Content uploaded by Cláudia Marques
Author content
All content in this area was uploaded by Cláudia Marques on Dec 13, 2017
Content may be subject to copyright.
Effects of whey peptide extract on the growth of
probiotics and gut microbiota
Ya-Ju Yu a, Manuela Amorim a, Cláudia Marques b, Conceição Calhau b,c,
Manuela Pintado a,*
aCentro de Biotecnologia e Química Fina – Laboratório Associado, Escola Superior de Biotecnologia,
Universidade Católica Portuguesa/Porto, Rua Arquiteto Lobão Vital, 4202-401 Porto, Portugal
bDepartamento de Bioquímica, Faculdade de Medicina da Universidade do Porto, Al. Prof. Hernâni Monteiro,
4200-319 Porto, Portugal
cCINTESIS, Centro de Investigação em Tecnologias e Sistemas de Informação em Saúde, Al. Prof. Hernâni
Monteiro, 4200-319 Porto, Portugal
ARTICLE INFO
Article history:
Received 23 June 2015
Received in revised form 21 October
2015
Accepted 26 October 2015
Available online
ABSTRACT
Whey peptide extract with molecular weight below 1 kDa was investigated in microplate
assay, and viable cells, as well as metabolic activity were determined to evaluate aug-
mented growth of probiotic bacteria (Lactobacillus acidophilus and Bifidobacterium animalis).
Results illustrated that whey peptide extract 1% (w/v) has the capacity to stimulate the pro-
liferation of both probiotic bacteria tested, further supported by the faster generation of
metabolic products. The effect of whey peptide extract on the modulation of gut microbiota
was also examined in Wistar rats fed either with a standard or a high-fat diet, assessed via
16S ribosomal RNA expression of gut microbiota by quantitative PCR. Relative abundance
of Lactobacillus spp., Bifidobacterium spp. and Bacteroidetes was significantly increased by whey
peptide extract in rats fed with a standard diet. These results highlight an additional
unexploited positive effect of whey peptide extract on gut microbiota modulation.
© 2015 Elsevier Ltd. All rights reserved.
Keywords:
Gut microbiota
Prebiotics
Probiotics
Whey peptide extract
1. Introduction
As a major waste of cheese industry, whey has been given in-
creasing importance not only due to its nutritious value but
also due to concern of environmental pollution (Pintado,
Pintado, & Malcata, 1999; Tavares & Malcata, 2013). Whey con-
tains highly valuable soluble milk components, particularly
soluble proteins (0.6–0.8%, w/v) (Barth & Behnke, 1997; Walzem,
Dillard, & German, 2002), and the role of these soluble pro-
teins has been increasingly emphasised due to the discoveries
on their bioactive properties (Sinha, Radha, Prakash, & Kaul,
2007;Urista, Fernandez, Rodriguez, Cuenca, & Jurado, 2011).
By definition, bioactive peptides are certain protein frag-
ments exhibiting positive health impacts (Kitts & Weiler, 2003).
Although bioactive whey peptides are less common than those
of casein, there have been some studies illustrating their diverse
biological functions (Lòpez-Expòsito & Recio, 2006;Marques
et al., 2015; Ortiz-Chao et al., 2009; van der Kraan et al., 2005).
On the other hand, consumption of prebiotics (Grootaert
et al., 2009) to modulate microbiota, such as stimulating pro-
liferation of Bifidobacterium and Lactobacillus genera (Tuohy,
*Corresponding author. Centro de Biotecnologia e Química Fina – Laboratório Associado, Escola Superior de Biotecnologia, Universidade
Católica Portuguesa/Porto, Rua Arquiteto Lobão Vital, 4202-401 Porto, Portugal. Tel.: +351 225580097; fax: +351 22 558 00 01.
E-mail address: mpintado@porto.ucp.pt (M. Pintado).
http://dx.doi.org/10.1016/j.jff.2015.10.035
1756-4646/© 2015 Elsevier Ltd. All rights reserved.
Journal of Functional Foods 21 (2016) 507–516
Available online at www.sciencedirect.com
journal homepage: www.elsevier.com/locate/jff
ScienceDirec
t
Rouzaud, Bruck, & Gibson, 2005), which brings about the healthy
impacts (Wang, 2009), has been also increasingly focused.
However, most substances identified as prebiotics or candi-
dates are currently non-digestible oligosaccharides (Crittenden
& Playne, 1996), i.e., the potential of proteins/peptides as
prebiotics, leading to growth promoting effect and improve-
ment of metabolism, has not yet been fully explored.
Various microorganisms exist in the human intestinal tract
and bacteria predominate among them. Advanced methods,
for instance 16S ribosomal RNA (rRNA) investigations and direct
sequencing of faecal microbiota, have facilitated findings on
the relationship between gut microbial communities and host
metabolism. More than 90% of those findings are associated
with Firmicutes and Bacteroidetes (Tremaroli & Backhed, 2012;
Vrieze et al., 2010), and host obesity was found to alter their
colonisation (Furet et al., 2010; Ley et al., 2005). On the other
hand, Actinobacteria (ex. Bifidobacterium) and Proteobacteria (ex.
Helicobacter and Escherichia) also constitute a great number
among gut bacteria (Eckburg et al., 2005; Ley et al., 2005).
In the current study, a new whey peptide (<1 kDa) extract
(WPE) obtained from whey hydrolysed by Cynara cardunculus
was evaluated to determine its impacts on the modulation of
gut beneficial bacteria. Initial screening and conventional mi-
crobiological analysis of the single strains, Bifidobacterium
animalis subsp. lactis (strain Bb 12) and Lactobacillus acidophi-
lus Ki were undertaken to examine in vitro direct effects on
augmented growth of specific bacteria, allowing a more com-
plete understanding of their probable mechanism.Additionally,
animal experiments were also conducted to examine whether
the WPE can modify the composition of colonic microbiota in
two different dietary patterns (standard and high-fat diet), by
quantifying 16S rRNA gene expressions of certain gut microbe
communities through real-time PCR.
