Zykilopen, a new member of the multi-copper ferroxidase family, is expressed in multiple tissues

Full text

The Journal of Nutrition
Biochemical, Molecular, and Genetic Mechanisms
Identification of Zyklopen, a New Member of the
Vertebrate Multicopper Ferroxidase Family, and
Characterization in Rodents and Human Cells
1–3
Huijun Chen,
4,5,15
Zouhair K. Attieh,
4,6,15
Basharut A. Syed,
4,7
Yien-Ming Kuo,
8
Vale r i e S t e v e n s ,
9
Brie K. Fuqua,
4
Henriette S. Andersen,
9
Claire E. Naylor,
10
Robert W. Evans,
11
Lorraine Gambling,
9
Ruth Danzeisen,
9,12
Mhenia Bacouri-Haidar,
13
Julnar Usta,
14
Chris D. Vulpe,
4
* and Harry J. McArdle
9
4
Department of Nutritional Science and Toxicology, University of California, Berkeley, CA 94720;
5
Medical School, Nanjing University,
Nanjing 210008, Jiangsu Province, China;
6
Department of Laboratory Science and Technology, American University of Science and
Technology, Ashrafieh 1100, Lebanon;
7
Visiongain Ltd, London EC1V 2QY, UK;
8
Department of Medicine, University of California, San
Francisco, CA 94143;
9
Rowett Institute of Nutrition and Health, University of Aberdeen, Bucksburn, AB21 9SB, UK;
10
Department of
Crystallography, Birkbeck College, London, WC1E 7HX, UK;
11
Division of Biosciences, Centre for Infection, Immunity and Disease
Mechanisms, School of Health Sciences and Social Care, Brunel University, Uxbridge, Middlesex, UB8 3PH, UK;
12
International Copper
Association, Inc., New York, NY 10016;
13
Department of Biology, Faculty of Sciences, Lebanese University, Hadath 1500, Lebanon; and
14
Department of Biochemistry, School of Medicine, American University of Beirut, Beirut 1103, Lebanon
Abstract
We previously detected a membrane-bound, copper-containing oxidase that may be involved in iron efflux in BeWo cells, a
human placental cell line. We have now identified a gene encoding a predicted multicopper ferroxidase (MCF) with a
putative C-terminal membrane-spanning sequence and high sequence identity to hephaestin (Heph) and ceruloplasmin
(Cp), the other known vertebrate MCF. Molecular modeling revealed conservation of all type I, II, and III copper-binding
sites as well as a putative iron-binding site. Protein expression was observed in multiple diverse mouse tissues, including
placenta and mammary gland, and the expression pattern was distinct from that of Cp and Heph. The protein possessed
ferroxidase activity, and protein levels decreased in cellular copper deficiency. Knockdown with small interfering RNA in
BeWo cells indicates that this gene represents the previously detected oxidase. We propose calling this new member of
the MCF family “zyklopen.” J. Nutr. 140: 1728–1735, 2010.
Introduction
Multicopper ferroxidases (MCF)
16
play a central role in iron
nutrition and homeostasis in organisms ranging from yeast to
humans (1). The 2 known vertebrate MCF, ceruloplasmin (Cp)
and hephaestin (Heph), are hypothesized to facilitate iron
transport in diverse tissues by oxidizing ferrous iron to the
ferric form, which is subsequently carried by transferrin (2). In
these reactions, electrons from 2 ferrous iron are transferred
from the MCF type I copper sites to the type II/type III copper
site, where molecular oxygen is then reduced to water (3).
Without a MCF, the membrane ferrous iron exporter ferroportin
1 (Fpn1) has been shown in some cells to be targeted for
degradation, leading to decreased cellular iron efflux (4).
Heph expression is most predominant in intestinal enterocytes
and, accordingly, the major phenotype in sex-linked anemia mice
harboring a mutation in Heph is iron deficiency anemia with
marked accumulation of iron in the small intestine (5). Heph,
however, is also expressed in other tissues, including the brain,
pancreas, heart, and lungs (5–8). Cp is mainly found as a soluble
serum protein originating from the liver but is also found as
a glycosylphosphatidylinositol-linked protein in astrocytes (3).
Individuals with mutations in the Cp gene (aceruloplasminemia)
accumulate iron in multiple tissues, including the liver, pancreas,
and brain, leading to diabetes and dementia (9–11). Similarly,
targeted disruption of the Cp gene in mice results in iron
accumulation in multiple tissues (12). Importantly, however, Cp
null offspring are normal at birth, strongly suggesting that Cp is
not essential for iron efflux into the fetal circulation. Similar to
hepatic and intestinal iron transport, placental iron transfer from
the mother to the fetus requires multiple iron transport steps (13),
although the exact mechanisms of placental iron efflux are still
not resolved. Ferroxidase-mediated transport, as in other tissues,
is a likely scenario but has not yet been characterized.
1
Supported by NIH grant R01 DK056376 to C.D.V., an NSF Graduate Research
Fellowship to B.K.F., a Lebanese University Research Development grant to
M.B-H., and a Rural Affairs Research and Analysis Directorate, Scottish
Government, EU (EARNEST and NuGO) grant to H.J.M.
2
Author disclosures: H. Chen, Z. K. Attieh, B. A. Syed, Y-M. Kuo, V. Stevens,
B. K. Fuqua, H. S. Andersen, C. E. Naylor, R. W. Evans, L. Gambling, R. Danzeisen,
M. Bacouri-Haidar, J. Usta, C. D. Vulpe and H. J. McArdle, no conflicts of interest.
3
Supplemental Figures 1–4 are available with the online posting of this paper at
jn.nutrition.org.
15
These authors contributed equally to the paper.
* To whom correspondence should be addressed. E-mail: vulpe@berkeley.edu.
