ArticlePDF Available

Eco-Taxonomic Profile of an Iconic Vermicomposter — the ‘African Nightcrawler’ Earthworm, Eudrilus eugeniae (Kinberg, 1867)

Authors:

Abstract and Figures

Eudrilus eugeniae (Kinberg, 1867), an adaptable exemplar of an anatomically advanced earthworm having direct fertilisation, is reviewed ecologically. A tropical West African species originating in savannah soils, it thrives on organically rich substrates. It has a rapid life-cycle from cocoon to maturity in as little as 47 days. Presence of this worm raised experimental pasture yields up to 83.9 %. Copious pellet-like casts deposited onto the soil surface are sought by roots. Passage of organic material through its gut reduces microbial pathogens and the resulting vermicompost product has enhanced nutrients, and microbial and enzymatic properties. Preliminary pharmaceutical reports are of inhibition of ‘Golden staph’ Staphylococcus aureus and ‘Thrush’ Candida albicans, plus anti-tumour effects in cancer cell lines. Its handling characteristics make this worm highly suitable for vermiculture wiThecological and economic provisioning of: (1) fishing bait or ‘seed’ cultures, (2) high-protein worm biomass for stock feeds, (3) organic fertiliser, (4) bio-stabilisation of contaminated matrices/fluids, (5) recycling of organic ‘wastes’, (6) carbon sequestration in soil organic matter (SOM, or humus), (7) bio-prospecting for pharmaceuticals, cosmetics or ‘silk’, and (8) eco-toxicology/ethology research. New reports are of cultivation in Denmark, South Africa, Egypt, Saudi Arabia, Ecuador, Peru, Indonesia, Malaysia, Thailand and Vietnam. Eudrilus eugeniae is figured and its ecological profile, global distribution and taxonomy updated with mtDNA barcodes.
Content may be subject to copyright.
527
African Invertebrates Vol. 56 (3): 527– 548 Pietermaritzburg 25 November 2015
http://africaninvertebrates.org
urn:lsid:zoobank.org:pub:CBAD704B-64F6-421B-BC71-74DF4620DB4E
Eco-taxonomic prole of an iconic vermicomposter — the ‘African
Nightcrawler’ earthworm, Eudrilus eugeniae (Kinberg, 1867)
Robert J. Blakemore
VermEcology, Yokohama, Japan and
C/- Biodiversity Lab., College of Natural Science, Hanyang University, Seoul 133-791;
rob.blakemore@gmail.com
ABSTRACT
Eudrilus eugeniae (Kinberg, 1867), an adaptable exemplar of an anatomically advanced earthworm having
direct fertilisation, is reviewed ecologically. A tropical West African species originating in savannah soils, it
thrives on organically rich substrates. It has a rapid life-cycle from cocoon to maturity in as little as 47 days.
Presence of this worm raised experimental pasture yields up to 83.9 %. Copious pellet-like casts deposited
onto the soil surface are sought by roots. Passage of organic material through its gut reduces microbial
pathogens and the resulting vermicompost product has enhanced nutrients, and microbial and enzymatic
properties. Preliminary pharmaceutical reports are of inhibition of ‘Golden staph’ Staphylococcus aureus and
‘Thrush’ Candida albicans, plus anti-tumour effects in cancer cell lines. Its handling characteristics make

or ‘seed’ cultures, (2) high-protein worm biomass for stock feeds, (3) organic fertiliser, (4) bio-stabilisation

matter (SOM, or humus), (7) bio-prospecting for pharmaceuticals, cosmetics or ‘silk’, and (8) eco-toxicology/
ethology research. New reports are of cultivation in Denmark, South Africa, Egypt, Saudi Arabia, Ecuador,
Peru, Indonesia, Malaysia, Thailand and Vietnam. Eudrilus eugeniae 
global distribution and taxonomy updated with mtDNA barcodes.
KEY WORDS: Annelida, Oligochaeta, Eudrilidae, vermiculture, DNA barcoding, soil ecology, megadrile
systematics.
INTRODUCTION
This paper reviews the current knowledge of the eco-taxonomic and morpho-molecular
Eudrilus eugeniae (Kinberg, 1867). It is not known when its vermiculture
potential was initially recognised but its initial wide ‘expat’ distribution has been mainly
attributed to accidental human transportation, since it was already well established in
  
the early 1800s (e.g. Perrier 1872; Michaelsen 1900, 1903; Stephenson 1923). More
recently it has been deliberately introduced for commercial and experimental purposes.
Ecological studies commenced from the mid-1960s to the late 1980s (e.g. Eno 1966;
Madge 1969; M’ba 1978; Neuhauser et al. 1979; Graff 1981; Bano & Kale 1988). This

of Lee (1959) as reported by (Blakemore 2008b) since it responds facultatively, spanning
the spectrum as either a geophage ‘topsoil’ species or alternatively as a detritivore
‘litter’ species. Lee (1985) characterised it as a topsoil species and it is known to deposit
-1
per annum according to Gates (1972: 52) — as well as producing uniformly enhanced
vermicomposts when reared on diverse organic ‘waste’ substrates.
Eudrilus
eugeniae is also reviewed and supported with mtDNA COI barcodes (see Appendix).

a detailed species description. Further data is presented from comparative ecological
528 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
studies conducted by the author (Blakemore 1994, 1997, 2008a). This update notes
the confusion over reproductive and digestive organs, counters misdescriptions (such
as that by Vijaya et al. 
distribution reports, such as New Zealand by Sims and Gerard (1985, 1999). A summary
of the glo bal distribution for Eudrilus eugeniae is updated from Michaelsen (1900,
1903). New ecological data is consolidated.
MATERIAL AND METHODS
Earthworms from worm farms in Australia and the Philippines were studied, and

and conventions of Blakemore (2012b). PCR methods similar to those described in
Blakemore et al. (2010) were used for mtDNA barcoding. Results of genetic analyses
with BLAST programs (www.blast.ncbi.nlm.nih.gov/BLAST.cgi) are compared to
Genbank (genbank.com) in the Appendix. Laboratory and glasshouse experiments plus
       Eudrilus eugeniae
by Blakemore (1994, 1997, 2008a) with extensive literature searches; herein data is
integrated and compared with recent published reports. Abbreviations: ANC = African
Nightcrawler; np = nephropores; Qld = State of Queensland in tropical NE Australia;
rhs/lhs = right/left hand side.
TAXONOMY
Phylum Annelida Lamarck, 1802
Class Oligochaeta Grube, 1850
Order Megadrilacea Benham, 1890
Family Eudrilidae Claus, 1880
Eudrilus eugeniae (Kinberg, 1867)
Figs 1–4
Lumbricus eugeniae Kinberg, 1867: 98. [Type locality: Humid mounts and valley of St Helena (15°56'S
05°43'W). Types in Natural History Museum, London BMNH 1904.10.5.550 with Swedish
Museum label: “Lumbricus Eugeniae Kinberg St Helena Swed. State Museum.” The specimen

Eudrilus decipiens Perrier, 1871: 1176; 18721887: 247 (syn.: lacazii, peregrinus,
boyeri
Eudrilus lacazii Perrier, 1872
Eudrilus peregrinus Perrier, 1872
Eudrilus boyeri 
Eudrilus sylvicola 
Eudrilus jullieni 
Eudrilus roseus Michaelsen, 1892
2162. Michaelsen notes “?Eudrilus perigrinus 
Eudrilus erudiens 
Eudrilus eugeniae: Beddard 1895lacazii, peregrinus, decipiens, boyeri, sylvicola, jullieni,
roseus); Eisen 1900 decipiens, lacazii +
peregrinus Perrier, 1872; boyeri, sylvicola, jullieni, roseus, erudiens); Stephenson 1923: 486;
1930: 873; Gates 1942
386; Csuzdi & Pavlicek 2009: 13 (excluding the peregrinus synonym by oversight?); Blakemore
1994; 2002; 2012b; 2013; 2014: 122.
Etymology: Named after Johan Gustaf Hjalmar Kinberg’s Swedish survey ship, the
‘Eugenie’.
BLAKEMORE: EUDRILUS EUGENIAE 529
Description:
External morphology:
Body length: Complete matures, 90–185 mm (pers. obs. and Gates 1972) or up to
250– 400 mm under optimal culture conditions (Viljoen & Reinecke 1994; Parthasarathi

1982). Width: Approximately 4–8 mm.
Mass: Mean per adult ca. 1.0 g (pers. obs.) or optimal maximum 5. 0–6.0 g.
Segments: 161–211 (pers. obs. and Gates 1972) or 250–300 (Viljoen & Reinecke 1994,
suggesting that larger worms add segments); constriction of 40– 46 seen in several Qld
specimens may be artefactual.
Colour: Red-brown dorsum fading posteriorly; anterior with bright blue/green iridescent
sheen from cuticle diffraction, ventrum beige, clitellum darker (sometimes lighter) than
surroundings.
Prostomium: Small, open epilobous.
Dorsal pores: None.
Setae: Eight per segment from 2, closely paired; setae a–b on 17 absent (dehisced); ratio
of aa:ab:bc:cd:dd:U on 7 = 6:1:5:1:10:0.5. Penial/genital setae absent.
Nephropores: Just behind anterior furrow of each segment (longitudinal slits) from 3/4
in c lines or slightly more median (sometimes in d lines).
Clitellum: 13, 14, 15– 18, usually 13, 14–18 and interrupted ventrally.
Male pores: In 17 on tips of longitudinally grooved, tapering, eversible penes in large
ventral chambers, retracted as lateral slits with wrinkled lips just anterior to 17/18 in
line with b setae.
Female pores: 
in 14 as raised intrasegmental openings just anterior to c setae. Gates (1972: 51) calls
these “vaginal apertures”.
Genital markings: Central raised pad centred in 17 between male pores, faintly repeated

