Primary and Secondary Abscission in Pisum sativum and Euphorbia pulcherrima—How Do They Compare and How Do They Differ?

Abstract

Abscission is a highly regulated and coordinated developmental process in plants. It is important to understand the processes leading up to the event, in order to better control abscission in crop plants. This has the potential to reduce yield losses in the field and increase the ornamental value of flowers and potted plants. A reliable method of abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established to study the process in a comprehensive manner. By correctly decapitating buds of the third order, abscission can be induced in 1 week. AFLP differential display (DD) was used to search for genes regulating abscission. Through validation using qRT-PCR, more information of the genes involved during induced secondary abscission have been obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental funiculus) gene, which was compared with wild type peas (tall and dwarf in both cases) was performed. The def mutant results in a deformed, abscission-less zone instead of normal primary abscission at the funiculus. RNA in situ hybridization studies using gene sequences from the poinsettia differential display, resulted in six genes differentially expressed for abscission specific genes in both poinsettia and pea. Two of these genes are associated with gene up- or down-regulation during the first 2 days after decapitation in poinsettia. Present and previous results in poinsettia (biochemically and gene expressions), enables a more detailed division of the secondary abscission phases in poinsettia than what has previously been described from primary abscission in Arabidopsis. This study compares the inducible secondary abscission in poinsettia and the non-abscising mutants/wild types in pea demonstrating primary abscission zones. The results may have wide implications on the understanding of abscission, since pea and poinsettia have been separated for 94–98 million years in evolution, hence any genes or processes in common are bound to be widespread in the plant kingdom.

Full text

ORIGINAL RESEARCH
published: 26 January 2016
doi: 10.3389/fpls.2015.01204
Frontiers in Plant Science | www.frontiersin.org 1January 2016 | Volume 6 | Article 1204
Edited by:
Roberts Alan Jeremy,
University of Nottingham, UK
Reviewed by:
Inger Martinussen,
Norwegian Institute of Bioeconomy
Research, Norway
Hao Peng,
Washington State University, USA
*Correspondence:
Anne K. Hvoslef-Eide
trine.hvoslef-eide@nmbu.no
†Present Address:
Kwadwo O. Ayeh,
Department of Botany, School of
Biological Sciences, College of Basic
and Applied Sciences, University of
Ghana, Legon-Accra, Ghana;
Paoly Rasolomanana,
Academic Program Directorate,
Hawassa University, Awasa, Ethiopia
Specialty section:
This article was submitted to
Crop Science and Horticulture,
a section of the journal
Frontiers in Plant Science
Received: 01 September 2015
Accepted: 14 December 2015
Published: 26 January 2016
Citation:
Hvoslef-Eide AK, Munster CM,
Mathiesen CA, Ayeh KO, Melby TI,
Rasolomanana P and Lee Y (2016)
Primary and Secondary Abscission in
Pisum sativum and Euphorbia
pulcherrima—How Do They Compare
and How Do They Differ?
Front. Plant Sci. 6:1204.
doi: 10.3389/fpls.2015.01204
Primary and Secondary Abscission in
Pisum sativum and Euphorbia
pulcherrima—How Do They Compare
and How Do They Differ?
Anne K. Hvoslef-Eide *, Cristel M. Munster, Cecilie A. Mathiesen, Kwadwo O. Ayeh †,
Tone I. Melby, Paoly Rasolomanana †and YeonKyeong Lee
Department of Plant Sciences, Norwegian University of Life Sciences, Aas, Norway
Abscission is a highly regulated and coordinated developmental process in plants. It
is important to understand the processes leading up to the event, in order to better
control abscission in crop plants. This has the potential to reduce yield losses in the field
and increase the ornamental value of flowers and potted plants. A reliable method of
abscission induction in poinsettia (Euphorbia pulcherrima) flowers has been established
to study the process in a comprehensive manner. By correctly decapitating buds of
the third order, abscission can be induced in 1 week. AFLP differential display (DD)
was used to search for genes regulating abscission. Through validation using qRT-PCR,
more information of the genes involved during induced secondary abscission have been
obtained. A study using two pea (Pisum sativum) mutants in the def (Developmental
funiculus) gene, which was compared with wild type peas (tall and dwarf in both
cases) was performed. The def mutant results in a deformed, abscission-less zone
instead of normal primary abscission at the funiculus. RNA in situ hybridization studies
using gene sequences from the poinsettia differential display, resulted in six genes
differentially expressed for abscission specific genes in both poinsettia and pea. Two
of these genes are associated with gene up- or down-regulation during the first 2 days
after decapitation in poinsettia. Present and previous results in poinsettia (biochemically
and gene expressions), enables a more detailed division of the secondary abscission
phases in poinsettia than what has previously been described from primary abscission in
Arabidopsis. This study compares the inducible secondary abscission in poinsettia and
the non-abscising mutants/wild types in pea demonstrating primary abscission zones.
The results may have wide implications on the understanding of abscission, since pea
and poinsettia have been separated for 94–98 million years in evolution, hence any genes
or processes in common are bound to be widespread in the plant kingdom.
Keywords: induced abscission, primary abscission, secondary abscission, pea, poinsettia, def mutants,
Differentially expressed genes, RNA in situ hybridization
Abbreviations: AZ, abscission zone; DD, differentially expressed genes.

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
INTRODUCTION
Abscission is a beneficial process for plants themselves, since
this is the mechanism for plants to discard unwanted or
superfluous organs in a highly orchestrated manner. However,
this developmental process cause seed shattering, fruit drop,
flower abscission, and other loss of value for crops valuable
to man. It is not surprising that prevention of seed shattering
probably was one of the first characters selected for when man
started to cultivate plants and selected for cereal plants where he
could harvest more seeds (Harlan et al., 1973). Abscission is a
complicated process, it is not clear the orchestrated manner by
which abscission is controlled in plants. The process is important
to understand, since agricultural and horticultural production is
increasingly more sophisticated and facilitates precise control of
the growth conditions, in greenhouses and increasingly also in
the field.
Cells in an abscission zone (AZ) are typically small, square-
shaped with dense cytoplasm (Sexton and Roberts, 1982) and
clearly distinguishable from surrounding cells. The number of
cell layers in an AZ is fixed for a species, but is highly variable
between species, with tomato as an example of two discrete
cell layers, which split between them (Valdovinos and Jensen,
1968; Tabuchi et al., 2001). The AZ of Sambucus nigra on
the other hand, is composed of up to 50 cell layers (Taylor
and Whitelaw, 2001). The term secondary abscission zones was
first introduced by Lloyd (1913-14). He reported on injury-
induced abscission in Impatiens sultani. Secondary abscission has
also later been described as a zone which occurs in a position
where a zone would not normally form in an intact plant
(Webster, 1970; Pierik, 1973). Having termed these adventitious
AZ as secondary, the predestined AZ occurring at particular
sites of positional differentiated cells have since been given the
term primary (Huang and Lloyd, 1999) to distinguish between
the two.
Abscission can be affected by environmental factors and is a
highly coordinated biological mechanism (Brown and Addicott,
1950; Osborne, 1955; Addicott, 1982; Patterson, 2001; Roberts
et al., 2002). It has been reported that low light conditions might
trigger cyathia abscission in poinsettia (Euphorbia pulcherrima)
(Bailey and Miller, 1991; Moe et al., 1992) but environmental
regulations, as well as the biological background of abscission
has not been fully investigated. Although the abscission process
is a natural biological process to dispose of redundant organs,
premature abscission results in the loss of yield and value in
agriculture and horticulture.
Valdovinos and Jensen demonstrated the cell wall
disintegration in the AZ allowing separation in tomato and
tobacco (Valdovinos and Jensen, 1968). Reviews have followed
with more insight into the process (Sexton and Roberts, 1982;
Osborne and Morgan, 1989; Taylor and Whitelaw, 2001; Bosca
et al., 2006). Our own results have clearly demonstrated and
confirmed that abscission is controlled by inter-organ signaling
events, yet it is still not clear how these signals co-ordinate
the events. Cell wall modifications in the AZ of poinsettia,
visualized using antibodies during the course of an induced
abscission process, is one way we have chosen to elucidate upon
the abscission process (Lee et al., 2008). Some of the other
approached will become clear in the present article.
Poinsettia is not the obvious choice for fundamental studies
since the molecular tools available for other model plants
are not available. Secondly, the life span is much longer
than for Arabidopsis. Thirdly, it is vegetatively propagated,
does not readily set seed and segregation studies would be
difficult to perform. Lastly, it has no available non-abscising
mutants. However, poinsettia is an important ornamental plant
worldwide during Christmas time. It is by far the most
important potted plant crop in Norway with more than five
million plants produced each year, for a population of about
the same number. In addition, Norwegian poinsettia growers
have pointed out that poinsettia suffers from premature flower
abscission, which can result in severe losses in value. Therefore,
there are economic reasons for being able to control this. A
method for induction of abscission to investigate the abscission
process has been developed using this plant species (Munster,
2006). This makes the study of abscission in poinsettia very
precise and predictable. Poinsettia flower pedicels have no pre-
destined AZ, and hence they are defined as having secondary
abscission. This inducible abscission system in the poinsettia
flower resembles systems in other plant species (Webster, 1970;
Hashim et al., 1980; Oberholster et al., 1991; Kuang et al.,
1992), especially the model plant tomato (pedicel abscission)
and thus provides a reliable, synchronized system for studying
the abscission process in general. Poinsettia (E. pulcherrima)
belongs to the large family of Euphorbiaceae, with about 300
genera and 7500 species. A number of plants of this family
are of considerable economic importance. Prominent plants
include cassava (Manihot esculenta), physic nut or Barbados nut
(Jatropha curcas), castor oil plant (Ricinus communis), and the
Para rubber tree (Hevea brasiliensis). Amongst several of these,
genomic and molecular tools are becoming available, because of
their economic importance for producing biofuels.
Previously, this inducible system has been used to study the
turnover of carbohydrates in the abscission zone (Lee et al.,
2008), and the effect of the cut position on hormones in the bud
(Munster, 2006). This article reports on the genes differentially
displayed during the 7 day period from induction to abscission
from the thesis of Munster (2006). We have since further verified
the gene expressions in poinsettia through quantitative RT-PCR
and RNA in situ hybridizations, all of which is included in this
article.
