First Record of Marine Dinofl agellate, Alexandrium tamutum (Dinophyceae) from Malaysia

Abstract

Several species of dinoflagellates in the genus Alexandrium are known to be toxic, and have been associated with paralytic shellfish poisoning (PSP) in Malaysia. These Alexandrium species showed high morphological similarity among the toxic and non-toxic species, and detailed observation of the thecal plate's arrangement is required for precise species identification. Co-occurrence of the toxic and non-toxic species has complicated the plankton monitoring of PSP. In this study, a clone of Alexandrium species was established from plankton samples collected from Kota Belud, Sabah. The specimen was observed under epi-fluorescence microscope, and nucleotide sequences of the nuclear-encoded ribosomal RNA gene obtained. Morphologically, the clone showed relatively wide and large sixth precingular plate (6″) compared to that of A. minutum. The posterior sulcal plate (Sp) is similar to that of A. minutum, which is wider than long. The first apical plate (1′) is irregularly rhomboidal with a small ventral pore (vp) present on its right margin. The morphological characters resembled to the species description of A. tamutum. Phylogenetic analysis of the ITS rDNA region also revealed a monophyly of this clone with other strains of A. tamutum, and separating them from the A. minutum clade. Species-specific sequence signatures of A. tamutum were obtained in silico, which could be as potential oligonucleotide probe regions for species detection by using molecular tool. This represents the first report of A. tamutum found in Malaysian waters.

Full text

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
81
First Record of Marine Dinoagellate, Alexandrium Tamutum
(Dinophyceae) from Malaysia
Kon, Nyuk Fong1, Hii, Kieng Soon1, Tan, Toh Hii1, Yek, Leh Hie1, Lim, Po Teen2, Leaw, Chui Pin1*
1 Institute of Biodiversity and Environmental Conservation (IBEC), University Malaysia Sarawak (UNIMAS), 94300 Kota
Samarahan, Sarawak, Malaysia,
2 Faculty of Resource Science and Technology (FRST), University Malaysia Sarawak (UNIMAS), 94300 Kota Samarahan,
Sarawak, Malaysia
*cpleaw@ibec.unimas.my, chuipinleaw@gmail.com (corresponding author)
ABSTRACT Several species of dinoagellates in the genus Alexandrium are known to be toxic, and have
been associated with paralytic shellsh poisoning (PSP) in Malaysia. These Alexandrium species showed high
morphological similarity among the toxic and non-toxic species, and detailed observation of the thecal plate’s
arrangement is required for precise species identication. Co-occurrence of the toxic and non-toxic species
has complicated the plankton monitoring of PSP. In this study, a clone of Alexandrium species was established
from plankton samples collected from Kota Belud, Sabah. The specimen was observed under epi-uorescence
microscope, and nucleotide sequences of the nuclear-encoded ribosomal RNA gene obtained. Morphologically,
the clone showed relatively wide and large sixth precingular plate (6´´) compared to that of A. minutum. The
sulcal posterior plate (Sp) is similar to that of A. minutum, which is wider than long. The rst apical plate
(1´) is irregularly rhomboidal with a small ventral pore (vp) present on its right margin. The morphological
characters resembled to the species description of A. tamutum. Phylogenetic analysis of the ITS rDNA region
also revealed a monophyly of this clone with other strains of A. tamutum, and separating them from the A.
minutum clade. Species-specic sequence signatures of A. tamutum were obtained in silico, which could be as
potential oligonucleotide probe regions for species detection by using molecular tool. This represents the rst
report of A. tamutum found in Malaysian waters.
(Alexandrium tamutum, A. minutum, Sabah, Malaysia, thecal plates)
INTRODUCTION
Harmful algal bloom (HABs) is a natural phenomenon
due to increase in density of phytoplankton resulted
in adverse effect to the ecosystem. Contamination of
biotoxins from the phytoplankton may lead to shellsh
poisoning when the toxins are transferred to human via
the shellsh vectors. In Malaysia, the most frequently
reported seafood intoxication associated with algal
toxins is paralytic shellsh poisoning (PSP) [1]. PSP is
caused by the consumption of contaminated shellsh
such as mussels, clams, oyster, scallop or other lter
feeders [2, 3]. The PSP toxin, collectively called
Saxitoxins (STXs), is a group of toxin family that blocks
the voltage gated sodium channels in mammalian nerve
cells and inhibits nerve conduction, which may lead to
paralysis of the neuromuscular system [4].
