The Australasian frog family Ceratobatrachidae in China, Myanmar and Thailand: discovery of a new Himalayan forest frog clade

Abstract

In an effort to study the systematic affinities and specieslevel phylogenetic relationships of the enigmatic anurans variably assigned to the genera Ingerana or Limnonectes (family Dicroglossidae), we collected new molecular sequence data for five species including four Himalayan taxa, Limnonectes xizangensis, Lim. medogensis, Lim. alpine, Ingerana borealis and one southeast Asian species, I. tasanae, and analyzed these together with data from previous studies involving other ostensibly related taxa. Our surprising results demonstrate unequivocally that Lim. xizangensis, Lim. medogensis and Lim. alpine form a strongly supported clade, the sister-group of the family Australasian forest frog family Ceratobatrachidae. This discovery requires an expansion of the definition of Ceratobatrachidae and represents the first record of this family in China. These three species are distinguished from the species of Ingerana and Limnonectes by the: (1) absence of interdigital webbing of the foot, (2) absence of terminal discs on fingers and toes, (3) absence of circumarginal grooves on the fingers and toes, and (4) absence of tarsal folds. Given their phylogenetic and morphological distinctiveness, we assign them to the oldest available generic name for this clade, Liurana Dubois 1987, and transfer Liurana from Dicroglossidae to the family Ceratobatrachidae. In contrast, Ingerana tasanae was found to be clustered with strong support with the recently described genus Alcalus (Ceratobatrachidae), a small clade of otherwise Sundaic species; this constitutes a new record of the family Ceratobatrachidae for Myanmar and Thailand. Finally, Ingerana borealis clustered with the "true" Ingerana (family Dicroglossidae), for which the type species is I. tenasserimensis.

Full text

ZOOLOGICAL RESEARCH
Science Press Zoological Research 37(1): 7-14, 2016 7
The Australasian frog family Ceratobatrachidae in
China, Myanmar and Thailand: discovery of a new
Himalayan forest frog clade
Fang YAN1,2,#, Ke JIANG1,2,#, Kai WANG1,3, Jie-Qiong JIN1, Chatmongkon SUWANNAPOOM4,1, Cheng LI5, Jens V.
VINDUM6, Rafe M. BROWN7, Jing CHE1,2,*
1 State Key Laboratory of Genetic Resources and Evolution, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming
Yunnan 650223, China
2 Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Yezin, Nay Pyi Taw 05282, Myanmar
3 Sam Noble Oklahoma Museum of Natural History and Department of Biology, University of Oklahoma, Norman OK 73072-7029, U.S.A.
4 School of Agriculture and Natural Resources, University of Phayao, Phayao 56000, Thailand
5 Imaging Biodiversity Expedition, Beijing 100107, China
6 Department of Herpetology, California Academy of Sciences, California 94118, U.S.A.
7 Biodiversity Institute and Department of Ecology and Evolutionary Biology, 1345 Jayhawk Blvd, University of Kansas, Lawrence KS
66045, U.S.A.
ABSTRACT
In an effort to study the systematic affinities and species-
level phylogenetic relationships of the enigmatic anurans
variably assigned to the genera Ingerana or
Limnonectes (family Dicroglossidae), we collected new
molecular sequence data for five species including four
Himalayan taxa, Limnonectes xizangensis, Lim.
medogensis, Lim. alpine, Ingerana borealis and one
southeast Asian species, I. tasanae, and analyzed these
together with data from previous studies involving other
ostensibly related taxa. Our surprising results
demonstrate unequivocally that Lim. xizangensis, Lim.
medogensis and Lim. alpine form a strongly supported
clade, the sister-group of the family Australasian forest
frog family Ceratobatrachidae. This discovery requires
an expansion of the definition of Ceratobatrachidae and
represents the first record of this family in China. These
three species are distinguished from the species of
Ingerana and Limnonectes by the: (1) absence of
interdigital webbing of the foot, (2) absence of terminal
discs on fingers and toes, (3) absence of circumarginal
grooves on the fingers and toes, and (4) absence of
tarsal folds. Given their phylogenetic and morphological
distinctiveness, we assign them to the oldest available
generic name for this clade, Liurana Dubois 1987, and
transfer Liurana from Dicroglossidae to the family
Ceratobatrachidae. In contrast, Ingerana tasanae was
found to be clustered with strong support with the
recently described genus Alcalus (Ceratobatrachidae), a
small clade of otherwise Sundaic species; this
constitutes a new record of the family Ceratobatrachidae
for Myanmar and Thailand. Finally, Ingerana borealis
clustered with the “true” Ingerana (family Dicroglossidae),
for which the type species is I. tenasserimensis.