Poinsettia has no mutants for abscission, in order to study
gene expression. However, there are other model systems with
numerous mutants. There are two def (Developmental funiculus)
mutant peas in the John Innes Pea Collection, one dwarf and
one tall type (JI184 and JI3020). These mutants were the tools
to elucidate upon the process of abscission in peas (Ayeh, 2008).
That study concluded that the def gene is a single locus gene
(Ayeh et al., 2011) and the abscission zone between the funiculus
and the pea was characterized (Ayeh et al., 2009) in both mutants
(with abscission-less zones) and tall and dwarf wild types. Pea has
primary abscission, with the AZ clearly defined from the onset in
the wild types and only the distorted abscission-less zone in the
mutants.
Frontiers in Plant Science | www.frontiersin.org 2January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
Pea and poinsettia are separated by 94–98 million years
(Bennett et al., 2000). Hence, any genes they share during
the abscission process will most likely be universal throughout
the plant kingdom. This paper summarizes the interesting
comparable results in pea and poinsettia with respect to cell wall
alterations (Ayeh, 2008; Lee et al., 2008) as well as gene expression
during the abscission process from induction to abscission. Our
hypothesis is that the primary abscission in pea (Pisum sativum)
and secondary abscission in poinsettia (E. pulcherrima) are more
similar than different. Pea represents primary abscission where
the abscission zones are clearly defined from the development of
the organs. Poinsettia represents secondary abscission, where the
abscission zones can develop upon induction. This paper presents
results, which tests the hypothesis comparing the developmental
stages in poinsettia abscission with the def mutants and wild
types in pea, discussing the similarities and differences between
these two systems as models for abscission.
MATERIALS AND METHODS
Plant Material—Poinsettia
Poinsettia (Euphorbia pulchérrima) ‘Lilo’ were grown as
previously described in Lee et al. (2008). Plants were grown under
long day condition (20 h photoperiod at 150 µmolm−2sec−1)
and the plants were kept under short day conditions (10/14 h
photoperiod) at 20◦C to induce flowering.
Induction of Abscission in the Flower Pedicel
(Secondary Abscission)
Cyathia of the third order (all male flowers) were used for
analyses to standardize abscission zone development, since
this gives six flowers in the same inflorescence of the same
developmental stage (3rd order; Figure 1). When third order
flowers began to open, they were decapitated with a razor blade
just below the floral organs, with the floral bottom still intact,
cut position 2 (cp2) in Figure 2A (Munster, 2006). The flowers
developed abscission zones (AZs) under short day conditions,
with 7 ±1 days to complete abscission. AZs were dissected
from the decapitated pedicels every 24 h, and harvested on the
same time to create the complete series from Day 0 (control) to
Day 7 and obtain comparable gene expressions. Figures 2B–E
shows the development of the AZ from Day 0 to Day 7 (day of
abscission). Figure 3 shows micrographs of poinsettia comparing
a pedicel with no AZ (A) with induced (B), and natural (C)
abscission.
Plant Material—Pea
The four lines of pea (P. sativum L.) seeds (JI 116, JI 2822, JI 1184,
and JI 3020) in this study were selected based on the presence of
specific alleles at the Def locus, which control the detachment of
the seed from the funiculus (Ayeh et al., 2009, 2011). Two wild
types (WT) with the Def locus and two def mutant pea seeds
were kindly supplied from the John Innes Pisum Collection Ayeh
et al. (2009). Tall wild type (JI 116) and dwarf wild type (JI 2822)
develop normal abscission events and therefore abscise the seed
from the funiculus through the intervening hilum region. The
tall def mutant (JI 1184) and the dwarf def mutant (JI 3020)
both lack the abscission event and therefore fail to abscise the
seed from the funiculus. These lines have a deficient abscission
zone, which we have given the name abscission-zone-less (AZL;
Ayeh, 2008). Seeds of each line were sown in pots with fertilized
peat and grown under greenhouse conditions at 22◦C and 16/8 h
photoperiod with a photon flux of 110 µmol m−2s−1[400–
700 nm Photosynthetic Active Radiation (PAR)] and a daylength
extending light provided from incandescent lamps (OSRAM,
Germany).
Definition of Growth Stages in Pea
We used young and mature developmental stages in both the
wild and the def mutant pea plants. For the tall wild type JI 116,
developmental stage 10.1 indicates young seed. For the tall def
mutant type JI 1184, developmental stage 8.1 indicates young
seed for a comparable developmental stage. The developmental
stage 2.1 indicates mature seed for both JI 116 and JI 1184.
For the dwarf wild type JI 2822 and the dwarf def mutant JI
3020, developmental stages 4.1 and 3.1 indicate young seeds,
respectively. Developmental stage 1.1 indicates mature seed for
both dwarf wild type JI 2822 and dwarf def mutant JI 3020.
Differential Display (DD) in Poinsettia
AZs were dissected from the area of the pedicel from Day 0 until
Day 7 as described in Munster (2006). As soon as the AZ could be
defined visually, samples of the distal part were harvested as an
internal control to eliminate senescence related genes from the
bands picked from DD. The pedicel slices from AZ tissue were
stored immediately in RNAlater (0.1 g/ml) at −20◦C until use.
RNA Extraction, Differential Display, and Sequencing
RNA was extracted from the AZ tissues by a time course
according to instruction of the Qiagen RNeasy Plant Kit. RNA
was treated using RNase-Free DNase I Set (Qiagen). The quantity
and quality of the RNA was measured by Nano Drop ND-1000
spectrophotometer (Nano Drop Technologies, USA).
Fluorescent DD was performed with the RNAspectra kit
(GenHunter, Nashville, TN, USA) in duplicates as all reactions
were performed with both red (rhodamin) and green (fluoricin)
fluorescence in parallel. The mRNA in the total RNA samples
was converted into DNA by reverse transcriptase with anchor
primers (H-T11A, H-T11G, or H-T11C). The resulting cDNA
was template and PCR products were amplified by DNA
Polymerase DyNAzymeII (Finnzyme, Espoo, Finland) using the
three different anchor primers, respectively, for each arbitrary
primer in separate reactions (for details see Supplementary Table
1). The RNA spectral kits used were red and green no. 1, 4, 5,
and 8. Four primers were in addition designed on conserved areas
of polygalactorunase and β-1,3-glucanase and used in the AFLP
DD analyses. These primers were added since these two enzymes
are associated with cell wall breakdowns during abscission.
These primers were PG-A 5′-AAGCTTATTATGGAGC-3′,
PG-T 5′-AAGCTTATTTTGGAGC-3′, GlucC 5′-AAGCTTTAT
GGAATG-3′, and GlucA 5′- AAGCTTTATGGCATG -3′. The
amplification products were separated on 6% denaturing
polyacrylamide gels casted between low fluorescence glass
plates (Amersham Bioscience). Parallel amplification products
Frontiers in Plant Science | www.frontiersin.org 3January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
FIGURE 1 | Poinsettia inflorescence. (A) Photo of a fully developed poinsettia inflorescence in aerial view. (B) Schematic drawing of the inflorescence showing 1st,
2nd, 3rd, and 4th order flowers in a profile view.
FIGURE 2 | Different cut positions (cp) (A) and development of the abscission zone (B–E). (A) The positions of the decapitating poinsettia cyathia (flowers) to
induce controlled abscission. We have used cp2 in all experiments reported here. (B) Day 0 (control). (C) Day 5. (D) Day 6. (E) Day 7. Arrows indicate the AZs on the
flower pedicels.
FIGURE 3 | Micrographs of poinsettia pedicels. (A) A control without abscission. (B) An AZ induced by decapitation of flower bud at the right cut position. (C) A
naturally formed AZ. Scale bars are 400 µm. Arrows indicate the AZs on the flower pedicels.
(fluoricin or rhodamin) were separated on different gels and
scanned on Typhoon 8600 (Amersham Bioscience, UK) using
the following laser settings: flouricin; excitation 495 nm, emission
520 nm, green laser (532 nm), emission filter 526 SP and
rhodamin; excitation 570 nm, emission 590 nm, green laser
(532 nm), emission filter 580 BP 30. Kapton tape (Amersham
Bioscience, UK) was used for gel orientation. The digital gel
image was printed on paper size 1:1 and used for gel orientation
and band identification. The AFLP gels were scored visually
in duplicates, and the differentially expressed bands excised
from the gel. DNA from the fragments was eluted in distilled
water, precipitated and reamplified by PCR as described by
the fluorescent DD kit manufacturer (GenHunter, USA). The
PCR product was purified on an agarose gel. Single bands
larger than 200 bp were excised and subcloned into plasmid
pCR 2.1-TOPO (Thermo Fisher Scientific, USA) and chemically
transferred into Top10 Escherichia coli cells as described by the
manufacturer. Twelve positive E. coli colonies were selected,
Frontiers in Plant Science | www.frontiersin.org 4January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
restreaked, and analyzed by colony PCR. The inserts were
confirmed by separating the PCR products on an agarose gel.
Plasmids from eight E. coli clones were prepared using Montage
plasmid miniprep 96 (MERK Millipore, Germany) and Jetquick
Plasmid Purification Spin Kit (Genomed, Germany). The insert
was sequenced with BigDye Terminator Cycle Sequencing Kit
v3.1 and ABIprism 3100 (MERK Millipore, USA). Sequences
were visualized and processed in BioEdit sequence alignment
editor (Hall, 1999).
Bioinformatics and Putative Homology Identification
of Sequences
To identify homologous sequences of those differentially
expressed during induced secondary pedicel abscission in
poinsettia, different Blast [BlastN 2.2.30+, Database GenBank
no (All GenBank +EMBL +DDBJ +PDB sequences) and
standard settings] methods were used (Altschul et al., 1990). We
also used Blast2Go to examine the ontology. All the Blast searches
were repeated on August 30 2015. Most commonly used was
Discontinuous MegaBlast (Morgulis et al., 2008), BlastN, and
BlastX 2.2.32+.
Real-Time qRT-PCR for Verification and
Quantification
Real-Time qRT-PCR primers were constructed using Primer
Express (Thermo Fisher Scientific, USA; Supplementary Table 1).