Bloom of the marine dinoflagellate, Pyrodinium
bahamense var. compressum, in Brunei Bay and
the subsequent PSP incidence in Sabah [5], was the
rst record of HABs and PSP in Malaysia. Whilst in
Peninsular Malaysia, poisoning case was rst reported
in 1991 when people consumed the green mussel, Perna
viridis, cultured at a mussel farm in Sebatu, Malacca. In
September 2001, poisoning case including one fatality
was reported from Tumpat, Kelantan, a coastal lagoon of
the east coast of Peninsular Malaysia. The intoxication
was due to the consumption of contaminated benthic
bivalve, Polymesoda sp. (local name, ‘lokan’) [6].
In this study, a marine dinoagellate from the genus
Alexandrium was morphologically and molecularly
characterized. Samples were obtained from Kota Belud,
Sabah, Malaysia, and clonal cultures of the dinoagellate
species were established. Both preserved and eld
samples were observed under an epi-fluorescence
microscope. Clonal cultures were further analyzed
based on the nucleotide sequences of ribosomal RNA
genes (rDNA). Genomic DNA was extracted, and the
7 MJS-Nyuk.indd 81 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
82
rDNA was amplied prior to sequencing. The sequences
obtained were analyzed and used for phylogenetic
reconstruction. Species-specic sequence signatures of
A. tamutum were also obtained in silico.
MATERIALS AND METHODS
Algal cultures
Plankton samples were collected from Kota Belud,
Sabah, using a 20 µm-mesh plankton net. Sampling was
undertaken during high tide, with salinity of ~30 psu.
Field in situ parameter i.e. temperature, salinity and pH
of the seawater was collected. Live samples were kept
in 1 L bottles in cool condition and brought back to the
laboratory for single-cell isolation. A portion of samples
(1/3) were preserved in acidic Lugol’s solution.
Samples were sieved through a 20 µm-mesh sieve and
back-washed to a petri dish for single-cell isolation by
micropipetting technique under an IX51 inverted light
microscope (Olympus, Melville, USA). Clonal cultures
were established in a 96-well microplate containing
ltered sterile seawater. Cultures established were grown
in ES-DK medium [7], and maintained at 25±0.5 °C
under a 12:12 h light:dark photoperiod in a SHEL LAB
temperature-light controlled growth chamber (SHEL
LAB, USA).
Species identication
Morphological observation was performed with an epi-
uorescence microscopy. Identication of the species
was based on cell shape and theca plate tabulation. Fixed
samples were stained with 1% Calcouor white solution
(Fluka, Japan), and the nuclei were stained with SYTOX
Green DNA stain (Invitrogen, Life Technologies, USA).
Stained samples were observed under an Olympus IX51
epiuorescence microscope (Olympus, Melville, USA)
with UV lter sets. Images were captured with a cooled
CCD camera (SIS Colorview F12, Germany).
DNA extraction, rDNA amplication and
sequencing
Mid-exponential growth phase cultures were harvested
by centrifugation at 2,800 rpm for 10 min. The cell
pellet was then suspended in distilled water, followed by
cetyltrimethylammonium bromide (CTAB) extraction
as described in [8, 9]. Cells were lysed by adding equal
volume of 2× CTAB lysis buffer containing 50 mM
CTAB, 14 mM NaCl, 10 mM Tris-base, 20 mM EDTA,
and 1% mecaptoethanol. The mixture was extracted
with chloroform: isoamyl alcohol (C:I, 24:1), and
subsequently phenol:chloroform:isoamyl alcohol (P:C:I,
25:24:1). Two volumes of absolute ethanol and 1/10
volume of 3M sodium acetate were added to precipitate
the DNA, followed by centrifugation at 13000 rpm for
10 min. DNA pellet was rinsed with 70% cold ethanol
and then dissolved in 30 µL TE buffer (10 mM Tris-
HCl, pH 7.4 and 1 mM EDTA, pH 8.0). Genomic DNA
samples were kept overnight at 4°C to totally dissolve
the DNA before stored at -20°C for further analysis.