Keywords: Dicroglossidae; Himalaya; Liurana
INTRODUCTION1
The frogs of family Ceratobatrachidae (Boulenger, 2009)
comprise a morphologically, developmentally, ecologically,
and biogeographically greatly variable and, thus, unique
clade (Brown et al., 2015). This family is notable for highly
variable body size, direct larval development, and the
ability to inhabit a wide variety of environments that lack
Received: 27 October 2015; Accepted: 15 December 2015
Foundation items: This study was supported by the Ministry of Science
and Technology of China (2014FY210200, 2011FY120200), the
program of Chinese Academy of Sciences (2015CASEABRI002), and
the Animal Branch of the Germplasm Bank of Wild Species of Chinese
Academy of Sciences (the Large Research Infrastructure Funding) to
JC; RMB’s work on the family Ceratobatrachidae has been supported
by the U. S. National Science Foundation (DEB 073199, 0334952,
0743491, 1418895).
#Authors contributed equally to this work
*Corresponding author, E-mail: chej@mail.kiz.ac.cn
DOI:10.13918/j.issn.2095-8137.2016.1.7

www.zoores.ac.cn
8
standing water-from small oceanic islands, to high-
elevation mossy montane forests (Brown & Alcala, 1982;
Brown et al., 2013; Günther, 2015). Currently, 91 species
are assigned to three genera: Platymantis Günther, 1858,
Cornufer Tschudi, 1838, and Alcalus Brown, Siler, Richards,
Diesmos, and Cannatella, 2015 (AmphibiaWeb, 2015;
Brown et al., 2015; Frost, 2015). These species are
distributed broadly from the South-West Pacific to the
island archipelagos of South Asia, with primary centers of
species diversity in Philippines and Solomon-Bismarck
Archipelago (Brown, 2009; Brown et al., 2013, 2015).
Four species, formerly referred to Southeast Asian frogs
Ingerana (Dubois, 1987), were recently assigned to the family
Ceratobatrachidae based on molecular data (Brown et al.,
2015). The four taxa (I. baluensis, I. mariae, I. rajae, I. sariba)
comprise a monophyletic group now shown to be the sister
group of Ceratobatrachinae (genera Platymantis and
Cornufer). However, “true” Ingerana (based on the
phylogenetic position of the type species, Ingerana
tenasserimensis [Sclater, 1892]) has been shown in multiple
studies to be more closely related to Dicroglossidae (Bossyut
et al., 2006; Wiens et al., 2009). Thus, these four species
were just recently assigned to the new genus Alcalus in the
family Ceratobatrachidae (Brown et al., 2015).
The species in genus Ingerana are small, plump frogs with
flattened and expanded toe and finger tips (Dubois, 1987).
Thirteen species previously have been referred to this genus
on the basis of morphological characters and life history traits.
However, recently its members have been placed in different
genera, and even different families, based on phylogenetic
analysis of molecular data analysis, i.e., A. baluensis, A.
mariae, A. rajae and I. tenasserimensis (Bossuyt et al., 2006;
Frost et al., 2006; Wiens et al., 2009; Brown et al., 2015).
The placement of other Ingerana species was controversial,
and some species were tentatively placed in different genera,
in the absence of accompanying molecular data. For example,
Limnonectes xizangensis was variably assigned to the genera
Cornufer (Hu, 1977), Ingerana (subgenus Liurana) (Dubois,
1987), Platymantis (Fei et al., 1990), Micrixalus (Zhao & Adler,
1993), and finally to Limnonectes (subgenus Taylorana)
(Borah et al., 2013; Frost, 2015). The complex and convoluted
taxonomic placement of several of these species has based
on morphological or reproductive characters. Because the
few key diagnostic characters emphasized by previous
worker are variable, and subject to individual interpretation
they may have mislead previous attempts to determine
systematic affinities of these poorly known frog species.