The primers were tested on both cDNA and genomic DNA. Real
time qRT-PCT analyses for the short sequences were performed
with a 7900HT Fast Real-Time PCR System (Thermo Fisher
Scientific,) using SuperScript III Platinum Two-Step qRT-PCR
Kit (Thermo Fisher Scientific). Transcript levels were normalized
using poinsettia 18S primer pair to make correlative gene
expression measurements (Table 1). All reactions were done in
triplicate using two different biological preparations.
qRT-PCR reactions for the whole gene sequences were
performed with a 7700 Real time PCR system (MERK Millipore)
used Platinum R
SYBR R
Green qPCR SuperMIX-UDG with ROX
according to the manual (Thermo Fisher Scientific). The qRT-
PCR was carried out in 25 µl reactions using 2.5 µl of diluted
template, 0.5 µl of each primer (stock10 µM- final 0.2 µM) and
1x SYBR Green reaction mix. Template, cDNA, were diluted
10−1and 10−4for the reactions included RACE-primers and
18s primers, respectively. Triplicate repeats of each reaction
and a template control of nuclease free water was carried out.
Amplifications were performed with the following program:
95◦C for 2 min followed by cycles of 95◦C for 15 s and 60◦C,
30 s. After amplification a melting curve analysis was performed.
An internal reference dye, ROX, was included in the Platinum
SYBR Green buffer to normalize the fluorescent reporter signal
in real-time quantitative RT-PCR.
Whole Gene Sequencing by 5′Rapid
Amplification of cDNA Ends (5′Race)
The total RNA from the AZ-tissue in poinsettia was used
as template to synthesize first strand cDNA in a reverse
transcription reaction using modified oligo (dT) primer. Gene-
specific primers (GSP) were constructed from seven of the
DD-sequences, using Primer 3 Software (http://frodo.wi.mit.
edu). For the GSP to find the correct cDNA-sequences the RACE
reaction was optimized to isolate the complete gene sequence.
The seven sequences were picked on the basis of showing
interesting DD differences, but too short for qRT-PCR and Blast
searches initially. The primers used are shown in Table 2.
The 5′-RACE was performed according to BD SMART™
RACE cDNA Amplification Kit (BD Biosciences Clontech,
USA). The RACE products were characterized by cloning and
sequencing. The 5′RACE products were cloned into the pCR R
4-
TOPO vector and transformed into competent TOP10 E. coli cells
(Supplementary Table 2). The inserts were sequenced to verify
that the amplified product had a segment of the same sequence
as in the DD product and to obtain sequence information from
the RACE product and its orientation in the 4-TOPO vector
(Supplementary Table 3).
RNA in situ Hybridization of Poinsettia and
Pea
Flower buds of poinsettia ‘Lilo’ induced for abscission and
control plants were cut into small pieces (2–3 mm-thick) which
were immediately fixed using 4% paraformaldehyde in sodium
phosphate buffer pH 7.0 and 0.1% (v/v) Tween 20, under vacuum
for 1 h, and left overnight at 4◦C. After fixation, samples were
washed in saline, dehydrated through a graded ethanol series,
and embedded in paraplast (Sakura, Japan) using Tissue-Tek
VIP Jr automatic embedding machine (Sakura, Japan). The
10 µm-thick sections were collected on poly-L-lysine coated
slides.
Similarly, the primary abscission zones of the wild type peas
(JI 116 and JI 2822), as well as the two def mutant peas (JI
1184 and JI 3020) were harvested and given the same fixation
and embedding as the poinsettias above. The def gene is a single
locus gene (Ayeh et al., 2011) and the abscission zone between
the funiculus and the pea was characterized (Ayeh et al., 2009) in
both mutants (with abscission-less zones) and both tall and dwarf
wild types.
The 20 selected sequences for hybridization were reamplified
from the pCR2.1TOPO constructs using their respective AFLP
DD primers (Supplementary Table 4) and inserted into the
pCR4 TOPO plasmid using the TA overhang cloning technology
(Thermo Fisher Scientific, Germany). Single-stranded RNA
probes were synthesized after linearization of plasmid DNA,
using NotI and SpeI restriction enzymes for sense and antisense
probes, respectively. Sense and antisense probes labeled with
digoxigenin (DIG). dUTP were prepared using T3 and T7 RNA
polymerases (Roche, Germany), respectively.
The 10 µm-thick sections on poly-L-lysine coated slides were
dewaxed using Histoclear (Cell Path, UK). The sections were
treated with Proteinase K (1 µg ml−1) and acetylated using
0.5% acetic anhydrine (Sigma Aldrich, Switzerland) in 0.1 M
triethanolamine and followed by washing in PBS solutions and
dehydrations using a graded ethanol series. Per slide, 100-
200 ng labeled antisense and sense riboprobes were applied in
40 µl hybridization solutions in a humid chamber for 16 h at
50◦C. Hybridization was performed using hybridization solution
Frontiers in Plant Science | www.frontiersin.org 5January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
TABLE 1 | Real-time RT-PCR results and similarity searches of AFLP DD clones from poinsettia pedicel secondary abscission.
DD# Primers GenBank Size Real time RT-PCR resultsaDiscontinuous MegaBlast, BlastN, or BlastX
used Acc. # (bp) Days after abscission induction
01234567DisteAccession no. Description Species Id (of 100%) E-value
025a 29A EB647682 194 GQ856147 Unknown mito. genome region Citrullus lanatus 91b9e-50
006a 33G EB647681 269 XP_007012396 Photosystem II subunit X Theobroma cacao 86d3e-12
AY340642 UVB-repressible protein Trifolium pratense 79b5e-31**
220_ 29C EB647701 515 XM_002528833 Transcription factor Ricinus communis*81b5e-26
084_ 40A EB647705 456 AEJ07931 Opie3 pol protein Zea mays 41d4e-24
090a 26A EB647690 255 XM_011094475 Organ-specific protein Sesamum indicum 71c0.020
AY188755 Atypical receptor-like kinase Zea mays 86c8.2**
038b 62C EB647683 233 CP011890 Unknown region of chr. 5 Ovis canadensis 86c0.005
304b PGTC EB647707 217 HQ874649 Unknown mito. genome region Ricinus communis*96b1e-61
057b 34A EB647687 412 YP_002720125 Cytochrome f subunit (PetA) Jatropha curcas*96d1e-65
208_ 27A EB647706 443 AY794600 Chloroplast tRNA-Leu E. pulcherrima*99b3e-98
136b GlcG EB647697 447 XM_002512633 fk506-binding protein Ricinus communis*81b3e-47
045c 1C EB647684 347 XM_002510884 Uridylate kinase Ricinus communis*83b2e-35
140b PG0 EB647699 306 XM_002532624 eIF3E (translation initiation) Ricinus communis*84b2e-28
103_ GlaG EB647693 434 XM_012213718 CASP-like protein Jatropha curcas*77b8e-36
003a 33A EB647680 279 FJ228477 α-tubulin Betula pendula 92b2e-21
301_ PGA EB647702 448 XM_002512412 RNA binding protein Ricinus communis*74b1e-20
060c 34A EB647688 304 XM_010526012 V-ATPase G subunit 1 Tarenaya hassleriana 83b2e-09
320b PGTG EB647704 218 BT092277 unknown mRNA Glycine max 87b6e-07
082a 40G EB647689 269 XM_002523025 Putative β-glucosidase Ricinus communis* 72c1e-06
101_ GlaG EB647692 426 XM_002511291 Histone deacetylase Ricinus communis*71c6e-06
140a PG0 EB647698 307 AM932356 Partial tRNA-Leu gene Typhonium giganteum 73c1e-05
091b 26G EB647691 247 CP001685 Glucan endo-1,3-β-D-glucosidase Leptotrichia buccalis 90c0.019
047b 6C EB647685 236 XM_002305663 Proteasome beta subunit B family protein Populus trichocarpa 82b7e-08
130_ GlcG EB647696 297 AY792209 NADH dehydrogenase SU 4L Ceratitis neostictica 81c3.5
304a 8C EB647686 299 – No significant matches – – –
304a GlaG EB647694 343 – No significant matches – – –
(Continued)
Frontiers in Plant Science | www.frontiersin.org 6January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
TABLE 1 | Continued
DD# Primers GenBank Size Real time RT-PCR resultsaDiscontinuous MegaBlast, BlastN, or BlastX
used Acc. # (bp) Days after abscission induction
01234567DisteAccession no. Description Species Id (of 100%) E-value
304a GlcG EB647695 268 - No significant matches – – –
304a GlcG EB673117 249 - No significant matches – – –
204c 27G EB647700 214 XM_012216503 Proteasome subunit alpha type-1-B-like Jatropha curcas* 72c1e-10
304a PGA EB647703 463 – No significant matches – – –
Similarities found in DNA sequences from chromosome,mitochondria,chloroplasts or bacteria. List of primers in Supplement Materials.
aVisualization of Real-time RT-PCR results relative to 18S expression of two individual experiments. The highest expression is black and the lowest expression is white, showing decreasing nuances of orange for descending steps of equal
size (8 nuances/steps).
bDiscontinuous MegaBlast [BlastN 2.2.32+, Database GenBank no (All GenBank +EMBL +DDBJ +PDB sequences) and standard settings 30 August 2015.
cBlastN [BlastN 2.2.32+, Database GenBank no (All GenBank +EMBL +DDBJ +PDB sequences) and standard settings 30 August 2015.
dBlastX Database no and standard settings 30. August 2015. Reading frame (RF) +1 of the Acc. # EB647681, +3 of the Acc. # EB647705 and EB647687.
eInternal control: Distal part of the abscising pedicel above the abscission zone at Day 0.
*Euphorbiaceae family member.
**From BlastX in Sept 2012, incl because they give an additional indication of function.
TABLE 2 | AFLP DD and RACE primers, results and similarity searches for full-length genes in poinsettia secondary abscission.