Fig. 1. A Eudrilus eugeniae specimen from a vermicompost site.
530 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
Perrier 1872
Michaelsen 1892
Beddard 1895 Eisen 1900
Perrier 1872
BLAKEMORE: EUDRILUS EUGENIAE 531
Internal anatomy:
Septa: From 4/5; (6/)7/8/9 and 14/15 thickened.
Dorsal blood vessel: Single, truncated before anterior hearts in 7; according to Gates
(1972: 51) connects to paired supra-oesophageals in 7– 14 and paired extra-oesophageals
median to the hearts.
Hearts: In 7 lateral, in 8– 11 latero-oesphageal, all distended with blood in some Qld
specimens (cf. Gates (1972) who said the anterior hearts were undistended).
Gizzard: Weakly muscular in 5 immediately behind pharyngeal mass.
Calciferous glands: Ventral spheroidal sacs in 10 and 11 (concealed by seminal vesicles):
large and pink due to blood supply with many internal lamellae; also in 12 (concealed
by seminal vesicles) a pair of yellow, lobular ‘calciferous’ glands which are medially
placed lateral to the oesophagus and ducted posteriorly into it in 13. This latter pair
    
calls the median oesophageal sacs “chylustaschen” but Stephenson (1930) only called
the paired glands in 12 “calciferous”. Eisen (1900: 138) found neither crystals nor lime
granules in the paired “diverticles” in 12, whereas Gates (1972: 51), after claiming
calcareous granules in both median and paired glands, classed them all as calciferous.
Intestine: Origin in 14 or close to 14/15. Caeca and typhlosole absent. Small, supra-
intestinal glands present in eight to forty-two segments in some of 62– 132 (Gates 1972:
52; 1982: table 8) may assist digestion and/or be implicated in the immune competency
of the worms.
Nephridia: Paired, large coiled holonephridia in each segment from 4, not obviously
vesiculate.
Male organs: Holandric with two large, unpaired (or attached?) sacs seen ventrally in 10
and 11, each contain a testis anteriorly and funnels posteriorly, i.e. two pairs of testes in

testes funnels are small and free from iridescent spermatozoa which aggregate in the
ducts and thus are easily missed. The male apparatus is complicated and descriptions
differ somewhat; the copulatory chamber contains a pointed and curved penis plus a

describe as a “Y-shaped gland” that opens into a groove going nearly to the tip of the
penis. Eisen found the product of this Y-shaped gland to be a secretion similar to that of
the silk gland of a caterpillar (possibly analogous to penial setae as found, for example,
in Nsukkadrilus mbae Segun, 1977, to remove sperm of previous concopulant?). The
Y-shaped gland is lacking in Eudrilus pallidus Michaelsen, 1891 and the copulatory
Fig. 2. Eudrilus eugeniae: (a) ventral view of Qld specimen, (b) vasa deferentia unite to form the muscular
euprostates ducting to the centre of the copulatory chamber (characteristic Y-shaped gland on rhs ducts
to lhs), (c) ‘spermathecal’ aperture and combined oviduct (unravelled) to ovisac opposite saccular
gland at junction of duct and ‘ampulla’ (ovary not shown), (d) prostomium, (e) calciferous glands,
hearts and dorsal vessel, (f) dorso-lateral view of caudal segments narrowing to pygomere, (g) cocoon.

 


sometimes fused to form a “single horseshoe-shaped
called the silk-producing “Y-shaped gland” (indicated as “Y-sg”).
532 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
chambers are absent from E. simplex Michaelsen, 1913, serving to anatomically separate
them from E. eugeniae according to Beddard (1895) and Gates (1972: 51).
Female organs: 

calls this the ‘diverticulum’) or duct by long, coiled oviduct tubes in 14, sited opposite
a saccular gland. Eisen’s (1900: 139) description differed from Beddard’s (1895) but
both (mistakenly?) agreed that ovaries in 13 are combined with ovisacs; and, whereas
Eisen thought there were two pairs of ovaries in segment 13, Gates (1972: 52) had the
second, functional pair in 14. However, Michaelsen (1892
small ovaries paired behind septum 12/13 connecting with the saccular part of the
spermatheca (what Sims (1987) calls the “receptaculum seminis”) and that the ovisac
or “receptaculum ovorum” is terminal to a long second oviduct. Easily missed, this

      
oviduct usually connects with the larger oviduct leading to the ovisac where the eggs
mature (as described by Eisen 1900: 139). Histological sections of Vijaya et al. (2012)



the terms “ovo-spermathecal duct” and “ovarian vesicle”.
Spermathecae: As just noted under ‘Female organs’, there is an atrium with muscular
    
and enclosed in a sheath; at their junction a long oviduct attaches leading to the ovisac
which is opposed by a small saccular outgrowth. The whole or just part of the structure
may be referred to as a ‘fertilisation chamber’ as it functions for internal fertilisation of
eggs with sperm, presumably before transfer of the embryos to the cocoon.
Prostates: Large pair of digitiform euprostates, with white muscular sheen from 18
extending to 23; acutely muscular enlargements of loop of paired sperm ducts which
attach to apex of copulatory chamber mound centrally. As noted, a smaller blind duct
— the Y-shaped gland — attaches to the base of the mound mesially, although Beddard

Other internal features: Small saccular ‘brown bodies’ formed from coelomocytes
were observed loose in coelomic cavities from 7 posteriorly; these may enclose shed
    
         

Pontoscolex; the function
in both cases is unknown.
The gut contains soil and/or organic matter (depending on habitat) — this species
appears to be an adaptive feeder and will survive in unaltered soil (as noted) but also

Cocoons: Dark coloured with adhesions, tapered lemon-shape with one side usually being
 
incubation and hatching data); may contain from one to eight hatchlings (Gates 1982).
Distribution (Fig. 3): After Michaelsen (1903: 122); Gates (1942: 98, 1972: 52, 1982: 72):
West African origin from Upper Guinea plain or coastal forest including Sierra Leone,
BLAKEMORE: EUDRILUS EUGENIAE 533
Liberia, Ivory Coast, Ghana, Togoland (Benin), Nigeria, Cameroon, Gabon and the
Congo; transported and peregrine to many tropical countries such as Madagascar and
the Comoros Islands (e.g. Anjouan), Seychelles (Gerlach 2011), Sri Lanka and India
(Michaelsen 1903; Stephenson 1923: 486; Dhiman & Battish 2005), and New Caledonia;
the Americas: [e.g. Gates (1982: 74) said it owes its North American distribution since

lower 48 United States, such as Florida, Alabama, Georgia, Texas, and even to Hawaii,
          
(Rodriguez-Aragones 1999), Suriname (Horst 1887), Panama [from 1896 — Eisen
(1900: 135) said: “Judging from the number of specimens in the collection, this species

as an introduction from the then ‘British Honduras’ noted by Gates 1982), Venezuela
(e.g. roseus), Guyana, Colombia (Feijoo et al. 2004), Paraguay (Schuldt 2009), Brazil;
          
Virgin Islands (Michaelsen 1903, 1910; Gates 1942, 1972), Cuba (Gates 1972; Alvarez
& Rodriguez-Aragones 2010), Bahamas, Antilles (Gates 1942: 99) and Guadeloupe
(Csuzdi & Pavlicek 2009 — who found it in a natural setting indicating it may have
become feral there as it is on St Helena); also the Atlantic: Bermuda (as E. erudiens),
St Helena (type-locality by introduction), Cape Verde (from where it was introduced
 
1903, 1910). Elsewhere in America, Gates (1982: 72–74) explained in some detail how

“can of worms (bait) inadvertently left behind” and cultured by the camp owner (a Mr
Fig. 3. Distribution map from Michaelsen (1903: chart 1) (hash marks family distribution). Note that New
Zealand was in error but other records outside its West African homeland are due mainly to human
transportation and the worm’s acclimatisation; early Caribbean and Latin American introductions
possibly relate to the 16th – 19th century Atlantic slave trade.
534 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
T. Baker), eventually shipped to all of the USA and Canada where it has been cultured
both indoors and outdoors.

in 1991 (Blakemore 1994, 1999) with stock (surface sterilised cocoons) originally

In Europe it was introduced to Hamburg with plants from the West Indies (Michaelsen
1903: 12) and to Kew Gardens in Wardian cases from British Guiana (Beddard 1906). It
is rarely reported from northern European glasshouses by Sims and Gerard (1985), albeit
rarely, e.g. from Denmark (Blakemore 2007) and eastern Europe, Hungary (Csuzdi et al.
2007 ); also maintained in laboratory cultures, e.g. Vigo, Spain (Dominguez et al. 2001).
Plisko (2010) notes that it was deliberately introduced to South Africa (RSA) by
Reinecke and Viljoen (1988) from Germany in stock originating in West Africa and
that this species is now widely used in RSA farms and is “adapting well to habitats in
this country” suggesting its naturalisation there.
Eudrilus eugeniae is stated to be newly introduced to Egypt (Medany & Yahia 2011:
20), but what this paper actually says is: “Four types of earthworms were brought
to Egypt from Australia: Lumbriscus Rubellus (Red Worm), Eisenia Fetida (Tiger
Worm), Perionyx Excavatus (Indian Blue), and Eudrilus Eugeniae (African Night
Crawler)”. However, Lumbricus rubellus Hoffmeister, 1843 has never been proven a
vermicomposting worm (Blakemore 1999, 2002), thus it is likely only three species or
fewer were involved. Eudrilus 

At least one worm farmer in Valparaiso, Chile and a technician (Mr Reinaldo Plasen-
cia) in Nicaragua claim to rear Eudrilus (“la lombriz africana”) sometimes misspelled
Fudrillus spp” (Lumbricultura 2014; Monographias 2014), which would both be new
national reports. Mr Enzo Bollo Tapia (pers. comm. 2014) communicated that it can be
cultivated in Ecuador, Colombia and Peru but that Chile is unsuitable for its survival
due to climate, although he did experiment there.
Introduced to the Philippines for vermicomposting in the 1980s, E. eugeniae is now
distributed in worm-beds on farms over the whole country. A report of its spreading to
some mountainous inland areas via agro-forest strips of Negros Occidental by Flores
(2007) is unsubstantiated as there is no proof that E. eugeniae itself was found. The
report just says “Eudrilus” based on a novice’s key to families. It is also newly reported
from Thailand, from an unpublished DNA barcode submission to GenBank in 2010/2011
(see Appendix) and recent reports from there (e.g. Malliga 2010; Loongyaii et al. 2011).
Eudrilus is used for soy bean residues and rice husks vermicomposting in Malaysia
(e.g. Lim et al. 2011; Shak et al. 2014) with the worms apparently imported as cocoons
from India. It is also reported from Indonesia where vermiculture operations in Solo,
Central Java are advertised (e.g. Indonetwork 2014; Cacinglumbricus 2014). This has

West Java (Andy Darmawan pers. comm. via email Nov. 2014). Recent reports from
Vietnam are from the provinces of Lang Son and Cao Bang by the Research Institute for
et al. (2011); AFSPAN (2012) but mispelt “Eudrilus euganaie
New Zealand records by Beddard (1895: 149), repeated by Michaelsen (1900,
1903), Hutton (1904: 355), Gates (1972), and Sims and Easton (1985) were stated by
Thompson (1922: 359), Benham (1950) and Lee (1959: 365) to be an error introduced
BLAKEMORE: EUDRILUS EUGENIAE 535
when Beddard (1891, 1895: 149) somehow mistook for Eudrilus eugeniae Smith’s
1886 report of Endrilus [sic lapsus for Eudriluslevis [= Octochaetus? levis (Hutton,

Zealand also failed to locate this species there (e.g. Blakemore 2012a).
The claim from the French islands off the coast of Newfoundland (St Pierre and
E. lacazii by Perrier (1872) was disputed by Gates (1982: 72), although

  

Philippines and South Africa), from a few southeast Asian countries neighboring
Vietnam, or yet from China/Taiwan.
Locality: Specimens were collected from worm farms in Brisbane (1991) and samples
sent to the author from Mackay, Qld (1992), and Menai, NSW (1996) [now in CSIRO/
        

but only close to worm beds; neither was it located ferally in surveys on Negros Island
(pers. obs. 2009– 2014, cf. Flores 2007).
Habitat: Originating in shaded savannahs of West Africa, it now thrives in worm beds
on worm farms; it is reported in natural high moisture/organic sites such as waterfalls
      