Here we report the results of a systematic study of five
species variably referred to Limnonectes or Ingerana,
including Lim. xizangensis, Lim. medogensis, Lim. alpine, I.
borealis and I. tasanae. We redistribute them among two
families, according to their phylogenetic affinities, as Liurana
xizangensis, Liu. medogensis, Liu. alpine, and Alcalus
tasanae (family Ceratobatrachidae) and Ingerana borealis
(family Dicroglossidae). These discoveries greatly extend the
westernmost geographic distribution of the primarily
Australasian archipelago family Ceratobatrachidae into
Indochina and China and assign early mainland branching
events in this family to lineages now exclusively represented
by species with restricted ranges in the high-elevation
Himalayan mountains of Tibet.
MATERIALS AND METHODS
Sampling
Four species, Limnonectes xizangensis, Lim. medogensis,
Lim. alpine and Ingerana borealis, were sampled from Medog
(=Motuo), Tibet (=Xizang), PR China (locality 1 in Figure 1,
Table 1). Following the collection of liver tissue samples
(preserved in 95% ethanol), the voucher specimens were
fixed with 10% formalin and then stored in 70% ethanol.
Collection of specimens followed animal-use protocols
approved by the Kunming Institute of Zoology Animal Use and
Ethics Committee. Two more species, I. tasanae and
Occidozyga martensii distributed in Myanmar and Thailand,
were also included. We borrowed their tissue samples from
the collections of the California Academy of Sciences (CAS),
Thailand National History Museum (THNHM), and Field
Museum of Natural History (FMNH) (Figure 1, Table 1).
DNA extraction and sequencing
Total DNA was extracted using standard phenol-chloroform
protocols (Sambrook et al., 1989). One fragment of
mitochondrial DNA of 12S rRNA, tRNA-Val, and 16S rRNA
(12S-16S) was sequenced for all samples using primers
L2519 and 16Sbr (Table 2). Three partial nuclear DNA
sequences of recombination activating gene 1 (Rag1),
tyrosinase (Tyr ) and rhodopsin (Rhod) were sequenced for all
samples using primers included in Table 2. Amplifications
were conducted in a 25 uL volume reaction, involved initial
denaturing step at 94 °C for 5 min; then 35 cycles of
denaturing at 94 °C for 45 sec, annealing at 50 °C or 55 °C for
45 sec, and extending at 72 °C for 45 sec; and a final
extending step of 72 °C for 7 min. The products were purified
with Gel Extraction Mini Kit (Watson BioTechnologies,
Shanghai, China), then sequenced on an ABI 3730×l DNA
automated sequencer (Applied Biosystems, UK).
For species not sampled by us, the sequences of 12S-16S,
Rag1, Tyr and Rhod were downloaded from GenBank (Table
1). All data were aligned with MUSCLE (Edgar, 2004) and
edited using MEGA 5.05 (Tamura et al., 2011).
Phylogenetic analysis
We estimated phylogenetic relationships using Bayesian
inference (BI) and maximum parimony (MP) using MrBayes
3.1.2 (Ronquist & Huelsenbeck, 2003) and PAUP* 4.0b10a
(Swofford, 2003). Mitochondrial and nuclear sequence
data were analyzed separately. Then a phylogenetic tree
was conducted using the concatenated sequence of all
genes. For BI analysis, the best-fitting nucleotide
substitution models were selected for 12S-16S and each
codon of Rag1, Tyr and Rhod using the Akaike information
criterion in MRMODELTEST v2.3 (Nylander, 2004). The BI
analysis used four Markov chains, with default heating

Zoological Research 37(1): 7-14, 2016 9

www.zoores.ac.cn
10
Figure 1 Map of sampling sites
Numbers correspond to localities in Table 1.
values, and run for 5 million generations while sampling trees every
1 000 generations. The first 25% sampled trees were discarded as
burn-in, and log-likelihood scores were examined using Tracer v
1.4 (Rambaut & Drummond 2007) to assure convergence
(effective sample size [ESS] values >200). For the MP analysis, full
heuristic tree searches were used, with 1 000 replications, random
addition of sequences and tree-bisection-reconnection (TBR)
branch swapping. Non-parametric bootstrap support was estimated
using 1 000 replicates of full heuristic searches.
