ArticlePDF Available

Sawsan Sajid [PDF] from ijcmas.com Prevalence of erm Genes among Methicillin Resistant Staphylococcus aureus MRSA Iraqi Isolates

Authors:

Figures

Content may be subject to copyright.
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
575
Original Research Article
Prevalence of
erm
Genes
among
Methicillin Resistant
S
taphylococcus
aureus
MRSA Iraqi
I
solates
Sawsan Mohammed Kareem
1*
, Sawsan
Sajid Al
-
Jubori
2
and
Munimradwan Ali
3
Department of Biology,
College of Science, Al
-
Mustan
siriyiah
University
, Iraq
*Corresponding author
A B S T R A C T
I
ntroduction
S. aureus bacteria consider the most
frequent agent for causing hospital a queried
infection additional to the great ability to
adapt itself to numerous conditions and
successful clones can be epidemic and even
pandemic by its ability to spread from one S.
aureus
is a common pathogen, although
continuous progress in the medical and
diagnostic field, it is a causative agent to a
vast
numbers of infections incorporating soft
tissue infections, impetigo, septicemia toxic
shock and scalded skin syndrome,
Conventionally methicillin resistance
Staphylococcus
aureus
(MRSA) was
consider a Hospital- Acquired infection
(HA) (
Patrick
et
al., 2009). The large
threading
is currently represented by
methicillin resistance S. aureus MRSA that
usually carries additional antibiotic
resistance determinants, therefore
warranting the usage of the last-barrier drug
like glycopeptides. Today the emergence of
MRSA with reduce sensitivity to
vancomyc
in has increased particularly
(
Mohammadi
et al., 2014). The control of
such hospital-acquired infection demands
spendy surveillance programs containing
ISSN: 2319
-7706
Volum
e
4
Number
5
(201
5
) pp.
575
-
585
http://
www.ijcmas.com
Eighty four
staphylococcal
bacterial isolates were obtained from Medical city in
Baghdad during the period August to November 2013The results revealed
74
isolated were S. aureus isolates identified by routine chemical tests, in genotypic
identification has been appeared (61 out of 74) isolates contained
mec
A (MRSA),
phenotypic screening about MLSB was showed(18 out of 74) S. aureus isolates is
constitut
ive resistance to erythromycin cMLSB phenotype (24.32%), (6 out of 74)
S. aureus isolates sensitive to erythromycin (9.83%), (4 out of 74) S. aureus
isolates inducible resistance to erythromycin D-shape (6.55%), (9 out of 74)
S.
aureus
isolates showed MS phenotype which is resistance to erythromycin and
sensitive to clindamycin without D-shape (14.75%) and finally (29 out of 74) S.
aureus
isolates showed intermediate resistance to erythromycin, while genotypic
screening about MLSB was s
howed
prevalence of
erm
A gene (7.35%), of
erm
C
gene (5.88%) and no
erm
B gene recovered fr
o
m
S. aureus
isolates.
Keywo rds
Staphylococcus
aureus,
MRSA,
erm genes
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
576
patient isolation and contact precaution, with
great i
mpact on costs (
Costella
et al., 2010
).
S. aureus isolates qualify to have a
resistance to Erythromycin, this resistance
commonly associated with resistance to
other Macrolides. It is found three genes in
S. aureus responsible for this resistance
(erm
A,
ermB and ermC) these genes
encoding to methylase enzymes which play
role in modifying ribosomal target site
leading to MLSB phenotype (
Zmantar
et al.,
2011). MLSB phenotype resistance maybe
occur constitutive or inducible form after
exposure to inducer which is macrolide
molecule, induction test have been done by
double diffusion disc test erythromycin and
clindamycin disks are utilized in test
(
Fiebelkorn
et al., 2003
).
The present study aims to identification of S.
aureus
isolates and investigate the
oc
currence of MRSA among S. aureus
isolates in Iraqi hospitals by detecting
mobile genetic elements mecA gene, the
isolates were also studied for phenotypic
screening about constitutive and inducible
resistance toward Macrolide- Lincosamide,-
Streptogramin B additional to genotypic
screening about MLSB genes erm A, erm B
and erm
C prevalence among MRSA
MSSA isolates.
Material and Methods
Collection and diagnosis of bacterial
isolates:
Eighty four staphylococcal bacterial isolates
were obtained from Medical
city in Baghdad
during the period August 2013 to November
2013. It was divided between seventy five
isolates from clinical samples from patient
and nine isolates from hospital environment.
The source of clinical isolates distributed as
(n=5) isolates from Blood, (n=15) isolate
from urinary tract infection, (n=43) skin
infection, (n=2) eye swab, (n=5) ear swab,
(n=3) nasal swab, one isolate from seminal
fluid and lastly one isolated from sputum.
