo
(COTEC 011.074/2010) and Instituto Ambiental do Paraná (IAP 384/2012) for the collecting permits. We also
thank UNIVILLE for allowing access to the study area and providing lodging at CEPA Rugendas and Vila da
Glória. We thank the Ecology & Evolutionary Biology Lab at Cornell University and Centro de Estudos de Insetos
Sociais (CEIS/UNESP/Rio Claro) for providing molecular laboratory facilities. We also thank A.A. Giaretta, H.
Zaher, J.P. Pombal Jr. and L.F. Toledo for allowing access to preserved specimens under their care. We are grateful
to Idea Wild for financial support for fieldwork. We thank J. Padial, J.P. Pombal Jr. and the anonymous reviewer for
the valuable comments in the earlier version of this manuscript. T.H. Condez was supported by scholarships
#141716/10–0 and #201033/2012–7 from Conselho Nacional de Desenvolvimento Científico e Tecnológico
(CNPq). C.F.B. Haddad thanks grant #2013/50741–7 from São Paulo Research Foundation (FAPESP) and CNPq
for financial support.
References
Araújo, C.B., Guerra, T.J., Amatuzzi, M.C.O. & Campos, L.A. (2012) Advertisement and territorial calls of Brachycephalus
pitanga (Anura: Brachycephalidae). Zootaxa, 3302, 66–67.
Bioacoustics Research Program (2011) Raven Pro: interactive sound analysis software, Version 1.4. The Cornell Lab of
Ornithology, New York, USA. Available from http://www.birds.cornell.edu/raven (accessed 8 July 2015)
Canedo, C. & Haddad, C.F.B. (2012) Phylogenetic relationships within anuran clade Terrarana, with emphasis on the
placement of Brazilian Atlantic rainforest frogs genus Ischnocnema (Anura: Brachycephalidae). Molecular Phylogenetics
and Evolution, 65 (2), 610–620.
https://dx.doi.org/10.1016/j.ympev.2012.07.016
Cei, J.M. (1980) Amphibians of Argentina. Monitore Zoologico Italiano (Nuova Serie) Monographs, 2, 1–609.
Clemente-Carvalho, R.B.G., Monteiro, L.R., Bonato, V., Rocha, H.S., Pereira, G.R., Oliveira, D.F., Lopes, R.T., Haddad,
C.F.B., Martins, E.G. & Reis, S.F. (2008) Geographic variation in cranial shape in the pumpkin toadlet (Brachycephalus
ephippium): a geometric analysis. Journal of Herpetology, 42 (1), 176–185.
Clemente-Carvalho, R.B.G., Antoniazzi, M.M., Jared, C., Haddad, C.F.B, Alves, A.C.R., Rocha, H.S., Pereira, G.R., Oliveira,
D.F., Lopes, R.T. & Reis, S.F. (2009) Hyperossification in miniaturized toadlets of the genus Brachycephalus (Amphibia:
Anura: Brachycephalidae): microscopic structure and macroscopic patterns of variation. Journal of Morphology, 270 (11),
1285–1295.
https://dx.doi.org/10.1002/jmor.10755
Clemente-Carvalho, R.G.B., Klaczo, J., Perez, I., Alves, A.C.R, Haddad, C.F.B. & Reis, S.F. (2011) Molecular phylogenetic
relationships and phenotypic diversity in miniaturized toadlets, genus Brachycephalus (Amphibia: Anura:
Brachycephalidae). Molecular Phylogenetics and Evolution, 61, 79–89.
https://dx.doi.org/10.1016/j.ympev.2011.05.017
Clemente-Carvalho, R.B.G., Giaretta, A.A., Condez, T.H., Haddad, C.F.B. & Reis, S.F. (2012) A new species of miniaturized
toadlet, genus Brachycephalus (Anura: Brachycephalidae), from the Atlantic Forest of southeastern Brazil.
Herpetologica, 68, 365–374.
http://dx.doi.org/10.1655/HERPETOLOGICA-D-11-00085.1
Clemente-Carvalho, R.B.G., Perez, S.I., Tonhati, C.H., Condez, T.H., Sawaya, R.J., Haddad, C.F.B. & Reis, S.F. (2015)
Boundaries of morphological and molecular variation and the distribution range of a miniaturized froglet, Brachycephalus
nodoterga (Anura: Brachycephalidae). Journal of Herpetology. [in press]
Condez, T.H., Clemente-Carvalho, R.B.G., Haddad, C.F.B. & Reis, S.F. (2014) A new species of Brachycephalus (Anura:
Brachycephalidae) from the highlands of the Atlantic Forest, southeastern Brazil. Herpetologica, 70 (1), 89–99.
https://dx.doi.org/10.1655/HERPETOLOGICA-D-13-00044
Darst, C.R. & Cannatella, D.C. (2004) Novel relationships among hyloid frogs inferred from 12S and 16S mitochondrial DNA
sequences. Molecular Phylogenetics and Evolution, 31 (2), 462–475.
CONDEZ ET AL.
54
·
Zootaxa 4083 (1) © 2016 Magnolia Press
https://dx.doi.org/10.1016/j.ympev.2003.09.003
Duellman, W.E. (1970) The hylids frogs of Middle America. Monograph of the Museum of Natural History, The University of
Kansas, 1–753.