16
Abbreviations used: BCS, bathocuproine disulfonic acid; Cp, ceruloplasmin; E,
embryonic (gestation) day; Fpn1, ferroportin 1; GAPDH, glyceraldehyde-3-
phosphate dehydrogenase; Heph, hephaestin; MCF, multicopper ferroxidase;
pPD, p-phenylene-diamine; siRNA, small interfering RNA; SOD1, superoxide
dismutase; Zp, zyklopen.
ã2010 American Society for Nutrition.
1728 Manuscript received October 22, 2009. Initial review completed January 8, 2010. Revision accepted July 6, 2010.
First published online August 4, 2010; doi:10.3945/jn.109.117531.
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from
http://jn.nutrition.org/cgi/content/full/jn.109.117531/DC1
Supplemental Material can be found at:

We recently identified an endogenous copper-containing
oxidase that may play a role in the iron efflux process in
placental cells (14). We demonstrated that iron export from
BeWo cells, a human trophoblast choriocarcinoma model for
placenta, is not enhanced by addition of Cp under a variety of
conditions designed to mimic the environment in the fetal
circulation. We found no evidence of Cp or Heph expression
using specific cDNA probes in this cell line. Affinity-purified
anti-peptide antisera to Heph did not cross-react with any
protein in this cell line, but a polyclonal antiserum to the entire
Cp protein did detect a cross-reacting protein in BeWo cells (14).
We demonstrated that copper deficiency decreases, whereas iron
deficiency increases, expression of this protein. Additionally,
copper deficiency decreased iron efflux from BeWo cells. From
these results, we postulated that an additional multicopper
oxidase, distinct from Heph and Cp, is involved in iron export in
the placenta (15).
We noted both genomic and expressed sequences in public
databases with similar but not identical sequence to Heph and Cp.
A GenBank entry listed these sequences under a novel coding
sequence termed Hephl1, proposed to encode a multicopper
oxidase based on sequence homology to Cp and Heph. In this
report, we demonstrate that Hephl1 represents a gene encoding a
new member of the multicopper oxidase family most closely
related to Heph. We further present evidence that supports our
hypothesis that this gene represents the placental MCF, as well as
expression data suggesting that this gene plays a role in other
tissues as well. We propose that the protein be called “zyklopen”
(Zp) after the Zyklops, the mythical one-eyed iron workers in
Greek mythology who helpedHephaestus in the forge of the gods.
Materials and Methods
Molecular modeling. Comparative structural modeling of mouse Zp
was carried out using Modeler 6.0, a program that satisfies spatial
constraints extracted from alignment of target sequences with a template
(16,17). Human Cp (Protein Data Bank code 1KCW) (18), which shares
49.4% sequence identity (similarity: 65.6%) with the ectodomain of
mouse Zp, was used as the template structure as previously described for
modeling of human Heph (19).
Animals and tissue preparation. C57BL6/J mice were obtained from
Jackson Laboratory at 6–8 wk of age and fed an AIN-93M diet (20) for 6
wk before being killed, after which tissues were collected. Mice were
allowed unlimited access to food and distilled water. All mouse protocols
were in accordance with NIH guidelines and approved by the Office of
Laboratory Animal Care at the University of California, Berkeley. For
immunohistochemistry, adult 10-wk-old ICR (CD-1) mice, fed the diet
above from the time of weaning, were purchased from Charles River.
The mice were then killed and tissues were processed for immunohis-
tochemistry at the University of California, San Francisco, following
approved protocols. When required for mouse studies, timed matings
were set up to harvest E [embryonic (gestation) day] 17.5 and E18
embryos and E7 placenta. Female weanling rats of the Rowett Hooded
Lister strain were bred at the Rowett Research Institute and killed after
mating at E21.5 and placenta was removed for analysis. All rats
consumed an AIN-93M diet (20) and distilled water ad libitum and all
rat experimental procedures were approved by the Home Office and the
Ethics Committee at the Rowett Research Institute and conducted in
accordance with the UK Animals (Scientific Procedures) Act, 1986.
Enterocytes were isolated from the multiple cell types of whole
intestine, as previously described (21), for subsequent RNA, protein, and
activity analyses. Other mouse tissues were homogenized using a Tissue
Tearor homogenizer (Cole-Parmer) and cleared by centrifugation
(13,000 3g; 30 min). Placentas from 21.5-d gestation rats were snap-
frozen in liquid nitrogen and then ground with a mortar and pestle to a
fine powder.
Cultured cells. BeWo, Caco-2, MCF7, T47D, and MCF10AT cells were
obtained from the ATCC (ATCC no. CCL-98, HTB-37, HTB-22, HTB-
133, and CRL-10317). BeWo, MCF7, and T47D cells were grown in
F12K medium (catalog no. 21127–022, Invitrogen) with 10% fetal
bovine serum (Atlanta Biologicals) and 1% penicillin-streptomycin
cocktail (Invitrogen) at 378C in a humidified atmosphere of 95% air 5%
CO
2
until 70% confluent. MCF10AT cells were similarly grown, but the
medium was supplemented with 0.1 mg/L cholera toxin (Sigma), 10 mg/L
insulin (Sigma), 0.5 mg/L hydrocortisone (Sigma), and 0.02 mg/L
epidermal growth factor (Invitrogen). Caco-2 cells were grown in
DMEM (catalog no. 11960–044, Invitrogen) supplemented with 10%
fetal bovine serum, 1% nonessential amino acids (Invitrogen), 1%
penicillin-streptomycin cocktail (Invitrogen), and 1% Glutamax (Invi-
trogen) and harvested at 100% confluency for experiments.
Cell lysis. Cultured cells, mouse tissue homogenates, and enterocytes
were washed twice with ice-cold PBS and lysed in PBS containing 1.5%
Triton X-100 supplemented with protease inhibitors (catalog no.