Each isolate was identified according the
morphology, routine biochemical tests
according to
Atlas
et al. (
1995
) and
confirmed by EPI Staph test.
Genotypic
detection to screening about
methicillin resistant S. aureus isolates
MRSA
The prevalence of MRSA isolates was done
by using specific primers and amplicon
sizea
s list in table 1 to detecting mecA gene
(responsibl
e for methicillin resistance)
(Cabrera et al., 2010). Template DNA was
prepared by simple boiling methods. Briefly,
few isolated colonies of overnight growth
bacteria were suspended thoroughly in 5 ml
of
TE buffer and boiled in water bath for 5
min. after centrifugation the supernatant was
separated and applied as template of DNA.
PCR mixture was prepared by adding 12.5µl
of GoTaq®Green master Mix (2X)
promega, l template DNA, 1.5µl from
each forward and reverse primers with final
concentration 1 poml l, finally volume
was completed to 25µl by adding nuclease
free water. PCR condition was usually
started the process with initial denaturation
step at (95 C/30 min) followed by repeated
cycles (35 times) which consists from
denaturation step at (94
C/30 sec.) annealing
step at (53 C/30 sec.) then extension step at
(72
C/30 sec.) followed by final extension
step at (72 C/10 min). PCR products were
detected in 1 % agarose gel for 1 hr. at 50 V,
stained with ethidium bromide and
visualized by transilluminator.
Phenotypic
screening of (MLSB)
in
S. aureus
isolates
Double
diffusion disc method (D
-shape) was
used to screening about MLSB phenotype
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
577
by using Clindamycin (2 µg/disc) and
Erythromycin (
15 µg/disc) discs were placed
at the distance
(15
-20 mm)
edge
-
to
-edge on
the surface of medium). The process was
carried as recommended in CLSI (2013)
isolates. Three phenotypes will be noticed as
following
1- Constitutive (cMLSB) phenotype:
isolates appeared resistant to each
erythromycin and clindamycin discs
with circular inhibition zone around both
discs.
2- Inducible (iMLSB) phenotype: isolates
appeared resistant to erythromycin and
sensitive to clindamycin with flat
inhibition zone D-shape toward
erythro
mycin disc
3- Macrolides resistance and clindamycin
sensitive (MS) phenotype: isolates
appeared resistance to erythromycin and
sensitive to clindamycin without D-
shape phenomenon.
The results summarized in (figure 1)
Genotyping detection of MLSB
The prevalence of erm
A,
erm B and erm C
genes were
determined
to genotypic
screening about macrolides resistant by
PCR. There were used Multiplex PCR to
screening about erm A and erm C genes and
uniplex PCR to screening about
erm
B gene,
Process was done by using specific primers
with the amplicon size (Martineau et al.,
2000) were listed in table 1. PCR mixture
was prepared as described previously. PCR
condition for each primer was started the
process with initial denaturation step at
(96
C/30 min) followed by repeated cycles
(40 times) which consists from denaturation
step at (94 C/30 sec.) annealing step at
(56
C/30 sec.) then extension step at
(72
C/30 sec.) followed by final extension
step at (72 C/10 min). PCR products were
detected i
n 1 % agarose gel for 1 hr. at 50 V,
stained with ethidium bromide and
visualized by transilluminator.
Results and Discussion
Bacterial isolation and identification
Staphylococcus aureus is a commensal
bacteria which almost colonizes the nose of
health
y persons.
S. aureus
bacteria can cause
wide spectrum of infection, beginning from
skin and soft tissue infections to invasive
diseases.
Because
S.
aureus
have numerous
virulence factors make it have ability
to
colonize
and distribute of different
environm
ents. It have been observed
Rapid emergence of MRSA In the last two
dedicate associated with complicated the
control of infection (
Gopal
et al.,
2008
).
The
collected isolates were initially diagnosed as
Staphylococcus.
to confirm biochemical
tests were d
one to confirm the identification,
Staphylococci which showed negative
reaction in oxidase test, positive reaction in
catalase test, also most of them (n=74)
showed positive reaction in coagulase test
(COPS) and few isolated (n=10) showed
negative reaction (CONS) coagulase
positive Finally, to confirm accurate
identification at generic and species level
was used API Staph system which applied
on all isolates including those with
coagulase negative results. The results
appeared similarities to the previous
i
dentifications tests as shown (table 2)
According to the results have been shown in
(Table 2), the highest percentage of
collected
S. aureus isolates from skin
infection (51.35%), Al-Talib and his
colleagues (Al-
Talib
et al., 2009) were
revealed in their
research
S. aureus isolates
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
578
was the predominant pathogen recovered
from burn wound (33.6%) which is
colonized and infected skin tissues more
than other bacterial species.