 Miagao, Philippines (pers. obs. Feb. 2014).
Behaviour: Hatchlings are reported to sometimes return to the cocoon when alarmed.
Active with a rapid escape response when disturbed, but if captured the adult worms
become placid and can be readily handled. The species will wander at night, leaving

  
that are shaped similar to a scorpion’s stinger (see Fig. 2).
DISCUSSION
Life cycle
The genus Eudrilus is bi-parental, being characterised by internal fertilisation preced-
ing cocoon production (Sims 1964, 1987). Initial life studies are relatively recent, for
example by Neuhauser et al. (1979), who found the best growth on horse manure or acti-
vated sewage sludge. Its life span can be 1–3 years, with Eudrilus eugeniae possessing
a life cycle that ranges from 50– 70 days, with sexual maturity reached at 35–50 days
in culture (Viljoen & Reineke 1989). Reineke and Viljoen (1988) reported that in a
cattle manure substrate at 25°C, cocoons produced by adult worms between the ages of
70– 100 days were incubated for ca. 17 days before producing a mean of 2.7 hatchlings
per cocoon (range 1–8) with 84 % hatchling success. Dominguez et al. (2001) had similar


3.6 cocoons per week with 2.2 viable hatchlings per cocoon (= 6.5 hatchlings per worm

clitella at between 35– 45 days; worms with fully developed clitella copulated readily
536 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
and the formation of cocoons started within 24 hours after copulation, continuing for
up to 300 days. In India, Nagavallemma et al. (2004) recorded an 18-fold increase in
population (from 55 specimens to 1,007) on legume leaf/cow dung substrate in three
months, the highest of three composting species they tested. Also in India, Vasanthi et
al. (2013b
mixed with sawdust and cattle manure at 26°C. These rates of growth and reproduction
are amongst the highest currently reported for any earthworm.
Parasites and disease resistance
Gates (1982: 74) states that, unlike in most earthworm species, parasitic protozoans
had not been reported. Internal nematodes (parasitic, paratenic or commensal) are known
(e.g. Gates 1974: 74; Poinar 1978; del Valle & Rodriguez 1988; McNeill & Anderson
1990; Spiridonov 1992), but this species is supposedly disease-free apart from records
of ammonia lesions on the clitellum (Gerasimov 2007). The functions of the ancillary
glands of the female and male organs are not fully worked out; possibly they produce
nutrients for eggs/sperm or are in part copulation sentinels preventing intromission of
parasites or other disease vectors. Neither is the function of the supra-intestinal glands
understood, as already noted.
Regeneration
Gates (1982: 74) reports ‘head’ regeneration as well as more easily observed posterior

et al. (2014), thus it
is plausible for this species to get two viable worms from a single ‘individual’ as with
some other species reported by Blakemore (2001).
Ecology and economics
Ecology of the three most common aerobic composting worm species, Eisenia fetida
(Savigny, 1826), Eudrilus eugeniae and Perionyx excavatus Perrier, 1872, that are most
often bred in worm farms and fed on household vegetable wastes or animal manures, are
detailed in reports by Graff (1982), Sabine (1983), Kale and Bano (1991), Reinecke et
al. (1992), Kale and Sunitha (1993, mispelt “Sunita” in Edwards 2004 : 388, table 19.3)
and by Dominguez et al. (2001). Comparative studies generally show E. eugeniae to be
a most productive species in tropical zones or under cover in temperate regions (where


 
Eisenia fetida, as noted below. For example, Gates (1982: 74) says it is the preferred food
for duck-billed platypuses [Ornithorhynchus anatinus 

In Cuba, India and the Philippines, this worm is favoured most for producing vermi-
compost fertiliser for organic farming, whereas in North America and Australia the

‘African Nightcrawler’ or ‘ANC’. The current studies noted a propensity to escape from

potential for mobility, there were no records of natural colonisation for North America
(Gates 1958, 1972, 1982) or Australia, and such records from New Zealand are now
BLAKEMORE: EUDRILUS EUGENIAE 537
known to be mistaken identities. As Gates (1958: 10) said: “This species, originating in
tropical Africa and until very recently known only from the tropics, has been raised and
distributed in the United States for several years by earthworm culturists. Sales appear to
be mostly to anglers for bait. Escapes of live specimens into natural environments must
have been numerous. As yet, however, there are no records to indicate acclimatization
and permanent colonization in mainland states.” This was slightly counter-indicated
by his later record of specimens from soil under oak trees at Vero Beach Laboratories,
Florida (Gates 1982: 72).
Nevertheless, the spread of Eudrilus eugeniae 
is a widely cultivated species in Brazil too and there are some records of its survival
away from worm farms, mainly in areas of high organic matter, but also in gardens

& Pavlicek 2009). A novice report from mountainous forests in Negros Occidental,
Philippines (Flores 2007) is unsubstantiated, being based on a simplistic, non-specialist
key only to families, and re-surveys (unpub.) by the current author have not found it
far from culture beds.
Preferring bedding material rich in organic matter in culture, this savannah worm
also survives in unamended soils (M’ba 1978); and Blakemore (1994) successfully
maintained it for six months with reproduction in mesocosms of heat-sterilised but
unamended clays (vertisol and kraznozem) and sandy (podzol) soils in the glasshouse.
Parthasarathi (2007) showed that over a year it will grow in clay loam but not as well as
in composts where its biomass may be six times as high; thus it is considered adaptable
to a wide range of soil types, unlike most other highly restricted earthworms that co-
evolve with their soils (Michaelsen 1922).
Such environmental tolerance was investigated by way of soil selections by Madge
(1969) who introduced Eudrilus eugeniae and another tropical species to gradients
of soil texture and found a marked preference for the 0.25 mm particle size fraction

Blakemore (1994) showed that it, along with Eisenia fetida, had a tendency to select
soil amended with manure when given a choice and compared to other species; it was
found in clay soil rather than loam or sandy soil in 25 % of all its observations. Habitat
E. eugeniae and another
tropical African species to a soil moisture gradient and found 65 % of the earthworms in
the 12– 17 % moisture sectors after 48 hours; tolerated pH range was between 5.6– 9.2
and for temperatures, he found an optimal range between 23°C and 31.5°C. In growth
experiments, Viljoen and Reinecke (1992) reported that no E. eugeniae juveniles survived
below 12°C or above 30°C, and optimal temperature for growth and reproduction was
around 25°C. Attempts to establish it in natural environments show that the worms do
well until the temperature drops to 40°F (4.4°C), at which time they die (Gates 1972:
52). Sims and Gerard (1985, 1999) say that temperatures below 10°C are not tolerated
and that the optimum breeding temperature range is 21–27°C. Domingues et al. (2001)

80– 82 % and 25–30°C. These moisture and temperature levels correspond well to
    
a light sandy loam (10 % clay) and the preferred temperature was 25°C, in gradient
cylinders laid horizontally to circumvent depth affects.
538 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
Nature of Eudrilus casts
Eudrilus eugeniae is plentiful in the coastal, shaded savannah grasslands of its West
African homeland where copious surface pellets are produced — remarkably, up to 140 t ha-1
-1 per annum according
to Gates (1972: 52), during the rainy season only.
In a series of mesocosm soil cores trials with combinations of species, soils and
test crops, Blakemore (1994, 2008a) determined that E. eugeniae produces distinctive

container edges where the worms burrowed, and had the highest surface cast production
-2
for a high casting rate of E. eugeniae estimated by Cook et al. (1980) of up to 2.43 g soil
per gram fresh weight worm per day. The casting rates in the 23 cm diameter (0.0434 m2)
by 33 cm deep mesocosms were as high as 610.5 g per pot in kraznozem soil in just six
-1
the rate reported by Madge (1969).
Blakemore (1994, 2008a) observed that, where casts for this species were deposited
on the surface, adventitious plant roots sought them out and that casts fallen over the

base too; when the roots were lifted cast pellets looked like miniature bunches of grapes
dangling on a vine. This may be explained by Eudrilus eugeniae
higher nutrients and trace elements in its casts compared to the clay soil matrix, especially
nitrate-N, K and Zn, which were about twice that of the soil (Blakemore 1994, also
Table 1), and possibly other plant attractant compounds.
Effects on plant yield and soil moisture after deliberate introduction of this species
a)

cores ranging from +21–74 % for oats and +15–50 % for grass shoots (and up to +50 %


by surface casts and also drainage in worm burrows. As one of a dozen candidate species
     Eudrilus eugeniae  
pasture grass yield by 83.9 % (i.e. nearly doubled compared to controls). However,
these preliminary results were considered inconclusive due to background variation and
lack of survivors after one year during a particularly severe drought in tropical eastern
Australia that precluded irrigation even from cattle stock reservoirs.
Inadvisability of deliberate introductions of alien species
The ethics of releasing an exotic species such as Eudrilus eugeniae into the Australian
        
this was an objective of the project that aimed to enhance improved pasture production
naturally (Blakemore 1994). Possible risks were considered acceptable on the grounds
that this species was present in Australia, having been legally imported from Canada by

bait, including in the Mundubbera township nearest to the release site (pers. obs.). This

than being parthenogenetic) and the upland release area, classed as dry, arid sub-tropical,
BLAKEMORE: EUDRILUS EUGENIAE 539
was several kilometres from a water course that may have aided dispersal. Thus the
likelihood that the species would persist due to the single release event, especially
in the prevailing drought, was considered negligible. However, increasing concerns
about the spread of alien species would mean it is inadvisable to contemplate such a
release or deliberate introduction in the future in Australia or elsewhere. Commercial
solutions for the worm bait/compost market could be found from the pool of native
species, some of which are already bred as bait in Australia (Blakemore 1999, 2012b)
but, again, redistribution of these natives is also ill-advised albeit less objectionable and