DD# Primers used Primers used AFLP DD resultsaBlastXb
for DD for 5′RACE
Days after abscission induction
0 1 2 3 4 5 6 7 Accession no. Description Species Id (of 100%) E-value
135 5′gactttccgtcccccatccctcatc 3′+– – – – – – – XP_002518733 Polyadenylate-binding protein 2 Ricinus communis*86 8e−155
133a 5′cagagtgccatgtcacctcgaacct 3′–+– – – – – – NP_176471 Lys-specific histone demethylase 1-1 A. thaliana 73 8e−138
Predicted Lys-specific histone demethylase 1-1 Prunus mume 79 0.0
108 5′cccccaggcaacaaataagagtc 3′+– – – – – – – XP_002530011 V-SNARE protein Ricinus communis* 91 2e−126
122 5′catccccagtacgaatcccaatacg 3′–+– – – – – – XP_012085745 Bidirectional sugar transporter N3 Jatropha curcas*76 4e−136
82b 5′ggcaacaaccgcagaaagtcgtaac 3′–+– – – – – – XP_002522811 Glycine-rich RNA-binding protein Ricinus communis*74 1e−44
105 5′ggccatgcaacatacaaccatc 3′+– – – – – – – NP_198917 DNA-directed RNA Pol. II su. K A. thaliana 88 6e−24
32a 5′gctctagctccatcaacccccaaag 3′+ + + + NP_001077782 DVL3 A. thaliana 58 1e−5
Similarities found in DNA sequences from chromosomes.
aReconstruction of visual screening of the result where +is upregulated and −is downregulated.
bBlastX (BLASTX 2.2.32+) Database no and standard settings 30 August 2015. Reading frame (RF) +2 of the Acc. # NP_198917, NP_001077782, XP_002522811 and XP_002518733. RF +1 of the Acc. # XP_012085745 and
NP_176471. RF +3 of the Acc. # XP_002530011.
*Euphorbiaceae.
Frontiers in Plant Science | www.frontiersin.org 7January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
containing 50% formamide, dextran sulfate, Denhardt’s solution,
tRNA, and 10 ×hybridization buffer (3 M NaCl, 0.5 M Na2HPO4,
10 mM EDTA). After hybridization, sections were washed in
SSPE and NTE buffer. After RNase treatment, sections were
blocked and probe was detected using anti-digoxinenic-alkaline
phosphate-coupled antibody. The hybridized DIG-labeled probe
and target was detected by anti-DIG antibodies conjugated with
alkaline phosphatase (Butler et al., 2001). Sections were visualized
by applying 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and
nitroblue tetrazolium salt (NTB; Promega, USA) diluted in
alkaline phosphate buffer. Sections were photographed using
bright field optics (Leica, Germany).
RESULTS
Genes Differentially Expressed during
Secondary Abscission in Poinsettia and
their Putative Identity
To elucidate on secondary abscission related genes, AFLP DD
analysis provided a database of poinsettia cDNA sequences
involved in AZ development and the induced secondary
abscission process. The total RNA samples used in the AFLP
DD screening were prepared from AZ tissue at eight different
stages: every 24 h from Day 0 (control) and until abscission on
Day 7. After 3–4 days, the first visible signs of the forthcoming
abscission event could be seen as a lighter green band at the place
of the AZ and the onset of senescence related color changes of
the distal end of the flowers (Figures 2B–E). On Day 7 the distal
end normally abscise after a coordinated separation of the cell
layers in the AZ. Generally, the induction of flower abscission
in poinsettia by decapitation (Figure 2A) has an accuracy of ±1
day (data not shown).
Our screen gave us 126 gene transcripts, either up- or
downregulated, an example gel from the DD is shown in
Figure 4. The sequences which were >200 bp (74 sequences)
were also run in a Real-Time quantitative assay (qRT-PCR),
a selection of the most interesting are presented in Figure 5.
Seven others, which were of particular interest due to their
expression profiles in the DD, were then put through a 5′RACE
and whole gene sequencing to include them in assay; making a
total of 81 sequences tested. Almost half of the first 74 (35) were
confirmed to be significantly differentially expressed relative to
the ribosomal subunit 18 (18S) in the qRT-PCR assay. BLAST
analysis gave a decent similarity hit for 29 sequences, where 18
matched beyond an expectation value of E−4(Table 1). Eight
of the sequences had no matches in databases, some of these
were strongly up- or downregulated as early abscission events.
They are putatively very interesting gene sequences to study
further to find their specific functions, as potentially unknown
AZ-genes. From the 5′-RACE-extended sequences we obtained
matches beyond E−5for all seven, some these also highly relevant
(Table 2).
Blast “Top-hits” species distribution chart obtained by
performing Blastx to NCBI, using Blast2go program, showed only
two hits to Theobroma cacao and one hit to the following species:
Aegolops tauschi, Nicotiana sylvestris, Zea mays, R. communis,
FIGURE 4 | DD-PAGE sections cDNA PCR products that were
differentially expressed. Poinsettia flower abscission zone total RNA
samples were prepared from Day 0 to Day 7(0–7). Left column indicate
specific clone numbers. Arrows are indicating specific bands isolated.
Datora stramonium and Medicago truncatula. Of these species,
R. communis belongs to the same family as poinsettia, namely
Euphorbiaceae. Examining Table 1,Japtropha curcas also belongs
to the same family. Although many exact hits in Tables 1, 3,
Jatropha does not reach as high overall as the abovementioned
species, and does not have more than one hit in Blastx.
Table 3 provides the percentage of up- and down-regulated
genes belonging to each proposed phase in abscission of
poinsettia. The majority of the significant differentially expressed
genes were upregulated during the first or second day after the
induction of abscission, in phase I. At this stage, it is not possible
to see any changes in the anatomy of the pedicel or any color
changes. Many of the genes can be functionally classified to
energy metabolism, cell growth and division.
We have also identified two sequences similar to cell wall
degrading enzymes (glucan endo-1,3-β-glucosidase and another
putative β-glucosidase), some sequences, which can be associated
with endoreduplication (fk506-binding protein and α-tubulin),
as well as a putative signal transducer.
Our specific primers toward polygalactorunase and β-1,3-
glucanase, showed differences in the AFLP screens, but could
not be identified as such through the BLAST searches. We thus
consider them as successful arbitrary primers that were all able
to produce DD bands picked up for identification. Regarding the
32 arbitrary primer from GenHunter, large differences could be
observed in their ability to give differentially displayed bands,
only 10 out of 32 primers did. The 36 different arbitrary primers
used would statistically give ∼75% of all expressed cDNAs, based
on calculations made by Yang and Liang (2004). In our hands,
fluorescent probed primers were just as effective as radioactive
labeled primers (data not shown), corresponding to that the
two methods have comparable sensitivity (Ito et al., 1994).
The rhodamin signal was generally slightly stronger than the
fluoricin signal. Figure 4 shows eight examples of selected DD
bands. From all DD bands, we obtained 126 sequences after
cloning the reamplified DD bands into a pCR 2.1-TOPO vector.
Frontiers in Plant Science | www.frontiersin.org 8January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
FIGURE 5 | Temporal expression patterns of poinsettia DD clones monitored by Real-Time qRT-PCR. 11Ct on the y axis refers to the fold difference of a
particular DD clone mRNA level relative to its lowest expression. Expressions were normalized to the 18S ribosomal RNA endogenous control during an induced
abscission process of poinsettia pedicel, whereas distal is an internal control sample dissected from above the AZ.
Frontiers in Plant Science | www.frontiersin.org 9January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
TABLE 3 | Proposed division of abscission phases in poinsettia (0-IV), the
corresponding # of days after decapitation and the percentage (%) of the
225 DD bands, which fall into each phase, either up- or downregulated.
Corresponding days
after decapitation
0 (Control) 0–2 2–4 4/5–7 7
Phases in abscission 0 I II III IV
% sequences
Upregulated
6 3 8 16 2
4
19
11
% sequences
Downregulated
29 3
126 of these were successfully cloned and sequenced.
When sequenced, product lengths were between 180 and 520
bp (Munster, 2006). Some bands where reamplified as a shorter
sequence than the one initially picked out from the AFLP DD
gel, this can be explained by the fact that the primers used are
arbitrary and the PCR conditions are changed from AFLP to
reamplification.
An overview of all bands picked up in the AFLP DD (225 in
total) shows that 29% (65/225) of the clones derived from DD
bands are downregulated after Day 0, in Phase 0.3% (7/225) are
down-regulated after Day 2, after Phase I. Approximately 6%
(13/225, Phase 0) and 3% (7/225) of the bands were upregulated
at Day 1 and 2, respectively, taken together about 9% of the DD
bands were upregulated in Phase I. During Phase II (Days 2–4),
8% (18/225) of the DD bands were upregulated. On Days 3–5
(Phase II-III), 4% (10/225) of the DD bands were upregulated.
During Phase III (Days 4/5–7), 16% (35/225) of the DD bands
were upregulated. Two percent (5/225) of the DD bands were
upregulated at Day 7, in Phase IV. In addition, 19% (43/225) and
11% (24/225) of the bands were seen upregulated at Days 1–7
(after Phase 0) and Days 2–7 (after Phase I), respectively. Of these
bands, 126 were successfully cloned and sequenced.
For all sequences, similarity to known protein and
DNA sequences were found using different Blast methods
(Discontinuous MegaBlast, BlastN and BlastX) and standard
settings (Tables 1, 2). Twenty-two of 29 sequences generated
putative similarities, out of which 13 have a very high similarity
(E-value <e−21), five have high similarity (E-value e−10–e−4),
and four have a less high similarity (E-value e−3–8.2). The latter
ones are also reported due to the fact that short sequences can
show relevant hits with high E-value (Information, T.N.C.F.B.,
2012). This can be illustrated by the similarity hit on Glucan
endo-1,3-β-D-glucosidase in Leptotrichia buccalis by sequence
91b (Acc.# EB647691) with an E-value of 8e−3(Table 1). Two
of the sequences did not have a significant similarity, while
two were annotated as unknown mRNA and one as unknown
mitochondric region. In addition to the possibility of the
two with no match, being a new and unknown sequence, a
contributing factor might be the use of poly A selective primers,
amplifying the non-translated UTR-3′region.