2. Materials and methods
2.1. Materials and microorganisms
Fructooligosaccharide (FOS) was purchased from Sigma-
Aldrich (St. Louis, MO, USA). Chemical standards utilised in HPLC
included 98% sulphuric acid (Merck KGaA, Darmstadt, Germany),
glacial acetic acid (Fisher Scientific, Leics, UK), L-(+)-Lactic acid
and glucose (Sigma-Aldrich). Microbial culture media (MRS broth
and MRS agar) were purchased from Biokar Diagnostics (Beau-
vais, France). Lactobacillus acidophilus Ki, previously isolated from
fermented milk, was obtained from CSK Food Enrichment (Leeu-
warden, The Netherlands) as ultrafrozen concentrates, and
Bifidobacterium animalis Bb12 was obtained from Christian
Hansen (Hørsholm, Denmark) as lyophilised culture.
2.2. Preparation of WPE
Whey extracts were obtained and processed according to
Tavares et al. (2012) with some modifications. Mixture of 80%
cow, 10% goat and 10% ewe whey was kindly provided by Saloio
(Torres Vedras, Portugal). Hydrolysis of whey was performed
using aqueous extract of Cynara cardunculus (Formulab, Maia,
Portugal) (Tavares et al., 2011) at an enzyme/substrate ratio of
3.0% (v/v), incubated for 3 h at pH 5.2 and 55 °C. Besides, further
processes were done using a 1 kDa cut-off membrane to gen-
erate the filtrates, constituting the peptides with MW <1 kDa.
The WPE with MW <1 kDa was further used in the following
experiments to assess its probiotic growth enhancing properties.
2.3. Screening of bacterial growth via microplate assay
To evaluate the role of the WPE as prebiotic (assuming the en-
hancing properties upon probiotic bacteria), the microplate
assay was conducted with variable media-pure MRS broth, MRS
broth with 2% (w/v) FOS or different concentrations of the whey
extract (1.0 and 2.0%). MRS broth was autoclaved at 121 °C for
20 min and subsequently supplemented with filter-sterilised
FOS and 0.5 g/L of L-cysteine (for the growth of B. animalis Bb12).
Owing to the lower solubility of whey extract, filter
sterilisation could not be used, but the broth with the extract
had to be sterilised at 80 °C for 30 min. In order to control the
sterility of this medium, a control without inoculum was always
included to prove the absence of growth. Each type of medium
was then inoculated at 2% (v/v) with each of aforementioned
probiotic bacteria. One aliquot of 250 µL was transferred to a
96-well microplate (Thermo Fischer Scientific, Denmark) in trip-
licate and the wells were covered with 50 µL autoclave-
sterilised liquid paraffin (Merck, Germany) to avoid the presence
of oxygen. Incubation occurred at 37 °C for a period of 48 h
under non-controlled pH conditions, and cellular growth was
monitored by measuring the OD of the cultures at 660 nm at
intervals of 60 min using microplate reader (FLUOstar OPTIMA,
BMG LABTECH GmbH, Ortenberg, Germany).
2.4. Evaluation of fermentable activity via determination
of viable cells and metabolic activity
Effect of peptide extracts on the growth of probiotics was evalu-
ated as the following. After completely dissolving, the medium
with the extract was specially sterilised at 80 °C for 30 min as
previously explained. L. acidophilus Ki and B. animalis Bb12 were
inoculated at 2% (v/v) into basal media MRS, with filter-
sterilised FOS 2% (medium used as positive control since FOS
is one of the most used prebiotics) and WPE (1% and 2% w/v)
for 24 h and 48 h, respectively. The culture was then trans-
ferred to 15-mL sterile tubes and incubated at 37 °C for 24 h.
All the conditions were sampled at 8 or 9 time points (0, 2, 4,
6, 8, 10, 12 and 24 h for L. acidophilus Ki and 48 h additionally
for B. animalis Bb12). At each sampling point, inoculated medium
(100 µL) was decimally diluted in salt peptone (1 g/L) (Sigma-
Aldrich), and plated in duplicate on two types of media: MRS
agar for L. acidophilus Ki and MRS agar added with 0.5%
L-cysteine for B. animalis Bb12. Inoculation, incubation and enu-
meration were conducted as described previously by Miles,
Misra, and Irwin (1938).
Of each triplicated sample 500 µL was diluted in 500 µLof
sulphuric acid 13 mM in a single run and the concentration
was obtained based on calibration curves previously pre-
pared with appropriate chromatographic standards. HPLC
analysis was conducted by referring to Zeppa, Conterno, and
Gerbi (2001) in order to assess the metabolic activity of each
probiotic in various medium. The HPLC system consists of a
LaChrom L-7100 pump (Merck-Hitachi, Fullerton CA, USA); an
508 Journal of Functional Foods 21 (2016) 507–516
ion exchange Aminex HPX-87H Column (300 mm ×7.8 mm) (Bio-
Rad, Richmond CA, USA), which was maintained at 65 °C (L-
7350 Column Oven; LaChrom, Merck-Hitachi); UV detector to
analyse organic acids at 220 nm (L-7400 UV Detector; LaChrom,
Merck-Hitachi), and detection was by refractive index for sugars.
The mobile phase used was 13 mM sulphuric acid, at a flow
rate of 0.8 mL/min. The running time was 30 min, and the in-
jection volume was 50 µL. Data were collected and analysed
by a D-7000 Interface (LaChrom, Merck-Hitachi) and HPLC
System Manager 3.1.1 Software (Merck-Hitachi).
2.5. Animals and housing
Twenty-one male Wistar rats (253 ±18 g) were purchased from
Harlan Laboratories (Santiga, Spain) and kept under con-
trolled environmental conditions (22–24 °C and 12 h light/
dark cycles), for at least 1 week before starting the experiments.
Animals were then randomly divided into two different diet
groups: standard diet group (St, N =9) and high-fat diet group
(HF, N =12). Diets were respectively categorised into “Stan-
dard” (Teklad, 2014, Harlan Laboratories) with 48% carbohydrate
(w/w), 14.3% protein (w/w) and 4% lipid (w/w), and “High-Fat”
(D1245 Research Diets, New Brunswick, USA) with 41% carbo-
hydrate (w/w), 24% protein (w/w) and 24% lipid (w/w)). Water
and chow were supplied ad libitum. Food and beverage con-
sumption and body weight were monitored weekly to carefully
characterise energy ingested and weight gain.
After 12 weeks of treatment, animals in each diet group were
further randomly subdivided into two different groups to form
the following 4 experimental groups: St (N =6), St +WPE (N =3),
HF (N =6) and HF +WPE (N =6). WPE was supplied in water at
a dose of 350 mg/kg/day during a total of 5 weeks.
