Content uploaded by Raúl A. Poutou-Piñales
Author content
All content in this area was uploaded by Raúl A. Poutou-Piñales on Dec 10, 2015
Content may be subject to copyright.
African Journal of Microbiology Research Vol. 5(13) pp. 1586-1598, 4 July 2011
Available online http://www.academicjournals.org/ajmr
ISSN 1996-0808 ©2011 Academic Journals
Full Length Research Paper
Enterobacterial repetitive intergenic consensus-
polymerase chain reaction (ERIC-PCR) fingerprinting
reveals intra-serotype variations among circulating
Listeria monocytogenes strains
Zulema Ruiz-Bolivar1, Ana K. Carrascal-Camacho1, Magda C. Neuque-Rico1, Carolina
Gutiérrez-Triviño2, María X. Rodríguez-Bocanegra2, Raúl A. Poutou-Piñales3* and Salim
Mattar4
1Laboratorio de Microbiología de Alimentos, Facultad de Ciencias, Pontificia Universidad Javeriana, Bogotá, D.C.
Colombia.
2Unidad de Investigaciones Agropecuarias (UNIDIA), Departamento de Microbiología, Facultad de Ciencias, Pontificia
Universidad Javeriana, Bogotá, D.C. Colombia.
3Laboratorio de Biotecnología Aplicada Grupo de Biotecnología Ambiental e Industrial (GBAI), Facultad de Ciencias.
Pontificia Universidad Javeriana, Bogotá, D.C. Colombia.
4Instituto de Investigaciones Biológicas del Trópico (IIBT), Facultad de Medicina Veterinaria, Universidad de Córdoba,
Montería. Colombia.
Accepted 19 May, 2011
Forty-five presumptive Listeria monocytogenes isolates were confirmed by multiplex polymerase chain
reaction (PCR) and characterized for antimicrobial susceptibility and tolerance to commonly used
disinfectants. Isolates were also serotyped by PCR and characterized by enterobacterial repetitive
intergenic consensus ERIC-PCR fingerprinting. All of the isolates showed PCR products of 938 bp
(genus) and of 750 bp (species). Antimicrobial susceptibility was 100% for ampicillin, amoxicillin/
clavulanic acid, vancomycin and chloramphenicol, whereas for trimethoprim/ sulfamethoxazole it was
98, azithromycin 96, erythromycin 91, tetracycline 82, penicillin 97.8 (2.2% no susceptible), ciprofloxacin
84.4, rifampin 64.4, meropenem 71.1 and clindamycin 22.2%, respectively. All the isolates were resistant
to cephalosporins. 71% of the isolates showed a MIC 200 ppm/10 to15 min for sodium hypochlorite
and 98% a MIC 1.5%/2 to15 min for Tego-51. 58% of isolates were serotyped as 4b/4d/4e, 16% as
½b/3b, 7% as ½a/3a, and 4% as ½c/3c. ERIC-PCR showed 28 polymorphic bands ranging from 100 to
2810 bp that did not cluster according to any phenotype. ERIC-PCR fingerprinting revealed intra-
serotypic variations and proved that different L. monocytogenes strains were circulating in the country
during the isolation period.
Key words: Listeria monocytogenes, molecular serotyping, antimicrobial susceptibility, disinfectant tolerance,
enterobacterial repetitive intergenic consensus- polymerase chain reaction (ERIC-PCR).
INTRODUCTION
Genus Listeria includes eight species (Orsi et al., 2011):
Listeria monocytogene, Listeria ivanovii, Listeria innocua,
Listeria welshimeri, Listeria seeligeri, Listeria grayi and
two new species recently reported named Listeria marthii
*Corresponding author. E-mail:
(Graves et al., 2010) and Listeria rocourtiae (Leclercq et
al., 2009). Only L. monocytogenes is a human and
animal pathogen, being the causal agent of listeriosis. In
humans the disease has two forms, the invasive one that
can affect the central nervous system (CNS) leading to
death or leaving neurological sequels, while the non-
invasive form of the illness causes gastrointestinal
syndrome. Listeriosis can occur in apparently healthy
people and there are risk groups such as infants,
pregnant women (Salazar et al., 2001), the elderly and
immunocompromised people (Torres et al., 2004); the
mortality rate within the risk groups is about 20 to 30%
(Korkeala and Siitonen, 2003).