Farris, J.S., Albert, V.A., Kallersjo, M., Lipscomb, D. & Kluge, A.G. (1996) Parsimony jackknifing outperforms neighbor-
joining. Cladistics, 12, 99–124.
https://dx.doi.org/10.1111/j.1096-0031.1996.tb00196.x
Frost, D.R. (2015) Amphibian species of the world: an online reference. Version 6.0. American Museum of Natural History,
New York, USA. Available from http://research.amnh.org/herpetology/amphibia/index.html (accessed 18 August 2015)
Garey, M.V., Lima, A.M.X., Hartmann, M.T. & Haddad, C.F.B. (2012) A new species of miniaturized toadlet, genus
Brachycephalus (Anura: Brachycephalidae), from southern Brazil. Herpetologica, 68 (2), 266–271.
https://dx.doi.org/10.1655/HERPETOLOGICA-D-11-00074.1
Giaretta, A.A. & Sawaya, R.J. (1998) Second species of Psyllophryne (Anura: Brachycephalidae). Copeia, 1998, 985–987.
https://dx.doi.org/10.2307/1447345
Goloboff, P., Farris, J. & Nixon, K. (2008) TNT, a free program for phylogenetic analysis. Cladistics, 24, 774–786.
https://dx.doi.org/10.1111/j.1096-0031.2008.00217.x
Haddad, C.F.B., Alves, A.C.R., Clemente-Carvalho, R.B.G. & Reis, S.F. (2010) A new species of Brachycephalus from the
Atlantic Rain Forest in São Paulo state, southeastern Brazil (Amphibia: Anura: Brachycephalidae). Copeia, 2010, 410–
420.
https://dx.doi.org/10.1643/CH-09-102
Hall, T. (1999) BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.
Nucleic Acids Symposium Series, 41, 95–98.
Hanifin, C.T. (2010) The chemical and evolutionary ecology of tetrodotoxin (TTX); toxicity in terrestrial vertebrates. Marine
Drugs, 8, 577–593.
https://dx.doi.org/10.3390/md8030577
Hedges, S.B., Duellman, W.E. & Heinicke, M.P. (2008) New World direct-developing frogs (Anura: Terrarana): molecular
phylogeny, classification, biogeography, and conservation. Zootaxa, 1737, 1–182.
Heyer, W.R., Rand, A.S., Cruz, C.A.G., Peixoto, O.L. & Nelson, C.E. (1990) Frogs of Boracéia. Arquivos de Zoologia, 31, 231–
410.
Izecksohn, E. (1971) Novo gênero e nova espécie de Brachycephalidae do estado do Rio de Janeiro, Brasil. Boletim do Museu
Nacional, Rio de Janeiro, nova série, Zoologia, 280, 1–12.
Kaplan, M. (2002) Histology of the anteroventral part of the breast-shoulder apparatus of Brachycephalus ephippium
(Brachycephalidae) with comments on the validity of the genus Psyllophryne (Brachycephalidae). Amphibia-Reptilia, 23
(2), 225–227.
Napoli, M.F., Caramaschi, U., Cruz, C.A.G. & Dias, I.R. (2011) A new species of flea-toad, genus Brachycephalus Fitzinger
(Amphibia: Anura: Brachycephalidae), from the Atlantic rainforest of southern Bahia, Brazil. Zootaxa, 2739, 33–40.
Nixon, K.C. (1999–2002) WinClada, v. 1.00.08. Ithaca, New York, USA. Available from: http://www.cladistics.com/
wincDownload.htm (accessed 10 July 2015)
Oliveira, A.K.C., Oliveira, I.S., Hartmann, M.T., Da Silva, N.R. & Toledo, L.F. (2011) Amphibia, Anura, Brachycephalidae,
Brachycephalus hermogenesi (Giaretta and Sawaya, 1998): new species record in the State of Paraná, southern Brazil and
geographic distribution map. Checklist, 7 (1), 17–18.
Oliveira, J.C.F., Coco, L., Pagotto, R.V., Pralon, E., Vrcibradic, D., Pombal, J.P. Jr. & Rocha, C.F.D. (2012) Amphibia, Anura,
Brachycephalus didactylus (Izecksohn, 1971) and Zachaenus parvulus (Girard, 1853): Distribution extension. Checklist, 8
(2), 242–244.
Padial, J.M., Grant, T. & Frost, D.R. (2014) Molecular systematics of terraranas (Anura: Brachycephaloidea) with an
assessment of the effects of alignment and optimality criteria. Zootaxa, 3825 (1), 1–132.
https://dx.doi.org/10.11646/zootaxa.3825.1.1
Pie, M.R. & Ribeiro, L.F. (2015) A new species of Brachycephalus (Anura: Brachycephalidae) from the Quiriri mountain range
of southern Brazil. PeerJ, 3, e1179.
https://dx.doi.org/10.7717/peerj.1179
Pimenta, B.V.S, Bérnils, R.S. & Pombal, J.P. Jr.(2007) Amphibia, Anura, Brachycephalidae, Brachycephalus hermogenesi:
Filling gap and geographic distribution map. Notes on Geographic Distribution. Checklist, 3 (3), 277–279.
Pires, O.R. Jr., Sebben, A., Schwartz, E.F., Largura, S.W.R., Bloch, C. Jr., Morales, R.A.V. & Schwartz, C.A. (2002)
Occurrence of tetrodotoxin and its analogues in the Brazilian frog Brachycephalus ephippium (Anura: Brachycephalidae).
Tox icon , 40, 761–766.
https://dx.doi.org/10.1016/S0041-0101(01)00279-3
Pires, O.R. Jr., Sebben, A., Schwartz, E.F., Morales, R.A.V., Bloch, C. Jr. & Schwartz, C.A. (2005) Further report of the
occurrence of tetrodotoxin and new analogues in the anuran family Brachycephalidae. Toxicon, 45, 73–79.
https://dx.doi.org/10.1016/j.toxicon.2004.09.016
Pombal, J.P. Jr., Sazima, I. & Haddad, C.F.B. (1994) Breeding behavior of the pumpkin toadlet, Brachycephalus ephippium
(Brachycephalidae). Journal of Herpetology, 28, 516–519.
https://dx.doi.org/10.2307/1564972
Zootaxa 4083 (1) © 2016 Magnolia Press
·
55
NEW BRACHYCEPHALUS FROM SOUTHERN ATL ANTIC FOREST
Pombal, J.P. Jr., Wistuba, E.M. & Bornschein, M.R. (1998) A new species of brachycephalid (Anura) from the Atlantic Rain
Forest of Brazil. Journal of Herpetology, 32, 70–74.
https://dx.doi.org/10.2307/1565481
Pombal, J.P. Jr. (1999) Oviposição e desenvolvimento de Brachycephalus ephippium (Spix) (Anura, Brachycephalidae).