At the end of the study, food was removed 4–6 h before sac-
rifice. Animals were anaesthetised with a mixture of ketamine
(50 mg/kg) and medetomidine (1 mg/kg) and sacrificed by ex-
sanguination. Fresh faecal samples were collected directly from
the colon of all animals, snap-frozen in liquid nitrogen and
stored at −80 °C until further analysis.
Animal handling and housing protocols followed the Eu-
ropean Union guidelines (Directive 2010/63/EU) for the use of
experimental animals in scientific research.
2.6. DNA extraction from stool
Genomic DNA was extracted and purified from stool samples
using NZY Tissue gDNA Isolation Kit (NZYTech, Lisboa, Portu-
gal) with some modifications. Briefly, faeces (170–200 mg) were
homogenised in TE buffer (10 mM Tris/HCl; 1 mM EDTA, pH 8.0)
and centrifuged at 4000 ×g for 15 min. The supernatant was
discarded and the pellet was re-suspended in 350 µL of buffer
NT1. After an incubation step at 95 °C for 10 min, samples were
centrifuged at 11,000 ×g for 1 min. Then, 25 µL of proteinase
K (22 mg/mL) (NZYTech, Lisbon, Portugal) was added to 200 µL
of the supernatant for incubation at 70 °C for 10 min. Con-
secutive steps were adopted according to manufacturer’s
instructions.
2.7. Microbial analysis of rat stool by real-time PCR
Real-time PCR was performed in sealed 96-well microplates using
a LightCycler FastStart DNA Master SYBR Green Kit and a
LightCycler Instrument (Roche Applied Science, Indianapolis, ID,
USA). PCR reaction mixtures (total of 10 µL) contained 5 µLof
2×FastStart SYBR green (Roche Diagnostics Ltd), 0.2 µLofeach
primer (Sigma-Aldrich, St. Louis, MO, USA) (final concentra-
tion of 0.2 µM), 3.6 µL of water and 1 µL of DNA (equilibrated to
20 ng). Primer sequences used to target the 16S rRNA gene of
the bacteria and the conditions for PCR amplification reac-
tions are described in Table 1 (Bacchetti De Gregoris, Aldred, Clare,
& Burgess, 2011; Delroisse et al., 2008; Queipo-Ortuno et al., 2013;
Stach, Maldonado, Ward, Goodfellow, & Bull, 2003).To verify the
specificity of the amplicon, a melting curve analysis was per-
formed via monitoring SYBR green fluorescence in the
temperature ramp from 60 to 97 °C. Data were processed and
analysed using the LightCycler software (Roche Applied Science).
DNA levels were approximated as 2−Ct, where Ctwas the cross-
ing threshold value calculated by the software. Results are
normalised to the universal bacteria gene and expressed in per-
centage of control (St group) (Bose, Song, Nam, Lee, & Kim, 2012).
2.8. Statistics analysis
Results are expressed as mean ±SD. GraphPad Prism 5.02
(GraphPad Software, Inc., La Jolla, CA, USA) was used to analyse
Table1–Primer sequences used for gut microbiota analysis by real-time PCR and corresponded reaction conditions.
Target group Primer sequence (5′-3′) PCR
product
Size (bp)
3-step amplification Ref.
Denaturation Annealing Elongation
Bifidobacterium spp. CGCGTCYGGTGTGAAAG 244 95 °C for 10 s 60 °C for 20 s 72 °C for 15 s Delroisse et al. (2008)
CCCCACATCCAGCATCCA
Lactobacillus spp. GAGGCAGCAGTAGGGAATCTTC 126 95 °C for 10 s 60 °C for 20 s 72 °C for 15 s Delroisse et al. (2008)
GGCCAGTTACTACCTCTATCCTTCTTC
Actinobacteria CGCGGCCTATCAGCTTGTTG 600 95 °C for 10 s 70 °C for 20 s 72 °C for 15 s Stach et al. (2003)
CCGTACTCCCCAGGCGGGG
Firmicutes ATGTGGTTTAATTCGAAGCA 126 95 °C for 10 s 60 °C for 20 s 72 °C for 15 s Queipo-Ortuno
et al. (2013)AGCTGACGACAACCATGCAC
Bacteroidetes CATGTGGTTTAATTCGATGAT 126 95 °C for 10 s 60 °C for 20 s 72 °C for 15 s
AGCTGACGACAACCATGCAG
Universal AAACTCAAAKGAATTGACGG 180 95 °C for 15 s 62 °C for 15 s 72 °C for 20 s Bacchetti De Gregoris
et al. (2011)CTCACRRCACGAGCTGAC
509Journal of Functional Foods 21 (2016) 507–516
all the data. One-way ANOVA followed by Bonferroni’s post-
hoc test was performed to evaluate the significant differences
between groups. Differences were considered significant when
P<0.05.
3. Results and discussion
3.1. Screening of probiotic bacteria growth via
microplate assay
In this study, growth curves of L. acidophilus Ki and B. animalis
Bb12 are depicted in Fig. 1. Results from the initial screening
showed that the addition of WPE to the medium can enhance
the growth through different concentrations but contributed
to distinctive outcomes in these two bacteria, i.e., both con-
centrations exerting similar effects on the growth in
L. acidophilus Ki, whereas only WPE 1% led to an obviously im-
proving effect for the growth of B. animalis Bb12. A previous
study found that this bacteria favours more catabolic activity
than anabolic activity at a certain level of nitrogen resource
(Beal & Corrieu, 1995). It is possible that WPE at 2% led to this
shift of physiological activity for B. animalis Bb12 and didn’t exert
positive effect on its growth. Evaluation of its anabolic activ-
ity at this concentration might be done by the detection of
ß-galactosidase.
On the other hand, 2% FOS enhanced the growth of
B. animalis Bb12 significantly (P<0.05) after 12 h but had no posi-
tive impact on the growth of L. acidophilus Ki. Due to limited
availability of transport enzyme,intracellular metabolic enzymes
for oligosaccharides, namely glycosyl hydrolases, of lactoba-
cilli have less accessibility to more complex carbohydrates In
comparison, Bifidobacterium spp. developed higher capacity of
hydrolysing extracellularly (Ganzle & Follador, 2012). The lack
of these transport enzymes of L. acidophilus might explain why
no positive impact on growth by FOS was observed.
Hence, it was observed that addition of WPE to the MRS
media significantly (P<0.05) benefited the growth of L. aci-
dophilus Ki and B. animalis Bb12 within 24 h and 48 h,
respectively, and WPE 1% possessed the capacity to improve
growth for both beneficial bacteria.