The clinical forms of the disease vary according to the
susceptibility of the infected patient. The most common
manifestations are meningitis, meningo-encephalitis,
septicaemia, abortion, prenatal infection and
gastroenteritis (Torres et al., 2005). In sporadic outbreaks
and epidemics a wide variety of foods act as vehicles:
milk, cheese, pate, beef, pork, poultry meat, vegetables,
and seafood (Kells and Gilmour, 2004; Torres et al.,
2004).
Significant differences between the virulence of clinical
strains and foods depending on the serotypes have been
reported (Norrung and Andersen, 2000). Currently 13
serotypes of L. monocytogenes have been described;
however, three of them (½a, ½b and 4b) have been
isolated in more than 90% of the cases from human and
animal listerioses (Low et al., 1993; Torres et al., 2004;
Orsi et al., 2011). Serotypes such as ½c have been
frequently found contaminating food (Espaze et al., 1991;
Orsi et al., 2011).
Four evolutionary lineages with different but
overlapping ecological niches have been identified for L.
monocytogenes: group or division I which includes
serotypes ½b, 3b, 3c and 4b, commonly associated with
human clinical cases (Piffaretti et al., 1989, Orsi et al.,
2011), group or division II including serotypes ½a, ½c
and 3a commonly found in foods and widespread in farm
environments and responsible for causing animal
listeriosis and sporadic human clinical cases (Piffaretti et
al., 1989; Orsi et al., 2011), group or division III is smaller
and comprises serotypes 4a, 4b and 4c (Rasmussen et
al., 1995; Wiedmann et al., 1997) and a newly named
fourth group or division IV consisting of serotypes 4a,
atypical 4b and 4c. Members of lineages 3 and 4 are rare
and isolated predominantly from animals (Roberts et al.,
2006, Ward et al., 2008, Orsi et al., 2011).
Apparently there are geographical differences in the
overall distribution of serotypes; for instance, serotype 4b
predominates in Europe and serotypes ½a, ½b and 4b
predominate in Canada and the United States. It is
known that strains of serotype 4b were the source of
most outbreaks reported in Europe and North America
(Comi et al., 1992; Schmid et al., 2003; Torres et al.,
2004).
In Colombia there are few published studies on L.
monocytogenes typing (Medrano et al., 2006), either
molecular serotyping or conventional serotyping
(Vanegas-López and Martínez-León, 2008). A few other
publications have been made in which the serotype was
related to the type of food and there are few published
papers analyzing the antimicrobial susceptibility pattern
of Listeria spp. (Gallegos et al., 2008).
The purpose of our study was to detect any ERIC-PCR
fingerprint relationships among origin, serotype,
Ruiz-Bolivar et al. 1587
disinfectant tolerance and antimicrobial susceptibility of L.
monocytogenes from different cities of Colombia, and
hence make a contribution to the knowledge on the
behaviour and spread of this pathogen.
MATERIALS AND METHODS
Isolates
DNA of 45 presumptive L. monocytogenes isolates collected from
foods, humans and animals were used. Food isolates were from:
poultry (n=3; 6.6%) from Bogotá; 4 cheese isolates from Bogotá
and 7 from Pamplona (Colombia) (n=11; 24.4%); lettuce (n=5;
11.1%) from Funza; spinach (n=15; 33.3%) from Funza; 3 cow raw
milk isolates from Madrid (Colombia) and 2 from Bogotá (n=5;
11.1%). Human isolates (n= 5; 11.1%) were distributed as follows: 4
from Bogotá and 1 from Cali. Animal isolates (n=1; 2.2%) were from
Bogotá. All of them were stored at -70°C in fresh culture media
supplemented with 20% (v/v) of glycerol for cryopreservation (Meza
et al., 2004).
Genomic DNA purification, quantification and visualization
Biochemically presumptive L. monocytogenes isolates were
cultivated in BHI supplemented with 0.5% (w/v) glucose during 12 h
at 37°C and 250 rpm. One millilitre of culture was taken for DNA
purification using the Wizard Genomic DNA Purification Kit
(Promega). DNA purity and concentration were determined with a
Biospec 1601 Shimadzu spectrophotometer (λ260/λ280 nm) with
background correction set at λ320 nm (Sambrook and Russell,
2001).