Genotypic method to screening about
MRSA
Detecting of MRSA isolates have been done
by mobile genetic element mecA and using
polymerase chain reaction PCR, this
technique characterized with (93.8 to 100
%) sensitivity and (98.6 to 100) specificity,
In recent years, clinicians and researchers
have been excerpted huge genomic
information from clinical samples
especially
in clinical bacteriology leading to major
transformation in diagnostic way, belong to
the diagnostic in PCR (
Ratnayake
and
Olver
, 2011
).
The results revealed (61 out of
74) isolates contained mecA (82.43%) is
MRSA and (13 out of 74) isolates did not
contained mec
A (17.57%) is MSSA
In fact the significant of rapid diagnostic
pathogen in clinical samples play critical
role in improve patient care because the
accurate identification of pathogen at
species level and antibiogram
sensitivity
consider the first line in treatment and
control on infectious diseases (
Croxatto
et
al., 2012
).
Phenotypic detection of (MLSB)
This method is concluded by detecting the
resistances
to erythromycin disc, inducible
resistance to clindamycin which occur when
erythromycin diffuse to ward clindamycin
disc will produce flattening inhibition zone
of clindamycin disc in the margin adjust to
the erythromycin disc to forming D-
shape
(
Sedighi
et al., 2009
).
Resistance in
S. aureus
bacteria have done if
it have
erm
genes, erythromycin can attach
to mRNA leading to get the cell start codon
of methylase gene as a result methylation is
done (
Zmantar
et al., 2011), so changing in
erythromycin binding site has been occurred
also overlapping in binding site of the three
mentioned classes account for cross-
resistance,
resistance to erythromycin
produced not only by expression of erm
genes constitutive way but also by inducible
way if present of erythromycin molecules
which induce production of methylase
(
Stefani
e
and
Gallert
, 2014
).
The results of this study have been revealed
four distinct resistance phenotypes, as
shown in (table 3)
.
As shown in (table 3) the results of double
diffusion disc (18 out of 74) S. aureus
isolates is constitutive resistance to
er
ythromycin cMLSB phenotype (24.32%),
which is distributed to(13 out of 61) MRSA
(21.31%) and MSSA (3 out of 13) (38.46%),
(6 out of 74) S. aureus isolates sensitive to
erythromycin (9.83%) all of them is MRSA,
(4 out of 74) S. aureus isolates inducible
res
istance to erythromycin D-shape (6.55%)
also all of them is MRSA, (9 out of 74)
S.
aureus
isolates showed MS phenotype
which is resistance to erythromycin and
sensitive to clindamycin without D-
shape
(14.75%) and finally (29 out of 74) S.
aureus
isolates showed intermediate
resistance to erythromycin distributed
between MRSA and MSSA as shown in
(table 3). MLSB are antibiotics used
commonly to treat S. aureus infection,
additional to clindamycin which is used
frequently to treat skin and superficial
infecti
on especially with patients have
allergy to penicillin as alternative drug
(
Sedighi
et al., 2009
).
In the current study, it
was observed a higher prevalence of the
cMLSB phenotype in the MSSA isolates
compared with MRSA isolates The results
of this study disagree with others studies
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
579
have showed higher frequency of
constitutive resistance to erythromycin in
MRSA isolates
Bottega
et al. (
2014
) have
been mentioned (20 out of 29; 68.9%)
MRSA have cMLSB
also
(
Seif
et al., 2012
)
have been observed found this phenotype in
(52.3%) MRSA isolates. On the other hands,
it have been observed iMLSB phenotype
among clinical samples of S. aureus
specially MRSA isolates more frequently in
urine, blood and general secretions, this
founding relatively similar with Bottega
et
a
l.
(2014) he mentioned (3 isolates of
MRSA showed D- test positive (2.1%).
Furthermore the results disagree with anther
author mentioned toprevalence of MS
phenotype among MRSA is high (44.6%)
(
Lyall
et al., 2013
).
In fact macrolides,
lincosamides and streptogramin B all of
them have same target site which is protein
biosynthesis, erythromycin belong to
macrolides and can induce cross-
resistance
against two others groups iMLSB, So
S.
aureus
isolates which appear resistance to
erythromycin will resist to li
nocosamides
and strptogramin B (
Stefanie
and
Gallert
,
2014
).
The prevalence of iMLSB
phenomenon is found in all
Staphylococcus
species pathogenic and non-pathogenic to
human so
Staphylococcus
isolates can play
critical role as reservoir for resistance gene
s
and possibly consider the source of spread
them to environment, because the little
concentration of erythromycin even pico-
molar can induce resistance against
lincosamides so it consider potential risk for
human health
(
Stefanie
and
Gallert
, 2014
).