3.2. Effects of peptides on probiotic bacteria growth and
assessment of metabolic activity
Following the beneficial effects seen in previous screening by
microplate assay, 1% WPE was further tested.
Fig. 2 shows the evolution of pH value and viable cell
numbers (log CFU/mL) at each sampling time for L. acidophi-
lus Ki during 24 h and B. animalis Bb12 during 48 h.
Growth of both probiotics in the media with WPE 1% re-
sulted in significantly lower pH value within the incubation,
possibly benefiting the inhibition of growth of pathogenic bac-
teria (Tannock, 2002).
After the incubation, viable cell numbers of L. acidophilus Ki
showed no significant difference (P>0.05) among three groups,
all achieving ca. 9.7–9.8 log CFU/mL. Nevertheless, the growth
rate of L. acidophilus Ki at exponential phase was still en-
hanced by WPE 1%, whereas it was not the case of FOS 2%.
Regarding the growth of B. animalis Bb12, significantly higher
growth rate and viable cell number after 48 h by WPE 1%
(P<0.05) are shown (Fig. 2) in comparison with control and FOS
2% groups.
Species from the genus Bifidobacterium are said to be the
main consumers prebiotics, are involved in the formation of
acetate and lactic acid (Palframan, Gibson, & Rastall, 2003), and
bring out butyrogenic effect (Falony & De Vuyst, 2009), which
further contributes to bifidogenic effects on the improve-
ment of health (De Vuyst & Leroy, 2001). In addition, lactate
is known to exhibit antimicrobial properties (Koo, Eggleton,
O’Bryan, Crandall, & Ricke, 2012).The production of acetate and
lactic acid by two probiotic bacteria in different media was as-
sessed in this study, not only unveiling the role of WPE in
alteration of metabolic activity but also evaluating its pos-
sible health-promoting property via the induction of organic
acids.
Evolutions of organic acids throughout incubation by L. aci-
dophilus Ki and B. animalis Bb12 are presented in Figs. 3 and 4,
respectively.Throughout the incubation of L. acidophilus Ki during
24 h, the production of lactic and acetic acids in the samples
with added WPE 1% exerted the best induction among three
groups. Highest rate (P<0.05) on depletion of the main sub-
strate, glucose, was also shown in the culture of WPE 1%. Due
to its homo-fermentative capacity (Salminen, von Wright, &
Ouwehand, 2004), L. acidophilus Ki preferably produces much
higher lactic acid. Steep decline on the pH value occurring
Fig.1–Growthcurves for (A) L. acidophilus Ki and (B)
B. animalis Bb12. Bacteria were grown in basal MRS
medium (●), MRS medium with FOS 2% (■) and MRS
medium with extract 1% (▲), 2% (▼), and growth
determined by measuring the OD values at 660 nm
(mean ±SD of triplicates) over 24 h or 48 h period.
510 Journal of Functional Foods 21 (2016) 507–516
during 4 h to 8 h (Fig. 2) corresponded to the obvious induc-
tion of lactic acid (Fig. 3), causing more significant pH-reducing
effect, in the incubation of L. acidophilus Ki.
Unique metabolic pathway termed “bifid shunt” (De Vries
& Stouthamer, 1967) contributes to higher acetic acid produc-
tion by B. animalis. In accordance with this fact, our result
showed that B. animalis Bb12 generated significantly higher
(P<0.05) acetic acid in the samples with WPE 1% than control
counterpart (Fig. 4). In addition, WPE 1% resulted in the con-
sumption of glucose at higher rate, which metabolised the
substrates to the significantly different (P<0.05) level at earlier
time point (at 4 h).
Aiming to evaluate the properties of WPE as a nitrogen
source, this study utilised the complete MRS basal medium,
i.e., when glucose is present at high concentrations in order
to simulate the real situation. FOS was chosen as the positive
control because no recognised prebiotics that originated from
proteins/peptides have been generally confirmed. FOS 2% trig-
gered higher production of lactic acid for both bacteria but didn’t
enhance the formation of acetic acid for B. animalis Bb12 sig-
nificantly. This may be related to the fact that two sugar sources
are in the media to provide energy constraining the meta-
bolic pathways.
Overall, the supplementation of WPE 1% in the basal MRS
medium was capable of not only enhancing the growth of viable
cells of B. animalis Bb12 but also expediting the metabolism of
both probiotics. Meanwhile, subsequent to the accelerated meta-
bolic process, higher generation of lactic acid mainly from
L. acidophilus and induction of acetic acid from B. animalis were
observed. Some previous observations might lay the founda-
tion to improvement on the growth of probiotics by whey
peptides (Dave & Shah, 1998; Mitchell & Gilliland, 1983), ex-
hibiting health-benefiting effect (Ghasemi-Niri et al., 2011).
Favourable effects of WPE might be attributed to the pres-
ence of amino acids and peptides obtained by hydrolysis of the
proteases from Cynara cardunculus.
3.3. Assessment of the effect of the WPE on the
composition of gut microbiota in rats
After twelve weeks of being fed with an HF diet, animals de-
veloped severe obesity as reflected by a significant increase in
Fig.2–pHvalues (A and B) and viable cell numbers (log CFU/mL) (C and D) (mean ±SD of 6 replicates) for the growth of
L. acidophilus Ki and B. animalis Bb12 incubated for 24 h and 48 h, respectively, at 37 °C growing in basal MRS medium (●),
MRS medium with FOS 2% (■) and MRS medium with extract 1% (▲).
511Journal of Functional Foods 21 (2016) 507–516
body weight (Marques et al., 2015).To evaluate the effect of WPE
on the modulation of gut microbiota in this diet-induced obesity
model, animals were treated withWPE during five more weeks.
In parallel, animals fed with an St diet were also treated with
WPE for five weeks to evaluate its beneficial bacteria-enhancing
properties in vivo (Table 2).