Microbial aspects
Sruthy et al. (2013) determined that the intestinal microbial populations of Eudrilus
eugeniae in the foregut, mid and hindgut were dominated by bacteria, actinomycetes
and fungi, respectively. These authors reviewed the diversity of types and number
of these microbes, plus yeasts and protozoans in the casts of E. eugeniae and other
vermicomposting species reported on by other researchers (see next section below).
Use of earthworms in vermistabilisation of sewage sludge and other wastes have had
TABLE 1
Composition of Eudrilus eugeniae casts produced from two types of unamended soils: (A) a sandy podzol
and (B) a clay vertisol (Blakemore, 1994: tables 4.3.22/23) compared to (C) 100 % ANC vermicast
  
source soil medium; 1 % = 10,000 mg/kg or 10,000 ppm (parts per million); ‘~’ = conversion estimates.
Component (A) Sand soil casts (B) Clay soil casts (C) 100% Vermicast/
compost
Moisture - - 30 %
pH   6.8
Organic matter   36 %
C:N Ratio   15:01
Total C   ~21–28 %
Total N*   1.89 %
P2O5 (from P-Bicarb)*   2.49 %
K2O (from K total)*   1.40 %
NO3-N   -
SO4-S   -
Ca   5.09 %
Cu   95ppm
Fe - - 2.63 %
Mg   0.17 %
Mn   1,233ppm
Zn   329ppm
MEAN ratio to soil   -
*Total macronutrients N-P-K are generally less important for composts that are microbially activated.
540 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
favourable results when attempted in various regions (e.g. Neuhauser et al. 1988;
Blakemore 2000b, c). Monroy et al. (2008) showed that processing of pig manure slurry
with E. eugeniae eliminated nematodes and reduced coliform bacteria by up to 98 %.
Composition of ANC vermicompost
The chemical and microbial characteristics of E. eugeniae vermicast/vermicompost
differ depending upon the nature of the substrate and the age of the casts. Chemical
composition is determined by the source material on which the worms are fed but is often
enhanced in terms of natural plant nutrients, these changes relating to physical, chemical
and microbial activities during and after passage through the worms’ intestines. Table 1
summarises data from experiments by Blakemore (1994: tables 4.3.22, 4.3.23) that
found that plant nutrients in casts of clay soil increased by about +20 %, whereas casts
from a sandy soil were depleted in nutrients (by -20 %) probably due to assimilation
by the worms, although structural characteristics of the soil matrix were improved by
the worm activities too, increasing plant yields as noted above. Several authors, have
et al. (1988). For
instance, Nagavallemma et al. (2004) found generic vermicomposts to have higher
percentages (nearly double) of both macro- and micronutrients and higher microbial
activity compared with garden composts, plus they detected these plant-growth-
promoting agents. Data from Parthasarathi (2006) is summarised in Table 2.

to mineralisation and the gradual release of nutrients, as well as plant-growth-promoting
enzymatic agents. As vermicompost ages, this biological activity declines, but the
vitamin content may double with time (Prabha et al. 2007). Studies by Parthasarathi
and Ranganathan (2000) showed that enzymes (cellulase, amylase, invertase, protease
and phosphatase) declined as the casts aged. Parthasarathi (2006) found that Eudrilus
eugeniae 
p<0.05) in microbial population (fungi + bacteria + actinomycetes) and dehydrogenase
enzyme activity in fresh casts, leading to enhanced nutrient mineralisation, but this
activity gradually decreased over the period of a month as the casts aged (see Table 2).
Effects of ANC vermicompost on plant yield
A study by Kale et al. (1992) commented on applications of Eudrilus eugeniae ver-
-1 plus half of the recommended

are similar to those reported by Pontillas et al. (2009) from the Philippines. However, the


 
Blakemore (2000a) which found that a partly organic section of Haughley Farm was not as
productive as a wholly organic section. Unpublished data from Kahariam organic farm in
the Philippines show that ANC vermicast application to paddy at rates of just 1.5–3 t ha-1
-1, well above the typical local
range of 20– 90 cavans ha-1 but without the need for chemical additions (Mr Danny

applying up to 30 t ha-1 Eudrilus vermicompost yields 90 t ha-1 (Mr R. Peñalosa, pers.
comm.), above the regional average yield of 50 t ha-1, i.e. +80 %. In current studies by
BLAKEMORE: EUDRILUS EUGENIAE 541
the author, the resident earthworms on both farms were enhanced in terms of biomass
and biodiversity when compared with neighbouring farms that use conventional chemical

using vermicomposts as primary fertilisers.
Composition of sh bait, stock feed and worm meal
Worms can be fed to stock directly, or dried and added to worm meal. Composition
is provided by several authors, for example Hertrampf and Piedad-Pascual (2000) who
show 85.3 % moisture in E. eugeniae worms with 56 % protein when dried, and ten
essential amino acids plus macro and trace minerals of freeze-dried vermimeal. Although
 E.
eugenia are not presently available.
Radioactivity and biocide effects
Eno (1966) found E. eugeniae to be less susceptible than Lumbricus terrestris Linnaeus,
1828 to irradiation in the range 16– 64 kR. In Nigerian soils, this worm had much higher
concentrations of DDT and its products, compared with the surrounding soil, and its
production of surface casts virtually ceased in DDT-treated plots, which was considered a
contributory factor to the overall decline in fertility of these plots (Cook et al. 1980). The
concentration of heavy metals (Cu, Zn, Pb, Cd and Hg) in the tissue of E. eugeniae fed
on municipal wastes accumulated beyond acceptable levels for protein-meal production
(Graff 1982), although this trait could be utilised for soil bioremediation.
Pharmaceutical or cosmetics uses

coagulent or thrombolytic drugs to treat and prevent cardiac and cerebrovascular diseases
in heart and stroke patients. In original 1982 Japanese patents (e.g. US4568545A) extracts
were said to come from “Lumbricus rebellus” (sic), but Indian researchers (Sharma et al.
2011aE.
eugeniae as well as Eisenia fetida
anticoagulant properties of E. eugeniae and its extracts have been variously studied (e.g.
Mathur et al. 2010a; Packia Lekshmi et al. 2014). When Eudrilus eugeniae was dried
and powdered, it produced antimicrobial responses of between 45– 90 % inhibition on
agar plates when assayed against seven human pathogens (Anjana et al. 2013). Extracts
from this worm showed antibacterial and antifungal properties that varied depending
on the formulation (Mathur et al. 2010b). Preliminary studies by Shobha and Kale
(2008) found indications of possible control of plant soil-borne fungal and bacterial
pathogens using E. eugeniae     et
al. (2013a) using a paste from this worm to inhibit the growth of resistant/recalcitrant
human pathogens of bacteria such as Staphylococcus aureus Rosenbach, 1884 (‘Golden
TABLE 2
Microbes in ANC vermicompost (after Parthasarathi, 2006: table 1); CFU = Colony Forming Units.
Casts Bacteria (CFU g-1) Fungi (CFU g-1) Actinomycetes (CFU g-1)
Fresh casts 444
30-day-old casts 444
542 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
staph’) and of fungi such as Candida albicans (Robin, 1853) (‘Thrush’), indicating its
antimicrobial properties.
Emulating the works of Cooper et al. (2004a, bE. eugeniae
as the source, Dinesh et al. on
cancer cell lines of human HeLa cells, colon cancer cells, WBC malignant tumour cells
and brain tumour cells, with reduction by up to 33 %. Such studies indicate novel use
of this earthworm for treatment of cancers.
Azmi et al. (2014) recently found earthworm extracts, including those from E.
eugeniae, to have anti-wrinkling properties as potential new ‘anti-aging’ agents.
CONCLUSION
Eudrilus eugeniae is a remarkably versatile vermicomposting species of the tropics
or indoors in temperate regions. It is useful for recycling soil organic matter (i.e.
  
stock-feed protein, bioprospecting for pharmaceuticals/cosmetics or perhaps silk produc-

bait. Its geographical range and the applications of its products are rapidly expanding,
with a summary of its vermiculture potential provided by Li et al.
           


similar Eudrilus pallidus (Michaelsen 1892: 216) from Accra, Ghana [?syns. E. buettneri
Michaelsen, 1892; Eudrilus ifensis
species E. pallidus atakpamensis Michaelsen, 1913 and E. simplex Michaelsen, 1913

Eudrilus eugeniae

unlike the 7,000 other earthworm species currently described but mostly neglected, and
these perhaps just a fraction of the total numbers in nature (Blakemore 2012b). Thus,

of earthworm ecology still remains largely open and unexplored.
ACKNOWLEDGEMENTS
Preliminary taxonomic work was undertaken during PhD studies at CSIRO Tropical Agriculture, Brisbane
under an Australian RIRDC grant from 1991–1993. Inspection of Natural History Museum, London

NIBR under the auspices of Dr Wonchoel Lee of Hanyang University, Seoul whence Dr Seunghan Lee

in Batangas, Philippines. Comments of editors and anonymous referees helped improve this contribution.
BLAKEMORE: EUDRILUS EUGENIAE 543
REFERENCES
AFSPAN.
3: Preliminary report on desk study on Regional/International cooperation activities. Report #02:
2012 (www.afspan.eu/publications/reports/wp3-regional-international-cooperation-report-2012.
pdf; accessed 17/11/2014).
, K. 2014. Video reports of Eudrilus eugeniae in Saudi Arabia. (https://www.youtube.com/user/
kalidabod/videos; accessed 25/07/2015).
 & -  2010. The scope of vermiculture in Cuba. In: Edwards,
C.A., Arancon, N.Q. & Sherman, R., eds, Earthworms, Organic Wastes, and Environmental
Management. Boca Raton, Florida: CRC Press, pp. 533– 543.
&  2013. Evaluation of earthworm powder
(Eudrilus eugeniae) and its application in cotton crepe bandage. International Journal of Bioassays
2 (9): 1250– 1255.
& N.M.N. 2014. Anti-elastase, anti-tyrosinase
and matrix metalloproteinase-1 inhibitory activity of earthworm extracts as potential new anti-
aging agent. Asian Pacic Journal of Tropical Biomedicine 4 (1): S348–354. (Online: http://www.
ncbi.nlm.nih.gov/pmc/articles/PMC4025347/; accessed 21/7/2015).
& 1988. Reproductive potential and existence of endogenous rhythm in production
of earthworm, Eudrilus eugeniae. Proceedings of the Zoological Society of Calcutta 32: 9–14.
 1886. Descriptions of some new or little-known earthworms, together with an account of the
variations in structure exhibited by Perionyx excavatus. Proceedings of the Zoological Society
of London 1886: 298– 314.
––––––1887. Contributions to the anatomy of earthworms. Nos. I., II., III. Proceedings of the Zoological
Society of London 1887: 372– 392.
––––––1891. On the structure of two new genera of earthworms belonging to the Eudrilidae and some
remarks on Nematodrilus. Quarterly Journal of Microscopical Science 32: 235–278.
––––––1895. A Monograph of the Order Oligochaeta. Oxford: Clarendon Press.
APPENDIX
mtDNA COI barcode data (BLAST from http://blast.ncbi.nlm.nih.gov).
P14 Eu. eugeniae from Kahariam farm, Philippines 21st Nov., 2013 in 70% ISO-Ethanol. Coll. RB/Rowena
Ocenar.
Sequence (584bp):
megaBLAST result: Eudrilus eugeniae (KC122194.1) from India, Id. 584/584 (100 %), i.e. perfect match;
Eudrilus eugeniae (HM219171.2) from Thailand, Id. 564/584 (97 %), i.e. some difference. GenBank:
HM219171.2 origin in Thailand not stated in publication by Loongyai et al. (2011).
P15 Eu. eugeniae from Kahariam, Philippines 21st Nov. 2013 in 70 % Ethyl-alcohol. RB/RO.
BLASTn result: P14 vs. P15 Id. 584/584 (100 %).
Note: Eudrilus eugeniae was said to have been introduced from West Germany to both India (in the late
1970s according to Meenatchi et al., 2009) and to Philippines (in the early 1980s) thus supporting the
same species origins. However, both these statements need to be tempered since Stephenson (1923: 486)
already recorded it in India from 1898, and local growers said other stocks of E. eugeniae were imported
to Philippines from Australia. Sharma et al. 2011b investigated DNA markers in E. eugeniae