1206893, Roche) by passage through a 27-gauge needle. For the rat
placenta, ~150 mg of powdered tissue was homogenized in 10 volumes
of 20 mmol/L HEPES, 250 mmol/L sucrose, pH 7.4, containing protease
inhibitors for 15 s using an Ultra Turrax homogenizing probe on ice. The
extracts were centrifuged at 10,000 3gfor 20 min at 48C and the
supernatants were collected. Protein concentrations were determined
using a protein assay kit (BioRad Laboratories).
Total RNA extraction, RT, and PCR. Total RNA was isolated from
mouse tissues, BeWo cells, and enterocytes using TRIzol reagent
(Invitrogen) according to the manufacturer’s protocol. Primers targeting
fragments of proposed protein-coding regions of Zp were designed using
Primer3 software (22) and ordered from Invitrogen. The sequences
(59-39) of mouse Zp primers were as follows: GGGACATCTGGAAG-
GAACAA (forward) and CTTTGAAAGTGGCATCAACA (reverse)
(954 bp expected product). Human Zp primers sequences were
AAGATTCAGAAGGAGCCCTA (forward) and CCCAGCATACCAG-
CTTGTAG (reverse) (672 bp expected product). Three micrograms of
total RNA were reverse transcribed using SuperScript II reverse
transcriptase (Invitrogen) and oligo-dT primer (Operon). PCR was
carried out using Taq DNA polymerase as directed by the supplier
(Takara). An amplification cycle of 958C for 45 s, 628C for 45 s, and
728C for 2 min was performed in a 100-mL volume. Following 35 cycles,
5mL of the reaction was removed and the product was separated and
visualized on a 1.5% agarose gel containing ethidium bromide. All
experiments were repeated independently a minimum of 3 times and
representative data are shown.
Antibodies to Zp and other proteins. Rabbit polyclonal antiserum
against the unique 15 C-terminal amino acids (AYREVQSCALPTDAL)
of Zp was generated and affinity purified (Open Biosystems). Rabbit
anti-Heph IgG (raised against QHRQRKLRRNRRSIL) was made
previously using the same protocol (21). Cp-specific IgG was from
Accurate Chemical and anti-glyceraldehyde-3-phosphate dehydrogenase
(GAPDH) IgG was from Chemicon. Peroxidase-labeled anti-mouse and
anti-rabbit secondary antibodies were obtained from Santa Cruz
Biotechnology and IR-680-conjugated anti-rabbit antibody was from
Li-Cor.
Immunoblot analysis. Extracts containing 50 mg protein from rat
placenta, mouse tissues, and human cell lines were immunoblotted as
described previously (21). Primary antibodies were used at dilutions of
1/1000 for rabbit anti-Zp, 1/2000 for rabbit anti-Heph, and 1:300 for
mouse anti-GAPDH. Secondary antibodies were 1/20,000 diluted
peroxidase-labeled anti-rabbit or anti-mouse IgG, visualized by en-
hanced chemiluminescence (Amersham) or 1/20,000 diluted IR680-
conjugated anti-rabbit IgG, visualized by an Odyssey imager (Li-Cor).
Experiments were repeated independently a minimum of 3 times and
representative data are shown.
Immunostaining for Zp in mouse tissue sections. Tissues from ICR
(CD-1) 10-wk-old mice and embryos at E17.5 were isolated and fixed for
Zyklopen, a new multicopper ferroxidase 1729
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

12–14 h in Bouins fixative (Sigma). Organs were washed in 70%
ethanol, dehydrated, embedded in paraffin, and sectioned (8 mm) as
previously described (23). Paraffin sections were dewaxed, rehydrated,
and steamed for 30 min in 1 mmol/L EDTA followed by treatment with
50 g/L hydrogen peroxide prior to staining. Sections were immunos-
tained using standard procedures with affinity-purified anti-Zp at 1:200
dilution and the VECTASTAIN Elite ABC kit (Vector Laboratories)
using the manufacturer’s protocol as previously described (24). Staining
was visualized with 3,39-diaminobenzidine (DAB substrate kit, Vector
Laboratories) and counterstained with Gills Hematoxylin (Vector
Laboratories). Controls included tissues incubated with preimmune
serum or anti-Zp serum preadsorbed with 10 mmol/L immunizing
peptide for 48 h at 408C. Sections were examined using a Nikon E800
Eclipse microscope and images captured using a Spot II digital camera.
Experiments were repeated independently a minimum of 3 times and
representative data are shown.
p-Phenylene diamine oxidase and ferroxidase activity assays. Zp
p-phenylene diamine (pPD) oxidase activity was determined with BeWo
cell lysates as previously described (25). Cleared lysates were separated
on native nonreducing, nondenaturing 4–12% Tris-glycine PAGE gels
(Invitrogen). The gels were then incubated with 0.1% pPD in 0.1 mol/L
acetate buffer, pH 5.45, for 2 h and air-dried in the dark. The
ferroxidase-specific assay differed from the pPD gel assay only in the
final step (25). The gels were placed for 2 h at 378C in a fresh solution of
0.00784% Fe(NH
4
)
2
(SO
4
)
2
×6H
2
O in 100 mmol/L sodium acetate, pH
5.0. Gels were then washed and rehydrated with 15 mmol/L ferrozine
solution in the dark. Color development was then monitored continu-
ously and quantified by scanning densitometry. Purified human Cp (Vital
Products) was used as a positive control in both assays. Experiments
were repeated independently a minimum of 3 times and representative
data are shown.
Small interfering RNA knockdown of Zp in BeWo cells. BeWo cells
were grown in 6-well plates to 30–40% confluency and then incubated
with serum-free DMEM media for 24 h prior to transfection. Cells were
then transfected with 160 pmol Stealth Select RNAi small interfering
(siRNA) (Invitrogen) set 1 (catalog no. HSS155799, GAGTTTCCTGG-
CATCTGATTGGATT), set 2 (catalog no. HSS155800, CATCCATTAT-
CATGCTGAGAGCTTT), or set 3 (catalog no. HSS155801, GGTGAT-
GTGATTGTCATTCATTTAA) using Lipofectamine RNAiMAX
(Invitrogen) according to the manufacturer’s protocol. Cells were
harvested 48–72 h post-transfection and then immunoblotted with
anti-Zp IgG and assayed for pPD oxidase activity. Immunoblotting of
cell extracts with anti-GAPDH IgG was used as a loading control.