The internal transcribed spacer region (ITS1-5.8S-
ITS2) of rDNA were amplified by polymerase
chain reaction (PCR) using the primer pair, ITS1F
(5’TCGTAACAAGGTTTCCGTAGGTG-3’) and
ITS1R (5’ATATGCTTAAGTTCAGCGGG-3’) [8].
Gene amplication was performed as described in [8, 9].
In brief, the amplication condition is as follow: initial
denaturation at 95°C for 5 min, denaturation at 94°C for
18 seconds, annealing at 55°C for 18 seconds, followed
by elongation at 72°C for 1 min and nal elongation at
72°C for 7 min. PCR products were subjected to further
purication prior to DNA sequencing by the sequencing
service laboratory (1st Base, Selangor, Malaysia),
using an ABI 377 automated sequencer (PE Applied
Biosystems, Foster City, CA, USA). Sequencing was
performed in both strands.
Sequence analysis and taxon sampling
Sequences were evaluated by using the Basic Local
Alignment Search Tool (BLAST) program [10], and
analyzed by ABI sequence Scanner ver. 1.0 (ABI
BioSystem, USA). Ambiguous bases were determined
by comparing both forward and reverse strands of each
strain. The reverse strands were reversed complemented
by using BioEdit version 6.0.7 [11] and pairwise-aligned
with the forward strands using Clustal-X [12]. These
were followed by assignation according to the IUPAC
nucleotide code.
Taxon sampling was achieved by blasting in the
nucleotide database, GenBank, in conjunction with the
National Center of Biotechnology Institute (NCBI) to
acquire related sequences. The selected sequences were
saved as FASTA format for further analysis.
Phylogenetic analyses
Phylogenetic analyses was performed by using
Phylogenetic Analysis Using Parsimony (PAUP) ver.
7 MJS-Nyuk.indd 82 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
83
4.0b10 [13] with the maximum likelihood (ML) and
maximum parsimony (MP) algorithms used to estimate
the phylogeny.
For ML analysis, Modeltest ver. 3.06 [14, 15] with
α value of 0.01 was used to identify the hierarchical
likelihood ratio so that the best model of evolution can
be determined. The evolutionary model selected for the
sequences data set and the ML parameters were used to
reconstruct the ML tree. ML was performed by heuristic
search with tree bisection-reconnection (TBR) branch
swapping and 10 random additions.
MP was performed by heuristic search of 1,000 random
addition and TBR branch swapping. Bootstrapping [16]
was performed on both ML and MP analyses with 1,000
replication (P < 0.001) to determine the condence limits
of tree topology using TBR branch swapping algorithm.
Sequence signatures assignation
The ITS sequence of A. tamutum was aligned and
compared to all other Alexandrium species retrieved
from GenBank to search for the signature regions.
Species-specic sequence signatures were identied by
using ARB package.
RESULTS AND DISCUSSION
Among the species of Alexandrium, A. tamutum showed
high morphological similarity to its closely related toxic
species, A. minutum. Microscopic cell observation
without pre-staining often is difcult to discriminate
the two species. Only detailed thecal plate arrangement
and the shapes revealed upon thecal staining could be
used to differentiate the two species. The morphological
characteristic of the sixth precingular plate (6’’) is one
7 MJS-Nyuk.indd 83 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
84
Figure 1. Alexandrium tamutum strain AuKA01 from Kota Belud, Sabah. (A) Bright eld. (B) Cell showing chlorophyll
pigments. (C) SYTOX green-stained cells showing the arc shaped nuclei. (D) Cell with thin thecal plates showing
rhomboidal 1´ and wide 6´´. Note the ventral pore (vp). (E) Antapical view of cell with wider than long posterior
sulcal plate (Sp). (F) Cell showing the sulcus with deep and excavated cingulum.
of the main diagnostic features used to delineate the
two species [17].