The identified DD genes from Tables 1, 2 can be
grouped according to the following biochemical functions:
(1) Transcription [Transcription factor (XM_002528833)
and Opie3 pol protein (RTV_2, AEJ07931) and DNA-
directed RNA Pol. II su. K (NP_198917)]. (2) Signal
transduction [Organ-specific protein/Atypical receptor-like
kinase (XM_011094475/ AY188755), DVL3 (NP_001077782)]
and (3) translation/protein synthesis (eIF3E (translation
initiation (XM_002532624), Chloroplast tRNA-Leu (AY794600),
RNA binding proteins (XM_002512412 and XP_002522811),
Lys-specific histone demethylase 1-1 (NP_176471), and
Polyadenylate-binding protein 2 (XP_002518733), Proteasome
subunit alpha type-1-B-like (XM_012216503)]. (4) Energy
(V-ATPase G subunit 1 (XM_010526012) and Bidirectional
sugar transporter N3 (XP_012085745), energy metabolism
(photosynthesis; Cytochrome f subunit (YP_002720125),
respiration; NADH dehydrogenase SU 4L (AY792209),
and unknown mitochondrial DNA regions (GQ856147 and
HQ874649) and proteasome metabolism (Proteasome subunit β
type-7-B-like (XM_002305663)]. (5) Cell growth and division
[α-tubulin (FJ228477), V-SNARE (XP_002530011), and Histone
deacetylase (XM_002511291)] and (6) Cell structure [cell wall
degradation (Glucan endo-1,3-β-D-glucosidase (CP001685
and XM_0022523025)]. (7) Defense/Disease [Photosystem II
subunit X/UVB-repressible protein (XP_007012396/AY340642)
and an uncharacterized membrane protein (CASP-like protein,
XM_012213718)]. Sequence 136b with the best similarity on
the Cytochrome f subunit (1e−47) also has an alternative and
interesting similarity in immunophilin (NP196845 (4e−24).
It is noteworthy that the length of the sequence did not seem to
have an influence on the E-value (Table 1). Only a few sequences
a little longer than 200 bp were not able to give any similarities
to the GenBank databases using different available programs
(August 2015).
RNA in situ Hybridization of Selected Sequences
Twenty of the DD sequences from Table 1 were also run through
a RNA in situ hybridization to investigate further the spatial and
temporal gene expression for these. The twenty were picked on
the basis of which of the 29 gave good probes for RNA in situ. All
the RNA in situ results verified them being expressed in the AZ
and not elsewhere (data for six of them are shown in Figure 6).
These six have been chosen based on the results from the other
RNA in situ experiments, where these riboprobes were hybridized
with sections of the four pea accessions from John Innes Centre,
UK. These six riboprobes are on top of Table 1 and the DD # are
in bold.
The six genes (6a, 25a, 38b, 84, 90a, and 220) are all
differentially expressed both in poinsettia and in pea. The positive
gene expression in antisense samples (Figures 6A,C,E,7A,B,E,F)
are seen as a dark blue coloring on the cells compared to no
expression (light blue cells) in sense samples (Figures 6B,D,F,
7C,D,G,H). Ayeh (2008) showed that poinsettia riboprobes
could be expressed in the AZ or the ALZ of the wild type and
def-mutants (both the tall and the dwarf accessions). We found
that five of these riboprobes were present only in the mutant
peas (6a, 25a, 38b, 84 and 220), while only one was expressed in
the wild type (90a).
Similarly, Rasolomanana (2008) was able to demonstrate
through RNA in situ hybridization on sections of poinsettia
pedicels that two of these six riboprobes (90a and 38b) are
Frontiers in Plant Science | www.frontiersin.org 10 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
FIGURE 6 | RNA in situ hybridization six transcripts in Euphorbia pulcherrima (poinsettia) flower pedicels. Control Day 0 (A, B), Day 5 (C, D), and Day 7
(E, F) after abscission was induced by decapitation. Longitudinal sections were hybridized with antisense (A, C, and E) or sense (B, D, and F). The six DD riboprobes
#6a, 25a, 38b, 84, 220, and 90a. Bars: 100 µm.
Frontiers in Plant Science | www.frontiersin.org 11 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
FIGURE 7 | RNA in situ hybridization for Pisum sativum using the six
poinsettia riboprobes from the poinsettia DD. (A) The antisense RNA
(Continued)
FIGURE 7 | Continued
localization of the def mutant JI 1184 for each of the six DD riboprobes # 6a,
25a, 38b, 84, 220, and 90a.(B) are the higher magnification of the As. (C) are
the sense (control probe) of def JI 1184. (D) higher magnification of (B).(E)
antisense Def wild type JI 116. (F) higher magnification of (E).(G) sense Def
wild type JI 116. (H) higher magnification of (G). Scale bars: A, C, E, and G,
12.5 µm; B, D, F, and G, 25 µm.
involved with the onset of abscission during the first 2 days.
Another two (84 and 220) are associated with early-mid-term
expression of the process. The last two (6a and 25a) were also
expressed toward the end of the separation.
DISCUSSION
E. pulcherrima (poinsettia) can be used as a model system to
elucidate on secondary abscission, induced by decapitation of
the flower bud and studied through the 7-day period before
abscission. When examining the natural abscission of a poinsettia
bud, (Figure 3C) with that of a decapitated bud (Figure 3B), we
can clearly see the similarities. The abscission process starts from
the epidermis around the whole pedicel, and as the AZ develops
toward the core of the pedicel, we see that the pedicel has
continued to grow through cell division and cell elongations of
the surrounding tissues, and the AZ is pushed upwards, forming
a cone shaped stub as the bud falls off on Day 7. This cone shaped
stub is very characteristic of poinsettia abscission. The control
bud (Figure 3A) has not been decapitated and is the same age and
from the same third order inflorescence as C. This bud has not
reached the mature stage of the flower in the natural abscission
(Figure 3B) yet, and shows no sign of developing AZ.
Although many plants have flowers and/or other plant parts
that abscise, we know of few systems as accurate and foreseeable
as this inducible poinsettia model system. Other model systems,
as pea leaves (McManus et al., 1998), impatiens (Warren Wilson
et al., 1986), and tomato (Kalaitzis et al., 1995), are all prepared
explants in vitro and not in planta, as for this poinsettia model
system. This study is also unique in the sense that we have
never seen a comparison between so distantly related species
showing consistent results with respect to elucidating upon the
genes involved in abscission, and at the same time comparing a
system for primary abscission using mutants with an inducible
system for secondary abscission. There is a large potential for
further elucidation into the significance of the genes in this
study, since poinsettia and pea are so far apart evolutionarily
(Bennett et al., 2000). We have revealed at least 18 putative genes
involved in the poinsettia secondary abscission process, many of
which are expressed differentially also for primary abscission in
peas. Earlier studies have tried to unravel the primary abscission
process on a broader level using Arabidopsis as model (Wang
et al., 2006), recently also González-Carranza et al. (2012).
Abscission is a complex process to unravel and we have
compared poinsettia abscission with abscission-less (AZL)
mutants first in Arabidopsis, with the interesting gene
inflorescence deficient in abscission (ida) T-DNA mutant,
identified as a novel putative ligand in plants (Butenko et al.,
Frontiers in Plant Science | www.frontiersin.org 12 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
2003). The 35S:IDA line overexpressing IDA results in earlier
abscission of floral organs and additionally abscission of organs
that are not normally shed, like the whole silique. There is
evidence that IDA encodes for arabinogalactan (Stenvik et al.,
2006), a protein also found in naturally abscission surfaces. In
our hands, poinsettia does not have any ida or ida-like genes.
Although similar abscission processes take place in both species,
the organs that abscise are not the same, since Arabidopsis sheds
its petals, while poinsettia abscises the whole floral organ by
developing an AZ on the pedicel. In Arabidopsis the pedicels do
not abscise and there is only a rudiment of an AZ left at the base
of the pedicles in this species, showing that AZ in Arabidopsis
petals are primary (pre-defined). When we failed to find ida
in poinsettia, we turned to the AZL def mutants in pea (Ayeh
et al., 2011). The pea system demonstrated expression of highly
conserved poinsettia sequences involved in pea abscission.
Although poinsettia and pea are distantly related and the
sequence homology is not expected to be high, we used our
poinsettia in situ probes on pea def mutant tissue and obtained
positive hybridization results (Ayeh, 2008).
Gene Sequences in Common for Pea and
Poinsettia during Abscission
We will briefly discuss the genes with sequences common
to poinsettia and pea abscission, i.e., common for primary
and secondary abscission in our models. The potentially
most important gene sequence could be 90a (XM_011094475/
AY188755). This riboprobe is only expressed in the wild
type pea, and is upregulated during the first 2 days after
poinsettia decapitation. This is a strong indicating that this
gene is necessary for abscission to takes place, both in pea and
poinsettia. Blast search revealed that 90a is close to an accession
encoding an organ-specific protein (XM_011094475). Additional
information, from the Blastx we did in 2012, gave a high
similarity also to an atypical receptor-like kinase (AY188755).
Since this is such a prominent gene sequence in our results, with a
possibility that this may be one of the genes controlling abscission
in plants, it would be very interesting to follow up on this.
DD 38b is a riboprobe expressed from the start of the
abscission process and then downregulated from Day 3 in
poinsettia. It is also expressed in the non-abscising mutants of
pea. This suggests that this gene could be prohibiting abscission
from taking place and the early expression pattern suggests a
putative equally important, but opposite role as 90a in starting
the cascade of events leading to abscission.
DD 6a (description Photosystem II subunit X) is found in
both poinsettia and pea. Liao and Burns (2012) have found that
Photosystem II subunit Q, X, P, and K had a two-fold increase
in huanglongbing (HLB)-infected Citrus sinencis trees, where this
infection was highly associated with both leaf and fruit abscission.
They speculate whether this could be due to a breakdown of the
photosynthetic apparatus since phloem plugging leads to starch
accumulation in the leaves. In poinsettia, this gene is upregulated
in Day 1 (after decapitation), before any visible signs of the AZ. In
an AZ there is certainly a stop in the transport of photosynthetic
products as the detachment is starting from the outside of the
pedicel and moves inwards as the abscission process progresses
during the week from decapitation to detachment, as can be seen
in Figure 2, however, this is not happening until Days 4–6. Our
results suggest that it is the gene for Photosystem II subunit X
which is shutting down photosynthesis as an early event, and
then there is a breakdown of the transport of sugars, causing the
pedicel to start to yellow and senesce after another 2–4 days.
DD # 084 is annotated to Opie3 pol protein found in Zea mays.
It is a receptor kinase, belonging to a large gene family in plants
with more than 600 members in Arabidopsis. This gene family is
said to be involved in a broad range of developmental processes,
including abscission (Yu et al., 2003).