Experiments were repeated independently a minimum of 3 times and
representative data are shown.
Bathocuproine disulfonic acid copper chelation and superoxide
dismutase activity assay. BeWo cells (1 310
5
) were seeded in 100
mm plates and grown as described. At 70% confluency the medium
was supplemented to give final concentrations of 0, 10, 20, 40, 60, 80,
and 100 mmol/L bathocuproine disulfonic acid (BCS). After 24 h, cells
were harvested by scraping. Superoxide dismutase 1 (SOD1) activity
was assayed using a SOD assay kit (Cayman Chemicals) per the
manufacturer’s instructions, as previously described (25). Briefly, cells
were collected by centrifugation at 1000 3gfor 10 min at 48C, lysed,
and centrifuged at 1500 3gfor 5 min at 48C. The protein
concentration was determined by the Bradford method (BioRad) and
then an aliquot of each cell extract was incubated with xanthine
oxidase for 20 min and absorbance measured at 450 nm. Duplicate
independent experiments to measure SOD1 activity were performed.
An aliquot of each extract (30 mg total protein/well) was also examined
by immunoblot for Zp and GAPDH. Band intensities were quantified
using densitometry with ImageJ (26) and the ratios of each band
density to the density of the 0 mmol/L BCS control were multiplied by
100, averaged, and then plotted versus the BCS concentration. Data
from 3 independent experiments were analyzed by linear regression
analysis using Prism version 5.0 for Macintosh OS X (GraphPad
Software).
Results
Identification of Zp. The zyklopen gene was initially identified
on the basis of sequence homology with Heph in the assembly of
mouse (XP_146812), rat (XP_235835), and human (XP_291947)
whole genome sequences. During the course of this study, Unigene
entries under the name HEPHL1 (Hephaestin-like 1) appeared for
mouse (Entrez GeneID 244698) (Mm.325134) and human (Entrez
GeneID 341208) (NM_001098672) as well as other species.
Zp has significant sequence similarity with Heph and Cp.
The mouse Zp sequence shares 45.9% identity (61.6% similar-
ity) with mouse Cp and 48.8% identity (66.2% similarity) with
mouse Heph at the protein level (Supplemental Fig. 1). The
identity at the nucleotide level is 56 and 59.4%, respectively.
Similar to Heph, but distinct from Cp, Zp contains a predicted
transmembrane segment near the C terminus. The C-terminal
region shares only 23% sequence identity (42.3% similarity)
with mouse Heph at the protein level; however, this increases to
47% at the nucleotide level. As can be seen from the sequence
alignment, all the residues involved in copper binding and
disulfide bond formation in Cp are conserved in Heph and Zp.
Molecular modeling of Zp. Molecular modeling of Zp
revealed remarkable structural conservation among Zp, Cp,
and Heph (Fig. 1). The likely 3D-fold of Zp, like Cp, has 6
domains organized in a triangular array (Fig. 1B). Each of the
domains exhibits plastocyanin-like folds with b-barrel strands
organized in a way reminiscent of the cupredoxin family of
redox metalloproteins, which also includes azurin, ascorbate
oxidase, and laccase (27). All of the type I, II, and III copper-
binding sites for the 6 copper ions in Cp are present in Zp (Fig.
1C). Three of the copper ions form the trinuclear metallic unit at
the interface of domains 1 and 6. The arrangement closely
resembles the one found in the ascorbate oxidase subunit and
other structures such as laccases (28,29). The other 3 copper
atoms form the mononuclear type I centers and, as in Cp, are
organized in domains 2, 4, and 6 (Fig. 1D).
Zp and Heph have type I copper centers in domain 2
distinct from Cp. The type I binding sites of blue copper
proteins, such as azurin, typically coordinate the copper ion in a
distorted tetrahedron or trigonal pyramid arrangement. Three of
the ligands (2 histidines and a cysteine) are arranged in a plane
around the copper ion and the 4th, a weak and more distal
ligand (normally a methionine), forms the pyramid apex. These
type I sites are normally seen in Long Range Energy Transfer
pathway proteins where the ligand arrangement is an interme-
diate between that normally seen for Cu
+
(tetrahedron) and Cu
2+
(distorted Jahn-Teller or square planar), thus facilitating elec-
tron transfer by providing a stable environment for both Cu
+
and Cu
2+
. In human Cp, 2 of the 3 type I centers conform to this
typical arrangement (copper 4 and 6 in domains 2 and 4),
whereas the 3rd type I site in domain 2 is a tricoordinate copper
site lacking the apex methionine, which has been mutated to a
nonmetal binding leucine residue in the equivalent position
(18,30) (Supplemental Fig. 2A). One of the striking disparities
between Zp and Cp, therefore, is the difference in this domain 2
copper-binding site. As is the case with Heph, this site in Zp has
the additional methionine residue (M356) that would be able to
coordinate the copper ion at this site and thus constitute a typical
type I copper environment. In Zp and Heph, the domain 2
binding sites are analogous to the ones in domains 4 and 6
(Supplemental Fig. 2B).
1730 Chen et al.
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

Zp has a predicted iron binding site. In the Cp structure,
additional atypical labile metal ion binding sites were identified
close to 2 of the 3 mononuclear sites (Cu 42 and 62) in domains
4 and 6, respectively (31). These may be involved in the
ferroxidase activity of Cp. Supplemental Figure 3 shows the
putative iron-binding site of Zp corresponding to the domain 6
labile site in Cp.