Ge
notypic detection about MLSB
This study have been revealed the
prevalence of erm A gene (7.35%) in five
out of sixty-eight isolates of S. aureus have
different phenotypically resistance forms to
erythromycin all five isolates is MRSA, (4
out of 5) isolates harboring with
erm
A gene
have constitutive resistance to MLSB and
only one isolates appeared MS that is
meaning resistance to erythromycin and
sensitive to clindamycin as shown in table
(3
-3). This finding is agree with Zmantar
et
al.
(2011) observed incidence of erm A
(7.7%) in MRSA isolates while disagree
with Paniagua-
Contreras
et al (19) have
been observed incidence of erm A gene
(100%),
erm
B gene (100%)and erm C
(9.5%) in MRSA isolates.
others founding in this study present of erm
C gene (5.88%) which is recovered from
four out of sixty-eight isolates, two of them
showed cMLSB phenotype and harboring
with erm
A gene. on the other hands two
isolates recovered from blood and sputum
showed inducible MLSB with D-
shape
phenomenon, unfortunately none of our
MRSA isolates harboring with erm B gene.
This finding is correspondence with many
studies have been done to investigate
harboring the clinical isolates of S. aureus
showed ermA and ermC
predominant
erm
genes found in S. aureus and CON
(
Gherardi
et al., 2009
).
S. aureus isolates
can resistant to macrolides by two
mechanism, ATP-dependent efflux pump
which encoded by
mrs
A gene also
macrolides efflux effected by the role of
membrane protein which coded by
mef
gene
(
Zmantar
et al., 2011
).
Another mechani
sm
which is done by erm genes family which
have nearly forty types of erm genes,
expression only one type can lead to
resistance against MLSB antibiotics
(
Stefanie
and
Gallert
, 2014). The resistance
presented by single alteration in ribosomal
target site, erm genes encode to N6-
demethylase which play the role in N6
demethylation of an adenine residue in the
23S rRNA causing conformational alteration
in ribosome and increase resistance of S.
aureus
strains to MLSB group (
Martineau
et
al.,
2000). As it
menti
oned previously in
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
580
phenotypic detection of MLSB, four isolates
of MRSA showed D-shape, two of these
isolates (MRSA NI and MRSA S21) had
none of three resistance genes, it maybe
belong to the high diversity of this gene
family specially in clinical isolates
additional to many different spices of
Staphylococcus
and high rate of horizontal
gene transfer with them.
Table.1
Primers
used for PCR amplification
primer
Primer sequences
5 ..3
Origin
Product
size (bp)
Reference
from
mec
A F
GTAGAAATGACTGAACGT
CCGATAA
mec
A R
CCAATTCCACATTGTTTCGGTCTAA
Oligo Data,
South,
Africa
314
Cabrera
et
at., 2010
erm
A F
TAT CTT ATC GTT GAG AAG GGA TT
erm
A R
CTA CAC TTG GCT TAG GAT GAA A
Oligo Data,
South,
Africa
139
Martineau
et al.,
2000
erm
B F
CTA TCT GAT TGT TGA
AGA AGG ATT
erm
B R
GTT TAC TCT TGG TTT AGG ATG AAA
Oligo Data,
South,
Africa
142
Martineau
et al.,
2000
erm
C F
CTT GTT GAT CAC GAT AAT TTC C
erm
C R
ATC TTT TAG CAA ACC CGT ATT C
Oligo Data,
South,
Africa
190
Martineau
et al.,
2000
Table.2
distr
ibution of Staphylococci belong to source of isolation
Source of isolation
No. of isolated
S. aureus
S. epidermis
Percentage
of
S. aureus
from total
isolates 74
Skin infection
43
38
5
51.35 %
UTI
15
12
3
16.21 %
Blood
5 3 2
4.05 %
Ear infection
5 5 0
6.75 %
Nasal infection
3 3 0
4.05 %
Eye infection
2 2 0
2.70 %
Sputum
1 1 0
1.35 %
Seminal fluid
1 1 0
1.35 %
Environmental of
hospitals
9 9 0
12.16 %
Total isolates
84
74
10
100%
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
581
Table.3
Phenotypic
results of S. aureus isolates toward MLSB
S.