Revista Brasileira de Zoologia, 16, 967–976.
Pombal, J.P. Jr. (2010) A posição taxonômica das "variedades" de Brachycephalus ephippium (Spix, 1824) descritas por
Miranda-Ribeiro, 1920 (Amphibia, Anura, Brachycephalidae). Boletim do Museu Nacional, Nova Serie, Zoologia, 526, 1–
12.
Pyron, R.A. & Wiens, J.J. (2013) Large-scale phylogenetic analyses reveal the causes of high tropical amphibian diversity.
Proceedings of the Royal Society B, 280 (1770), 20131622.
https://dx.doi.org/10.1098/rspb.2013.1622
R Development Core Team (2015) R: A language and environment for statistical computing. R Foundation for Statistical
Computing, Vienna, Austria. Available from http://www.R-project.org (accessed 1 June 2015)
Ribeiro, L.F., Bornschein, M.R., Belmonte-Lopes, R., Firkowski, C.R., Morato, S.A.A. & Pie, M.R. (2015) Seven new
microendemic species of Brachycephalus (Anura: Brachycephalidae) from southern Brazil. PeerJ, 3, e1011.
https://dx.doi.org/10.7717/peerj.1011
Rittmeyer, E.N., Allison, A., Gründler, M.C., Thompson, D.K. & Austin, C.C. (2012) Ecological guild evolution and the
discovery of the world's smallest vertebrate. PLoS one, 7 (1), e29797.
https://dx.doi.org/10.1371/journal.pone.0029797
Sebben, A., Schwartz, C.A., Valente, D. & Mendes, E.G.A. (1986) Tetrodotoxin-like substance found in the Brazilian frog
Brachycephalus ephippium. Tox i c o n, 24, 799–806.
https://dx.doi.org/10.1016/0041-0101(86)90105-4
Tamura, K., Stecher, G., Peterson, D., Filipski, A. & Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis
Version 6.0. Molecular Biology and Evolution 30, 2725–2729.
https://dx.doi.org/10.1093/molbev/mst197
Taylor, W.R. & Van Dyke G.C. (1985) Revised procedures for staining and clearing small fishes and other vertebrates for bone
and cartilage study. Cybium, 9, 107–119.
Thompson, J.D., Higgins, D.G. & Gibson, T.J. (1994) ClustalW: improving the sensitivity of progressive multiple sequence
alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic acids research,
22 (22), 4673–4680.
http://dx.doi.org/10.1093/nar/22.22.4673
Verdade, V.K., Rodrigues, M.T., Cassimiro, J., Pavan, D., Liou, N. & Lange, M. (2008) Advertisement call, vocal activity, and
geographic distribution of Brachycephalus hermogenesi (Giaretta & Sawaya, 1998) (Anura, Brachycephalidae). Journal
of Herpetology, 42 (3), 542–549.
http://dx.doi.org/10.1670/07-287.1
Yeh, J. (2002) The effect of miniaturized body size on skeletal morphology in frogs. Evolution, 56, 628–641.
http://dx.doi.org/10.1111/j.0014-3820.2002.tb01372.x
APPENDIX 1. Specimens of Brachycephalus examined for morphological analyses.
Brachycephalus didactylus—CFBH 32636–32640, MNRJ 58974, 66733, 66735–66737, 66746, 66749, 66755, 66759, 66766,
Serra das Torres, município de Atílio Vivacqua, State of Espírito Santo; MNRJ 31201, 49294–49296, 49298, 55475, 59361,
59362, 70585, 70586, Ilha Grande, município de Angra dos Reis, State of Rio de Janeiro; MNRJ 54402, 54403, 69868, 69875,
69877, 69880, 69884, 69891–69893, Parque Estadual dos Três Picos, município de Cachoeiras de Macacu, State of Rio de
Janeiro; MNRJ 53231, 53232, 55473, 55474, 57736, 68819, 68820, 72358–72360, Reserva Ecológica do Guapiaçu, município
de Cachoeiras de Macacu, State of Rio de Janeiro; MNRJ 4062–4073, MUFV 7655, 1289, MZUSP 58319, 58320, 64810–
64812, 94620, 94621, Sacra Família do Tinguá, município de Engenheiro Paulo de Frontin, State of Rio de Janeiro; MNRJ
54600, 56556, 56157, 60980, 62841, 62842, 62856, município de Magé, State of Rio de Janeiro; MNRJ 71334, município de
Rio Claro, State of Rio de Janeiro; MNRJ 39096, 70581, Vale da Revolta, município de Teresópolis, State of Rio de Janeiro.
Brachycephalus hermogenesi—MZUSP 132257–132263, 134377, Morro Grande, município de Cotia, State of São Paulo;
MZUSP 138640–138643, Parque Estadual do Jacupiranga, município de Eldorado, State of São Paulo; MZUSP 142568,
município de Ibiúna, State of São Paulo; MZUSP 134806–134807, município de Juquitiba, State of São Paulo; AAGUFU 178–
182, município de Paraibuna, State of São Paulo; CFBH 24086, município de Peruíbe, State of São Paulo; MZUSP 138279,
município de Registro, State of São Paulo; CFBH 20125–20130, MNRJ 47932–47934, MZUSP 138347, Estação Biológica de
Boracéia, município de Salesópolis, State of São Paulo; MNRJ 18624, 18625, 18662, 18663, Fazenda Capricórnio, município
de Ubatuba, State of São Paulo; CFBH 29793–29797, MNRJ 18907, MZUSP 137218–137219, Picinguaba, município de
Ubatuba, State of São Paulo; AAGUFU 175–177, Sertão da Cutia, município de Ubatuba, State of São Paulo. Brachycephalus
pulex—CFBH 39373–39387, MNRJ 69646, Serra Bonita, município de Camacan, State of Bahia. Brachycephalus sulfuratus
sp. nov.ZUEC 16602, APA de Guaratuba, município de São José dos Pinhais, State of Paraná; MZUSP 129855, Ilha do
Cardoso, município de Cananéia, State of São Paulo.
CONDEZ ET AL.