Morphological characterization of A. tamutum
Cells are round and small, with 9–25 µm long and
9–33 µm wide (Figure 1). Chlorophyll pigments
present indicating the cells are photosynthetic (Figure
1B). The fairly large nucleus with chromosomes that
are permanently condensed can be readily seen after
SYTOX Green staining (Figure 1C). The thecal plates
are thin and smooth. Cingulum is deep and excavated,
with its left end shifted anteriorly (Figure 1D). The rst
apical plate (1´) is irregularly rhomboidal, with a small
ventral pore (vp) present on its right margin (Figure 1D).
The sixth precingular plate (6´´) is wider than long, and
adjacent to 1´ (Figure 1D). The posterior sulcal plate
(Sp) on the hypotheca is wider than long (Figure 1E).
The epi-uorescence image clearly showed the sulcal
area of A. tamutum, with both sulcal right posterior plate
(Sdp) and sulcal left posterior plate (Ssp) (Figure 1F).
Alexandrium tamutum resembled A. minutum in its
relatively small cell size, rounded or elliptical [17].
However, large A. tamutum cells have a slightly
pentagonal shape which is similar to the outline of
small-sized A. tamarense [17]. Alexandrium andersoni
is another small-sized species which is difcult to
distinguish it from A. tamutum and A. minutum. Both
A. andersoni and A. minutum are PSP toxin producers
[18], but A. tamutum was reported as non-toxic [17].
Several Alexandrium species share similar cell outline
and size ranges. Thus, it is difficult to distinguish
Alexandrium species solely based on cell size and
shape. Identication at species level requires detailed
investigation of the pattern of their thecal plates.
Alexandrium tamutum differs from A. minutum by
its relatively wide and large 6´´, whereas A. minutum
has narrower and smaller 6´´ [17]. The large 6´´ of A.
tamutum is similar to that of A. tamarense [17].
Shape of the sulcal posterior plate (Sp) has been
suggested as a diagnostic character to delineate species
of Alexandrium [19]. The Sp of A. tamutum is similar to
that of A. minutum which is wider than long, while the
Sp is longer than wide in A. tamarense. Both A. tamutum
and A. minutum have rhomboidal 1´ plate. However,
the vp of that in A. tamutum is located in the median/
upper part of the margin [17], whilst in A. minutum it is
located on the posterior end of the anterior right margin
of plate 1´ [20].
ITS rDNA phylogeny of Alexandrium
The ITS region of rDNA of A. tamutum was successfully
amplied for the strain AuKA01. Blast search revealed
an e-value of 0.0 with a total of six hits to A. tamutum
in the nucleotide database of GenBank (NCBI). Closely
related species of A. tamutum were included in the taxon
sampling; they are A. afne, A. andersoni A. catenella,
A. minutum, , A. ostenfeldii, A. peruvianum A. tamarense
and A. tamiyavanichii (Table1). Pyrodinium bahamense
var. compressum was used as the outgroup.
7 MJS-Nyuk.indd 84 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
85
Species Strain Location
Alexandrium afne AC-1 China
AS-1 China
A. andersoni CCMP 1718 Massachusetts, USA
A. catenella PE01 Southern Chile
A4 Daya Bay, China
AD1 East China Sea, China
A. minutum CBA64 Catalan Sea, Spain
AMITA Trieste, Italy
Palmira1 Catalan Sea, Spain
CBA28 Tyrrhenian Sea, Italy
A. ostenfeldii AOFUN0905 Hokkaido, Japan
AOFUN0904 Hokkaido, Japan
ASBH01 China
A. peruvianum IEO-VGOAMD12 Catalan Sea, Spain
IEO-VGOAM10 Catalan Sea, Spain
A. tamarense 04-197-30 Scotland, United Kingdom
S06-010-01 Scotland, United Kingdom
A. tamiyavanichii A1PSA Porto Seguro, Brazil
B2PSA Porto Seguro, Brazil
PSII Porto Seguro, Brazil
A. tamutum IEO-VGO616 Catalan Sea, Spain
IEO-VGO617 Catalan Sea, Spain
IEO-VGO615 Catalan Sea, Spain
AL2T -
LBM-A5 North West Adriatic Sea, Italy
IEO-VGO662 Tyrrhenian Sea, Italy
Table 1. Sequences of ITS region retrieved from NCBI nucleotide database with species, strain and accession.