DD # 220 has a high similarity (81% and 2e-26) to a putative
transcription factor from R. communis, also belonging to the
Euphorbiaceae family, making this similarity even more likely. It
has a strong upregulation in Day 2 and may be another putative
key regulator. Transcription factors are often the key to the whole
cascade of events for such complicated processes as abscission. As
yet, we do not know which transcription factor it could be.
DD # 6a is expressed all through the abscission event, but
is at its strongest upregulated on Day 1 of all the riboprobes,
except # 82a, which also has its peak on Day 1. This is very early
on, only 24 h after decapitation. It resembles a UVB-repressible
protein from Trifolium pretense. This may have implications for
the handling of stress in plants, as it is well-known that UVB
induces stress and DNA damage in organisms.
DD # 25a is barely expressed on the day of decapitation,
but expression increases strongly the day after. It resembles a
gene from an unknown mitochondrial region in Citrullus lanatus.
Very hard to say anything more on what this may imply, but the
sequence being expressed in both poinsettia and wild type pea,
suggests a closer look at the function.
A Proposed New Phase Division for
Secondary Abscission
The pioneers of using the model system in Arabidopsis for
studying abscission (Bleecker and Patterson, 1997), proposed
to divide the abscission process into phases. They described
this very well for primary abscission in Arabidopsis. However,
we find that the development and morphology during induced
secondary abscission in poinsettia needs to be divided with a
higher resolution. We describe in a previous study the sequential
transformations in the detection of cell wall polysaccharides
during this induced abscission event (Lee et al., 2008) in the
poinsettia model system. Based upon these results, as well as the
present results on gene expression and the sequence of events
here, we propose six phases: from Phase 0 to Phase V (Table 3).
The induction phase (phase 0) is the induction and localization
of the secondary abscission zone position, the following phase
I is the where the cells become receptive to the signaling of the
onset of the abscission process and where we observe the first
biochemical changes (Lee et al., 2008). Phase II is characterized
by cell divisions and the onset of rounded cells and continued
biochemical changes, as can be seen by color changes in the distal
part of the pedicel. Major biochemical restructuring characterize
Phase III, where the ring marking the AZ is clearly visible and
the analysis show de-esterification of homogalacturonan and the
breakdown of cellulose, arabinose and other pectins preparing
Frontiers in Plant Science | www.frontiersin.org 13 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
for the separation of the organ (Lee et al., 2008). Following the
previously described breakdowns, the cell walls are enriched with
xylan and lignin, probably to seal off the AZ once the distal part
has been removed. We propose to call this Phase IV. Finally,
Phase V represents the detachment of the organ. We have related
the annotated gene sequences below to these proposed, more
detailed phases of abscission.
Annotated Gene Sequences Upregulated
at the Onset (Phase I)
The genes differentially regulated just after the time of
decapitation are putatively the key regulators of abscission.
Naturally, these are of utmost interest. Main indications from
the gene expression analysis (DD +qRT-PCR +RNA in situ)
gives the following zone specific regulations: The energy state
is especially upregulated on Day 1 and 2, indicated by several
hits on photosystem II [XP_007012396 and XM_002512633
(fk506-binding protein)] and mitochondrial genome (GQ856147
and HQ874649) related genes/proteins. Protein metabolism is
specifically upregulated during Day 2 and 3, indicated by
hits on a transcription factor (XM_002528833), transportRNA
(AY794600), translation initiation (XM_002532624), and RNA
binding protein (XM_002512412) related genes/proteins. There
is initially (Days 0–2) an increase in cell divisions going on,
but this is followed by downregulation as indicated by Histone
deacetylase (XM_002511291) and α-tubulin (FJ228477). All
these up-and downregulations are as expected from previous
observations in the microscope on cells changing shape as the
ordinary pedicel cells are initiated to form AZ cells, which are
smaller, more dense and less vacuolated (Figure 3).
From Tables 1, 2, Day 2 is regulatory very important,
where overall central proteins (strongly upregulated) can be
the proteasome-like genes upregulated Day 2 (XM_012216503
and XM_002305663). We also find the V-ATPase G subunit 1
(XM_010526012) really strongly upregulated on Day 2. Burr et al.
(2011) support that V-ATPase is associated with abscission in
Arabidopsis.
Another strong upregulation is the Atypical receptor-like
kinase from Z. mays (AY188755). Receptor-like kinases regulate
a range of signaling pathways, many of which have been shown
to be involved in abscission, as reviewed by Taylor and Whitelaw
(2001). Since then, numerous groups have shown the importance
of receptor-like kinases in abscission, examples can be: in
Arabidopsis (Wagner and Kohorn, 2001; Butenko et al., 2003;
Diévart and Clark, 2003; Cai and Lashbrook, 2008; Cho et al.,
2008; Liljegren et al., 2009; González-Carranza et al., 2012) and
in tomato (van der Hoorn et al., 2005).
We had another hit for an Organ-specific protein from
Sesamum indicum. This up-regulation is extreme and it is bound
to be of importance. This is one of the common genes for
poinsettia and peas described earlier (90a) and hence extremely
interesting.
A much better described hit is the Lysine-specific histone
demethylase 1-1 (Table 2) from Arabidopsis (DD # 133a). This
enzyme is closely associated with the gene Flowering Time Locus
(FLC), which is in the core of events for Arabidopsis flowering in
the complex pathway involving particularly temperature and day
length. The enzyme is involved in H3K4 methylation of target
genes, including FLC and FWA. We also had a predicted hit (e=
0.0) with Prunus mume with the same enzyme, confirming it.
Annotated Gene Sequences
Downregulated at the Onset (Phase I)
The downregulated proteins can be equally important, such as
Cytochrome f subunit (PetA; YP_002720125). Cytochrome F is
a crucial component of the photosynthetic electron transport
chain of higher plants. The subunit PetA is one of four major
subunits. It seems like photosynthesis is restricted already after
Day 0, the day of decapitation. This makes sense as the bud has
started on its road to doom, and no longer needs to spend energy
on photosynthesis. The yellowing of the pedicels become visible
around Days 3–4 and could be due to the downregulation of
this gene.
Another downregulated gene (DD #103) codes for CASP-
like protein (XM_012213718). Roppolo et al. (2014) recently
reported on AtCASPL1D2, a gene encoding a CASP-like protein
expressed in the AZ of Arabidopsis. Another gene, AtCASPL2A2
is reported to be expressed in the floral organ abscission zone
(González-Carranza et al., 2012). Roppolo et al. (2014) states
that: “AtCASPL5C3 is expressed in the floral organ abscission
zone as well, but its early expression in floral buds precedes the
activation of the abscission zone and the expression of most of
the genes known to be involved in floral organ shedding.” This
supports our hit on XM_012213718 from Jatropha curcas (in the
same family as poinsettia, Euphorbiaceae) as important for organ
abscission and the sequence of events precedes the activation of
the AZ. We deduce from this that CASP-like proteins may be
important for the AZ to be able to be activated, a prerequisite
for abscission, perhaps.
The combination of protein biosynthesis and degradation
suggests a protein change context during the early steps of
poinsettia pedicel leaf abscission. (Agustí et al., 2012) found
expression in the lateral abscission zone for three putative E2
ligase proteins. Uridylate kinase (XM_002510884) is an enzyme
in pyrimidin metabolism. The Unknown protein (CP011890) DD
# 45c) has a very strong downregulation.
The last sequence downregulated is a riboprobe with
resemblance to the V-SNARE proteins (DD # 108, from Table 2).
These are proteins involved in membrane assembly and hence
important in growth and development. Table 2 shows that this
gene is downregulated just after Day 0, which is a remarkable
quick response to decapitation.
Other Annotated Gene Sequences Involved
during Later Phases II-V
There is much evidence that glucanases are involved in the cell
wall degradation necessary to break down the middle lamella
and enable cell separation (Roberts et al., 2002). It is, therefore,
hardly surprising to find Glucan endo-1,3-β-D-glucosidase and a
Putative β-glucosidase (DD # 82a) popping up in the DD analysis.
The putative Putative β-glucosidase (DD # 82a) is upregulated on
Days 1–2, very early on, possibly to start the dehision of the cells.
Then, there is a downregulation for the phases II-IV, before the
Frontiers in Plant Science | www.frontiersin.org 14 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
final expression level increases. The final is possibly to degrade
the walls in phase V prior to abscission. The other DD # 91b
seems to have two peaks, one on Day 2 and another on Day 6,
in a similar fashion.
The hits for genes associated with endoreduplication (DD #
136b—fk506-protein and DD #3a—α-tubulin) are of particular
interest. Endoreduplication is the process of preparation for cell
division with the division of nuclei, but without the follow-up of
a cell division. The results are cells with multiple nuclei, which a
larger than cells with only a single nuclei (Sugimoto-Shirasu and
Roberts, 2003). We have seen the enlarged cells toward the end
of the abscission process, very much in line with what Wong and
Osborne reported for Echallium elaterium (Wong and Osborne,
1978). These enlarged cells probably aid the plant in pushing the
unwanted organ off. These genes are higher in Days 0–2, then
downregulated and end up being upregulated again in Day 7 and
in the distal parts. We have run a cell sorting of poinsettia cells
from the various days after decapitation in a flow cytometer and
find that indeed, the cells have increasing number of nuclei as the
days pass (data not shown).
DD # 208 with our only hit for a poinsettia sequence (E.
pulcherrima, Table 1) is close to a gene sequence coding for
chloroplast tRNA-Leu. This sequence codes for tRNA involved
in Leucine assembly in the chloroplasts, thus another gene
important for photosynthesis. # 208 has its peak expression on
Days 2–3 and then downregulated toward the end of events on
Day 6.
Gene Sequences Strongly Differentiated,
with Unknown Function
The riboprobes # 304a, although with a length of 463 bp, has no
significant matches in the databases as of end of August 2015.
It is strongly upregulated on Day 2 and then downregulated
again, indicating a putative gene in a signaling pathway. The
riboprobes # 113, #125b, and # 125c are all upregulated on Day
2, albeit not as strongly as # 304. However, they are all very
interesting as putative regulating genes as well. Riboprobe # 50a
behaves differently from the other unknown sequences; it is the
only one with no significant matches which is downregulated
on Day 1, culminating at the lowest level on Day 2, only
to be strongly upregulated again from Day 3 and onwards.