Progress of metagenomics analyses (Tomas, Langella, &
Cherbuy, 2012) has facilitated the investigation of influential
factors in the human gut microbiota (Gerritsen, Smidt, Rijkers,
& de Vos, 2011; Turnbaugh et al., 2009). Among them, a strong
correlation between diet and gut microbiota has been estab-
lished (Fallani et al., 2010; Sekirov, Russell, Antunes, & Finlay,
2010). It has been shown that obesity induced by HF diet modi-
fied the profile of intestinal bacteria (Cani et al., 2007;Kim, Gu,
Lee, Joh, & Kim, 2012), i.e., decreasing the relative abundance
of Bacteroidetes (Turnbaugh et al., 2006) and consequently in-
creasing Firmicutes to Bacteroidetes ratio (Ley, Turnbaugh, Klein,
Fig. 3 – Lactic and acetic acids (g/L) produced and glucose
(g/L) consumed by L. acidophilus Ki throughout 24 h of
incubation at 37 °C. (A, B and C) Differences (P<0.05)
among control (MRS broth ■), FOS 2% (■) and extract 1% (■)
at each sampling time (mean ±SD of 6 replicates). (a–e)
Differences (P<0.05) in each sample throughout time
(mean ±SD of 6 replicates).
Table 2 – Energy ingestion of animals from different experimental groups during the 5 weeks of the study.
St St +Whey HF HF +Whey
Energy ingestion (kcal/day) 53.3 ±7.4 56.3 ±3.9 74.2 ±8.4*69.4 ±7.3*
Values are expressed as mean ±SEM.
*P<0.05 vs St group.
Fig. 4 – Lactic and acetic acids (g/L) produced and glucose
(g/L) consumed by B. animalis Bb12 throughout 48 h of
incubation at 37 °C. (A, B and C) Differences (P<0.05)
among control (MRS broth ■), FOS 2% (■) and extract 1% (■)
at each sampling time (mean ±SD of 6 replicates). (a–e)
Differences (P<0.05) in each sample throughout time
(mean ±SD of 6 replicates).
512 Journal of Functional Foods 21 (2016) 507–516
Fig. 5 – Real-time PCR quantification of microbiota phyla (A) Actinobacteria, (B) Firmicutes, (C) Bacteroidetes and genera (D)
Bifidobacterium spp., and (E) Lactobacillus spp. in different groups of treatment. (F) Firmicutes to Bacteroidetes ratios were
calculated as the relative expression of 16S rDNA of Firmicutes divided by the one of Bacteroidetes. Data are presented in
percentage of control as mean ±SD (N =3–6). *P<0.05, **P<0.01 and ***P<0.001 vs St group. St, standard diet group; HF,
high-fat diet group; WPE, whey protein extract.
513Journal of Functional Foods 21 (2016) 507–516
& Gordon, 2006). These alterations in the gut microflora com-
position are associated with an increased intestinal permeability
that eventually can lead to the development of metabolic
endotoxemia, inflammation and metabolic disorders (Cani et al.,
2008).
In the present study, after seventeen weeks, HF diet caused
a significant decrease in the relative abundance of Bacteroidetes,
in comparison with the St group. It also led to induction on
the ratio of Firmicutes to Bacteroidetes (P<0.05). With regard
to the relative abundance of Actinobacteria, Lactobacillus spp.,
Bifidobacterium spp. and Firmicutes, no differences were ob-
served between St and HF group (Fig. 5). Results from our group
also indicated that a similar pattern is observed in the gut
microbiota of rats fed with a high fat diet for twelve weeks
(Marques et al., 2015).
Under the pattern of St diet, WPE significantly increased the
relative abundance of Bacteroidetes (P<0.05), Bifidobacterium
spp. (P<0.05) and Lactobacillus spp. (P<0.001). However, no sig-
nificant changes were observed in the Firmicutes to
Bacteroidetes ratio and in the relative abundance of
Actinobacteria and Firmicutes, in rats treated withWPE (Fig. 5).
On the whole, in a diet-induced obesity model,WPE did not
cause any statistical significant change in the relative abun-
dance of above mentioned bacteria compared with HF control
group. These results showed that WPE was not able to rescue
the deleterious outcomes caused by HF diet through raising
the number of beneficial bacteria. Since WPE supplementa-
tion was only initiated after obesity was installed, these findings
might indicate that a longer or earlier intervention may be re-
quired for WPE to modulate intestinal flora.
Nevertheless, the effects of WPE in the presence of an St
diet are remarkable.WPE promoted the growth of Bifidobacterium
spp. and Lactobacillus spp. in vivo like our in vitro studies had
pointed out. These results are in accordance with a previous
study conducted in pigs that reported a larger population of
lactobacilli and bifidobacteria in gut microbiota after liquid whey
feeding (Kobayashi et al., 2011). Furthermore, WPE also in-
creased the relative abundance of Bacteroidetes.
Effects of bioactive peptides incorporated into diet either
are required to resist gastrointestinal digestion or undergo
physiological conversion into functional fragments, ex. the
case of some antihypertensive peptides (Miguel, Aleixandre,
Ramos, & Lopez-Fandino, 2006; Vermeirssen, Van Camp, &
Verstraete, 2004), and reach target sites to exert its bioactivi-
ties. In our study, despite that both preliminary in vitro
assessments and the following in vivo evaluation on microbiota
couldn’t specifically indicate which mechanism WPE con-
ducts, the benefits acting in the organisms were demonstrated.
It is still necessary that the identification and characterisa-
tion of bioactive peptides in WPE are executed in the future
study.
It is known that Bacteroides spp. belongs to one of amino
acid fermenting bacteria (Dai, Wu, & Zhu, 2011) and is able to
secrete proteolytic enzymes in large intestine, which is also
attributed to Lactobacillus spp. and Bifidobacterium spp. (Macfarlane
& Cummings, 1991). This, combined with other features, in-
cluding polyamine production (Allison & Macfarlane,1989) and
aromatic amino acid fermentation (Smith & Macfarlane, 1996),
may explain the distinctive growth of these three species by
WPE in our gut microbiota analysis.
Altogether, these findings highlight for the first time the pos-
sible intervention of WPE as a probiotic growth and metabolism
enhancer – “prebiotic” in a healthy life style.
4. Conclusions
More innovative than other hydrolysis processes, whey extract
evaluated in this study was obtained by the enzymatic reac-
tions of proteases from Cynara cardunculus, which is vegetable
rennet, instead of the enzymes originated from animal or mi-
croorganism. After some in vitro assessments, the fraction of
WPE with MW <1 kDa at 1% showed the potential to be used
as a supplementation to promote the growth of Lactobacillus
acidophilus Ki and Bifidobacterium animalis Bb12 by lowering pH
and inducing faster organic acid production, including lactic
acid and acetic acid.