The resulting BI tree showed that AuKA01 strain
obtained in this study was clustered together with
other A. tamutum from GenBank (AM236857,
AM236858, AM236859, AM236860, AM238452 and
EU707497) (Figure 2). This further supported the
species identication of strain AuKA01 as A. tamutum.
The clade formed a sister group with A. minutum
group (FR668134, FR668136, FR668140, FR668142).
The molecular phylogenetic inference supported the
morphological observation that A. tamutum was a sister
taxon to A. minutum.
The MP analysis revealed 333 parsimony-informative
characters, resulted in one parsimonious tree with a tree
length of 1,039 evolutionary steps, with the parsimony
indices of consistency index (CI) = 0.7036, homoplasy
index (HI) = 0.2964, retention index (RI) = 0.8229, and
rescaled consistency index (RC) = 0.5790.
Bootstrap supports of the monophyly of A. tamutum
were relatively high with MP, ML bootstraps of 81% and
78% respectively, and BI posterior probability (PP) of
1.0. The A. minutum clade was also supported by 100%
for MP, 96% for ML and 1.0 for BI.
Although A. tamutum is closely related morphologically
to A. minutum, the results of phylogenetic inferences
7 MJS-Nyuk.indd 85 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
86
Figure 2. Phylogenetic tree of Alexandrium species derived from Bayesian analysis (BI) of ITS sequences. Alexandrium
tamutum from Kota Belud, Sabah used in this study are in boldface. Bootstrap supports of MP/ML/BI are shown at
the internal nodes. Scare bar = 0.1 substitution per site.
strongly supported the split of A. tamutum as a single
clade, while A. minutum formed another clade (Figure 2).
Sequence signature
The ITS sequence of A. tamutum was aligned with ITS
sequences of other Alexandrium species retrieved from
the GenBank to search for the signature regions.
By using ARB program, several regions of sequences
with nucleotides length of 25bp and100% hits were
identied. These regions were identied as species-
specific to A. tamutum based on the nucleotide
polymorphism to the non-target species. Table 2 shows
the E-value and number of hits of the nblast search
result. Three signature regions were proposed as the
DNA signature of A. tamutum (Figure 3).
Table 2. nBlast search of signature regions revealed the respective e-value and the number of hits
Signature Uppermost Blastn hit against NCBI
nr-database
e-value Number of hits
AGGGUGGCAUGGCUUGCAAUAGCAA A. tamutum 2e-04 6
AUGCUGCUGCAUUGGACACACGCGC A. tamutum 2e-04 5
AUUUGCUCGAGGGUGGCAUGGCUUG A. tamutum 2e-04 5
7 MJS-Nyuk.indd 86 11/13/2013 2:50:33 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
87
Figure 3. Three possible sequence logos of signature region of A. tamutum predicted in this study
CONCLUSION
Culture of Alexandrium from Kota Belud, Sabah was
identied and designated as Alexandrium tamutum
based on the rhomboidal rst apical plate (1´), wide
sixth precingular plate (6´´) and wide posterior sulcal
plate (Sp). The phylogenetic analyses also supported the
species identity based on the evidence of monophyly of
taxa identied as A. tamutum. This represents the rst
report of A. tamutum found in the Malaysian waters.
Species-specic sequence signatures of A. tamutum
were obtained in silico. The species-specic sequence
signatures of A. tamutum obtained in this study can be
used to develop molecular probe for rapid detection of
the species.
REFERENCES
1. Lim P. T., Leaw C. P., Usup G. and Ahmad A.
(2002). Probable toxin producer responsible for
the rst occurrence of paralytic shellsh poisoning
on the east coast of peninsula Malaysia. Malaysian
Applied Biology 31(2): 29-35.
2. Shumway S. (1990). A review of the effect of algal
blooms on shellsh and aquaculture. Journal of
World Aquaculture Society 21: 65-104.
3. Shumway S. E., Sherman-Caswell S. and Hurst
J. W. (1988). Paralytic shellfish poisoning in
Maine: Monitoring a monster. Journal of Shellsh
Research 7: 643-652.