Expression of Zp in human BeWo, MCF7, and T47D cells
and rodent tissues. PCR amplification of reverse-transcribed
RNA from mouse tissues using Zp-specific primers demon-
strated expression of Zp in the heart, kidney, embryo, and, most
markedly, the placenta (E7 and E18), but expression was not
found in liver or enterocyte (Fig. 2A). A single band was detected
for all positive tissues and was of the expected size based on the
primer design. Similarly, Zp mRNA expression was observed in
human BeWo placenta cells (data not shown).
Protein expression of Zp was investigated in rat placenta;
mouse serum, enterocyte, embryo, and mammary tissues; and
human BeWo, Caco-2, MCF7, T47D, and MCF10AT cell lines.
FIGURE 1 Molecular modeling of Zp.
(A) The superimposition of modeled hu-
man Zp on Cp structure. The figures were
generated using a modified version of
Molscript (43) and subsequently rendered
in Raster3D version 2.0 (44). (B) The
ribbon diagram of Zp shown with top
view, bottom view (C), and side view (D).
The residues are colored blue to green for
domains 1 and 2 (residues 1–370), yellow
to red for domains 3 and 4 (residues 371–
720), and lilac to gray for domains 5 and 6
(residues 721–1067). The copper and
oxygen atoms are shown in blue and
red, respectively.
FIGURE 2 Expression of Zp in
rodent tissues (A,B) and human
cell lines (C). (A) Expression of Zp
mRNA in E18 mouse placenta,
liver, heart, kidney, E7 placenta,
E18 embryo, and enterocytes.
GAPDH expression was used as
a loading control. (B) Immunoblot
with Zp-specific IgG of rat pla-
centa, lactating mouse mammary
tissue, mouse E18 embryo, and
(C). mouse serum and entero-
cytes, and human BeWo, MCF7,
T47D, and MCF10AT cell line
extracts. (D) Immunoblot with
Cp- and Heph-specific IgG, respec-
tively, of mouse serum and enter-
ocytes; 50 mg total protein/lane.
Zyklopen, a new multicopper ferroxidase 1731
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

Rat placenta immunoreacted with Zp IgG, as well as mouse
mammary tissue and whole embryo, revealed a major band at
148 kDa and a minor band at 130 kDa. No signal was observed
in mouse serum or enterocytes (Fig. 2C) or Caco-2 cell extracts
(data not shown) immunoreacted with Zp IgG, indicating that
the IgG does not cross-react with Cp or Heph. BeWo, MCF7,
and T47D, but not MCF10AT cell extracts, immunoreacted
with Zp-specific IgG to give a single band of 130 kDa (Fig. 2C).
No expression of Cp or Heph was observed in any of these cell
lines (data not shown). When samples were immunoreacted with
Cp-specific IgG, a major band of 130 kDa was observed in
mouse serum (Fig. 2D). A single band of 130 kDa was also
observed in mammary tissue extracts (data not shown);
however, it is not clear if it is circulating Cp or Cp expressed
in this tissue.
Immunostaining of Zp in mouse tissues. We examined
expression of Zp in mouse adult, embryonic (E17.5), and
placental (E15.5) tissues. In the adult, expression was noted in
the brain, kidney, testes, and retina (Fig. 3A) but not in the liver
or intestine. In the embryo, expression was seen in brain,
bladder, eye, and brown fat (Fig. 3B). We found expression in
placenta in the labyrinth, inverted yolk sac, and spongiotropho-
blast (Supplemental Fig. 4). This expression pattern is distinct
from what has been previously reported for Heph and Cp (3,5–
8), although there is coexpression in some tissues, including the
FIGURE 3 Immunostaining of Zp in adult (A) and embryonic (B) mouse tissues. (A) Immunohistochemical localization of Zp in adult mouse
brain, kidney, testes, and retina at 10 wk of age. No staining is detected in the preimmune control sera (top row). In the brain, Zp was detected in
the choroid plexus, the dentate gyrus, and the CA1 region of the hippocampus (arrow). Zp was localized in cross-sectioned tubules in the kidney
medulla and medullary rays (arrow). Zp was highly expressed in the mature spermatozoa of the testes and in the interstitial spaces between the
tubules where the endocrine Leydig cells are located (arrow). In the retina, Zp was detected in the retinal pigment epithelium (RPE) and ganglion
cell layer (GCL) (arrows). (B) Immunohistochemical localization of Zp in embryonic (E17.5) mouse brain, bladder, eye, and brown fat. No staining
was detected using the preimmune control sera (top row). Zp expression was high in the choroid plexus of the brain and in the urinary epithelium
of the bladder. Zp was also expressed in the E17.5 retina and brown fat. All images were taken at 203magnification.
1732 Chen et al.
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

kidney and placenta (Heph and Zp) and eye and brain (Heph,
Cp, and Zp).
Zp has pPD and ferroxidase activities in BeWo cells. Amino
acid sequence and homology modeling of Zp with Heph and Cp
suggest that Zp has pPD and ferroxidase activities. The pPD and
ferroxidase activities of Zp were probed in BeWo cells using in-
gel assays and each revealed a single band (Fig. 4A,B). The
molecular weight of the signal was difficult to assess on the
native gels; however, replicate samples immunoreacted with Zp
antisera under the same conditions produced a single band
comparable in position to that observed in these assays (Fig. 4C).
BeWo cells do not express Heph or Cp (15).
SiRNA knockdown of Zp reduces pPD oxidase activity in
BeWo cells. We verified that the signals observed by immuno-
blot and oxidase assays were Zp by siRNA knockdown of Zp.
BeWo cells incubated with siRNA primers targeting the Zp
transcript were immunoblotted and assayed for pPD oxidase
activity. Zp protein levels were lower in BeWo cells treated with
siRNA primer sets 2 and 3 compared with control (Fig. 5A).
Similar results were obtained with the in-gel pPD oxidase
activity assay (Fig. 5B).
Zp levels are regulated by copper in placental cells. Zp
protein levels decreased (r
2
= 0.926; P#0.0005) in increasingly
copper-deficient BeWo cells in parallel with loss of SOD1
activity (r
2
= 0.982; P#0.0001) (Fig. 6).