L. monocytogenes PCR identification
Two sets of primers were employed: L1/U1 and LF/LR (Bansal,
1996; Poutou et al., 2005). The PCR final reaction volume was of
35 l, composed of 1X Green PCR buffer, 1.5 mM of MgCl2, 0.2
mM dNTPs, 20 pmol of primers and 2 µ of GoTaq Flexi DNA
polymerase (Promega). Five l of DNA were used for thermal
cycling. Cycling temperature was controlled in a C1000TM Thermal
Cycler (BioRad). Amplification cycles and temperatures are listed in
Table 1. L. monocytogenes (ATCC 19115) and L. innocua domestic
isolates (L5) were used as PCR controls.
Antimicrobial susceptibility test (AST)
For the antimicrobial susceptibility testing of isolates, a broth
microdilution technique (MicroScan system) was employed. A cell
suspension equivalent to 0.5 on the McFarland scale prepared in
Müeller-Hinton medium supplemented with lysed horse blood was
inoculated into the MICroSTREP plus 3 (SIEMENS) panel that
included penicillin (PEN), ampicillin (AM), cefotaxime (CFT),
cephradine (CFR), cefepime (CPE), chloramphenicol (C),
trimethoprim/sulfarnethoxazole (TMP/SMX), cefuroxime (CRM),
rifampin (RIF), meropenem (MER), amoxacillin/clavulanic acid
(AOX/CLAV), clindamycin (CD), tetracycline (TET), azithromycin
(AZI), erythromycin (E), vancomycin (VA), and ciprofloxacin (CP).
Panels were incubated following the manufacturer’s
recommendations. S. pneumoniae (ATCC 49619) was used as a
control for ASTs (Clinical and Laboratory Standards Institute, 2008).
Software Whonet 5.6 (2010) was used for descriptive statistical
analysis (Fasehun, 1999; Miranda et al., 2006b).
1588 Afr. J. Microbiol. Res.
Table 1. Sets of successive amplifications used for the taxonomic identification, the serotype detection and the molecular characterization of L. monocytogenes isolates.
Primer
set Forward sequence Reverse sequence Product
size (bp)
Thermocycling
conditions
hot start; (clycling details) number
of cycles; final elongation Specificity References
L1/U1∇ CTCCATAAAGGTGACCCT CAGCMGCCGCGGTAA TWC 938 Genus (16S rDNA)
LF/LR∇ CAAACGTTAACAACGCAGTA TCCAGAGTGATCGATGTTAA 750
95°C x 1´; (94°C x 30s, 51°C x
20s, 72°C x 30s) 40; 72°C x 8´ Species (hlyA)
(Bansal, 1996,
Poutou et al., 2005)
D1* CGATATTTTATCTACTTTGTCA TTGCTCCAAAGCAGGGCAT 214 95°C x 3´; (95°C x 30s; 59°C x
30s; 72°C x 1´) 25; 72°C x 10´
Division I or III
D2* GCGGAGAAAGCTATCGCA TTGTTCAAACATAGGG CTA 140 95°C x 3´; (95°C x 30s; 59°C x
30s; 72°C x 1´) 25; 72°C x 10´ Division II
FlaA* TTACTAGATCAAACTGCTCbC AAGAAAAGCCCCTCGTCC 538 95°C x 3´; (95°C x 30s, 54°C x
30s; 72°C x 1´) 25; 72°C x 10´ Serotypes 1/2a and
3a
GLT* AAAGTGAGTTCTTACGAGATTT
AATTAGGAAATCGACCTTCT 483 95°C x 3´; (95°C x 30s, 45°C x
30s; 72°C x 1´) 25; 72°C x 10´ Serotypes 1/2b and
3b
(Borucki and Call,
2003)
MAMA-C*
CAGTTGCAAGCGCTTGGAGT GTAAGTCTCCGAGGTTGCAA 268 95°C x 10´; (95°C x 30s, 55°C x
1´, 72°C x 1´) 40; 72°C x 10´ Serotypes 4a and 4c
(Rasmussen et al.,
1991, 1995;
Jinneman and Hill,
2001)
ERIC
1R/ERIC 2
♦
ATGTAAGCTCCTGGGGATTCAC
AAGTAAGTGACTGGG
GTGAGCG Several 95°C x 2´; (94ºC x 30s, 92ºC x
30s, 50ºC x 30s, 52ºC x 1´, 65ºC
x 8´) 35, 65° x 8´
Enterobacterial
Repetitive Intergenic
Consensus
(Jersek et al., 1999;
Chung-Hsi and
Chinling, 2006)
∇:1% (w/v) agarose gel in 1X TAE buffer (40 mM Tris-acetate, 1 mM EDTA pH 8.0 ± 0.2), 120 volts, 1h.*: 1.5% (w/v) agarose gel in 1X TAE buffer. ♦: 1% (w/v) agarose gel in 1X TAE buffer at 4volt/cm b:
The underlined nucleotide is a mismatch that was introduced by (Borucki and Call, 2003) to increase primer specificity. Gels for DNA or PCR products were stained with etidium bromide (5 g/ml) and
visualized directly under UV light.