56
·
Zootaxa 4083 (1) © 2016 Magnolia Press
APPENDIX 2. DNA sequences (16S mtDNA gene) used for molecular phylogenetic analyses. GenBank accession
numbers are in brackets.
Brachycephalus alipioi—CFBH 3566 (HQ435690), município de Vargem Alta, State of Espírito Santo, Brazil, 20°28’ S,
41°00’ W. Brachycephalus brunneus—CFBH 7905 (HQ435691), município de Campina Grande do Sul, State of Paraná,
25°23’ S, 48°83’ W. Brachycephalus didactylus—CFBH 12907 (HQ435692), município de Angra dos Reis, State of Rio de
Janeiro, 23°05’ S, 44°16’ W. Brachycephalus ephippium—CFBH 16807 (HQ435693), município de Atibaia, State of São
Paulo, 23°07’ S, 46°33’ W. Brachycephalus ferruginus—CFBH 8025 (HQ435695), município de Morretes, State of Paraná,
25°43’ S, 48°92’ W. Brachycephalus garbeanus—CFBH 16800 (HQ435694), município de Nova Friburgo, State of Rio de
Janeiro, 22°28’ S, 42°12’ W. Brachycephalus hermogenesi—CFBH 29794 (KU321531), município de Ubatuba, State of São
Paulo, 23°21’ S, 44°46’ W. Brachycephalus izecksohni—CFBH 7374 (HQ435696), município de Paranaguá, State of Paraná,
25°78’ S, 49°38’ W. Brachycephalus nodoterga—CFBH 6211 (HQ435697), município de Mairiporã, State of São Paulo,
23°42’ S, 46°65’ W. Brachycephalus pernix—CFBH 2597 (HQ435698), município de Quatro Barras, State of Paraná, 25°38’
S, 49°08’ W. Brachycephalus pitanga—CFBH 16746 (HQ435699), município de São Luis do Paraitinga, State of São Paulo,
23°20’ S, 45°08’ W. Brachycephalus pombali—CFBH 8043 (HQ435700), município de Guaratuba, State of Paraná, 25°65’ S,
48°85’ W. Brachycephalus sulfuratus sp. nov.CFBH 39141 (KU321532), município de São Francisco do Sul, State of Santa
Catarina, 26°10’ S, 48°42’ W; CFBH 39146 (KU321533), município de Joinville, State of Santa Catarina, 26°13’ S, 49°03’ W;
CFBH 39150 (KU321534), município de Quatro Barras, State of Paraná, 25°22’ S, 49°01’ W; CFBH 39149 (KU321535),
município de Cananéia, State of São Paulo, 25°06’ S, 47°55’ W. Brachycephalus toby—CFBH 23002 (HQ435701), município
de Ubatuba, State of São Paulo, 23°27’ S, 45°11’ W. Brachycephalus vertebralis—CFBH 7907 (HQ435702), município de
Ubatuba, State of São Paulo, 23°09’ S, 44°45’ W. Ischnocnema parva—No Voucher (EF493532), município de Salesópolis,
State of São Paulo, 23°31’ S, 45°50’ W.
... Finally, the B. didactylus group comprises five species of so-called flea-toads (B. didactylus, B. hermogenesi, B. pulex, B. puri, and B. sulfuratus), characterized by having a ''leptodactyliform'' body shape and cryptic coloration in brownish or grayish tones, with an X-shaped mid-dorsal mark (vestigial in B. sulfuratus and incomplete in B. puri), transverse stripes on the hind limbs, and a dark brown lateral stripe extending from the tip of the snout to the groin and anterior surface of the thigh (Izecksohn, 1971;Giaretta and Sawaya, 1998;Napoli et al., 2011;Condez et al., 2016;Almeida-Silva et al., 2021). Species assigned to the B. pernix group occur in the southern portion of the Atlantic Rainforest domain (from 258S to 278S), the B. ephippium group occurs further north (between 208S and 248S), and the B. didactylus group is comparatively more widely distributed, ranging from 158S to 268S Guimarães et al., 2017;Monteiro et al., 2018). ...
... Despite not being evident in all specimens of B. didactylus, B. hermogenesi, B. pulex, B. puri, and B. sulfuratus, a dark brown X-shaped mark on dorsum is shared among the aforementioned species and B. clarissae and distinguish these species from all others in the genus. The general yellow background color of live Brachycephalus clarissae distinguishes it from B. didactylus, B. hermogenesi, B. pulex, B. puri, and B. sulfuratus, all of which have a brown or gray general body color (Izecksohn, 1971;Giaretta and Sawaya, 1998;Napoli et al., 2011;Condez et al., 2016;Almeida-Silva et al., 2021). Brachycephalus clarissae also differs from the five aforementioned species by having markedly granular dorsal texture (smooth in the other species), toe V vestigial (distinct and functional in B. hermogenesi and B. sulfuratus), and toe II externally present (externally absent in B. pulex). ...
... Brachycephalus clarissae also differs from the five aforementioned species by having markedly granular dorsal texture (smooth in the other species), toe V vestigial (distinct and functional in B. hermogenesi and B. sulfuratus), and toe II externally present (externally absent in B. pulex). The new species further differs from B. didactylus, B. hermogenesi, B. pulex, B. sulfuratus, and B. curupira (no information on color in life is given for B. puri by Almeida-Silva et al., 2021) by having a solid black iris, with no evident delimitation from pupil (iris distinctly lighter than pupil or black with light spots in those other species; Napoli et al., 2011;Condez et al., 2016Condez et al., , 2020Ribeiro et al., 2017). ...
... Brachycephalus currently includes the pumpkin toadlets, which are the majority of the species, and the poorly known flea-toads (Condez et al. 2016). The popular name ''pumpkin toadlet'' was attributed to the bright-colored type species Brachycephalus ephippium (Pombal et al. 1994). ...