Discussion
We have identified Zp, a new vertebrate MCF similar to Heph
and Cp, which may play a role in placental iron transport. MCF,
originally comprising only the serum globulin Cp, now appear to
be a family of proteins involved in iron efflux from different
tissues. Forty-four vertebrate genomes, as of March 2010, were
reported by the Ensembl genome browser to have a protein-
coding sequence for Zp (as Hephl1), revealing conservation of
this gene. We previously provided physiological data implicating
a membrane-bound copper-containing oxidase in the efflux of
iron from placental cells. We further demonstrated that the
placental oxidase was not Heph, Cp, or their splice variants,
although the oxidase showed strong similarities to both (14,15).
We now show in this report that Zp represents the previously
unidentified placental copper-containing oxidase.
Zp is an MCF based on striking sequence similarity with
Heph and Cp, structural modeling, and in-gel ferroxidase
assays. All of the type I, II, and III copper-binding sites in Cp
are conserved in Zp. In addition, the structural modeling
suggests the presence of a putative iron-binding site in domain
6 analogous to sites observed in Cp. In multicopper oxidase blue
proteins, substrate binds close to the mononuclear site and
FIGURE 4 pPD oxidase (A) and ferroxidase (B) activity of Zp in the
BeWo human placental cell line. (A) In-gel pPD oxidase activity was
measured in cell extracts (60, 90, 120, and 150 mg total protein/lane)
separated under nondenaturing conditions by native gel electropho-
resis. Purified human Cp (5–20 mg/lane) was used as a control. (B)
In-gel ferroxidase activity of the same extracts in A.(C) Immunoblot of
the same extracts in Awith Zp-specific IgG.
FIGURE 5 pPD oxidase activity in BeWo cells after siRNA knock-
down of Zp. (A) Immunoblot with Zp- and GAPDH-specific IgG of
extracts (100 mg total protein/lane) of nontransfected BeWo cells (Ctrl)
and BeWo cells transfected with set 1, set 2, and set 3 siRNA targeting
Zp. Purified human Cp was used as a control (20 mg/lane). (B) In-gel
pPD activity assay of the same samples (100 mg total protein/lane).
Zyklopen, a new multicopper ferroxidase 1733
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

donates an electron, which is transferred via a cysteine residue to
a histidine residue (His-Cys-His motif) involved in binding the
trinuclear copper cluster (1). The transfer of electrons through
mononuclear copper 6 to the type II and III coppers in the
trinuclear cluster would be of primary significance, because
molecular oxygen binds to this site and after a transfer of 4
electrons is reduced to 2 molecules of water. These similarities
among Zp, Cp, and blue proteins lend strong support for a
similar function to Zp. Furthermore, ferroxidase activity in
BeWo cells, detected in an in-gel assay, occurred at a comparable
position to Zp, as detected by immunoblot. In-gel pPD oxidase
activity assay levels also decreased in BeWo cells treated with
siRNA against Zp, suggesting that this oxidase activity is due to
Zp. We also demonstrated decreased protein levels of Zp in
cellular copper deficiency as we (25) and others have seen
previously for Heph and Cp (3,32,33). The changes in Zp mirror
the changes in the protein levels of the unknown placental
copper oxidase detected previously (15).
We hypothesize that Zp is a membrane-bound protein
involved in iron efflux, perhaps in concert with the iron
efflux protein, Fpn1 (34–36). The glycosylphosphatidylinositol-
anchored variant of Cp facilitates iron efflux through interaction
with Fpn1 (4) and Heph is proposed to actuate iron efflux in a
mechanism that likely involves Fpn1 as well (2). Zp is predicted
to have a C-terminal membrane-bound region and to have the
correct protein topology to interact with Fpn1 with the
ferroxidase domain located extracellularly. Fpn1 is expressed
in a number of tissues, including placenta (34–37). The
ferroxidase-transporter mechanism for iron efflux may therefore
be used to transfer iron through the placenta or from the
placenta to the fetus via the Zp-mediated conversion of Fe(II) to
the Fe(III) form that can be incorporated into fetal transferrin.
Our proposed role of Zp in placental iron release is consistent
with our own observations (37–39) and those of others (40) that
the fetus can maintain iron status despite maternal anemia, but
that with copper deficiency, the fetus becomes iron deficient
whereas placental iron levels do not decrease. The elucidation of
the exact role of Zp in iron efflux in the tissues expressing the
gene awaits further experimental work.
The functional role of Zp relative to the other MCF remains
unclear. Zp is expressed in a number of tissues, including
placenta, but not liver or intestine. We detected 2 bands for Zp in
all positive tissues, but not in cell lines, which may represent
differences in glycosylation as seen for both Cp and Heph (3,33).
Heph is expressed in the placenta as well (8), but the interplay
between Heph and Zp in coordinating iron placental egress is
not yet known. Zp and Heph could play a similar mechanistic
role in mobilization of iron but in distinct placental tissues. Zp
could also play a supplemental role in tissues where Cp and/or
Heph are also present, perhaps under conditions of unique iron
need. In accordance with this, Cp has been shown to augment
iron transport from the intestine following severe phlebotomy-
induced iron need (41). The 3 MCF may be regulated differently,
function in different conditions, or function in different aspects
of iron trafficking by certain cells, as is the case for the 2 yeast
MCF paralogs Fet3p and Fet5p in Saccharomyces cerevisiae,
which have distinct yet complementary roles in maintaining
cellular iron homeostasis (42). Additional work will be needed
to resolve the respective roles of Cp, Heph, and Zp.
Acknowledgments
Z.K.A. designed research; H.C., Z.K.A., B.A.S., Y.M.K., V.S.,
H.A.S., L.G., and R.D. conducted research; Z.K.A., B.A.S.,
C.E.N., Y.M.K., B.K.F., and H.J.M. analyzed data and prepared
figures; Z.K.A., B.A.S., B.K.F., R.D., M.B-H., J.U., C.D.V., and
H.J.M. wrote the paper; and R.W.E. provided intellectual input.