and lowest genetic similarity index values of 1.0 to 0.40. However, neither of these studies tested the COI
gene, cf. GenBank: KC122194.1 from India by Gupta et al. “Earthworm for production of compost from
coconut leaf biomass” (unpublished), submitted in November 2012.
TAAGACAGCCGGGTGCTTTTCTAGGAAGAGACCAACTCTATAACACTATCGTTACAGCTCAT
GCTTTTCTAATAATCTTTTTCCTTGTAATGCCAGTTTTTATTGGCGGATTTGGAAATTGATTA
CTCCCACTAATACTGGGAGCGCCCGACATAGCATTCCCCCGACTAAATAATTTAAGATTTTG
ATTATTACCTCCTTCACTAATTCTCTTAGTTTCGTCAGCTGCAGTTGAAAAGGGTGCAGGTAC
AGGATGAACTGTTTACCCACCACTTGCAAGAAATCTTGCTCATGCGGGGCCCTCAGTAGACC
TAGCCATTTTCTCTCTTCATCTTGCAGGGGCATCATCTATTTTAGGGGCAATTAACTTTATTA
CAACAGTAATTAATATACGATGATCCGGTCTTCGATTAGAACGAATTCCACTATTTGTATGA
GCAGTAGTAATCACTGTAGTGCTACTTCTTCTATCACTTCCAGTCTTAGCGGGGGCAATCAC
AATACTTCTCACAGATCGTAATCTCAATACTTCATTCTTCGACCCAGCTGGGGGTGGAGATC
CAATTCTTTATCAACATTTATTC
544 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
––––––1906. Annelida, Oligochaeta. Bulletin of Miscellaneous Information. Additional Series. Royal
Gardens, Kew 5: 66–67.
, W.B. 1950. On Cryptochaeta, a new genus of earthworms; and a nomenclatural muddle solved.
Transactions of the Royal Society, N.Z. 78: 324–328.
, R.J. 1994. Earthworms of south-east Queensland and their agronomic potential in brigalow
soils. PhD thesis, University of Queensland.
––––––1995. Register of National Earthworm Collection, ANIC, Canberra. (http://www.annelida.net/
earthworm/Australasian%20Earthworms/Register.xls; accessed 26/11/2013).
––––––1997. Agronomic potential of earthworms in brigalow soils of south-east Queensland. Soil Biology
& Biochemistry 29 (3/4): 603– 608.
––––––1999. The diversity of exotic earthworms in Australia — a status report. In: Ponder, W. & Lunney,
D., eds, Proceedings of “The Other 99%”, Transactions of the Royal Zoological Society of NSW,
1999. Mosman, NSW, pp. 182–187.
––––––2000a. Ecology of earthworms under the “Haughley Experiment” of organic and conventional manage-
ment regimes. Biological Agriculture & Horticulture 18 (2): 141–159. (http://www.annelida.net/
earthworm/Haughley/Haughley.doc; accessed 21/7/2015; DOI: 10.1080/01448765.2000.9754876).
––––––2000b. Vermicology I — Ecological considerations of the earthworm species used in vermiculture.
In: Applehof, M., ed., Vermillennium — International Conference on Vermiculture and
Vermicomposting, Kalamazoo MI. September 2000. (http://www.annelida.net/earthworm/
Vermillennium%202000/Vermicology%20I.pdf; accessed 26/11/2013).
––––––2000c. Vermicology II — The products, potential, and problems of vermiculture. Vermillennium
— International Conference on Vermiculture and Vermicomposting, Kalamazoo MI. September
2000. (http://www.annelida.net/earthworm/Vermillennium%202000/Vermicology%20II.pdf;
accessed 26/11/2013). Published as Chapter 17 In: Edwards, C.A., ed., (2002) Earthworms in
the Processing and Utilization of Organic Wastes. Pennsylvania: J.G. Press.
––––––2001. Tasmanian earthworm grows second head. Invertebratata 20: 3 (http://
zoology/invertebrata/printarchive/printtext/inv20aitems.html#20blakemore; accessed 26/11/2013).
––––––2002. Cosmopolitan earthworms — an eco-taxonomic guide to the peregrine species of the World.
Kippax: VermEcology.
––––––2007. Scandinavian earthworms – a checklist of species . In: Blakemore, R.J., ed., A series of
search able texts on earthworm ecology and taxonomy. (http://www.annelida.net/earthworm/
Scandinavian.pdf; accessed 25/07/2015).
––––––2008a. Copy of PhD thesis. In: Blakemore, R.J., ed., A series of searchable texts on earthworm
ecology and taxonomy. (http://www.annelida.net/earthworm/PhD%20Thesis/PhDThesis.DOC;
accessed 25/07/2015).
––––––2008b. Seeking consensus on main categories of ecological strategies of earthworms. In: Pavlicek,
T. & Cardet, P., eds, Advances in Earthworm Taxonomy III. Proceedings IOTM3. Ministry of
Agriculture, Natural Resources and Environment of the Republic of Cyprus, Nicosia, pp. 129– 136.
––––––2012a. On Schmarda’s lost worm and some newly found New Zealand species. Journal of Species
Research 1 (2): 105–132. (http://www.nibr.go.kr/eng/event/journal_spe_3_201208.jsp; accessed
26/11/2013).
––––––2012b. Cosmopolitan earthworms. 5th edition. Yokohama, Japan: VermEcology.
––––––2013. The major megadrile families of the world reviewed again on their taxonomic types (Annelida:
Oligochaeta: Megadrilacea). Opuscula Zoologica Budapest 44 (2): 107 –127. (http://opuscula.
elte.hu/opuscula44_2.htm; accessed 26/11/2013).
––––––2014. Miscellaneous earthworm types in the Natural History Museum, London (Annelida:
Oligochaeta: Megadrilacea: Eudrilidae, Lumbricidae, Megascolecidae, Moniligastridae,
Octochaetidae). Opuscula Zoologica 45 (2): 199– 155. (http://opuscula.elte.hu/PDF/Tomus45_2/2_
Op_Blakemore_London_Museum_worms.pdf; accessed 17/11/2014).
&Drawida hattamimizu Hatai,

earthworm type, with a response to the ‘Can of Worms’ theory of cryptic species. ZooKeys 41: 1–29.
& 2007. Minhocas na América Latina: Biodiversidade e Ecologia. Londrina:
Embrapa Soja.
 2014. Indonesian internet mart selling ANC. (http://cacinglumbricus.wordpress.com/;
accessed 17/11/2014).
 &, R. 1980. Effects of cultivation
and DDT on earthworm activity in a forest soil in the sub-humid tropics. Journal of Applied
Ecology 17: 21–29.
BLAKEMORE: EUDRILUS EUGENIAE 545
& N. 2004a. Earthworms: sources of antimicrobial and anticancer molecules. In:
Cooper, E.L. & Yamaguchi, N., eds, Complementary and Alternative Approaches to Biomedicine.
New York: Kluwer Academic/Plenum Publishers, pp. 359–390.
&, M. 2004b 
antimicrobial and anticancer molecules. International Journal of Immunopathological
Pharmacology 17 (3): 237– 244.
, Cs. (2012) Earthworm species, a searchable database. Opuscula Zoologica 43 (1): 97–99. (http://
earthworm.uw.hu/; accessed 25/7/2015).
& E. 2007. Is Dichogaster bolaui    
earthworm species? European Journal of Soil Biology 44: 198–201.
  &, T. 2009. New records of earthworms from Guadeloupe with description of a
new species (Oligochaeta: Glossoscolecidae, Acanthodrilidae, Megascolecidae and Eudrilidae).
Opuscula Zoologica 40 (1): 9– 15.
, C.R. 1881. The formation of vegetable mould, through the action of worms, with observations on
their habits. Murray, London. (Online: http://darwin-online.org.uk/converted/pdf/1881_Worms_
F1357.pdf; accessed 25/7/2015).
&, C. 1988. Mesidionema praecomasculatis (Rhabditida:
Nematoda), un parasite de Eudrilus eugeniae (Oligochaeta: Eudrilidae). Prevalencia e intesidad
de invasion. Revista Biologia (Havana) 11 (3): 17 –23.
&, S.K. 2005. Earthworms from Northern Indian States with Ocnerodrilus occidentalis
Eisen, 1878 as a new report from Punjab. Zoos’ Print Journal 21 (1): 2135– 2137.
  &  R.N. 2013. Anticancer
potentials of peptides of coelomic fluid of earthworm Eudrilus eugeniae. Biosciences
Biotechnology Research Asia 10 (2): 601–606.
&, J. 2001. The biology and ecology of Eudrilus eugeniae (Kinberg)
(Oligochaeta) bred in cattle wastes. Pedobiologia 45: 341–353.
. 2004. Earthworm Ecology. Second edition. Boca Raton, Florida: CRC Press.

and adjacent Islands. Proceedings of the California Academy of Sciences 2 (1): 85–276. (http://
biostor.org/reference/110208; accessed 26/11/2013).
 C.F. 1966. The effect of gamma radiation on soil microorganisms. Report of Florida Agricultural
Experimental Stations 1966: 175– 176.
& , A.G. 2004. Patrón de distribución y listado de
especies de las lombrices de tierra (Annelida, oligochaeta) en Colombia. Acta Zoológica Mexicana
20 (2): 197–220. (http://www.ecologia.edu.mx/azm/documentos/20_2/M-Feijoo.pdf; accessed
26/11/2013).
 D.G. 2007. Earthworm distribution in selected islands of the Visayan (Central Philippines)
Archipelago. Philippine Journal of Systematic Biology 1 (1): 2731.
. 1942. Notes on various peregrine earthworms. Bulletin of the Museum of Comparative Zoology,
Harvard 89 (3): 61–144.
––––––1958. On some species of the oriental earthworm genus Pheretima Kinberg, 1867, with key to species
reported from the Americas. American Museum Novitates 1888: 1–30.
––––––1972. Burmese Earthworms, an introduction to the systematics and biology of Megadrile oligochaetes
with special reference to South-East Asia. Transactions of the American Philosophical Society
62 (7): 1–326.
––––––1982. Farewell to North American megadriles. Megadrilogica 4: 12–80.
 D. 2007. Response to ‘Disease in African night crawler — Eudrilus eugeniae’ thread. Annelida
Bulletin board. (http://www.bio.net/hypermail/annelida/2007-March/002721.html; accessed
26/11/2013).
 J. 2011. Seychelles Fauna Monographs
 O. 1981. Preliminary experiments on vermicomposting of different waste materials using Eudrilus
eugeniae (Kinberg). In: Applehof, M., ed., Workshops on the role of earthworms in the stabilization
of organic residues. Kalamazoo, MI: Beech Leaf Press, pp. 179–191.
––––––1982. Vergleich der Regenswurmaten Eisenia foetida und Eudrilus eugeniae Hinsichlich Ihrer
Eignung zur Proteinwinnung aus Abfallstoffen. Pedobiologia 23: 277–282.
&, F. 2000. Handbook on Ingredients for Aquaculture Feeds. London:
Kluwer Academic Publishers.
 R. 1887. Description of Vermes. Notes from the Leyden Museum 9: 248– 291.
Eudrilus. Memoires de la Societe
Zoologique Francaise 3: 223– 240.
546 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
W. 1904. Index Faunae Novae Zealandiae. London: Bulau & Co.
 2014. Indonesian internet mart selling ANC. (http://www.indonetwork.net/tradeoffers/15/
lumbricus.html; accessed 17/11/2014).
&, K. 1991. Time and space relative population growth of Eudrilus eugeniae. In: Veeresh,
G.K., Rajagopal, D. & Viraktamath, C.A., eds, Advances in Management and Conservation of
Soil Fauna. New Delhi: Oxford and IBH, pp. 657– 664.
&
    Soil Biology
and Biochemistry 24: 1317– 1320.
&  N.S. 1993. Utilization of earthworms in recycling of household refuse — a case
study in biogas slurry utilization. New Delhi: CORT.
.H. 1867. Annulata nova. Öfersigt af Kungliga Svenska Vetenskaps-Akademiens Förhand-
lingar 1866, Stockholm (1867) 23 (4): 97–103. (http://www.biodiversitylibrary.org/
item/100619#page/105/mode/1up; accessed 25/07/2015).
 K.E. 1959. The Earthworm Fauna of New Zealand. Bulletin 130. Wellington: New Zealand Department