Through the investigation of rat gut microbiota commu-
nity in this study, it was observed that intake of WPE at the
dose of 350 mg/day/kg in rats can significantly induce the 16S
rRNA expression of Lactobacillus spp., Bifidobacterium spp. and
Bacteroidetes in gut under the pattern of St diet, meaning the
shift towards the beneficial microbiota profile, but was not
capable of rescuing the adverse consequences resulting from
HF.
Acknowledgements
The production of WPE was supported by ACTIPEP Project
(QREN-ADI 11531). This work was supported by National Funds
from FCT – Fundação para a Ciência e a Tecnologia through
project PEst-OE/EQB/LA0016/2013 and by the PhD grant of Maria
Manuela Amorim and Cláudia Marques with reference SFRH/
BD/81901/2011 and SFRH/BD/93073/2013, respectively.
REFERENCES
Allison, C., & Macfarlane, G. T. (1989). Influence of pH, nutrient
availability, and growth rate on amine production by
Bacteroides fragilis and Clostridium perfringens. Applied and
Environmental Microbiology,55(11), 2894–2898.
Bacchetti De Gregoris, T., Aldred, N., Clare, A. S., & Burgess, J. G.
(2011). Improvement of phylum- and class-specific primers
for real-time PCR quantification of bacterial taxa. Journal of
Microbiological Methods,86(3), 351–356. doi:10.1016/
j.mimet.2011.06.010; [Research Support, Non-U.S. Gov’t].
Barth, C. A., & Behnke, U. (1997). Nutritional significance of whey
and whey components. Die Nahrung,41(1), 2–12.
Beal, C., & Corrieu, G. (1995). On-line indirect measurements of
biological variables and their kinetics during pH controlled
batch cultures of thermophilic lactic acid bacteria. Journal of
Food Engineering,26, 511–525.
Bose, S., Song, M. Y., Nam, J. K., Lee, M. J., & Kim, H. (2012). In vitro
and in vivo protective effects of fermented preparations of
dietary herbs against lipopolysaccharide insult. Food
Chemistry,134(2), 758–765. doi:10.1016/j.foodchem.2012.02.175.
Cani, P. D., Amar, J., Iglesias, M. A., Poggi, M., Knauf, C., Bastelica,
D., Neyrinck, A. M., Fava, F., Tuohy, K. M., Chabo, C., Waget, A.,
Delmée, E., Cousin, B., Sulpice, T., Chamontin, B., Ferrières, J.,
514 Journal of Functional Foods 21 (2016) 507–516
Tanti, J. F., Gibson, G. R., Casteilla, L., Delzenne, N. M., Alessi,
M. C., & Burcelin, R. (2007). Metabolic endotoxemia initiates
obesity and insulin resistance. Diabetes,56(7), 1761–1772.
doi:10.2337/Db06-1491.
Cani, P. D., Bibiloni, R., Knauf, C., Waget, A., Neyrinck, A. M.,
Delzenne, N. M., & Burcelin, R. (2008). Changes in gut
microbiota control metabolic endotoxemia-induced
inflammation in high-fat diet-induced obesity and diabetes in
mice. Diabetes,57(6), 1470–1481. doi:10.2337/db07-1403;
[Research Support, Non-U.S. Gov’t].
Crittenden, R. G., & Playne, M. J. (1996). Production, properties and
applications of food-grade oligosaccharides. Trends in Food
Science & Technology,7(11), 353–361. doi:10.1016/S0924-
2244(96)10038-8.
Dai, Z. L., Wu, G., & Zhu, W. Y. (2011). Amino acid metabolism in
intestinal bacteria: Links between gut ecology and host
health. Frontiers in Bioscience (Landmark Edition),16, 1768–1786.
[Research Support, Non-U.S. Gov’t Review].
Dave, R. I., & Shah, N. P. (1998). Ingredient supplementation
effects on viability of probiotic bacteria in yogurt. Journal of
Dairy Science,81(11), 2804–2816.
De Vries, W., & Stouthamer, A. H. (1967). Pathway of glucose
fermentation in relation to the taxonomy of bifidobacteria.
Journal of Bacteriology,93(2), 574–576.
De Vuyst, L., & Leroy, F. (2001). Cross-feeding between
bifidobacteria and butyrate-producing colon bacteria explains
bifidobacterial competitiveness, butyrate production, and
gas production. International Journal of Food Microbiology,149,
73–80.
Delroisse, J. M., Boulvin, A. L., Parmentier, I., Dauphin, R. D.,
Vandenbol, M., & Portetelle, D. (2008). Quantification of
Bifidobacterium spp. and Lactobacillus spp. in rat fecal
samples by real-time PCR. Microbiological Research,163(6), 663–
670. [Evaluation Studies Research Support, Non-U.S. Gov’t].
Eckburg, P. B., Bik, E. M., Bernstein, C. N., Purdom, E., Dethlefsen,
L., Sargent, M., Gill, S. R., Nelson, K. E., & Relman, D. A. (2005).
Diversity of the human intestinal microbial flora. Science,
308(5728), 1635–1638. doi:10.1126/science.1110591.
Fallani, M., Young, D., Scott, J., Norin, E., Amarri, S., Adam, R.,
Aguilera, M., Khanna, S., Gil, A., Edwards, C. A., & Dore, J.
(2010). Intestinal microbiota of 6-week-old infants across
Europe: Geographic influence beyond delivery mode, breast-
feeding, and antibiotics. Journal of Pediatric Gastroenterology and
Nutrition,51(1), 77–84. doi:10.1097/MPG.0b013e3181d1b11e;
[Research Support, Non-U.S. Gov’t].
Falony, G., & De Vuyst, L. (2009). Ecological interactions of
bacteria in the human gut. In D. Charalampopoulos & R. A.
Rastall (Eds.), Prebiotics and probiotics science and technology (pp.
641–682). New York: Spring er.
Furet, J. P., Kong, L. C., Tap, J., Poitou, C., Basdevant, A., Bouillot, J.
L., Mariat, D., Corthier, G., Doré, J., Henegar, C., Rizkalla, S., &
Clement, K. (2010). Differential adaptation of human gut
microbiota to bariatric surgery-induced weight loss: Links
with metabolic and low-grade inflammation markers.
Diabetes,59(12), 3049–3057. doi:10.2337/db10-0253; [Research
Support, Non-U.S. Gov’t].
Ganzle, M. G., & Follador, R. (2012). Metabolism of
oligosaccharides and starch in lactobacilli: A review. Frontiers
in Microbiology,3, 340. doi:10.3389/fmicb.2012.00340.