This is probably a gene coding for an inhibitory gene product
in abscission. Our group has also compared the results from
immunolabeling poinsettia pedicels using antibodies (JIM5,
JIM7, LM5, and LM6) to describe changes in arabinogalactan,
galacturonan, and esterification of homogalacturonan (HG) in
poinsettia. The earliest detected temporal change (Day 2) in
poinsettia was a loss of LM5 [(1→4)-β-D-galactan] epitope in
the distal region. On Day 5, the AZ lost the JIM5 (partially
metyl-esterified/unesterified HG) in the distal part of the pedicel.
The FT-IR analysis (Fourier-Transform Infra-Red microscopy)
indicated that lignin and xylan were abundant in the AZ
and that lower levels of cellulose, arabinose and pectins were
present at Day 7 compared to the initiation phase I. The
observations in poinsettia indicate that the induction of a
secondary abscission event results in a temporal sequence of
cell wall modifications involving the spatial regulatory loss,
appearance and/or remodeling of distinct sets of cell wall
epitopes. LM6 [(1→5)-α-L-arabinan] epitopes in the AZ cells
disappeared at Day 7 (Lee et al., 2008). If we compare these
findings with cell wall changes in Def wild type AZ using
monoclonal antibodies LM5 and LM6; we observed changes
in cell wall epitopes of the AZ from young to mature seeds.
The apparent absence of (1→4)-β-D-galactan and (1→5)-α-L-
arabinan epitopes in the AZ of mature Def wild type seeds may
reveal the involvement of the action of hydroxyl ions (OH−)
produced by peroxidases (Cosgrove, 2005) which is known to
cleave wall polysaccharides. In def mutant pea seeds, the absence
of an abscission event at the seed/funiculus junction may be due
to a structural defect in forming the AZ rather than changes in
the cell wall epitopes (Ayeh, 2008).
CONCLUSIONS
The majority of the significant differentially expressed genes were
upregulated during the first or second day after the induction of
abscission. At this stage, it is not possible to see any changes in
the anatomy of the pedicel or any color changes in poinsettia.
Many of the genes found can be functionally classified to energy
metabolism, cell growth and division. We have also identified two
sequences similar to cell wall degrading enzymes (glucan endo-
1,3-β-glucosidase and another putative β-glucosidase), as well as
some sequences, which can be associated with endoreduplication
(fk506-binding protein and α-tubulin), and a putative signal
transducer. Our results are very much in alignment of the
proposed model for abscission in Citrus (Agustí et al., 2012). The
comparability with Citrus strongly supports the poinsettia model
system to be suitable for further insight into gene regulations of
the secondary abscission process. Based on our molecular results,
it seems appropriate to modify the previous model of phases
in abscission, by introducing a higher resolution for secondary
abscission.
We have demonstrated that poinsettia and peas share at
least six genes involved in abscission, two at the onset, two in
phase II-III and the last two genes allocated to phase VI-V.
It would be of great interest to use our two systems to find
key regulatory gene(s) for abscission conserved throughout the
plant kingdom. A universal abscission induction signal for AZ
now seems more likely to find, since the six genes involved in
abscission of both poinsettia and pea must be highly conserved
during evolution. Further studies on our sequence data might
reveal key regulatory genes, as well as more genes involved in the
complicated abscission process for the plant kingdom.
AUTHOR CONTRIBUTIONS
AKHE devised and participated in all aspects of the studies.
AKHE and CAM coordinated the logistics of the DD study,
while AKHE and YKL did the same for the RNA in situ
hybridization experiments. CMM and CAM contributed to
designing poinsettia experiments, growing of the plants,
harvested materials and carried out the DD experiments. CMM
did the validations through Real-Time qRT-PCR. KOA executed
the pea experiments through growing, harvesting and preparing
Frontiers in Plant Science | www.frontiersin.org 15 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
the pea material, as well as the RNA in situ in pea. PR executed the
same in the poinsettia RNA in situ experiments. YKL performed
the in structural analysis in the microscope together with KOA
and PR and improved some of the in situ experiments through
new hybridizations. TM performed the RACE experiments and
the subsequent Real-Time qRT-PCR of the full-length sequences.
AKHE, YKL, CAM, CMM, TM, KOA, and PR participated at
various times in the data analysis. CAM, CMM, YKL, and AKHE
participated in writing the article. All authors have read and
approved the final manuscript.
ACKNOWLEDGMENTS
The authors acknowledge the financial contribution of the
Norwegian Research Council for the initiation of this work
in the Strategic Program “Fundamental Studies on Postharvest
Physiology and Plant Health (PoPPH).” We are indebted to
the late Professor Roar Moe for his dedicated coordination
of this Program. The following people are thanked for their
contributions: Kari Boger for all valuable technical help in the
greenhouses, Dr. Päivi Rinne for her initial work of the in planta
decapitation system together with CM. Dr. Mike Ambrose is
thanked for providing the pea accessions from the John Innes
Pea Collection. Anders Keim B. Sagvaag for updating the BLAST
searches and Dr. Mallikarjuna Rao Kovi for updated ontology
annotations in 2015.
SUPPLEMENTARY MATERIAL
The Supplementary Material for this article can be found
online at: http://journal.frontiersin.org/article/10.3389/fpls.2015.
01204
REFERENCES
Addicott, F. T. (1982). Abscission. London: Univeristy of California Press, Ltd.
Agustí, J., Gimeno, J., Merelo, P., Serrano, R., Cercós, M., Conesa, A., et al. (2012).
Early gene expression events in the laminar abscission zone of abscssion-
promoted Citrus leaves after a cycle of water stress/rehydration: involvement
of CitbHLH1. J. Exp. Bot. 63, 6079–6091. doi: 10.1093/jxb/ers270
Altschul, S. F., Gish, W., Miller, W., Meyers, E. W., and Lipman, D. J. (1990).
Basic local alignment search tool. J. Mol. Biol. 215, 403–410. doi: 10.1016/S0022-
2836(05)80360-2
Ayeh, K., Lee, Y., Ambrose, M. J., and Hvoslef-Eide, A. K. (2011). Growth, seed
development and genetic analysis in wild type and Def mutant of Pisum
sativum L. BMC Res. Notes 4:489. doi: 10.1186/1756-0500-4-489
Ayeh, K. O., Lee, Y. K., Ambrose, M. J., and Hvoslef-Eide, A. K. (2009).
Characterization and structural analysis of wild type and a non-abscission
mutant at the development funiculus (Def) locus in Pisum sativum L. BMC
Plant Biol. 9:76. doi: 10.1186/1471-2229-9-76
Ayeh, K. O. (2008). Studies of Wild Type and Mutant Pea (Pisum sativum
L.) Regarding the Development Funiculus (Def) Gene using Histology,
Immunohistochemistry, Genetics and Molecular Biology. Ph.D. thesis,
Norwegian University of Life Sciences.
Bailey, D. A., and Miller, W. B. (1991). Poinsettia developmental and
postproduction responses to growth-retardants and irradiance. Hortscience 26,
1501–1503.
Bennett, M. D., Bhandol, P., and Leitch, I. J. (2000). Nuclear DNA amounts in
angiosperms and their modern uses—807 new estimates. Ann. Bot. 86, 859–909.
doi: 10.1006/anbo.2000.1253
Bleecker, A. B., and Patterson, S. E. (1997). Last exit: senescence, abscission,
and meristem arrest in Arabidopsis.Plant Cell 9, 1169–1179. doi:
10.1105/tpc.9.7.1169
Bosca, S., Barton, C. J., Taylor, N. G., Ryden, P., Neumetzler, L., Pauly, M., et al.
(2006). Interactions between MUR10/CesA7-dependent secondary cellulose
biosynthesis and primary cell wall structure. Plant Physiol. 142, 1353–1363. doi:
10.1104/pp.106.087700
Brown, H. S., and Addicott, F. T. (1950). The anatomy of experimental leaflet
abscission in Phaseolus Vulgaris.Am. J. Bot. 37, 650–656. doi: 10.2307/
2437877
Burr, C. A., Leslie, M. E., Orlowski, S. K., Chen, I., Wright, C. E., Daniels, M.
J., et al. (2011). CAST AWAY, a membrane-associated receptor-like kinase,
inhibits organ abscission in Arabidopsis. Plant Physiol. 156, 1837–1850. doi:
10.1104/pp.111.175224
Butenko, M. A., Patterson, S. E., Grini, P. E., Stenvik, G. E., Amundsen, S. S.,
Mandal, A., et al. (2003). Inflorescence deficient in abscission controls floral
organ abscission in Arabidopsis and identifies a novel family of putative ligands
in plants. Plant Cell 15, 2296–2307. doi: 10.1105/tpc.014365
Butler, K., Zorn, A. M., and Gurdon, J. B. (2001). Nonradioactive in
situ hybridization to xenopus tissue sections. Methods 23, 303–312. doi:
10.1006/meth.2000.1142
Cai, S., and Lashbrook, C. C. (2008). Stamen abscission zone transcriptome
profiling reveals new candidates for abscission control: enhanced retention of
floral organs in transgenic plants overexpressing Arabidopsis ZINC FINGER
PROTEIN2. Plant Physiol. 146, 1305–1321. doi: 10.1104/pp.107.110908
Cho, S. K., Larue, C. T., Chevalier, D., Wang, H., Jinn, T.-L., Zhang, S., et al. (2008).
Regulation of floral organ abscission in Arabidopsis thaliana. Proc. Natl. Acad.
Sci. U.S.A. 105, 15629–15634. doi: 10.1073/pnas.0805539105
Cosgrove, D. J. (2005). Growth of the plant cell wall. Nat. Rev. Mol. Cell Biol. 6,
850–861. doi: 10.1038/nrm1746
Diévart, A., and Clark, S. E. (2003). Using mutant alleles to determine the structure
and function of leucine-rich repeat receptor-like kinases. Curr. Opin. Plant Biol.
6, 507–516. doi: 10.1016/S1369-5266(03)00089-X
González-Carranza, Z. H., Shahid, A. A., Zhang, L., Liu, Y., Ninsuwan, U., and
Roberts, J. A. (2012). A novel approach to dissect the abscission process in
Arabidopsis. Plant Physiol. 160, 1342–1356. doi: 10.1104/pp.112.205955
Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor
and analysis program for Windows 95/98/NT. Nucleic Acids Symp. 41, 95–98.