––––––1985. Earthworms — Their Ecology and Relationships with Soils and Land Use. Sydney: Academic
Press.
     . 2010. Earthworms helping economy, improving ecology and protecting health.
International Journal of Global Issues 10 (3– 4): 354–365.
&. The potential reuse of soybean husk as feedstock of Eudrilus
eugeniae in vermicomposting. Journal of the Science of Food and Agriculture 91 (14): 2637– 2642.
& , S. 2011. External morphological comparison, taxonomic
revision and molecular differentiation of the four economically important species of earthworms
in Thailand. International Journal of Agriculture & Biology 13 (4): 553–558.
 14. Vermiculture website. (http://www.lombricultura.cl/index.php; http://www.
lombricultura.cl/index.php?id=240; accessed 17/11/2014).
 D.S. 1969. Field and laboratory studies on the activities of two species of tropical earthworms.
Pedobiologia 9: 188– 214.
. 2010. The determination of protein and certain essential elements in earthworms Eudrilus
eugeniae fed with different kinds of organic litters. MSc thesis, Suranaree University of Technology,
Thailand. (http://www.sutir.sut.ac.th:8080/sutir/bitstream/123456789/4211/2/Fulltext.pdf;
accessed 17/11/2014).
&, V.K. 2010a. Pharmaceutical signicance of earthworm, Eudrilus eugeniae.
Germany: Lambert Academic Publishers.
& V.K. 2010b. Antimicrobial
activity of earthworm extracts. Journal of Chemical and Pharmaceutical Research 2 (4): 364–370.
       
Eudrilus eugeniae (Kinberg). Zeitschrift für Panzenernährung und Bodenkunde 141: 453–68.
  &  90. Development of Porrocaecum ensicaudatum (Nematoda:
Ascaridoidea) in terrestrial oligochaetes. Canadian Journal of Zoology 68 (7): 1476– 1483.
& 2011. Vermiculture in Egypt: Current Development and Future Potential. Cairo:
FAO/UN.
  &, P. 2009. Assessment of genetic variability among strains of
earthworm Eudrilus eugeniae     Karnataka Journal of
Agricultural Science 22 (5): 942– 945.
 W. 1892. Terricolen der Berliner Zoologischen Sammlung, II. Archiv für Naturgeschiechte,
Berlin 58: 209– 261.
––––––1900. Das Tierreich Vol. 10: Vermes, Oligochaeta. Berlin: Friedländer & Sohn.
––––––1903. Die geographische Verbreitung der Oligochaeten. Berlin: Friedlander & Sohn. (http://www.
biodiversitylibrary.org/bibliography/11667#/summary; accessed 18/11/2013).
––––––1910. Oligochaeta für 1908. Archiv für Naturgeschichte, Berlin 75 (2): 1–10. (https://archive.org/
details/archivfrnaturg7503berl; accessed 18/11/2013).
––––––1913. Oligochäten vom tropischen und südlich-subtropischen Africa. Zoologica 68: 1–69. (http://
bionames.org/references/f72d74f2e34abdca7e413f317f09993a; accessed 18/11/2013).
––––––1922. Die Verbreitung der Oligochäten im lichte der Wegenerischen Theorie der Kontinenten-
Verschiebung und andere fragen zur Stammesgeschischte und Verbreitung dieser Tiergruppe.
Verhandelingen des Vereins für Naturwissenschaftliche Unterhaltung zu Hamburg 29 (3): 45–79.
2014. Monographias.com website. http://
shtml; accessed 17/11/2014).
&, J. 2008. Changes in density of nematodes, protozoa and total coliforms after
transit through the gut of four epigeic earthworms (Oligochaeta). Applied Soil Ecology 39: 127–132.
BLAKEMORE: EUDRILUS EUGENIAE 547
&,
K.L. 2004. Vermicomposting: Recycling Wastes into Valuable Organic Fertilizer. Report No. 8.
Andhra Pradesh, India: ICRISAT.
&, R. 1979. Life history of the earthworm Eudrilus eugeniae.
Revue d’Ecologie et Biologie du Sol 16: 525– 534.
&. 1988. The potential of earthworms for managing sewage
sludge. In: Edwards, C.A. & Neuhauser, E.F., eds, Earthworms in Waste and Environmental
Management. The Hague: SPB Academic Publishing, pp. 9–20.

 &    
     Eudrilus eugeniae and Pontoscolex corethrurus and its
antimicrobial potency. Asian Journal of Pharmaceutical and Clinical Research 7 (1): 177– 182.
&. 2011. Effect of Vitamin A on regeneration capacity of both anterior and posterior
region of Eudrilus eugeniae. Indian Journal of Environment & Ecoplanning 18 (2–3): 309 –314.
. Aging of pressmud vermicast of Lampito mauritii (Kinberg) and Eudrilus eugeniae
(Kinberg) – reduction in microbial population and activity. Journal of Environmental Biology
27 (2): 221–223.
––––––2007. Life cycle of Lampito mauritii (Kinberg) in comparison with Eudrilus eugeniae (Kinberg)
cultured on different substrates. Journal of Environmental Biology 28 (4): 803–812.
&, L.S. 2000. Aging effect on enzyme activities in pressmud vermicasts
of Lampito mauritii (Kinberg) and Eudrilus eugeniae (Kinberg). Biology and Fertility of Soils
30: 347– 350.
&V. 2012. Remediation of heavy metals from urban waste by vermicomposting
using earthworms: Eudrilus eugeniae, Eisenia fetida and Perionyx excavatus. International
Journal of Environmental Waste Management 10 (2–3): 284– 296.
Perrier, E. 1871. Description of Eudrilus and Eu. decipiens. Les Comptes Rendus de l’Académie des sciences,
Paris 73: 1175–76.
––––––1872. Recherches pour servir à l’histoire des lombriciens terrestres. Nouveaux Archives du Muséum
National d’Histoire Naturelle, Paris 8: 5–198.
 J.D. 2010. Megadrile earthworm taxa introduced to South African soils (Oligochaeta: Acanthodrilidae,
Eudrilidae, Glossoscolecidae, Lumbricidae, Megascolecidae, Ocnerodrilidae). African
Invertebrates 51 (2): 289– 312.
 .O. 1978. Thelastoma endoscolicum sp. n. (Oxyirida: Nematoda) a parasite of earthworms
(Oligochaeta: Annelida). Proceedings of the Helminthological Society of Washington 45: 92–96.
&
fertilizer applied in lowland rice. The Threshold VI (Jan–Dec): 66–75. (http://www.eisrjc.com/

pdf; accessed 18/11/2013).
&, S.D. 2007. Comparative studies on the levels of vitamins
during vermicomposting of fruit wastes by Eudrilus eugeniae and Eisenia fetida. Applied Ecology
and Environmental Research 5 (1): 57–61.
 & , S.A. 1988. Reproduction of the African earthworm, Eudrilus eugeniae
(Oligochaeta) — cocoons. Biology and Fertility of Soils 7: 23– 27. (http://link.springer.com/
article/10.1007%2FBF00260727#page-1; accessed 26/11/2013).
––––––1993. Effects of worm density on growth and cocoon production of the African Nightcrawler Eudrilus
eugeniae (Oligochaeta). European Journal of Soil Biology 29: 29–34.
   & , R.J. 1992. The suitability of Eudrilus eugeniae, Perionyx
excavatus and Eisenia fetida (Oligochaeta) for vermicomposting in southern Africa in terms of
Soil Biology & Biochemistry 24 (12): 1295– 1307.