Gerritsen, J., Smidt, H., Rijkers, G. T., & de Vos, W. M. (2011).
Intestinal microbiota in human health and disease: The
impact of probiotics. Genes & Nutrition,6(3), 209–240.
doi:10.1007/s12263-011-0229-7.
Ghasemi-Niri, S. F., Abdolghaffari, A. H., Fallah-Benakohal, S.,
Hosseinpour-Feizi, M., Mahdaviani, P., Jamalifar, H., Baeeri, M.,
Dehghan, G., & Abdollahi, M. (2011). On the benefit of whey-
cultured Lactobacillus casei in murine colitis. Journal of
Physiology and Pharmacology,62(3), 341–346.
Grootaert, C., Van den Abbeele, P., Marzorati, M., Broekaert, W. F.,
Courtin, C. M., Delcour, J. A., Verstraete, W., & Van de Wiele, T.
(2009). Comparison of prebiotic effects of arabinoxylan
oligosaccharides and inulin in a simulator of the human
intestinal microbial ecosystem. FEMS Microbiology Ecology,
69(2), 231–242. doi:10.1111/j.1574-6941.2009.00712.x.
Kim, K. A., Gu, W., Lee, I. A., Joh, E. H., & Kim, D. H. (2012). High fat
diet-induced gut microbiota exacerbates inflammation and
obesity in mice via the TLR4 signaling pathway. PLoS ONE,
7(10), e47713. doi:10.1371/journal.pone.0047713; [Research
Support, Non-U.S. Gov’t].
Kitts, D. D., & Weiler, K. (2003). Bioactive proteins and peptides
from food sources. Applications of bioprocesses used
in isolation and recovery. Current Pharmaceutical Design,
9(16), 1309–1323. [Research Support, Non-U.S. Gov’t
Review].
Kobayashi, Y., Itoh, A., Miyawaki, K., Koike, S., Iwabuchi, O.,
Iimura, Y., Kobashi, Y., Kawashima, T., Wakamatsu, J., Hattori,
A., Murakami, H., Morimatsu, F., Nakaebisu, T., & Hishinuma,
T. (2011). Effect of liquid whey feeding on fecal microbiota of
mature and growing pigs. Animal Science Journal,82(4), 607–
615. doi:10.1111/j.1740-0929.2011.00876.x; [Research Support,
Non-U.S. Gov’t].
Koo, O. K., Eggleton, M., O’Bryan, C. A., Crandall, P. G., & Ricke, S.
C. (2012). Antimicrobial activity of lactic acid bacteria against
Listeria monocytogenes on frankfurters formulated with and
without lactate/diacetate. Meat Science,92(4), 533–537.
doi:10.1016/j.meatsci.2012.05.023; [Comparative Study
Research Support, Non-U.S. Gov’t Research Support, U.S.
Gov’t, Non-P.H.S.].
Ley, R. E., Backhed, F., Turnbaugh, P., Lozupone, C. A., Knight, R.
D., & Gordon, J. I. (2005). Obesity alters gut microbial ecology.
Proceedings of the National Academy of Sciences of the United
States of America,102(31), 11070–11075. doi:10.1073/
pnas.0504978102.
Ley, R. E., Turnbaugh, P. J., Klein, S., & Gordon, J. I. (2006). Microbial
ecology: Human gut microbes associated with obesity. Nature,
444(7122), 1022–1023. doi:10.1038/4441022a; [Clinical Trial].
Lòpez-Expòsito, I., & Recio, I. (2006). Antibacterial activity of
peptides and folding variants from milk proteins. International
Dairy Journal,16, 1294–1305.
Macfarlane, G. T., & Cummings, J. P. (1991). The colonic flora,
fermentation and large bowel digestive function. In S. F.
Philips, J. H. Pemberton, & R. G. Shorter (Eds.), The large
intestine. Physiology, pathophysiology and disease (pp. 51–92). New
York: Raven Press.
Marques, C., Meireles, M., Norberto, S., Leite, J., Freitas, J., Pestana,
D., & Calhau, C. (2015). High-fat diet-induced obesity Rat
model: A comparison between Wistar and Sprague-Dawley
Rat. Adipocyte, 1–11.
Miguel, M., Aleixandre, M. A., Ramos, M., & Lopez-Fandino, R.
(2006). Effect of simulated gastrointestinal digestion on the
antihypertensive properties of ACE-inhibitory peptides
derived from ovalbumin. Journal of Agricultural and Food
Chemistry,54(3), 726–731. doi:10.1021/jf051101p; [Research
Support, Non-U.S. Gov’t].
Miles, A. A., Misra, S. S., & Irwin, J. O. (1938). The estimation of the
bactericidal power of the blood. The Journal of Hygiene,38(6),
732–749.
Mitchell, S. L., & Gilliland, S. E. (1983). Pepsinized sweet whey
medium for growing Lactobacillus acidophilus for frozen
concentrated cultures. Journal of Dairy Science,66(4), 712–
718.
Ortiz-Chao, P., Gomez-Ruiz, J. A., Rastall, R. A., Mills, D., Cramer,
R., Pihlanto, A., Korhonen, H., & Jauregi, P. (2009). Production
of novel ACE inhibitory peptides from beta-lactoglobulin
using protease N amano. International Dairy Journal,19(2), 69–
76. doi:10.1016/j.idairyj.2008.07.011.
515Journal of Functional Foods 21 (2016) 507–516
Palframan, R. J., Gibson, G. R., & Rastall, R. A. (2003). Carbohydrate
preferences of Bifidobacterium species isolated from the
human gut. Current Issues in Intestinal Microbiology,4(2), 71–75.
[Comparative Study].
Pintado, M. E., Pintado, A. E., & Malcata, F. X. (1999). Controlled
whey protein hydrolysis using two alternative proteases.
Journal of Food Engineering,42(1), 1–13. doi:10.1016/S0260-
8774(99)00094-1.
Queipo-Ortuno, M. I., Seoane, L. M., Murri, M., Pardo, M., Gomez-
Zumaquero, J. M., Cardona, F., Casanueva, F., & Tinahones, F. J.
(2013). Gut microbiota composition in male rat models under
different nutritional status and physical activity and its
association with serum leptin and ghrelin levels. PLoS ONE,
8(5), e65465. doi:10.1371/journal.pone.0065465; [Research
Support, Non-U.S. Gov’t].