4. Doucette G. J., Logan M. L., Ramsdell J. S.
and Dolah F. M. V. (1997). Development and
preliminary validation of a microtiter plate-based
7 MJS-Nyuk.indd 87 11/13/2013 2:50:34 PM

Malaysian Journal of Science 32 (SCS Sp Issue) : 81-88 (2013)
88
receptor binding assay for paralytic shellfish
poisoning toxins. Toxicon 35: 625-636.
5. Roy R. N. (1976). Red tide and outbreak of
paralytic shellsh poisoning in Sabah. Medical
Journal of Malaysia 31(3): 247-251.
6. Lim P. T., Leaw C. P. and Usup, G. (2004). First
incidence of paralyc shellsh poisoning on the east
coast of Peninsular Malaysia. In Phang, S. M., Chong,
V. C., Ho, S. S., Mokhtar, N., Ooi, J. L. S. (eds.) Marine
Science into New Millennium: New perspecves and
challenges. University of Malaya Marime Research
Centre, Kuala Lumpur, pp. 661-667
7. Kokinos J. P. and Anderson D. M. (1995).
Morphological development of resting cysts in
cultures of the marine dinoagellate Linguladinium
polyedrum (= L. machaerophorum). Palynology
19: 143-166.
8. Leaw C. P., Lim P. T., Ahmad A. and Usup
G. (2001). Genetic diversity of Ostreopsis
ovata (Dinophyceae) from Malaysia. Marine
Biotechnology 3(3): 246-255.
9. Leaw C. P., Lim P. T., Ng B. K., Cheah M. Y.,
Ahmad A. and Usup G. (2005). Phylogenetic
analysis of Alexandrium species and Pyrodinium
bahamense (Dinophyceae) based on theca
morphology and nuclear ribosomal gene sequence.
Phycologia 44: 550-565.
10. Altschul S. F., Gish W., Miller W., Myer E. W. and
Lipman D. J. (1990). Basic local alignment search
tool. Journal of Molecular Biology 215: 403–410.
11. Hall T. A. (1999). BioEdit: A user-friendly
biological sequence alignment editor and analysis
program for Windows 95/98/NT. Nucleic Acids
Symposium Series 41: 95–98.
12. Thompson J. D., Gibson T. J., Plewniak F.,
Jeanmougin F. and Higgins D. G. (1997). The
CLUSTAL X windows interface: Flexible
strategies for multiple sequence alignment aided
by quality analysis tools. Nucleic Acids Research
24: 4876–4882.
13. Swofford D. L. (2000). PAUP*: phylogenetic
analysis using parsimony (* and other methods).
Version 4.0b10. Sinauer Associates, Sunderland,
Massachusetts, USA.
14. Posada D. and Crandall K. A. (1998). Modeltest:
Tes t i n g the model o f DNA substit u t i o n .
Bioinformatics 14: 817-818.
15. Posada D. and Crandall K. A. (2001). Selecting
the best-fit model of nucleotide substitution.
Systematic Biology 50: 580-601.
16. Felsenstein J. (1985). Confidence limits on
phylogenies: An approach using the bootstrap.
Evolution 39: 783-791.
17. Montresor M., John U., Beran A. and Medlin
L. (2004). Alexandrium tamutum sp. nov.
(Dinophyceae): A new, non-toxic species in the
genus Alexandrium. Journal of Phycology 40 (2):
398-411.
18. Ciminiello P., Fattorusso E., Fiorino M. and
Montresor, M. (2000). Saxitoxin and neosaxitoxin
as toxic principles of Alexandrium andersoni
(Dinophyceae) from the Gulf of Naples, Italy.
Toxicon 38: 1871-1877.
19. Usup G., Leaw C. P., Ahmad A. and Lim
P. T. (2002). Phylogenetic relationship of
Alexandrum tamayavanichii (Dinophyceae) to
other Alexandrium species based on ribosomal
RNA gene sequences. Harmful Algae 1: 59-68.
20. Balech E. (1995). The Genus Alexandrium halim
(Dinoagellata). Sherkin Island Marine Station,
Cork, Ireland.
21. Schneider T. D and Stephens R. M. (1990).
Sequence logos: A new way to display consensus
sequences. Nucleic Acids Research 18(20): 6097-
6100.
7 MJS-Nyuk.indd 88 11/13/2013 2:50:34 PM