All authors read and approved the final manuscript.
Literature Cited
1. Kosman DJ. Fet3p, ceruloplasmin and the role of copper in iron
metabolism. Adv Protein Chem. 2002;60:221–69.
2. Anderson GJ, Vulpe CD. Mammalian iron transport. Cell Mol Life Sci.
2009;66:3241–61.
3. Hellman NE, Gitlin JD. Ceruloplasmin metabolism and function. Annu
Rev Nutr. 2002;22:439–58.
4. De Domenico I, Ward DM, di Patti MC, Jeong SY, David S, Musci G,
Kaplan J. Ferroxidase activity is required for the stability of cell surface
FIGURE 6 Regulation of Zp by copper in BeWo cells. (A) BeWo cells
were made copper-deficient by incubation with increasing concentra-
tions of BCS, and cell extracts (100 mg total protein/lane) were then
immunoblotted with Zp-specific and GAPDH-specific IgG followed by
development with chemiluminescence and measurement of band
intensity by densitometry. The ratio of each Zp band density to the
density of the 0 mmol/L BCS control were multiplied by 100, averaged,
and then plotted versus BCS concentration (r
2
= 0.926; P#0.0005).
Values are means 6SD of results from 3 independent experiments.
(B) SOD1 activity as measured in the same cell lysates as in Aand
plotted versus BCS concentration (r
2
= 0.982; P#0.0001). Values are
means 6SD, n= 2 independent experiments.
1734 Chen et al.
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from

ferroportin in cells expressing GPI-ceruloplasmin. EMBO J. 2007;
26:2823–31.
5. Vulpe CD, Kuo Y-M, Libina N, Askwith C, Murphy TL, Cowley L,
Gitschier J, Anderson G. Hephaestin, a ceruloplasmin homologue
implicated in intestinal iron transport, is defective in the sla mouse. Nat
Genet. 1999;21:195–9.
6. Hudson DM, Curtis SB, Smith VC, Griffiths TA, Wong AY, Scudamore
CH, Buchan AM, MacGillivray RT. Human hephaestin expression is
not limited to enterocytes of the gastrointestinal tract but is also found
in the antrum, the enteric nervous system, and pancreatic beta-cells. Am
J Physiol Gastrointest Liver Physiol. 2010;298:G425–32.
7. Hahn P, Qian Y, Dentchev T, Chen L, Beard J, Harris ZL, Dunaief JL.
Disruption of ceruloplasmin and hephaestin in mice causes retinal iron
overload and retinal degeneration with features of age-related macular
degeneration. Proc Natl Acad Sci USA. 2004;101:13850–5.
8. Frazer DM, Vulpe CD, McKie AT, Wilkins SJ, Trinder D, Cleghorn GJ,
Anderson GJ. Cloning and gastrointestinal expression of rat hephaestin:
relationship to other iron transport proteins. Am J Physiol Gastrointest
Liver Physiol. 2001;281:G931–9.
9. Okamoto N, Wada S, Oga T, Kawabata Y, Baba Y, Habu D, Takeda Z,
Wada Y. Hereditary ceruloplasmin deficiency with hemosiderosis. Hum
Genet. 1996;97:755–8.
10. Takahashi Y, Miyajima H, Shirabe S, Nagataki S, Suenaga A, Gitlin JD.
Characterization of a nonsense mutation in the ceruloplasmin gene
resulting in diabetes and neurodegenerative disease. Hum Mol Genet.
1996;5:81–4.
11. Yoshida K, Furihata K, Takeda S, Nakamura A, Yamamoto K, Morita
H, Hiyamuta S, Ikeda S, Shimizu N, et al. A mutation in the
ceruloplasmin gene is associated with systemic hemosiderosis in
humans. Nat Genet. 1995;9:267–72.
12. Harris ZL, Durley AP, Man TK, Gitlin JD. Targeted gene disruption
reveals an essential role for ceruloplasmin in cellular iron efflux. Proc
Natl Acad Sci USA. 1999;96:10812–7.
13. Srai SKS, Bomford A, McArdle HJ. Iron transport across cell
membranes: molecular understanding of duodenal and placental iron
uptake. Best Pract Res Clin Haematol. 2002;15:243–59.
14. Danzeisen R, Ponnambalam S, Lea RG, Page K, Gambling L, McArdle
HJ. The effect of ceruloplasmin on iron release from placental (BeWo)
cells: evidence for an endogenous Cu oxidase. Placenta. 2000;21:805–12.
15. Danzeisen R, Fosset C, Chariana Z, Page K, David S, McArdle HJ. Placental
ceruloplasmin homolog is regulated by iron and copper and is implicated
in iron metabolism. Am J Physiol Cell Physiol. 2002;282:C472–8.
16. Sali A, Blundell TL. Comparative protein modelling by satisfaction of
spatial restraints. J Mol Biol. 1993;234:779–815.
17. Fiser A, Do RK, Sali A. Modeling of loops in protein structures. Protein
Sci. 2000;9:1753–73.
18. Zaitseva I, Zaitseva V, Card G, Moshkov K, Bax B, Ralph A, Lindley P.
The X-ray structure of human serum ceruloplasmin at 3.1 angstrom:
nature of the copper centres. J Biol Inorg Chem. 1996;1:15–23.
19. Syed BA, Beaumont NJ, Patel A, Naylor CE, Bayele HK, Joannou CL,
Rowe PS, Evans RW, Srai SK. Analysis of the human hephaestin gene
and protein: comparative modelling of the N-terminus ecto-domain
based upon ceruloplasmin. Protein Eng. 2002;15:205–14.
20. Reeves PG, Nielsen FH, Fahey GC Jr. AIN-93 purified diets for
laboratory rodents: final report of the American Institute of Nutrition
ad hoc writing committee on the reformulation of the AIN-76A rodent
diet. J Nutr. 1993;123:1939–51.