... The abbreviations for the 14 measurements adopted are SVL (snout-vent length); HL (head length; from the tip of snout to the angle of the jaw); HW (head width; greatest width of head located between the angle of the jaw); ND (nostril diameter); IND (internostril distance; between inner margins of nostrils); ED (eye diameter); IOD (interorbital distance; between anterior corners of eyes); END (eye-nostril distance; from the anterior corner of the eye to posterior margin of the nostril); THL (thigh length); TBL (tibia length); FL (foot and tarsus length; from the longest toe to the plantar plus tarsus length); UAL (upper arm length); FAL (forearm length); and HAL (hand length; between the palmar and the longest finger). Except for FL, which is modified to include tarsus length, and ND (Condez et al. 2016), the measurements follow Duellman (1970;SVL, HL, HW, ED, and TBL), Cei (1980;IOD, IND, and END), and Heyer et al. (1990;UAL, FAL, HAL, and THL). Sex of specimens was determined by the presence of vocal slits in adult males and the presence of mature oocytes in adult females. ...
... Comparisons . Additionally, the dominant frequency of the advertisement call ranging from 4.0 to 4.3 kHz (in average 4.1 6 0.06) in new species is also distinct from the described for B. darkside: 2.8-3.7 kHz (in average 3.4 6 1.8; Guimarães et al. 2017) and B. sulfuratus: 6.2-7.2 kHz (in average 6.7 6 0.3 kHz; Condez et al. 2016). ...
Article
Four species of pumpkin toadlets are currently recognized by the extreme condition of hyperossification in the skull and vertebral column within the genus Brachycephalus. In addition to their larger body size, relative to other congeneric species, Brachycephalus darkside, Brachycephalus ephippium, Brachycephalus garbeanus, and Brachycephalus margaritatus share remarkable osteological features, such as the large paravertebral plates forming an ornamented dorsal bone shield, visible through the integument. We add to the current knowledge of this group by analyzing its diversity and describing a new hyperossified species from some important Atlantic Forest remnants in southeastern Brazil, including those bordering São Paulo, the largest and most populous city in South America. The new species is diagnosed by a combination of morphological, osteological, and bioacoustic characters, with further evidence of mtDNA sequences to confirm its distinction from the other congeners. The parotic and paravertebral bone plates externally bordered with a rough and pale contour can readily distinguish the new species from the other hyperossified species within Brachycephalus. The new species is widely distributed along the Serra do Mar mountain range, including the regionally named Serra de Paranapiacaba, in elevations from 700 to 1000 m above sea level (a.s.l.), in the central coast of the state of São Paulo, southeastern Brazil. We discuss valuable morphological characters within this group of species, reinforce the need for further studies, and highlight the relevance of protected areas for biodiversity conservation in metropolitan regions.
... During the last ten years, researchers have looked deeper into these frogs' diversification and biogeography [6]. Consequently, the number of endemic Brachycephalus species increased significantly, especially with 15 species described for the last five years (e.g., B. crispus [7]; B. albolineatus [8]; B. sulfuratus [9]; B. darkside [10] do Meio Ambiente" (MMA), that also evaluates protocols for our collection and research. All collecting, holding and storage (scientific collection) procedures followed Brazilian animal care guidelines and were previously approved by the Universidade Estadual Paulista (UNESP) animal care committee (registration number CEUA IB/CLP #03/2020). ...
... While in B. vertebralis there is some internal dark pigmentation near the region of the spinal vertebrae [10]. [9,26,56,57]. The parotic plates of B. rotenbergae sp. ...
... nov. distinguishes it from Brachycephalus didactylus, B. hermogenesi, B. pulex, and B. sulfuratus, which have leptodactyliform bodies[9,26,56,57]. The bright orange overall body coloration of B. rotenbergae sp. ...
Full-text available
Article
Species of Brachycephalus has been having taxonomical issues due its morphological similarity and genetic conservatism. Herein, we describe a new species of Brachycephalus from the south Mantiqueira mountain range and semidecidual forests in the municipalities of Mogi das Cruzes, Campinas and Jundiaí, state of São Paulo, Brazil, based on an integrative approach. It can be distinguished from all species of the B. ephippium species group based on morphological characters (especially osteology and head shape), advertisement call and divergence in partial mitochondrial DNA gene sequences (16S). The new species is genetically similar to B. margaritatus and morphologically similar to B. ephippium. It can be differentiated from B. ephippium by the presence of dark faded spots on skull and post-cranial plates, presence of black connective tissue connective tissue scattered over dorsal muscu-lature, parotic plate morphology, smaller snout-vent length (adult SVL: males 13.46-15.92 mm; females 16.04-17.69 mm) and 3% genetic distance. We also present natural history data and discuss the robustness of the integrative approach, geographic distribution, genetic data, behaviour, fluorescence in ontogeny, and conservation status.
... Os recorrentes registros pontuais de distribuição de espécies (e. g. Souza-Filho et al., 2012, Passos et al., 2012, Zanette-Silva et al., 2016, Monteiro et al., 2019, as listas locais de espécies (Argáez et al., 2017, Comitti, 2017 e a descrição de novas espécies (Condez et al., 2016, Monteiro et al., 2018 corroboram com a existência de uma significativa diversidade regional. ...
... O levantamento da literatura totalizou 69 trabalhos que foram analisados quanto aos registros de ocorrência das espécies da herpetofauna. Para as espécies de anfíbios com ocorrência confirmada pela literatura e/ou possível ocorrência no Ecossistema Babitonga, foram reunidas 37 publicações incluindo dados de distribuição (Conte et al., 2005, Garcia et al., 2007, Fusinatto et al., 2008, Conte et al., 2009, Lucas & Garcia, 2011, Mott et al., 2011, Maciel et al., 2013, Monteiro et al., 2014, Zanette-Silva et al., 2016, Bornschein et al., 2019, Monteiro et al., 2019, levantamento de espécies (Lingnau, 2004, Conte & Rossa-Feres, 2006, Conte & Rossa-Feres, 2007, Lucas, 2008, STCP, 2009, Cunha et al., 2010, Armstrong & Conte, 2012, Mariotto, 2014, Argáez et al., 2017, Comitti, 2017, Grose et al., 2019, e na categoria "outros" como descrições de espécies e revisões taxonômicas por exemplo (Heyer, 1983, Izecksohn, 1993, Nunes et al., 2012, Gehara et al., 2013, Berneck et al., 2016, Condez et al., 2016, Maciel, 2016, Monteiro et al., 2018, Walker et al., 2018, Cruz et al., 2019, de Sá et al., 2019). ...