Harlan, J. R., de Wet, J. M. J., and Price, E. G. (1973). Comparative evolution in
cereals. Evolution 27, 311–325. doi: 10.2307/2406971
Hashim, I., Chee, K. H., Wilson, L. A., and Duncan, E. J. (1980). A comparison of
abscission of rubber (Hevea brasiliensis) leaves Infected with Microcyclus ulei
with leaf abscission Induced by ethylene treatment, deblading and senescence.
Ann. Bot. 45, 681–691.
Huang, R. F., and Lloyd, C. W. (1999). Gibberellic acid stabilises microtubules in
maize suspension cells to cold and stimulates acetylation of α-tubulin. FEBS
Lett. 443, 317–320. doi: 10.1016/S0014-5793(98)01718-9
Information, T.N.C.F.B. (2012). BLAST E-value. Available online at: 821
http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastDocs&
DOC_TYPE=FAQ#expect [Accessed 6 november 2012].
Ito, T., Kito, K., Adati, N., Mitsui, Y., Hagiwara, H., and Sakaki, Y. (1994).
Fluorescent differential display - arbitrarily primed RT-PCR fingerprinting on
an automated DNA sequencer. FEBS Lett. 351, 231–236. doi: 10.1016/0014-
5793(94)00867-1
Kalaitzis, P., Koehler, S. M., and Tucker, M. L. (1995). Cloning of a tomato
polygalacturonase expressed in abscission. Plant Mol. Biol. 28, 647–656. doi:
10.1007/BF00021190
Kuang, A., Peterson, C. M., and Dute, R. R. (1992). Leaf abscission
in soybean - cytochemical and ultrastructural-changes following
benzylaminopurine treatment. J. Exp. Bot. 43, 1611–1619. doi: 10.1093/jxb/43.
12.1611
Lee, Y., Derbyshire, P., Knox, J. P., and Hvoslef-Eide, A. K. (2008). Sequential
cell wall transformations in response to the induction of a pedicel abscission
Frontiers in Plant Science | www.frontiersin.org 16 January 2016 | Volume 6 | Article 1204

Hvoslef-Eide et al. Primary and Secondary Abscission in Poinsettia and Pea
event in Euphorbia pulcherrima (poinsettia). Plant J. 54, 993–1003. doi:
10.1111/j.1365-313X.2008.03456.x
Liao, H.-L., and Burns, J. K. (2012). Gene expression in Citrus sinensis fruit tissues
harvested from huanglongbing-infected trees: comparison with girdled fruit.
J. Exp. Bot. 63, 3307–3319. doi: 10.1093/jxb/ers070
Liljegren, S. J., Leslie, M. E., Darnielle, L., Lewis, M. W., Taylor, S. M., Luo,
R., et al. (2009). Regulation of membrane trafficking and organ separation
by the NEVERSHED ARF-GAP protein. Development 136, 1909–1918. doi:
10.1242/dev.033605
Lloyd, F. E. (1913-14). Injury and abscission in Impatiens sultani. Quebec Soc. Prot.
Plants 6, 72–79.
McManus, M. T., Thompson, D. S., Merriman, C., Lyne, L., and Osborne,
D. J. (1998). Transdifferentiation of mature cortical cells to functional
abscission cells in bean. Plant Physiol. 116, 891–899. doi: 10.1104/pp.116.
3.891
Moe, R., Fjeld, T., and Mortensen, L. M. (1992). Stem elongation and keeping
quality in poinsettia (Euphorbia pulcherrima Willd) as affected by temperature
and supplementary lighting. Sci. Hortic. 50, 127–136. doi: 10.1016/S0304-
4238(05)80015-9
Morgulis, A., Coulouris, G., Raytselis, Y., Madden, T. L., Agarwala, R., and
Schäffer, A. A. (2008). Database indexing for production MegaBLAST searches.
Bioinformatics 24, 1757–1764. doi: 10.1093/bioinformatics/btn322
Munster, C. (2006). On the Flower Abscission of Poinsettia (Euphorbia pulcherrima
Willd. Ex Klotzsch) -A Molecular and Plant Hormonal Study. Ph.D. thesis,
Norwegian University of Life Sciences.
Oberholster, S. D., Peterson, C. M., and Dute, R. R. (1991). Pedicel abscission
of soybean - Cytological and ultrastructural changes induced by auxin and
ethephon. Can. J. Bot. 69, 2177–2186. doi: 10.1139/b91-273
Osborne, D. (1955). Acceleration of abscission by a factor produced in senescent
leaves. Nature 176, 1161–1163. doi: 10.1038/1761161a0
Osborne, D. J., and Morgan, P. W. (1989). Abscission. Crit. Rev. Plant Sci. 8,
103–129. doi: 10.1080/07352688909382272
Patterson, S. E. (2001). Cutting loose. Abscission and dehiscence in Arabidopsis.
Plant Physiol. 126, 494–500. doi: 10.1104/pp.126.2.494
Pierik, R. L. M. (1973). Secondary abscission and parthenocarpic fruit growth in
apple and pear flowers in vitro.Acta Hort. (ISHS) 34, 299–310. doi: 10.17660/
ActaHortic.1973.34.41
Rasolomanana, P. (2008). In situ Localization Study of Differentially Expressed
Abscission Genes in Poinsettia (Euphorbia pulcherrima) Flower Abscisison.
Master, Norwegian University of Life Sciences.
Roberts, J. A., Elliott, K. A., and Gonzalez-Carranza, Z. H. (2002). Abscission,
dehiscence and other cell separation processes. Annu. Rev. Plant Biol. 53,
131–158. doi: 10.1146/annurev.arplant.53.092701.180236
Roppolo, D., Boeckmann, B., Pfister, A., Boutet, E., Rubio, M. C., Dénervaud-
Tendon, V., et al. (2014). Functional and evolutionary analysis of the casparian
strip membrane domain protein family. Plant Physiol. 165, 1709–1722. doi:
10.1104/pp.114.239137
Sexton, R., and Roberts, J. A. (1982). Cell biology of abscission. Annu. Rev. Plant
Physiol. 33, 133–162. doi: 10.1146/annurev.pp.33.060182.001025
Stenvik, G. E., Butenko, M. A., Urbanowicz, B. R., Rose, J. K., and Aalen, R.
B. (2006). Overexpression of inflorescence deficient in abscission activates
cell separation in vestigial abscission zones in Arabidopsis. Plant Cell 18,
1467–1476. doi: 10.1105/tpc.106.042036
Sugimoto-Shirasu, K., and Roberts, K. (2003). “Big it up”: endoreduplication
and cell-size control in plants. Curr. Opin. Plant Biol. 6, 544–553. doi:
10.1016/j.pbi.2003.09.009
Tabuchi, T., Ito, S., and Arai, N. (2001). Anatomical studies of the abscission
process in the tomato pedicels at flowering stage. J. Jpn. Soc. Hortic. Sci. 70,
63–65. doi: 10.2503/jjshs.70.63
Taylor, J. E., and Whitelaw, C. A. (2001). Signals in abscission. New Phytol. 151,
323–340. doi: 10.1046/j.0028-646x.2001.00194.x
Valdovinos, J. G., and Jensen, T. E. (1968). Fine structure of abscission zones. II.
Cell-wall changes in abscising pedicels to tobacco and tomato flowers. Planta
83, 295–302. doi: 10.1007/BF00385339
van der Hoorn, R. A., Wulff, B. B., Rivas, S., Durrant, M. C., van der Ploeg, A.,
de Wit, P. J., et al. (2005). Structure-function analysis of cf-9, a receptor-like
protein with extracytoplasmic leucine-rich repeats. Plant Cell 17, 1000–1015.
doi: 10.1105/tpc.104.028118
Wagner, T. A., and Kohorn, B. D. (2001). Wall-associated kinases are expressed
throughout plant development and are required for cell expansion. Plant Cell
13, 303–318. doi: 10.1105/tpc.13.2.303
Wang, X. Q., Xu, W. H., Ma, L. G., Fu, Z. M., Deng, X. W., Li, J. Y., et al.
(2006). Requirement of KNAT1/BP for the development of abscission zones
in Arabidopsis thaliana. J. Integr. Plant Biol. 48, 15–26. doi: 10.1111/j.1744-
7909.2005.00085.x-i1
Warren Wilson, P. M., Warren Wilson, J., and Addicott, F. T. (1986). Induced
abscission sites in internodal explants of Impatiens sultani - a new system for
studying positional control. Ann. Bot. 57, 511–530.
Webster, B. D. (1970). A morphogenetic study of leaf abscission in Phaseolus.Am.
J. Bot. 57, 443. doi: 10.2307/2440873
Wong, C.-H., and Osborne, D. J. (1978). The ethylene-induced enlargement of
target cells in flower buds of Ecballium elaterium L. and their identification by
endoreduplicated nuclear DNA. Planta 139, 103.
Yang, S., and Liang, P. (2004). Global analysis of gene expression by differential
display - A mathematical model. Mol. Biotechnol. 27, 197–208. doi:
10.1385/MB:27:3:197
Yu, L. P., Miller, A. K., and Clark, S. E. (2003). POLTERGEIST encodes a protein
phosphatase 2c that regulates CLAVATA pathways controlling stem cell identity
at Arabidopsis shoot and flower meristems. Curr. Biol. 13, 179–188. doi:
10.1016/S0960-9822(03)00042-3
Conflict of Interest Statement: The authors declare that the research was
conducted in the absence of any commercial or financial relationships that could
be construed as a potential conflict of interest.
Copyright © 2016 Hvoslef-Eide, Munster, Mathiesen, Ayeh, Melby, Rasolomanana
and Lee. This is an open-access article distributed under the terms of the Creative
Commons Attribution License (CC BY). The use, distribution or reproduction in
other forums is permitted, provided the original author(s) or licensor are credited
and that the original publication in this journal is cited, in accordance with accepted
academic practice. No use, distribution or reproduction is permitted which does not
comply with these terms.
Frontiers in Plant Science | www.frontiersin.org 17 January 2016 | Volume 6 | Article 1204