Salminen, S., von Wright, A., & Ouwehand, A. (2004). Lactic acid
bacteria: Microbiological and functional aspects. CRC Press.
Sekirov, I., Russell, S. L., Antunes, L. C., & Finlay, B. B. (2010). Gut
microbiota in health and disease. Physiological Reviews,90(3),
859–904. doi:10.1152/physrev.00045.2009; [Research Support,
Non-U.S. Gov’t Review].
Sinha, R., Radha, C., Prakash, J., & Kaul, P. (2007). Whey protein
hydrolysate: Functional properties, nutritional quality and
utilization in beverage formulation. Food Chemistry,101(4),
1484–1491. doi:10.1016/j.foodchem.2006.04.021.
Smith, E. A., & Macfarlane, G. T. (1996). Enumeration of human
colonic bacteria producing phenolic and indolic compounds:
Effects of pH, carbohydrate availability and retention time on
dissimilatory aromatic amino acid metabolism. Journal of
Applied Bacteriology,81(3), 288–302.
Stach, J. E., Maldonado, L. A., Ward, A. C., Goodfellow, M., & Bull,
A. T. (2003). New primers for the class Actinobacteria:
Application to marine and terrestrial environments.
Environmental Microbiology,5(10), 828–841. [Research Support,
Non-U.S. Gov’t].
Tannock, G. W. (2002). Probiotics and prebiotics: Where are
we going? International Journal of Food Microbiology,4,
75–79.
Tavares, T., Contreras Mdel, M., Amorim, M., Pintado, M., Recio, I.,
& Malcata, F. X. (2011). Novel whey-derived peptides with
inhibitory effect against angiotensin-converting enzyme: In
vitro effect and stability to gastrointestinal enzymes. Peptides,
32(5), 1013–1019. doi:10.1016/j.peptides.2011.02.005; [Research
Support, Non-U.S. Gov’t].
Tavares, T. G., Amorim, M., Comes, D., Pintado, M. E., Pereira, C.
D., & Malcata, F. X. (2012). Manufacture of bioactive peptide-
rich concentrates from whey: Characterization of pilot
process. Journal of Food Engineering,110(4), 547–552.
doi:10.1016/j.jfoodeng.2012.01.009.
Tavares, T. G., & Malcata, F. X. (2013). Whey proteins as source of
bioactive peptides against hypertension. In B. Hernandez-
Ledesma & C.-C. Hsieh (Eds.), Bioactive food peptides in health
and disease.<http://dx.doi.org/10.5772/52680>Accessed
31.01.14.
Tomas, J., Langella, P., & Cherbuy, C. (2012). The intestinal
microbiota in the rat model: Major breakthroughs from new
technologies. Animal Health Research Reviews,13(1), 54–63.
doi:10.1017/S1466252312000072; [Review].
Tremaroli, V., & Backhed, F. (2012). Functional interactions
between the gut microbiota and host metabolism. Nature,
489(7415), 242–249. doi:10.1038/Nature11552.
Tuohy, K. M., Rouzaud, G. C. M., Bruck, W. M., & Gibson, G. R.
(2005). Modulation of the human gut microflora towards
improved health using prebiotics – Assessment of efficacy.
Current Pharmaceutical Design,11(1), 75–90. doi:10.2174/
1381612053382331.
Turnbaugh, P. J., Hamady, M., Yatsunenko, T., Cantarel, B. L.,
Duncan, A., Ley, R. E., Sogin, M. L., Jones, W. J., Roe, B. A.,
Affourtit, J. P., Egholm, M., Henrissat, B., Heath, A. C., Knight,
R., & Gordon, J. I. (2009). A core gut microbiome in obese and
lean twins. Nature,457(7228), 480–484. doi:10.1038/
Nature07540.
Turnbaugh, P. J., Ley, R. E., Mahowald, M. A., Magrini, V., Mardis, E.
R., & Gordon, J. I. (2006). An obesity-associated gut
microbiome with increased capacity for energy harvest.
Nature,444(7122), 1027–1031. doi:10.1038/nature05414;
[Comparative Study Research Support, N.I.H., Extramural
Research Support, Non-U.S. Gov’t].
Urista, C. M., Fernandez, R. A., Rodriguez, F. R., Cuenca, A. A., &
Jurado, A. T. (2011). Review: Production and functionality of
active peptides from milk. Food Science and Technology
International,17(4), 293–317. doi:10.1177/1082013211398801.
van der Kraan, M. I., Nazmi, K., Teeken, A., Groenink, J., van’t Hof,
W., Veerman, E. C., Bolscher, J. G., & Nieuw Amerongen, A. V.
(2005). Lactoferrampin, an antimicrobial peptide of bovine
lactoferrin, exerts its candidacidal activity by a cluster of
positively charged residues at the C-terminus in combination
with a helix-facilitating N-terminal part. Biological Chemistry,
386(2), 137–142. doi:10.1515/BC.2005.017; [Research Support,
Non-U.S. Gov’t].
Vermeirssen, V., Van Camp, J., & Verstraete, W. (2004).
Bioavailability of angiotensin I converting enzyme inhibitory
peptides. The British Journal of Nutrition,92(3), 357–366.
[Research Support, Non-U.S. Gov’t Review].
Vrieze, A., Holleman, F., Zoetendal, E. G., de Vos, W. M., Hoekstra,
J. B., & Nieuwdorp, M. (2010). The environment within: How
gut microbiota may influence metabolism and body
composition. Diabetologia,53(4), 606–613. doi:10.1007/s00125-
010-1662-7; [Research Support, Non-U.S. Gov’t Review].
Walzem, R. L., Dillard, C. J., & German, J. B. (2002). Whey
components: Millennia of evolution create functionalities for
mammalian nutrition: What we know and what we may be
overlooking. Critical Reviews in Food Science and Nutrition,42(4),
353–375. doi:10.1080/10408690290825574; [Research Support,
Non-U.S. Gov’t Review].
Wang, Y. B. (2009). Prebiotics: Present and future in food science
and technology. Food Research International,42(1), 8–12.
doi:10.1016/j.foodres.2008.09.001.
Zeppa, G., Conterno, L., & Gerbi, V. (2001). Determination of
organic acids, sugars, diacetyl, and acetoin in cheese by high-
performance liquid chromatography. Journal of Agricultural and
Food Chemistry,49(6), 2722–2726. doi:10.1021/Jf0009403.
516 Journal of Functional Foods 21 (2016) 507–516