... Recentemente foram descritas duas espécies de anfíbios com localidade-tipo no município de São Francisco do Sul: o sapopulga, Brachycephalus sulfuratus (Condez et al., 2016) e o sapinho-pingo-de-ouro, B. actaeus (Monteiro et al., 2018). Brachycephalus sulfuratus se distribui nas regiões montanhosas do leste dos estados de Santa Catarina, Paraná e sul de São Paulo (Condez et al., 2016, Bornschein et al., 2019. ...
Full-text available
Article
O conhecimento sobre a fauna local fornece subsídios chave para a elaboração de estratégias e implementação de práticas de conservação. O Ecossistema Babitonga (EB), no nordeste do estado de Santa Catarina, abriga uma importante diversidade biológica, ao mes-mo tempo em que sua economia crescente tem acelerado o uso dos recursos naturais da re-gião. O presente trabalho teve como objetivo fazer uma revisão do conhecimento existente sobre a herpetofauna não marinha desta região sobre a qual existem grandes lacunas de in-formação. Foi realizada uma revisão da literatura que reuniu 69 trabalhos a fim de listar as espécies com ocorrência comprovada ou provável ocorrência no EB. Foram identificadas 128 espécies da herpetofauna, quatro estão ameaçadas de extinção em Santa Catarina, sendo que 56 espécies de anfíbios e 31 espécies de répteis são endêmicas do Bioma Mata Atlântica e a espécie Brachycephalus actaeus é endêmica do EB. Esperamos que este trabalho sinalize a importância da região para a conservação da herpetofauna em Santa Catarina e incentive futuros trabalhos que contribuam para uma gestão sustentável de seu ecossistema.
... and Fonoteca Neotropical Jacques Vielliard (FNJV; https://www2.ib.unicamp.br/fnjv/). The analyses began by the assessment of the original diagnosis of B. sulfuratus (Condez et al., 2016). We looked for the proposed diagnostic characters in museum specimens, calls, sources provided in the literature, and our own photographs of live specimens. ...
... We analyzed calls under note-centered approach (Köhler et al., 2017), as Bornschein et al. (2018 and Pie et al. (2018b). The definition of call used by Condez et al. (2016) is the one defined by Köhler et al. (2017) as note-centered approach, in which several notes emitted continuously over a period represent the call of the species, in contrast to the call-centered approach, in which each note represents a call. Remaining call terminology used were those of Bornschein et al. (2018). ...
... Our list of specimens and calls analyzed of B. sulfuratus and B. hermogenesi, per locality, is provided in Table 1 and Appendix 1. Diagnosis between Brachycephalus sulfuratus and B. hermogenesi Condez et al. (2016) indicated three morphological characters to diagnose B. sulfuratus from the very similar B. hermogenesi: (1) It "differs from… B. hermogenesi… by having (in life) yellow blotches on the ventral surfaces of the throat, chest, arms, and forearms" (Condez et al., 2016: 43, 50); (2) a more evident "singular inverted v-shaped mark around the cloacal region in ventral view", that is "generally rounded and not ornamented in… B. hermogenesi…" (Condez et al., 2016: 43, 50); and (3) the presence of an "m-shaped mark around the cloacal opening [in dorsal view], which is… not clearly defined in B. hermogenesi" (Condez et al., 2016: 50). Specimens of B. sulfuratus collected in southern São Paulo, Paraná and Santa Catarina ( Table 1) have revealed that the yellow spots on the ventral surface of this species might still be present, on the throat, chest, arms, and/or forearms, but not necessarily in all of these body parts. ...
Full-text available
Article
Background: The flea toad Brachycephalus sulfuratus was recently described from southeastern and southern Brazil. In its description, the authors overlooked previous records of flea toads that had been identified as "Brachycephalus sp. nov." and B. hermogenesi occurring in the same regions, which could suggest the possibility of up to three flea toads coexisting in southern Brazil. In addition, B. sulfuratus is characterized by substantial phenotypic variability, to an extent that compromises its current diagnosis with respect to its congener B. hermogenesi. Therefore, the current state-of-affairs regarding the geographical distribution of these two species and the identification of previously known populations is hitherto uncertain. Our goals are to reassess previous records of flea toads attributable to B. hermogenesi, B. sulfuratus and "Brachycephalus sp. nov.", considering the description of B. sulfuratus, and to review the diagnosis of B. sulfuratus. Methods: A critical analysis of the species identity of flea toad specimens attributable to B. hermogenesi, B. sulfuratus, or to a potentially undescribed species from southeastern and southern Brazil was based either on the analysis of morphology or on their advertisement calls. These analyses include our independent examinations of specimens and, when not possible, examinations of published descriptions. To allow for a consistent comparison of advertisement calls between B. hermogenesi and B. sulfuratus, we made recordings of both species, including in the type locality of the former. Results: We found that morphological and call characters originally proposed as diagnostic for B. sulfuratus in relation to B. hermogenesi vary intraspecifically. Live individuals with ventral yellow spots correspond to B. sulfuratus; individuals without yellow spots can be either B. sulfuratus or B. hermogenesi. In preservative, they are indistinguishable. Previous records of Brachycephalus sp. nov. correspond to B. sulfuratus. We propose that the reduced number of notes per call and the presence of only isolated notes in the call of B. sulfuratus, as opposed to a high number of notes per call with isolated notes and note groups in the call of B. hermogenesi, as the only diagnostic characters between them. Regarding their distributions and based in our assessment, only B. sulfuratus occurs in southern Brazil, without any overlap with B. hermogenesi. There is a narrow gap between the distributions of these species around the southeast of the city of São Paulo. Our revision also revealed that some records previously attributed to B. hermogenesi in Rio de Janeiro and north São Paulo represent a distinct, unidentified flea toad that is not B. sulfuratus. Both species occur side by side in Corcovado, São Paulo, a locality from where five paratypes of B. hermogenesi were obtained. Biogeographic events that might have led to vicariance between B. hermogenesi and B. sulfuratus are discussed.