aureus
MRSA 61
out of 74
100%
MSSA13
out of 74
100%
total
Both Erythromycin -
clindamycin
resistance cMLSB phenotype
13
21.31
5
38.46
18
Erythromycin resistance-
clindamycin
sensitive D
-
shape iMLSB phenotype
4
6.55
0 0 4
Erythromycin resistance-
clindamyc
in
sensitive no D
-
shape MS phenotype
9
14.75
0 0 9
Both erythromycin- clindamycin
sensitive
6
9.83
0 0 6
Erythromycin intermediate-
clindamycin
sensitive
3
4.91
1
7.69
4
Erythromycin intermediate- clindamycin
intermediate
9
14.75
3
23.07
12
Erythromyci
n intermediate- clindamycin
resistance
11
18.03
1
7.69
12
Erythromycin resistance- clindamycin
intermediate
6
9.83
2
15.38
8
Erythromycin sensitive- clindamycin
intermediate
0 0 1
7.69
1
Total
61
100
13
100
74
Table.4
Prevalence
of erm A, B and C am
ong MRSA isolates
Strain
Isolation
site
cMLSB
iMLSB
MS
ermA
ermB
ermC
MRSA U2
Urine
- - + + - -
MRSA U4
Urine
+ - - + - -
MRSA S12
Skin
+ - - + - -
MRSA S24
Skin
+ - - + - +
MRSA SP1
Sputum
- + - - - +
MRSA B1
Blood
- + - - - +
MRSA Y1
Eye
+ - - + - +
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
582
Figure.1
Diagram
explain D
-Test negative and positive results on Müller-
Hinton agar
(designed according to this study)
Figure.2
D
-
Shape positive iMLSB for S. aureus isolates
E
rythromycin
disc
Inhibitio
n zone
C
lindamycin
disc
P
ositive Result
ve result
Negative
R
esult
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
583
Figure.3
Agarose
gel electrophoresis (1% agarose, 7V/cm, for 90 min) for mobile genetic
element mec A (amplified size 314 bp) compared with (100 bp) DNA ladder line M DNA
Ladder; lines 2,3,6 and 7 positive results of bands; lines 1and 5 negative results
Figure.4
Agaro
se gel electrophoresis (1% agarose, 7V/cm, for 60 min) for
ermA
gene (amplified
size 139 bp) and
ermC
(amplified size 190 bp) compared with (100 bp) DNA ladder
line M DNA
Ladder; lines 2,3 and 4 positive results of bands; l
ines 1,6 and 7 negative results
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
584
References
Al-Talib, H.; Yean, C.Y.; Al-Khateeb, A.;
Hassan, H.; Singh, K.B.; Al-
Jashamy, K. and Ravichandran, M.
2009. A pentaplex PCR assay for the
rapid detection of methicillin-
resistant Staphylococcus aureus and
Panton
-Valentine Leucocidin BMC
Mi
crobiology 9:11
Atlas, R.M; Brown, A.E & Parks, L.C.
1995. Laboratory manual of
experimtal microbiology. 1st ed
.Mosby,st.Louis U.S.A.
Bottega,A.; Rodrigues, M. D.; Carvalhol,
F.A.; Wagner, T.F.; Leal,I. A.; dos
Santos, S.O.; Rampelotto, R.F. and
Hörner,
R.2014. Evaluation of
constitutive and inducible resistance
to clindamycin in clinical samples of
Staphylococcus aureus from a
tertiary hospitalRevista da
SociedadeBrasileira de Medicina
Tropical 47(5):589
-592
Cabrera, E.C. ; Ramirez-Argamosa, D.T.
and Rodriguez, R.DM. 2010.
Prevalence of community-
acquired
methicillinresistant Staphylococcus
aureus from inmates of the Manila
City Jail, characterization for
SCCmec type and occurrence of
Panton
-
Valentine
leukocidingenePhilippine Science
Letters Vol.3 .1
Clin
ical and Laboratory Standard Institute.
2013 .Analysis and presentation of
cumulative antimicrobial
susceptibility test data. 3rd ed.
Approved guideline M39-
A3. Wayne
PA USA
Costella, M. C. 2010. single nucleotide
polymorphism SNP genotyping for
community
acquired methicillin
resistance Staph. aureus including
the subtyping of PVL toxin
procedures using Real-time PCR.
Master thesis in microbiology.
Queensland University of
technology.
Croxatto, A.; Prod hom, G. and Greub,
G.2012. Applications of MALDI-
TO
F mass spectrometry in clinical
diagnostic microbiology. FEMS
Microbiol Rev. 36: 380 407.
Fiebelkorn, K. R.; Crawford, S.
A.;McElmeel, M. L. and J. H.
Jorgensen, J. H. 2003. Practical Disk
Diffusion Method for Detection of
Inducible Clindamycin Resistance
in
Staphylococcus aureus and
Coagulase
-Negative Staphylococci
Journal of Clinical Microbiology.
Vol. 41. No. 10 p. 4740 4744
Gherardi, G.; De Florio, L.; Lorino, G.;
Fico, L. and Dicuonzo, G.2009.
Macrolide resistance genotypes and
phenotypes among erythro
mycin
-
resistant clinical isolates of
Staphylococcus aureus and
coagulase
-negative staphylococci,
Italy. FEMS Immunol Med
Microbiol 55: 62 67.
Gopal, T.; Nagarajan, V. and Elasri, M.O.