RESULTS
Sequence information
Sequencing generated a total of 1 371 base pairs (bp) of 12S-
16S data for Limnonectes alpine and Ingereana tasanae.
Additionally, a part of fragment of 12S-16S was successfully
sequenced for Occidozyga martensii, Lim. xizangensis and I.
borealis. We were unable to collect 12S-16S for Lim.
medogensis. For nuclear sequences of Rag1, 1 100 bp was
successfully sequenced for all samples except for Lim.
medogensis, but we only included 553 bp in subsequent
analyses so as to match Rag1 data sequences available on
GenBank. Sequences of 553 bp Ty r and 316 bp Rhod were
successfully sequenced for all samples. All new generated
sequences were submitted to GenBank (Accession numbers
KU243083-KU243120, Table 1).
Tab le 2 Primers information used for four DNA fragments sequencing
Locus Primer name Sequence (5'-3') Tm Citation
12S-16S L2519 AAACTGGGATTAGATACCCCACTAT 55 Richards & Moore, 1996
H3296 GCTAGACCATKATGCAAAAGGTA
16Sbr CCGGTYTGAACTCAGATCAYGT Palumbi et al., 1991
16Sbr CCGGTYTGAACTCAGATCAYGT
12/16S-696F TATARCAATAGTACCGCAAG This study
STW-NA1 GGGTGACGGGCGGTTTGT
Rag1 L-RAG1RAn CTGGTCGTCAGATCTTTCAGC 50 Stuart, 2008
H-RAG1RAn GCAAAACGTTGAGAGTGATAAC
L-RAG1RAninT GGAAATTGGTGGAATCCTCAG
H-RAG1RAninT ATATAGATAGAGCCTGAGGC
Tyr TYR 1 G TGCTGGGCRTCTCTCCARTCCCA 50 Bossuyt & Milinkovitch, 2000
TYR 1 B AGGTCCTCYTRAGGAAGGAATG
Rhod RhoG 1 A ACCATGAACGGAACAGAAGGYCC 50
RhoG 1 G GTAGCGAAGAARCCTTCAAMGTA
Phylogenetic relationships
The best-fitting model were TVM+I+G for mitochondrial 12S-
16S, K80+I, TIMef+I and TIMef+I for three codon positions
of Rag1, TVM+I+G, K81+I and GTR+G for three codon
positions of Tyr, SYM+G, TVM+I+G and TIM+G for three
codon positions of Rhod. The phylogenetic analyses based
on nuclear DNA and mtDNA showed similar topologies.
Most recognized families formed monophyletic groups;
however, the monophyly of Dicroglossidae was not
recovered using mtDNA, but highly supported by nuclear
DNA. This possibly is due to the inability of mtDNA
sequence to resolve phylogenetic relationship at deeper
levels (i.e., Kingston et al., 2009), or sparse taxon
sampling in our analysis. The five focal species were
yielded the same topology in both phylogenetic analyses,
so the difference between mtDNA and nuclear DNA
topologies do not affect our taxonomy. The Bayesian tree
resulting from based on concatenated sequence of all
genes is shown in Figure 2. Limnonectes xizangensis, Lim.
medogensis, Lim. alpine and Ingerana tasanae clustered
with species of family Ceratobatrachidae. Three primary
lineages were identified in this family, corresponding to two

Zoological Research 37(1): 7-14, 2016 11
known subfamilies Alcalinae (Clade A) and
Ceratobatrachinae (Calde B), and a new lineage (Clade C),
unsampled in previous phylogenetic estimates (Brown et
al., 2015). Samples of Ingerana tasanae from Thailand and
Myanmar grouped together, and this clade formed a
strongly supported group with Alcalus baluensis and A.
mariae (Clade A). Limnonectes xizangensis, Lim.
medogensis and Lim. alpine formed a monophyletic group
(Clade C), which is strongly supported as related to the
family Ceratobatrachidae. Finally, Ingerana borealis
samples clustered with species in the subfamily
Occidozyginae (Dicroglossidae). This species formed a
clade with I. tenasserimensis (type species of Ingerana),
as the sister group to Occidozyga.