... From B. didactylus, B. hermogenesi, B. pulex, and B. sulfuratus, B. garbeanus is distinguished by its well-developed dorsal shield, bufoniform body shape, and larger size (absence of a developed dorsal shield, leptodactyliform body shape and smallest size combined SVL 7.4-10.8 mm males and females in those species ;Izecksohn 1971;Giaretta & Sawaya 1998;Napoli et al. 2011;Condez et al. 2016). Brachycephalus garbeanus is distinguishable from species of the B. vertebralis lineage (B. ...
... Brachycephalus garbeanus call differs from that of B. sulfuratus by its shorter pulse duration, its larger note repetition rate and its lower dominant frequency (pulse duration = 20-30 ms; note repetition rate = 0.1-0.3 notes/s; dominant frequency = 6.2-7.2 kHz in the calls of B. sulfuratus, Condez et al. 2016). It is distinguished from B. hermogenesi by its shorter notes, larger number of pulses by note, larger note repetition rate, and lower dominant frequency (note duration= 200±10 ms; pulses/note= 1-2, Monteiro et al. 2018b; note repetition rate = 1.09 notes/s; dominant frequency = 6.8 ± 0.8 kHz, Verdade et al. 2008). ...
Article
Although we celebrate the centennial of Brachycephalus garbeanus’ discovery, little progress has been done on understanding this species’ biology apart from a few morphological and ecological studies, which includes its redescription based on three specimens from the type-series, microhabitat use, sexual dimorphism in body size, and feeding habits. This species is endemic to the Serra dos Órgãos Mountain range, in the state of Rio de Janeiro, southeastern Brazil. Here we redescribe B. garbeanus based on a wide sampling, including its advertisement and aggressive calls, and also the chigger mites infestation pattern. The advertisement call is longer than 25.8 s with pulsed notes series emitted at an average rate of 2.3 notes/s and 14.1 pulses/s; long inter-note interval with 320 ms; notes with distinctly short pulses (1 to 16 ms); low dominant frequency for this genus (3.0-5.4 kHz) and presence of four harmonics. This species is often parasitized by chigger mites of Hannemania, with a prevalence of infection of 67%, mainly affecting the ventral body surface. Females had a higher prevalence of parasites than males and there was no correlation found between the size of specimens and the number of parasites. Our study, provides an important and overdue taxonomical contribution, including a large amount of novel information for B. garbeanus.
... Watters et al. (2016); forearm length (FLL) corresponds to the FAL in literature for the genus (e.g. Condez et al. 2016Condez et al. , 2021Nunes et al. 2021). See Material and Methods for details. ...
Article
We describe a new species of dull-colored flea-toad, genus Brachycephalus, from the Atlantic Forest of Caparaó mountains in southeastern Brazil. The new species is characterized by its diminutive size, “leptodactyliform” body, brownish color with an inverted V-shaped dark mark on dorsum, skin smooth, hyperossification and dorsal shield absent, linea masculinea absent, Fingers I and IV vestigial, Toe I externally absent, Toe II reduced but functional, Toes III and IV with pointed tips, Toe V vestigial, and ventral color uniformly brown. It is a leaf litter dweller, known only from type locality in the humid forests on the eastern slopes of Parque Nacional do Caparaó mountains, a protected area in the states of Espírito Santo and Minas Gerais, southeastern Brazil. It is the third flea-toad occurring in the state of Espírito Santo recovered as sister to all other Brachycephalus distributed from the state of São Paulo northward in the Atlantic Forest.
... didactylus) was proposed mostly based on morphological resemblance (e.g. Clemente-Carvalho et al., 2011;Ribeiro et al., 2015;Condez et al., 2016;Monteiro et al., 2018;Condez et al., 2020). We are aware that most of these studies included only mitochondrial genes, which is inappropriate for phylogenetic relationships (see Hillis, 2019). ...
Article
Brachycephalus is a small, endemic genus of anurans that occur throughout the Brazilian Atlantic Forest. Recent analyses corroborated the monophyly of two species groups within this genus (B. ephippium and B. pernix), whereas the B. didactylus group appears to be polyphyletic. Herein, we compare and describe the skeletal system of all species from the Brachycephalus ephippium species group. We investigated diagnostic characters that are potentially useful to delimit similar species, confirmed the previously proposed genus definition and added six extra characters. We propose an osteological diagnosis for each species of the B. ephippium group, evaluating and describing intraspecific variations. Our results suggest that adults of B. ephippium group have ornamented parotic plates, ornamented post‐orbital crests, absence of quadratojugal and neopalatines, distal end of the otic ramus of squamosal expanded towards the parotic plate, reduced zygomatic ramus of the squamosals, posterolateral projection of the crista parotica, presence of ornamented spinal plates (except B. alipioi) and ornamented paravertebral plates. We highlighted the importance of including more than one specimen per species when dealing with miniaturized taxa. A comparison with other Brachycephalus species groups and with Ischnocnema was also provided. Lastly, we suggest some characters to be included in future phylogenetic analysis.