2015. SATRAT: Staphylococcus
aureustranscript regulatory network
analysi
s tool. PeerJ 3:e717
Lyall, K. D. S.; Gupta, V. and Chhina,
D.2013. Inducible clindamycin
resistance among clinical isolates of
Staphylococcus aureus Journal of
Mahatma Gandhi Institute of
Medical Sciences .Vol .18.Issue 2
Martineau, F.; Picard, F.J.; Lansac, N.;
Ménard, C.; Roy, P.H.;Ouellette, M.
& Bergeron, M.G. 2000. Correlation
between the Resistance Genotype
Determined by Multiplex PCR
Assays and the Antibiotic
Susceptibility Patterns of
Staphylococcus aureus and
Staphylococcus epidermidis. J.
Int.J.Curr.Microbiol.App.Sci
(2015)
4(
5
):
575
-
585
585
Antimic
rob. Agents Chemother.
44(2):231
238
Mohammadi, S. ; Sekawi, Z.; Monjezi, A.;
Maleki, M.; Soroush, S.;
Sadeghifard, N.; Pakzad,I.; Azizi-
Jalilian, F.; Emaneini, M.;
Asadollahi, K.; Pourahmad, F.;
Zarrilli, R. and Taherikalani,
M.2014.Emergence of SCCmec ty
pe
III with variable antimicrobial
resistance profiles and spa types
among methicillin-
resistant
Staphylococcusaureus isolated from
healthcare
- and community-
acquired
infections in the west of Iran /
International Journal of Infectious
Diseases 25 . 152 158.
Patrick, M et al. 2009. Chapters 2,3,16,17 in
Medical Microbiology , 6th edition
by. Mosby Inc.
Petaïnen, M.; Francois, P.; Tangomo-
Bento,
M.; Sahl, H.G.; Schrenzel, J. and
Kontinen,V. 2009. Transcriptome
analyses of the responses of S.
aureus cells to stress caused by
sublethal concentrations of cationic
antimicrobial peptides. BMC
Genomics
Ratnayake, L. and Olver, W.J. 2011. Rapid
PCR detection of methicillinresistant
Staphylococcus aureus and
methicillin
-sensitive S. aureus
samples from charcoal-
conta
ining
blood culture bottles. J. Clin.
Microbiol. 49:2382.
Sedighi, I; Mashouf, R.Y.; Pak, N.;
Mohammad Ali SeifRabiee, M. A. S.
2009. DTest Method for Detection of
Inducible Clindamycin Resistance in
Staphylococcus aureus Iran J Pediatr.
Vol 19 (No 3), Pp:293
-
297
Seif, N.; Kahani, N.; Askari, E.; Mahdipour,
S. and Naderi, N.M.2012 Inducible
clindamycin resistance in
Staphylococcus aureus isolates
recovered from Mashhad, Iran. Iran J
Microbiol 2012; 4:82
-
86
Stefanie, H.e.&Gallert, C.2014.
Demonstration of staphylococci with
inducible macrolide
lincosamide
streptogramin B (MLSB) resistance
in sewage and river water and of the
capacity of anhydroerythromycin to
induce MLSB. FEMS MicrobiolEcol
.88.48 59
Zmantar, T.; Kouidhi, B.; Miladi, H. and
Bakhrouf, A. 2011. Detection of
macrolide and disinfectant resistance
genes in clinical Staphylococcus
aureus and coagulase-
negative
staphylococci. BMC Res Notes.
4:453.
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
Introduction Methicillin-resistant Staphylococcus aureus (MRSA) is a pathogen of public health importance. The prevalence of MRSA and its antimicrobial resistance pattern, as well as SCCmec and spa types, remain unclear both in the community and in the hospitals of the western region of Iran. Methods One hundred MRSA isolates were collected from different hospitals in the west of Iran during 2010–2011. Antimicrobial susceptibility testing to 15 antimicrobial agents was carried out by disk agar diffusion (DAD) method in accordance with the Clinical and Laboratory Standards Institute guidelines. Vancomycin minimum inhibitory concentrations (MICs) were evaluated by a broth microdilution method. The Etest was used for the detection of highly gentamicin-resistant MRSA. A combination of single and multiplex PCR was used for the detection of different resistance genes, including beta-lactamase, aminoglycoside modifying enzymes (AMEs), and macrolide–lincosamine, and for SCCmec typing of MRSA isolates. Genotyping of MRSA isolates was performed via spa typing. Results All tested isolates were susceptible to quinupristin–dalfopristin, linezolid, and vancomycin, but were resistant to penicillin (100%), erythromycin (50%), clindamycin (27%), and gentamicin (18%). MIC50 and MIC90 was 256 μg/ml among gentamicin-resistant MRSA. The most prevalent AME genes among aminoglycoside-resistant isolates were aac(6′)-1e-aph(2′′)-1a (77.8%), aph(3′)-IIIa (38.9%), and ant(4′)-1a (27.8%). Nearly all tetracycline- and erythromycin-resistant MRSA had ermA and/or ermC but not ermB. Five SCCmec types and subtypes, 13 spa types, and four BURP groups (A–D) were identified. SCCmec types III (45%) and IVc (24%), spa type t701 (30%), and new spa type t12311 (15%) were the most prevalent among MRSA isolates. Conclusions This study showed the emergence of MRSA with SCCmec type III and with spa types t12311, t10740, t1234, t1991, and t2651 with different phenotypic and genotypic antimicrobial resistance in the west of Iran. We found different SCCmec and spa types distributed among nosocomial and non-nosocomial MRSA in the west of Iran.