Figure 2 Bayesian inference tree based on concatenated analysis of all genes
Nodal support values are Bayesian posterior probabilities (only ≥90 are shown) and bootstrap proportions from maximum parsimony analysis (only ≥70 are
shown). Newly sequenced samples are emphasized with bold text.
DISCUSSION
Taxonomy of species of Limnonectes and Ingerana, and a
record of a new family for China, Myanmar and Thailand
The three poorly understood species, formerly referred to
Limnonectes and Ingerana from the largely unexplored area
of Himalayan Tibet (Lim. xizangensis, Lim. medogensis and
Lim. alpine), have had unstable taxonomic histories (Frost,
2015) and, until now, unclear systematic affinities. Dubois
(1987) established the genus Ingerana, in which there are two
subgenera Ingerana (Ingerana) and Ingerana (Liurana).
Ingerana xizangensis (formerly Cornufer xizangensis, Hu,
1977) was included in subgenus Ingerana (Liurana) by Dubois
(1987). Fei et al. (1997) identified significant morphological
differences between these two subgenera, including the
presence of lingual papilla on the tongue, the absence of
terminal discs on fingers and toes, and the absence of
circumarginal grooves on fingers and toes in Ingerana
(Liurana), (Figures 3-4). Thus, Liurana was elevated to the
level of genus to include the species Liu. xizangensis, Liu.

www.zoores.ac.cn
12
Figure 3 Photos of Liurana alpine and Liurana xizangensis in life
(Photos by Kai WANG)
A-D: dorsolateral view; ventral view; ventral view of hand; and ventral
view of foot of Liu. Alpine, respectively; E-H: dorsolateral view; ventral
view; ventral view of hand, and ventral view of foot of Liu. Xizangensis,
respectively.
Figure 4 Photos of Liurana medogensis (Photos by Kai WANG)
A-C: dorsal view, dorsolateral view, and ventral view (C) in life,
respectively; D: ventral view of hand (above) and foot (below) in
drawing (from Fei et al., 2009).
medogensis, Liu. alpine and Liu. liui (Fei et al., 1997, 2009,
2012; Huang & Ye, 1997). Fei et al. (2009) considered Liurana
to be part of the family Occidozygidae. Subsequently, Fei et al.
(2010) established a new subfamily Liuraninae in the family
Occidozygidae based on morphological data. Frost et al.
(2006) considered Liurana to be a junior synonym of Ingerana
on the basis of the original description and overlapping
character states. Based on available morphological
characters, Borah et al. (2013) placed Liurana in synonymy
with Taylorana (now considered to be a subgenus of
Limnonectes, [Frost, 2015]). Thus, for the last several years,
these species have resided in Limnonectes (Frost, 2015)
pending appropriate phylogenetic analysis to determine of
their systematic affinities.
Based on analysis of multilocus DNA sequence data, Liu.
xizangensis, Liu. medogensis and Liu. alpine are herein
assigned to the family Ceratobatrachidae and represent the
first record of this family in China. In our analysis these
species formed strongly supported monophyletic group,
clustering with members of the Ceratobatrachidae (sensu Brown
et al., 2015). In contrast, species of genus Ingerana (I.
tenasserimensis and I. borealis) and Limnonectes (Lim. limborgi,
Lim. sp.) formed the strongly supported clades in subfamily
Occidozyginae, as showed in previous studies (i.e. Bossuyt et
al., 2006; Wiens et al., 2009; Pyron & Wiens, 2011). Based on
our observations of morphological variation, these three
species likewise are distinguished from the species of
Ingerana and Limnonectes by the: (1) absence of interdigital
webbing of the feet, (2) absence of terminal discs on fingers
and toes, (3) absence of circumarginal grooves on the fingers
and toes, and (4) absence of tarsal folds. All available
evidence supports the recognition of Liu. xizangensis, Liu.
medogensis and Liu. alpine as single taxon, for which Liurana is
the available generic name with priority. We assign Liurana to the
family Ceratobatrachidae. Within Ceratobatrachidae, three
lineages are recognized: Clade A and Clade B (Figure 2)
correspond to previously recognized subfamilies Alcalinae
and Ceratobatrachinae, respectively. The genus Liurana
(Clade C) is equivalent in species content to the subfamily
Liuraninae Fei, Ye and Jiang, 2010, now transfered to the
family Ceratobatrachidae.