21. Chen H, Su T, Attieh ZK, Fox TC, McKie AT, Anderson GJ, Vulpe CD.
Systemic regulation of Hephaestin and Ireg1 revealed in studies of
genetic and nutritional iron deficiency. Blood. 2003;102:1893–9.
22. Rozen S, Skaletsky H. Primer3 on the WWW for general users and for
biologist programmers. Methods Mol Biol. 2000;132:365–86.
23. Kuo YM, Gitschier J, Packman S. Developmental expression of the
mouse mottled and toxic milk genes suggests distinct functions for the
Menkes and Wilson disease copper transporters. Hum Mol Genet.
1997;6:1043–9.
24. Kuo YM, Su T, Chen H, Attieh Z, Syed BA, McKie AT, Anderson GJ,
Gitschier J, Vulpe CD. Mislocalisation of hephaestin, a multicopper
ferroxidase involved in basolateral intestinal iron transport, in the sex
linked anaemia mouse. Gut. 2004;53:201–6.
25. Chen H, Huang G, Su T, Gao H, Attieh ZK, McKie AT, Anderson GJ,
Vulpe CD. Decreased hephaestin activity in the intestine of copper-
deficient mice causes systemic iron deficiency. J Nutr. 2006;136:1236–41.
26. Abramoff MD, Magelhaes PJ, Ram SJ. Image processing with ImageJ.
Biophotonics International. 2004;11:36–42.
27. Adman ET. Copper protein structures. Adv Protein Chem. 1991;42:
145–97.
28. Messerschmidt A, Ladenstein R, Huber R, Bolognesi M, Avigliano L,
Petruzzelli R, Rossi A, Finazzi-Agro A. Refined crystal structure of
ascorbate oxidase at 1.9 A resolution. J Mol Biol. 1992;224:
179–205.
29. Ducros V, Brzozowski AM, Wilson KS, Brown SH, Ostergaard P,
Schneider P, Yaver DS, Pedersen AH, Davies GJ. Crystal structure of the
type-2 Cu depleted laccase from Coprinus cinereus at 2.2 A
˚resolution.
Nat Struct Biol. 1998;5:310–6.
30. Takahashi N, Ortel TL, Putnam FW. Single-chain structure of human
ceruloplasmin: the complete amino acid sequence of the whole
molecule. Proc Natl Acad Sci USA. 1984;81:390–4.
31. Zaitsev VN, Zaitseva I, Papiz M, Lindley PF. An X-ray crystallographic
study of the binding sites of the azide inhibitor and organic substrates to
ceruloplasmin, a multicopper oxidase in the plasma. J Biol Inorg Chem.
1999;4:579–87.
32. Reeves PG, Demars LC, Johnson WT, Lukaski HC. Dietary copper
deficiency reduces iron absorption and duodenal enterocyte hephaestin
protein in male and female rats. J Nutr. 2005;135:92–8.
33. Nittis T, Gitlin JD. Role of copper in the proteosome-mediated
degradation of the multicopper oxidase hephaestin. J Biol Chem. 2004;
279:25696–702.
34. McKie AT, Marciani P, Rolfs A, Brennan K, Wehr K, Barrow D, Miret S,
Bomford A, Peters TJ, et al. A novel duodenal iron-regulated
transporter, IREG1, implicated in the basolateral transfer of iron to
the circulation. Mol Cell. 2000;5:299–309.
35. Donovan A, Brownlie A, Zhou Y, Shepard J, Pratt SJ, Moynihan J, Paw
BH, Drejer A, Barut B, et al. Positional cloning of zebrafish ferroportin1
identifies a conserved vertebrate iron exporter. Nature. 2000;403:
776–81.
36. Abboud S, Haile DJ. A novel mammalian iron-regulated protein
involved in intracellular iron metabolism. J Biol Chem. 2000;275:
19906–12.
37. Gambling L, Danzeisen R, Gair S, Lea RG, Charania Z, Solanky N,
Joory KD, Srai SK, McArdle HJ. Effect of iron deficiency on placental
transfer of iron and expression of iron transport proteins in vivo and in
vitro. Biochem J. 2001;356:883–9.
38. Andersen HS, Gambling L, Holtrop G, McArdle HJ. Effect of dietary
copper deficiency on iron metabolism in the pregnant rat. Br J Nutr.
2007;97:239–46.
39. McArdle HJ, Andersen HS, Jones H, Gambling L. Fetal programming:
causes and consequences as revealed by studies of dietary manipulation
in rats: a review. Placenta. 2006;27:S56–60.
40. Ervasti M, Sankilampi U, Heinonen S, Punnonen K. Early signs of
maternal iron deficiency do not influence the iron status of the newborn,
but are associated with higher infant birthweight. Acta Obstet Gynecol
Scand. 2009;88:83–90.
41. Cherukuri S, Potla R, Sarkar J, Nurko S, Harris ZL, Fox PL.
Unexpected role of ceruloplasmin in intestinal iron absorption. Cell
Metab. 2005;2:309–19.
42. Spizzo T, Byersdorfer C, Duesterhoeft S, Eide D. The yeast FET5 gene
encodes a FET3-related multicopper oxidase implicated in iron trans-
port. Mol Gen Genet. 1997;256:547–56.
43. Esnouf RM. Polyalanine reconstruction from Calpha positions using the
program CALPHA can aid initial phasing of data by molecular
replacement procedures. Acta Crystallogr D Biol Crystallogr. 1997;53:
665–72.
44. Merritt EA, Murphy ME. Raster3D version 2.0. A program for
photorealistic molecular graphics. Acta Crystallogr D Biol Crystallogr.
1994;50:869–73.
Zyklopen, a new multicopper ferroxidase 1735
at Univ of California-Berkeley Periodicals Division on November 7, 2010 jn.nutrition.orgDownloaded from