Caribbean Journal of Science 35 (1–2): 155–158. (http://
academic.uprm.edu/publications/cjs/Vol35a/p.155-158.pdf; accessed 26/11/2013).
, J.R. 1983. Earthworms as a source of food and drugs. In: Satchell, J.E., ed., Earthworm Ecology,
London: Chapman and Hall, pp. 285– 296.
&. 2013. Vermicompost production by using tomato residue and yard waste. Journal of
Medical and Bioengineering 2 (4): 270– 273.
 M. 2009. Biotic potential of Eisenia fetida (‘Californian’ red earthworm) (Oligochaeta,
Lumbricidae) and Eudrilus eugeniae (African night crawler) (Oligochaeta, Eudrilidae). Species of
vermicomposting importance. Estrucplan On Line (www.estrucplan.com.ar/Articulos/verarticulo.
asp?IDArticulo=2141; accessed 18/11/2013).
 1977. Eudrilin earthworms, including a new genus, from eastern Nigeria. Proceedings of the
Biological Society, Washington 90 (2): 255–262.
548 AFRICAN INVERTEBRATES, VOL. 56 (3), 2015
&  C.A. 2014. Sustainable reuse of rice residues as feedstocks in
vermicomposting for organic fertilizer production. Environmental Science and Pollution Research
21(2): 1249– 1359.
    &, T.R. 2011a. Cloning
     Indian Journal of
Biotechnology 10: 270– 273.
––––––2011b. Analysis of genetic diversity in earthworms using DNA markers. Zoological Science 28: 25–31.
& R.D. 2008. Invitro studies on control of soil-borne plant pathogens by earthworm
Eudrilus eugeniae exudates. Green Pages, 2008. (http://www.eco-web.com/edi/080106.html;
accessed 26/11/2013).
 1964. Internal fertilization and the functional relationship of the female and spermathecal systems
in new earthworms from Ghana. Proceedings of the Zoological Society of London 143: 587–608.
––––––1965. Acanthodrilidae and Eudrilidae (Oligochaeta) from Ghana. Bulletin of the British Museum
(Natural History) Zoology 12(8): 283– 311. (http://biostor.org/reference/4951.pdf; accessed
26/11/2013).
––––––1987. Review of the central African family Eudrilidae (Oligochaeta). In: Pagliai, A.M.B. & Omodeo,
P., eds, On Earthworms: Selected Symposia and Monographs, No. 2, Mucchi, Modena: Unione
Zoolo-gica Italiana, pp. 359– 388.
&
Synopsis of the British Fauna (New series). No. 31. Leiden: E.J. Brill.
––––––1999. Earthworms: Notes for the identication of British species. 4th edition. Montford Bridge,
Shrewsbury: Field Studies Council.
. 1992. Mbanema nigeriense n. gen., n. sp. (Drilonematidae: Nematoda) from Eudrilus
eugeniae (Eudrilidae: Oligochaeta) in Nigeria. Fundamentals of Applied Nematology 15 (5):
443– 447.
 &  S. 2013. Screening of earthworm (Eudrilus
eugeniae) gut as a transient microbial habitat. Advances in Zoology and Botany 1 (3): 53– 56.
 J. 1923. The fauna of British India, including Ceylon and Burma. Oligochaeta. London: Taylor
& Francis. (http://www.archive.org/stream/FBIOligochaeta/oligochaeta#page/n7/mode/2up;
accessed 18/11/2013).
––––––1930. The Oligochaeta. Cambridge: Clarendon Press.
        &     
Lactobacillus sporogenes, and essential microbes supplementation on regeneration of Eudrilus
eugeniae Kinberg. Advances in Applied Science Research 5 (3): 226–229.
   & P. 2011. Technical support from Czech
Govern ment to aquaculture in mountain areas of Vietnam
1. (http://www.ria1.org/ria1/Defaults.aspx?ctl =newsdetail&LangID=2&p=&aID=275&stID=356;
accessed: 17/11/2014).
M. 1922. The Naturalisation of Animals and Plants in New Zealand. Cambridge: Cambridge
University Press.
& E. 1988. The hormone-like effects of earthworm casts on plant growth.
Biology and Fertility of Soils 5: 288– 294.
. Beitrage zur Kenntnis auslanderischer Regenwurmer. Zeitshrift fur Wissenschaftlishe Zoologie
57: 57– 75.
& A.J.A. 2013a. Antimicrobial activity of earthworm (Eudrilus
eugeniae) paste. African Journal of Environmental Science and Technology 7 (8): 789– 793.
&.A. 2013b
on growth and reproduction of earthworms Eudrilus eugeniae. International Journal of Current
Microbial and Applied Sciences 2 (7): 202–206.
&, G.
2012. Morphological and histological studies on the vermicomposting Indian earthworm Eudrilus
eugeniae. World Journal of Zoology 7 (2): 165–170.
&. 1989. Life-cycle of the African nightcrawler, Eudrilus eugeniae (Oligochaeta).
South African Journal of Zoology 24: 27–32.
Eudrilus eugeniae (Oligochaeta)
— A laboratory study. Soil Biology & Biochemistry 24 (12): 1345–1350.
––––––1994. The life cycle and reproduction of Eudrilus eugeniae under controlled environmental conditions.
Mitteilungen aus dem Hamburgischen Zoologischen Museum und Institut 89: 149–157.
... A E. eugeniae, conhecida popularmente como a "gigante Africana", é uma espécie de minhoca da família Eudrilidae originária do Oeste da África, mas que se encontra em solos naturais de diversos países tropicais (Blakemore, 2015). Não obstante, longe de seu local de origem, tende a ser encontrada mais comumente em minhocários comerciais do que no solo, devido à sua adaptação à criação com fontes de matéria orgânica (especialmente esterco), onde é usada frequentemente para geração de isca para a pesca (Domínguez et al., 2001;James;Guimarães, 2010 (Blakemore, 2015). ...
... A E. eugeniae, conhecida popularmente como a "gigante Africana", é uma espécie de minhoca da família Eudrilidae originária do Oeste da África, mas que se encontra em solos naturais de diversos países tropicais (Blakemore, 2015). Não obstante, longe de seu local de origem, tende a ser encontrada mais comumente em minhocários comerciais do que no solo, devido à sua adaptação à criação com fontes de matéria orgânica (especialmente esterco), onde é usada frequentemente para geração de isca para a pesca (Domínguez et al., 2001;James;Guimarães, 2010 (Blakemore, 2015). Próstatas Presentes e grandes (até 8 mm); ductos curtos e musculares espécie é a presença de grandes próstatas (até 0,8 cm), e um complexo sistema reprodutor, incomum em outras espécies de minhocas (Blakemore, 2015). ...
... Não obstante, longe de seu local de origem, tende a ser encontrada mais comumente em minhocários comerciais do que no solo, devido à sua adaptação à criação com fontes de matéria orgânica (especialmente esterco), onde é usada frequentemente para geração de isca para a pesca (Domínguez et al., 2001;James;Guimarães, 2010 (Blakemore, 2015). Próstatas Presentes e grandes (até 8 mm); ductos curtos e musculares espécie é a presença de grandes próstatas (até 0,8 cm), e um complexo sistema reprodutor, incomum em outras espécies de minhocas (Blakemore, 2015). A reprodução de E. eugeniae é biparental, e seu ciclo de vida se realiza em 58 a 67 dias (Figura 4.8), e sua expectativa de vida oscila entre 1 e 3 anos. ...
... Nevertheless, Eudrilus eugeniae (Kinderg, 1867), a largesized earthworm found in organically rich substrates, is abundant in savannahs, fields and refuse disposal sites of the Adamawa region of northern Cameroon (personal observation). Originating from Africa, it is a top soil species of the family Eudrilidae, and is widely distributed in West and Central Africa (Lee 1985;Blakemore 2015). ...
... Despite its wide distribution in the tropics and renewed focus in the scientific literature , seldom verified molecular data are available for this seemingly important earthworm species. To date, Blakemore (2015), which elevates E. eugenia to "iconic vermicomposter" status, remains the most important contribution to the eco-taxonomic description and molecular identification of this species. The application of the DNA barcode approach of Hebert et al. (2003) for earthworm species identification is currently among the most used molecular taxonomy approaches. ...
... Sequences MN587121 to MN587125 (generated in the present study) matched with previously identified E. eugeniae of Blakemore (2015) and from Gupta et al. (unpublished) and Yadav et al. (unpublished) with K2P distances lower or equal to 2.82% (Fig. 2). The genetic distances (%) between the 5 sequences generated in this study and published E. eugeniae sequences from Blakemore (2015), were within the interval of [1-2%] ( Table 2). This was far below the ambiguous interval of (9-15%) delimited by Chang and James (2011). ...
Article
Full-text available
The ingestion of organic and mineral materials by earthworms is a prominent functional role that has profound consequences for the decomposition and stabilization of soil organic matter. To investigate the litter consumption of the African nightcrawler earthworm Eudrilus eugeniae (Kinberg, 1867) under different tropical conditions, (i) we used DNA barcoding to identify specimens of E. eugeniae collected from sites across the Adamawa region in Cameroon, and (ii) studied the influence of habitat suitability (soil properties), soil moisture, litter type and population density on litter consumption. A total of four litter consumption experiments were carried out using soils collected from refuse disposal sites, agricultural lands and savannahs dominated by the Mexican sunflower Tithonia diversifolia (Hemsl). The results revealed that litter consumption significantly increased in the refuse disposal and agricultural soils as opposed to the Mexican sunflower (T. diversifolia) soil, a cow dung enriched substrate and a sterile soil horizon from the savannah (P < 0.05). The optimum moistures for litter consumption were between 24 and 50%. Litter type did not affect the consumption rate of the earthworms (P > 0.05). We observed a general positive density dependent consumption with litter mass loss increasing with increasing density. Our results suggest that E. eugeniae has a strong direct effect on the decomposition of plant materials than expected from previous estimations, and that litter consumption rates are determined by several habitat components and population density.
... Despite depletion, biota-supporting topsoil is yet key for regulation of atmospheric gases (e.g., CO2, N2O, CH4- [38,41]), it underpins primary production plus its humus is the interface of adsorption/retention/rehabilitation of pollutants, such as heavy metals and pesticides. It supplies sustenance and medicines (as indeed do earthworms- [42]). Due to this dependency, importance, and urgency, one would think that the status of soil is well worked out as a major concern. ...
... Despite depletion, biota-supporting topsoil is yet key for regulation of atmospheric gases (e.g., CO 2 , N 2 O, CH 4 - [38,41]), it underpins primary production plus its humus is the interface of adsorption/retention/rehabilitation of pollutants, such as heavy metals and pesticides. It supplies sustenance and medicines (as indeed do earthworms- [42]). Due to this dependency, importance, and urgency, one would think that the status of soil is well worked out as a major concern. ...
... African nightcrawler (Eudrilus eugeniae) is a remarkably versatile vermicomposting species of the tropics (Blakemore, 2015) . Under Philippine conditions, this earthworm species has been efficient for vermicomposting (PCAARRD, 2014). ...
Article
Full-text available
Vermicomposting is a simple biotechnological procedure to produce excreta of earthworms called vermicompost. Vermicompost contains a high concentration of nutrients that are capable of improving soil health and quality. However, the complexity of interacting factors that affect vermicomposting is not yet fully understood. A study laid out in a completely randomized design was conducted to identify the effects of different loading schemes of mixed shredded leaves (SL) and poultry manure (PM) to vermicompost recovery and chemical properties using the Eudrilus eugeniae, a litter-dwelling species of earthworm which can consume and mix a large amount of soil and organic matter (OM) and convert it into fertile casts. Results showed the improved chemical properties of vermicomposts such as pH, organic matter (OM), available N, available P, and exchangeable K. A significant difference was also observed in pH, N, P, and K. The frequent loading that causes a sudden rise in pile temperature increased the mortality of earthworms affecting vermicompost recovery. Overall, the recovery was still high from all treatments based on the capability of the initial number of earthworms placed in each vermicomposting container to produce vermicompost.
... It is widely used as fish baits; also they are reared on animal waste to convert organic waste and used as animal feed. Being an epigeic species, E. euginae encounters a wide array of pesticides in its natural environment (Dominguez et al. 2001;Blakemore 2015). In this study, we aim to catalogue the response of E. euginae and its gut microbiome to an increasing concentration of CPF. ...
Article
Full-text available