Ingerana tasanae is distributed in western and central
peninsular Thailand, and its range possibly extends into
adjacent Tenaserim and Myanmar (Stuart et al., 2008). Our
molecular data clearly place all Ingerana tasanae samples in
the same clade as other members of the genus Alcalus
(Ceratobatrachidae). This constitutes a new record of family
Ceratobatrachidae for Myanmar and Thailand. Our northern
Myanmar samples of A. tasanae is highly divergent from
individuals from southern Myanmar and southern Thailand. It
remains possible that additional taxonomic diversity will be
revealed in the genus Alcalus with accumulation of data and
field studies of these populations.
Previous studies placed I. borealis in the genus
Phrynoglossus (Fei et al., 2009, 2010, 2012), Occidozyga
(Ahmed et al., 2009; Mathew & Sen, 2010), and Ingerana
(Sailo et al., 2009). Based on our molecular data, I. borealis
falls into a strongly supported clade with I. tenasserimensis,
the type species of Ingerana. Thus, our molecular data
support its systematic position within genus Ingerana based
on morphological comparison by Sailo et al. (2009).
New insight from the phylogeny and distribution of
Ceratobatrachidae
Brown et al. (2015) developed a stable taxonomy for the
family Ceratobatrachidae. Two subfamilies were identified:
Ceratobatrachinae and Alcalinae. Ceratobatrachinae includes

Zoological Research 37(1): 7-14, 2016 13
two large monophyletic radiations, Cornufer and Platymantis.
The species belonging to the subfamily Ceratobatrachinae
have a broad distribution in the south-west Pacific, including
Philippines, Borneo, New Guinea, Admiralty and Bismarck
archipelagos, Solomon Islands, and Fiji. Alcalinae includes
only four species of Alcalus, which are distributed only on the
island archipelagos of Southeast Asia (Sundaland).
Our research identified other four species which we now
transfer to Ceratobatrachidae; this greatly increases the
distribution of the family to the mainland of Southeast Asia
and the Himalayan region (Figure 1). Given our experience
with the unexpected phylogenetic affinities of the species
studied here, we would not be surprised if additional
phenotypically similar taxa are found to belong in
Ceratobatrachidae in the near future. Of particular note,
Ingerana charlesdarwini (Das, 1998), distributed in the
Andaman Islands (India), could very well be the sister lineage
to the remaining lineages in this large and spectacularly
diverse anuran family.
The surprising discovery that the clade Ceratobatrachidae
is broadly distributed from the Himalayas, mainland and
peninsular southeastern Asia, to the southwest Pacific, will
help us to understand the biogeography in this region. The
sister-group relationship of Ceratobatrachinae and Alcalinae,
although not unequivocally supported mirrors the geographic
distribution of these clades. This relationship between
mainland and archipelago species is also seen in the
divergence between the mainland species Alcalus tasanae
and the archipelago species A. mariae and A. baluensis.
Additional, unexpected patterns between mainland and island
taxa may be found with more complete taxon sampling, which
emphasizes the need for additional fieldwork in mainland
southeastern Asia.
ACKNOWLEDGEMENTS
We would like to thank Dr. Pi-Peng LI (Shenyang Normal University), Mr.
Tao LIANG, Mr. Duan YOU, and Mr. Ya-Di HUANG, who helped with
fieldwork in Tibet, Prof. Yue-Zhao WANG (CIB), Prof. Yue-Ying CHEN (CIB)
and Prof. Sheng-Quan LI (CIB) for kindly letting us examine specimens
under their care. We also thank the California Academy of Sciences (CAS),
Thailand National History Museum (THNHM), and Field Museum of Natural
History (FMNH) for loan of tissue samples.
REFERENCES
Ahmed MF, Das A, Dutta SK. 2009. Amphibians and Reptiles of Northeast
India. A Photographic Guide. Guwahati, India: Aaranyak.
AmphibiaWeb: Information on amphibian biology and conservation. [web
application]. 2015. Berkeley, California: AmphibiaWeb. Available at http:
//amphibiaweb.org/.