Article
Full-text available
Staphylococcus aureus is an important agent in hospital and community-associated infections, causing high morbidity and mortality. Introduction of the new antimicrobial classes for this pathogen has been usually followed by the emergence of resistant strains through multiple mechanisms. For instance, resistance to clindamycin (CLI)can be constitutive or inducible. Inducible clindamycin resistance which may lead to treatment failure can simply be identified by performing D-test. The aim of this study was to determine the prevalence of inducible clindamycin resistance among Staphylococcus aureus isolates by D-test method. This was a cross-sectional study conducted on 211 non-duplicated S. aureus isolates in Imam Reza hospital of Mashhad during 2010. Susceptibility to oxacillin, cefoxitin, erythromycin and clindamycin was performed by agar disk diffusion method according to CLSI guidelines and D-shaped clindamycin susceptibility patterns where considered as D-test positive (D(+)). Of 211 S. aureus isolates,88 (41.7%) were methicillin resistant. It was found that of 88 MRSA isolates, 78 (88.6%) were erythromycin (ERY) resistant and 46 (52.3%) were CLI resistant. ERY and CLI resistance in MSSA strains was 22% and 10.6% respectively. Inducible clindamycin resistance was detected in 18 (20.5%) MRSA isolates. 47(53.4%) of MRSA isolates and 9 (7.3%) of MSSA showed constitutive MLS(B) phenotype. In conclusion, we found a high prevalence of inducible clindamycin resistance phenotype in our region. We recommend that whenever clindamycin is intended to be used for S. aureus infections, D-test should be performed to facilitate the appropriate treatment of patients.
Article
Full-text available
ABSTRACT: Staphylococcus aureus and Coagulase-negative staphylococci (CoNS) are a major source of infections associated with indwelling medical devices. Many antiseptic agents are used in hygienic handwash to prevent nosocomial infections by Staphylococci. Our aim was to determine the antibiotic susceptibility and resistance to quaternary ammonium compound of 46 S. aureus strains and 71 CoNS. S. aureus (n = 46) isolated from auricular infection and CoNS (n = 71), 22 of the strains isolated from dialysis fluids and 49 of the strains isolated from needles cultures were investigated. Erythromycin resistance genes (ermA, ermB, ermC, msrA and mef) were analysed by multiplex PCR and disinfectant-resistant genes (qacA, qacB, and qacC) were studied by PCR-RFLP. The frequency of erythromycin resistance genes in S. aureus was: ermA+ 7.7%, ermB+ 13.7%, ermC+ 6% and msrA+ 10.2%. In addition, the number of positive isolates in CoNS was respectively ermA+ (9.4%), ermB+ (11.1%), ermC+ (27.4%), and msrA+ (41%). The MIC analyses revealed that 88 isolates (74%) were resistant to quaternary ammonium compound-based disinfectant benzalkonium chloride (BC). 56% of the BC-resistant staphylococcus isolates have at least one of the three resistant disinfectants genes (qacA, qacB and qacC). Nine strains (7.7%) among the CoNS species and two S. aureus strains (2%) harboured the three-qac genes. In addition, the qacC were detected in 41 strains. Multi-resistant strains towards macrolide and disinfectant were recorded. The investigation of antibiotics and antiseptic-resistant CoNS may provide crucial information on the control of nosocomial infections.
Article
Full-text available
Objective: Methicillin resistant staphylococcus aureus (MRSA) is a frequent cause of infections in children. The purpose of this study was to determine the frequency of nasal colonization of S. aureus in children and detection of inducible clindamycin resistance (ICR) by disk approximation test (D-test).Methods: This was a cross-sectional study conducted in Hamedan from 2007 to 2008. 520 nasal swabs were obtained from children under 12 years of age at the time of admission and 287 swabs at the time of discharge. Antibiogram was performed by method of disk diffusion for oxacillin, erythromycin, clindamycin, cefazolin and vancomycin as well as D-test. Chi-square test was applied for statistical analysis.Findings: Out of 520 patients, 118 (22.3%) were colonized with S. aureus as community-acquired (CA-S. aureus). Of 287 patients, 64 (22.3%) were colonized with isolates of S. aureus at discharge time. Of these 64 patients, 32 cases were colonized with hospital acquired (HA-S. aureus) isolates after admission. Only one CA-MRSA isolate was resistant to clindamycin, 5% of 118 CA-S. aureus isolates and 6.3% of HA-S. aureus isolates had inducible clindamycin resistance (D-test). Also 37.5% of CA-MRSA isolates at the time of admission and 22.2% of HA-MRSA isolates at discharge had positive D-test. Conclusion: We emphasize that D-test should be used routinely and clindamycin should not be used in patients with infections caused by inducible resistant S. aureus.