The earthworms are important soil invertebrates and play a crucial role in pedogenesis. The application of pesticides and prolonged exposure to pesticides causes mortality of earthworms apart from profoundly affecting the resident gut microbiome. The microbiome plays a significant effect on the metabolic processes associated with earthworms. The pesticide Chlorpyrifos (CPF) was studied for its toxicity on Eudrilus euginae by toxicity studies. The LC50 value of filter paper contact test and acute toxicity test was 3.8 mg/mL and 180 mg/kg. The prolonged exposure of earthworms to pesticide on reproductive toxicity resulted in the mortality of earthworms and absence of cocoon formation. Further, the effects of CPF on the whole gut microbiome of E. euginae was analyzed using a long amplicon Nanopore sequencing. Results indicated no fluctuations with Firmicutes and Bacteroidetes, that were found to be dominant at bacterial phyla level while at the genus level, remarkable differences were noticed. Clostridium dominated the earthworm gut prior to CPF exposure while Bacillus dominated after exposure. Similarly, the fungal members such as Ascomycota and Basidiomycota were observed to dominate the gut of earthworm at the phyla level before and after exposure to CPF. In contrast, Clavispora (65%) was the dominant genus before CPF exposure and Taloromyces (42%) dominated after the CPF exposure. Our study demonstrates the effect of CPF on the mortality of E. euginae while the amplicon sequencing established the unique microbiome of the gut in response to the CPF exposure. Graphic abstract
... Thus, E. eugeniae can survive in high environmental variations. It makes this species to co-exist in a polyculture unit with another species (Blakemore 2015). In a natural environment, when this species co-exists with other species, due to their mutual interaction, the overpopulation is checked, and thus, polyculture has an influence on the population dynamics of this species during vermicomposting (Kammenga et al. 2003). ...
Article
Full-text available
Parthenium hysterophorus is considered one of the most noxious terrestrial weeds which needs to be efficiently managed to sustain the environment and vermicomposting are a promising eco-friendly management technique. In the current study, vermicomposting of P. hysterophorus was carried out using a polyculture of two epigeic earthworm species, i.e., Eisenia fetida and Eudrilus eugeniae employed in five different vermireactors referred as Rp1, Rp2, Rp3, Rp4, and Rp5 with five mixing ratios 3:7, 4:6, 5:5, 6:4, and 7:3 respectively of P. hysterophorus to cow dung as a blending material. The nutrients in the final vermicompost were determined by analyzing different physico-chemical parameters and the efficiency evaluated by the growth rate of earthworms. After vermicomposting, TKN, TP, and K contents increased with the highest percentage change of 74.74%, 91%, and 47.2% respectively, compared to initial values. Reduction in C/N ratio was observed in all the vermireactors with the lowest C/N ratio of 9.76. EC increased for all the vermireactors during the process and reached in the range of 3.7–3.85 ds/m at the end of the process. The highest percentage gain in biomass of earthworms was 46.25% in Rp2. Vermicomposting of P. hysterophorus is possible for the management of this invasive weed through polyculture of the earthworms E. fetida and E. eugeniae to obtain a value-added organic fertilizer, i.e., vermicompost by a sustainable process.
... Cacing diletakkan di atas media dan akan masuk dengan sendirinya apabila media hidup tersebut cocok untuk hidup cacing (Susetyarini, 2007). Ciri fisik E. Eugeniae yaitu tubuhnya berwarna merah kecoklatan memudar, panjang tubuh 90-185 mm dengan lebar 4-8 mm, berat optimal 5-6 g dan secara taksonomi masuk dalam klasifikasi (Blakemore, 2015): ...
Article
Penambahan pupuk organik seperti vermikompos dapat dilakukan untuk mengatasi masalah kekurangan bahan organik tanah. Salah satu spesies cacing tanah yang biasa digunakan dalam vermicomposting adalah Eudrilus eugeniae. Penelitian ini bertujuan mengetahui pengaruh kombinasi antara kotoran sapi dan jerami padi terhadap kualitas vermikompos dari kandungan C-organik, N, P, K total dan aktivitas enzim urease serta produksi vermikompos yang dihasilkan. Penelitian ini menggunakan rancangan acak lengkap (RAL) dengan 4 perlakuan. Perlakuan berupa P1: pakan 400 g kotoran sapi, P2: pakan 400 g jerami padi, P3: pakan 280 g kotoran sapi dan 120 g jerami padi, dan P4: pakan 140 g kotoran sapi dan 60 g jerami padi. Hasil penelitian menunjukkan perlakuan secara nyata mempengaruhi semua parameter pada vermikompos yang dihasilkan. Hasil produksi ditentukan berdasarkan nilai nisbah output/input (O/I). Kualitas dan produksi vermikompos pada P4 merupakan perlakuan yang memiliki hasil terbaik. Hal ini dikarenakan pencampuran kombinasi kotoran sapi dan jerami padi memberikan hasil makro nutrisi yang relatif lengkap serta dosis pemberian pakan yang lebih tinggi akan memberikan hasil produksi vermikompos yang lebih tinggi. Kata kunci: bahan organik, enzim urease, jerami padi, kotoran sapi
Thesis
Full-text available
The extremely difficult and challenging process is identifying pheretimoid species, genus Metaphire and Amynthas involving increased homoplasy in various morphological characteristics. The molecular identification, phylogenetic relationships, and evolutionary divergence time of earthworms belonging to the pheretimoid complex were investigated in this study using partial mitochondrial COI (cytochrome C oxidase subunit I) gene sequences ranging from 550-680 bp. Results revealed that 86 pheretimoid earthworms were morphologically different from a total of 342 mature worms. Moreover, 11 pheretimoid species were molecularly identified, including Metaphire posthuma (02), M. anomala (01), M. houlleti (02), M. californica (01), M. birmanica (02), Amynthas minimus (01), A. morrisi (01), and M. bununa (01). A phylogenetic tree was constructed with bootstrap values of 95%, which supported a monophyletic lineage of two well-supported clades formed by 12 partial COI sequences and 48 GenBank sequences using Hirudo medicinalis as an outgroup. The monophyly of these obtained genera indicated overall similarity at species level. Today, species like Amynthas, Metaphire and Pheretima have worm diversity in the form of pheretimoid earthworms, which dates to the Late Miocene (11.2-5.3 Mya) and the Pliocene (5.3-2.4 Mya). Compared to all relevant pheretimoid species, genetic p-distance values ranged from 0.0% to 0.57% (less than 1%). These low range values demonstrated that both genera Metaphire and Amynthas, supported the theory, which states that there are shared similarities among the species, despite different morphology. The current study is the first attempt in Pakistan to identify earthworms through DNA barcoding thus providing a genomic stamp. The work explored the significance of COI gene sequences to construct molecular tools that will be useful to overcome the different obstacles in morphologically similar earthworm identification and their phylogenetic study.
Article
Detergent fiber analysis was used to fractionate carbon (C) into hemicellulose (degradable carbon) and cellulose and lignin (recalcitrant carbon) for cattle manure (CM), neem leaves (NL), corn stover (CS), and lawn clipping (LC) to investigate the effects of C quality on vermicomposting. A factorial design having five C sources (CM, CM + NL, CS, CS + NL, and LC) and two earthworm species (Eudrilus eugeniae (EE) and Omodeoscolex divergens (OD)) was studied under pure and mixed culture vermicomposting. Earthworm fecundity, biomass, and vermicompost quality were measured. The combination of culture and C source was significant (p < 0.05) for all fecundity and biomass variables. CM and CM + NL were mainly associated with increased responses. Change in population was > tenfold for EE and OD reared on CM. Percentage change in biomass increased up to 200% for OD and EE when fed CM and CM + NL. Contrastingly, decreases or no changes in fecundity and biomass parameters were associated with CS and CS + NL. The NL combinations resulted in lower responses in fecundity and biomass; however, earthworms favored CM + NL over CS + NL. OD was highest (p < 0.05) amongst cultures for LC. The mixed culture response was generally low for parameters measured. Vermicompost C/N ratio decreased from initial carbon source values except for LC. O. divergens vermi-converted carbon sources of varying C quality, producing distinct vermicompost in the process.
Article
Full-text available
The first earthworm species named was Lumbricus terrestris Linnaeus, 1758. Since then, there were some 6000 earthworm (Oligochaeta: Megadrili) species names described, from which ca. 3000-3500 are valid. In order to help the orientation in such a huge amount of data a web-based database was created. Each record contains the basic data of the species names described; i.e. family, genus, specific epithet, author, year, reference to the original description and optionally the valid combination of the species name and deposition of type specimens. The database is searchable by every field mentioned and the resulted list can be arranged alphabetically.
Article
Full-text available
Nanotechnology is also referred to the ability for designing, characterization, production and application of structures. An increasingly common application is the use of silver nanoparticles and nanofibers for antimicrobial coatings, wound dressings, and biomedical devices. In this recent world earthworms are showing the excellent scale in the medical field. In this present paper, we have collected Eudrilus eugeniae, and Pontoscolex corethrurus to harvest the coelomic fluid from the earthworm for the synthesis of silver nanopaticles and nanofibers. Nanofibers are synthesized using human collagen and poly lactic acid. Coelomic fluid and Ag NPS was investigated for antibacterial activity and haemolytic activity. Haemolytic activity of Eudrilus eugeniae was observed even in low quantity of coelomic fluid and haemolysis was observed for Pontoscolex corethrurus only in high quantity of fluid. The antimicrobial activity was found high in all types of earthworms. But nanoparticles from coelomic fluid showed higher activity than the coelomic fluid. Nanofibres from coelomic fluid does not showed any bioactivity against pathogens. Ag NPS was confirmed by the colour reduced to form brown and by UV-visible spectrum in the range of 400 to 430nm. Protein profile was investigated by the SDS-PAGE and the molecular weight was determined as 200KDa. From this study we conclude that the coelomic fluid from earthworm can be used as therapeutic agent.
Article
Eudrilus eugeniae were kept at 25°C in cattle manure at a moisture content of 80%. Worms tend to be smaller and produce fewer cocoons at higher densities in spite of the fact that ample food is provided. -from Authors
Article
George Thomson (1848–1933) was born in Calcutta, grew up in Scotland and emigrated to New Zealand at 20. He settled there, working as a teacher and analytical chemist, and was eventually elected to the House of Representatives in 1908. Thomson had an interest in natural history, but he was especially fascinated by the biological battles between native species of plants and animals and more recent arrivals. Realising New Zealand's unique advantage in having written records about the introduction of new species from the period of Captain Cook's second voyage in 1773 onwards, Thomson was able to trace the origins and spread of many plants and animals. This study, published in 1922, notes their locations and dates, and includes lists of foreign species officially designated as pests. It is a comprehensive guide to the non-native flora and fauna of New Zealand, providing valuable information about the country's ecological history.
Article
Four economically important species of earthworm were cultured and the external and internal characters of adult clitellate earthworms were studied. Partial sequences for ribosomal 16S rDNA and subunit one for mitochondrial cytochrome c oxidase (COI) of four earthworm species were obtained. The result of sequence analysis combined with taxonomic characters could distinguish the different species of earthworm. Morphology and nucleotide sequence of two genes for the red worm (Pheretima peguana) were distinct from Eudrilus eugeniae but were similar to the blue worm (Perionyx excavatus) and Lao worm (P. excavates) and therefore, it was classified as a new species, Perionyx sp. 1. Moreover, Eudrilus eugeniae was evidently defined as the same genus and species. Interestingly, the blue worm and Lao worm were morphologically similar to Perionyx sp. However, the molecular data of 16S rDNA could not differentiate in taxa of those two species. COI nucleotide sequence analyses showed the presence of divergent lineages between two species, suggesting the blue worm and Lao worm could be described as Perionyx sp. 2 and Perionyx sp. 3, respectively.