Borah MM, Bordoloi S, Purkayastha J, Das M, Dubois A, Ohler A. 2013.
Limnonectes (Taylorana) medogensis (Fei, Ye & Huang, 1997) from Arun-
achal Pradesh (India), and on the identity of some diminutive ranoid frogs
(Anura: Dicroglossidae, Occidozygidae). Herpetozoa, 26(1/2): 39-48.
Bossuyt F, Brown RM, Hillis DM, Cannatella DC, Milinkovitch MC. 2006.
Phylogeny and biogeography of a cosmopolitan frog radiation: Late creta-
ceous diversification resulted in continent-scale endemism in the family
ranidae.. Systematic Biology, 55(4): 579-594.
Bossuyt F, Milinkovitch MC. 2000. Convergent adaptive radiations in
Madagascan and Asian ranid frogs reveal covariation between larval and
adult traits. Proceedings of the National Academy of Sciences of the United
States of America, 97(12): 6585-6590.
Boulenger GA. 2009. Diagnoses of new reptiles and batrachians from the
Solomon Islands, collected and presented to the British Museum by Guppy
HB, Esq, MB, ‘Lark’ HMS. Proceedings of the Zoological Society of Lon-
don, 52(2): 210-213.
Brown WC, Alcala AC. 1982. Modes of reproduction of Philippine anurans.
In: Rodin AGJ, Miyata A., (eds). Advances in Herpetology and Evolutionary
Biology. Cambridge, MA: Museum of Comparative Biology, 416-428.
Brown RM. 2009. Frogs. In: Gillespie R, Clague D. (, eds). Encyclopedia of
Islands. Berkeley: University of California Press, .
Brown MR, Richards JS, Broadhead ST. 2013. A new shrub frog in the
genus Platymantis (Ceratobatrachidae) from the Nakanai Mountains of
eastern New Britain Island, Bismarck Archipelago. Zootaxa, 3710 (1): 31-45.
Brown MR, Siler DC, Richards JS, Diesmos AC, Cannatella CD. 2015.
Multilocus phylogeny and a new classification for Southeast Asian and
Melanesian forest frogs (family Ceratobatrachidae). Zoological Journal of
the Linnean Society, 174(1): 130-168.
Das I. 1998. A remarkable new species of ranid (Anura: Ranidae), with
phytotelmonous larvae, from Mount Harriet, Andaman Island. Hamadryad,
23: 41-49.
Dubois A. 1987. Miscellanea taxinomica batrachologica (I). Alytes, 5: 7-95.
Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accu-
racy and high throughput. Nucleic Acids Research, 32(5): 1792-1797.
Fei L, Ye CY, Huang YZ. 1990. Key to Chinese Amphibians. Chongqing:
Publishing House for Scientific and Technological Literature.
Fei L, Hu SQ, Ye CY, Huang YZ. 2009. Fauna Sinica. Amphibia. Volume 3.
Anura Ranidae. Beijing: Science Press.
Fei L, Ye CY, Huang YZ. 1997. Taxonomic studies of the genus Liurana of
China including descriptions of a new species (Amphibia: Ranidae). Cultum
Herpetologica Sinica, 6-7: 75-80.
Fei L, Ye CY, Jiang JP. 2010. Phylogenetic systematics of Ranidae. Herpe-
tologica Sinica, 12: 1-43.
Fei L, Ye CY, Jiang JP. 2012. Colored Atlas of Chinese Amphibians and
Their Distributions. Chengdu: Sichuan Publishing House of Science &
Technology, . .
Frost RD, Grant T, Faivovich J, Bain HR, Haas A, Haddad FBC, de Sá OR,
Channing A, Wilkinson A, Donnellan CS, Raxworthy JC, Campbell AJ,
Blotto LB, Moler P, Drewes CR, Nussbaum AR, Lynch DJ, Green MD,
Wheeler CW. 2006. Amphibians tree of life. Bulletin of American Museum
of Natural History, 297: 1-370.
Frost DR. 2015. Amphibian Species of the World: an Online Reference.
Version 6.0 (Nov 12, 2015). Electronic Database accessible at http: //
research.amnh.org/herpetology/amphibia/index.html. American Museum of
Natural History, New York, USA.