Article
Full-text available
Staphylococcus aureus is a major human pathogen, especially methicillin-resistant S. aureus (MRSA), which causes a wide range of hospital and community-acquired infections worldwide. Conventional testing for detection of MRSA takes 2-5 days to yield complete information of the organism and its antibiotic sensitivity pattern. The present study focused on the development of a pentaplex PCR assay for the rapid detection of MRSA. The assay simultaneously detected five genes, namely 16S rRNA of the Staphylococcus genus, femA of S. aureus, mecA that encodes methicillin resistance, lukS that encodes production of Panton-Valentine leukocidin (PVL), a necrotizing cytotoxin, and one internal control. Specific primer pairs were successfully designed and simultaneously amplified the targeted genes. The analytical sensitivity and specificity of the pentaplex PCR assay was evaluated by comparing it with the conventional method. The analytical sensitivity of the pentaplex PCR at the DNA level was found to be 10 ng DNA. The analytical specificity was evaluated with 34 reference staphylococci and non-staphylococcal strains and was found to be 100%. The diagnostic evaluation of MRSA carried out using 230 clinical isolates, showed 97.6% of sensitivity, 99.3% of specificity, 98.8% of positive predictive value and 98.6% of negative predictive value compared to the conventional method. The presence of an internal control in the pentaplex PCR assay is important to exclude false-negative cases. The pentaplex PCR assay developed was rapid and gave results within 4 h, which is essential for the identification of Staphylococcus spp., virulence and their resistance to methicillin. Our PCR assay may be used as an effective surveillance tool to survey the prevalence of MRSA and PVL-producing strains in hospitals and the community.
Article
Staphylococci causing diseases in humans and animals are well described, whereas not very much is known about the staphylococci in natural ecosystems. Due to increased consumption of antibiotics, multiresistant species are released with excrements. Therefore, 1048 staphylococci from raw and treated sewage and from receiving water bodies were isolated, identified and tested for resistance against erythromycin, clindamycin, oxacillin and ciprofloxacin. More resistant staphylococci were present in raw sewage (33.8%) than in treated sewage (24.9%) or river water (10.9%). Of all isolates, 20.2% were resistant against the macrolide erythromycin which can induce cross resistance against lincosamides and streptogramin B antibiotics (iMLSB ). Erythromycin is metabolized to anhydroerythromycin and excreted which urine into sewage. The question arise wheather anhydroerythromycin can also induce resistance against MLSB antibiotics in staphylococci. This was investigated with antibiotic susceptibility tests (D-tests) and macrodilution assays. Staphylococci with iMLSB phenotype in river water were more numerous (27.8%) than in treated sewage (18.9%). The most common MLSB -resistance gene was ermC. Traces of erythromycin and anhydroerythromycin (1 ng L(-1) ) induced already resistance against clindamycin after only 10 min. exposure. This is reported for the first time and is relevant for risk assessment. This article is protected by copyright. All rights reserved.
Article
Recent advances in technology have allowed development of automated, rapid, real time PCR tests that are able to differentiate between Meticillin-sensitive Staphylococcus aureus (MSSA) and Meticillin-resistant S.aureus (MRSA) in blood cultures....
Laboratory manual of experimtal microbiology
  • R M Atlas
  • A Brown
  • L C Parks
Atlas, R.M; Brown, A.E & Parks, L.C. 1995. Laboratory manual of experimtal microbiology. 1st ed .Mosby,st.Louis U.S.A.
  • A Bottega
  • M D Rodrigues
  • F A Carvalhol
  • T F Wagner
  • I A Leal
  • S O Santos
  • R F Rampelotto
  • R Hörner
Bottega,A.; Rodrigues, M. D.; Carvalhol, F.A.; Wagner, T.F.; Leal,I. A.; dos Santos, S.O.; Rampelotto, R.F. and Hörner,R.2014. Antimicrob. Agents Chemother. 44(2):231 238
Chapters 2,3,16,17 in Medical Microbiology
  • M Patrick
Patrick, M et al. 2009. Chapters 2,3,16,17 in Medical Microbiology, 6th edition by. Mosby Inc.