Article
Aim The diversity of brood size across animal species exceeds the diversity of most other life‐history traits. In some environments, reproductive success increases with brood size, whereas in others it increases with smaller broods. The dominant hypothesis explaining such diversity predicts that selection on brood size varies along climatic gradients, creating latitudinal fecundity patterns. Another hypothesis predicts that diversity in fecundity arises among species adapted to different microhabitats within assemblages. A more recent hypothesis concerned with the consequences of these evolutionary processes in the era of anthropogenic environmental change predicts that low‐fecundity species might fail to recover from demographic collapses caused by rapid environmental alterations, making them more susceptible to extinctions. These hypotheses have been addressed predominantly in endotherms and only rarely in other taxa. Here, we address all three hypotheses in amphibians globally. Location Global. Time period Present. Major taxa studied Class Amphibia. Methods Using a dataset spanning 2,045 species from all three amphibian orders, we adopt multiple phylogenetic approaches to investigate the association between brood size and climatic, ecological and phenotypic predictors, and according to species conservation status. Results Brood size increases with latitude. This tendency is much stronger in frogs, where temperature seasonality is the dominant driver, whereas salamander fecundity increases towards regions with more constant rainfall. These relationships vary across continents but confirm seasonality as the key driver of fecundity. Ecologically, nesting sites predict brood size in frogs, but not in salamanders. Finally, we show that extinction risk increases consistently with decreasing fecundity across amphibians, whereas body size is a “by‐product” correlate of extinction, given its relationship with fecundity. Main conclusions Climatic seasonality and microhabitats are primary drivers of fecundity evolution. Our finding that low fecundity increases extinction risk reinforces the need to refocus extinction hypotheses based on a suggested role for body size.
Article
Miniaturized amphibians of the genus Brachycephalus are phenotypically diverse. The species of Brachycephalus have bufoniform or leptodactyliform baupläne and any of three skeletal states: nonhyperossified, hyperossified without dorsal shield, and hyperossified with dorsal shield. We integrate high-resolution microcomputed tomography, geometric morphometrics, and an estimate of molecular phylogenetic relationships to investigate skull diversity in shape and size-shape space in selected species of Brachycephalus. Skull diversity amongst species of Brachycephalus can be partitioned into shape and size-shape space according to the four conditions of skeletal states-baupläne, namely, nonhyperossified leptodactyliform, nonhyperossified bufoniform, hyperossified bufoniform without dorsal shield, and hyperossified bufoniform with dorsal shield. Skull diversity in shape and size-shape space in nonhyperossified leptodactyliform species of Brachycephalus is markedly larger, when compared to skull diversity in species of the three other conditions of skeletal states-baupläne. Variation in skull shape scales with size across Brachycephalus and, therefore, can be explained by allometry. Skull diversity, baupläne, and skeletal states covary to a large extent with monophyletic lineages of Brachycephalus, as revealed by a mitochondrial DNA species tree. Nonhyperossified bufoniform species and hyperossified bufoniform species with or without dorsal shield are monophyletic lineages, as inferred from a mitochondrial DNA species tree. Nonhyperossified leptodactyliform species of Brachycephalus do not share, however, a most recent common ancestor. The nonhyperossified leptodactyliform species of Brachycephalus, due to their marked skull diversity and lack of monophyly, emerge as evolutionarily complex. Therefore, further sampling of the nonhyperossified leptodactyliform condition of skeletal states-baupläne will be necessary to further understand the evolutionary history of Brachycephalus.
Full-text available
Article
We report geographic range extensions for two anuran species, Brachycephalus didactylus (Bachycephalidae) and Zachaenus parvulus (Cycloramphidae), recorded during a short-term herpetofaunal survey carried out at mid-elevation (600-900 m) Atlantic Forest sites at the Serra das Torres mountains (21°00' S, 41°13' W), in the state of Espírito Santo, SE Brazil. These two species are reported for the first time in Espírito Santo, representing the northernmost records for both of them and raising to 135 the number of anuran species currently known to occur in the state.
Full-text available
Article
A new miniaturized toadled of the genus Brachycephalus (Anura: Brachycephalidae) is described from Serra do Quiriri in the municipality of Campo Alegre, Santa Catarina, southern Brazil. Specimens were collected from the leaf litter between from 1,263 and 1,318 m above sea level. The new species is distinguished from all its congeners by the combination of the following characters: snout-vent length 9.9-13.1 mm; skin on head and dorsum without dermal co-ossification; snout mucronate in dorsal view; dorsum rugose; general color brown, with a narrow orange vertebral stripe. The region where the new species is located is also shared with other endemic anuran species and has experienced strong anthropogenic impacts,suggesting that immediate actions should be taken to ensure their long-term preservation.
Article
Abstract- Because they are designed to produced just one tree, neighbor-joining programs can obscure ambiguities in data. Ambiguities can be uncovered by resampling, but existing neighbor-joining programs may give misleading bootstrap frequencies because they do not suppress zero-length branches and/or are sensitive to the order of terminals in the data. A new procedure, parsimony jackknifing, overcomes these problems while running hundreds of times faster than existing programs for neighbor-joining bootstrapping. For analysis of large matrices, parsimony jackknifing is hundreds of thousands of times faster than extensive branch-swapping, yet is better able to screen out poorly-supported groups.
Article
New World frogs recently placed in a single, enormous family (Brachycephalidae) have direct development and reproduce on land, often far away from water. DNA sequences from mitochondrial and nuclear genes of 344 species were analyzed to estimate their relationships. The molecular phylogeny in turn was used as the basis for a revised classification of the group. The 882 described species are placed in a new taxon, Terrarana, and allocated to four families, four subfamilies, 24 genera, 11 subgenera, 33 species series, 56 species groups, and 11 species subgroups. Systematic accounts are provided for all taxa above the species level. Two families (Craugastoridae and Strabomantidae), three subfamilies (Holoadeninae, Phyzelaphryninae, and Strabomantinae), six genera (Bryophryne, Diasporus, Haddadus, Isodactylus, Lynchius, and Psychrophrynella), and two subgenera (Campbellius and Schwartzius) are proposed and named as new taxa, 13 subspecies are considered to be distinct species, and 613 new combinations are formed. Most of the 100 informal groups (species series, species groups, and species subgroups) are new or newly defined. Brachycephalus and Ischnocnema are placed in Brachycephalidae, a relatively small clade restricted primarily to southeastern Brazil. Eleutherodactylidae includes two subfamilies, four genera, and five subgenera and is centered in the Caribbean region. Craugastoridae contains two genera and three subgenera and is distributed mainly in Middle America. Strabomantidae is distributed primarily in the Andes of northwestern South America and includes two subfamilies, 16 genera, and three subgenera. Images and distribution maps are presented for taxa above the species level and a complete list of species is provided. Aspects of the evolution, biogeography, and conservation of Terrarana are discussed.