Günther, ACLG. 1858. Neue Batrachier in der Sammlung des britischen
Museums. Archiv für Naturgeschichte, 24: 319-328.
Günther R. 2015. Description of two new taxa of the ceratobatrachid genus
Platymantis from western New Guinea (Amphibia, Anura). Vertebrate

www.zoores.ac.cn
14
Zoology, 65(1): 101-116.
Hu SQ. 1977. A survey of amphibians in Xizang (Tibet). Acta Zoologica
Sinica, 23: 54-63.
Huang YZ, Ye CY. 1997. A new species of the genus Liurana (Amphibia:
Ranidae) from Xizang, China. Cultum Herpetologica Sinica, 6-7: 112-115.
Kingston SE, Adams LD, Rosel PE. 2009. Testing mitochondrial sequences
and anonymous nuclear markers for phylogeny reconstruction in a rapidly
radiating group: molecular systematics of the Delphininae (Cetacea: Odon-
toceti: Delphinidae). BMC Evolutionary Biology, 9: 245.
Mathew R, Sen N. 2010. Pictorial Guide to Amphibians of North East India.
Kolkata, India: Zoological Survey of India.
Nylander JAA. 2004. MrModeltest v2. Uppsala University, Evolutionary
Biology Center.
Palumbi SR, Martin A, McMillan WO, Stice L, Grabowski G. 1991. The
simple fool’s guide to PCR, Version 2.0. Privately published document
compiled by S. Palumbi.
Pyron RA, Wiens JJ. 2011. A large-scale phylogeny of Amphibia including
over 2800 species, and a revised classification of advanced frogs, sala-
manders, and caecilians. Molecular Phylogenetics and Evolution, 61(2):
543-583.
Rambaut A, Drummond AJ 2007. Tracer v 1.4. Available at
http://beast.bio.ed.ac.uk.sci-hub.io/Tracer.
Richards CM, Moore WS. 1996. A phylogeny for the African treefrog family
Hyperoliidae based on mitochondrial rDNA. Molecular Phylogenetics and
Evolotion, 5(3): 522–532.
Ronquist F, Huelsenbeck JP. 2003 MRBAYES 3: Bayesian phylogenetic
inference under mixed models. Bioinformatics, 19(12): 1572-1574.
Sailo S, Lalremsanga HT, Hooroo RNK, Ohler A. 2009. Ingerana borealis
(Annandale, 1912): a new record from Mizoram (India), with notes on its
systematic position and natural history. Alytes, 27: 1-12.
Sambrook J, Fritsch E, Maniatis T. 1989. Molecular Cloning: A Laboratory
Manual (2nd edn). New York: Cold Spring Harbor Laboratory Press, .
Stuart BL. 2008. The phylogenetic problem of Huia (Amphibia: Ranidae).
Molecular Phylogenetics and Evolution, 46(1): 49-60.
Stuart SN, Hoffmann M, Chanson J, Berridge NCR, Ramani P, Young B.
2008. Threatened Amphibians of the World. Barcelona, Spain; International
Union for the Conservation of Nature, Gland. Switzerland; Conservation
International, Arlington, Virginia, USA: Lynx Editions.
Swofford DL. 2003. PAUP*: Phylogenetic analysis using parsimony (*
and other methods) Version 40b10. Sinauer Associates, Sunderland,
Maryland.
Tamura K, Peterson D, Stecher G, Nei M, Kumar S. 2011. MEGA5: Molecu-
lar evolutionary genetics analysis using maximum likelihood, evolutionary
distance, and maximum parsimony methods. Molecular Biology and Evolu-
tion, 28(10): 2731-2739.
Tschudi JJ. 1838. Classification der Batrachier mit Berücksichtigung der
fossilen Thiere dieser Abtheilung der Reptilien. Neuchâtel: Petitpierre.
Wiens JJ, Sukumaran J, Pyron RA, Brown RM. 2009. Evolutionary and
biogeographic origins of high tropical diversity in Old World frogs (Ranidae).
Evolution, 63(5): 1217-1231.
Zhao EM, Adler KA. 1993. Herpetology of China.Oxford, Ohio: Contributions
to Herpetology 10. Society for the Study of Amphibians and Reptiles.