Preliminary determination of disinfectant tolerance of
L. monocytogenes isolates
We employed two commonly used disinfectants in the
national food industry: sodium hypochlorite (Merck) and
Tego-51 (Merck). For this analysis we performed a
McFarland calibration curve by measuring the OD600 nm in a
Genesys 10 UV spectrophotometer (Thermo Spectronic)
and correlating it with the cells·ml-1 of each tube of the
scale (Equation 1). On the other side, we took into account
the equivalence given by Manzano et al. (1997) (Equation
2).
9875.0;03768.01051267.0 23 =+×= −RXy (1)
UFCOD nm
7
600 1012.0 ×= (2)
Isolates of L. monocytogenes were grown in BHI broth
supplemented with 0.5% (w/v) glucose at 37°C, 100 rpm,
for 24 h OD600 nm was then measured and a cell suspension
equivalent to 0.5 on the McFarland scale was prepared in
saline solution (0.85% (w/v) NaCl). 300 µl of the
suspension were inoculated into 2.7 ml (1/10) of the
disinfectant in order to obtain the desired concentration
and the mixture was then incubated at room temperature
for different exposure times.
After each exposure time, 20 µl of the suspension were
inoculated into BHI broth supplemented with 0.5% (w/v) of
glucose (1/150) and incubated for 24 h at 35°C.
The OD600 nm was measured after the incubation, and
using the equivalence in cells·ml-1 obtained from the
McFarland calibration curve, the effect of the disinfectants
on the cell population was analyzed comparing it with the
inoculated population of cells·ml-1. If the population of cells·ml-1
decreased, we considered this observation as a result of the
exposure to the disinfectant and therefore we interpreted it as the
minimum inhibitory concentration (MIC) of the disinfectant and
expressed it in terms of the concentration of disinfectant and the
exposure time in minutes. If the population of cells·ml-1 was
maintained or increased we considered this observation as a result
of "tolerance" and interpreted it as the necessity to increase the
concentration of disinfectant and/or the exposure time to find the
point in which the microorganism concentration decreases to report
a MIC value (MIC/time).
Molecular serotyping
Sorting by divisions
The isolates of L. monocytogenes were serotyped by PCR. All the
amplifications were performed in a Thermal Cycler C1000 TM
(BioRad). Different sets of primers were employed: the first set was
D1 which yields a product of 214 bp and classifies isolates into
division 1 (serotypes ½b, 3b, 4b, 4d and 4e) or division III
(serotypes 4a and 4c). Isolates that did not amplify the 214 bp band
were further amplified with the primer set D2, which yields a product
of 140 bp and classifies the isolates into the division II (serotypes
½a, ½c, 3a and 3c), (Borucki and Call, 2003).
Serotyping
The isolates classified into division II were subtyped using the FlaA
primer set to generate a product of 538 bp that is characteristic of
serotypes ½a and 3a; the absence of amplification indicated the
presence of serotypes ½c or 3c (Borucki and Call, 2003). Isolates
grouped into divisions I and III were subtyped with the GLT primer
set to obtain a product of 483 bp that identifies serotypes ½b and
3b; Isolates that did not amplify the band of 483 bp were considered
serotype 4 and thus further subtyped with primers MAMA-C
(LM4/LMB) yielding an amplified product of 268 bp that identifies
serotypes 4a and 4c. In this way the strains that did not amplify
were considered serotype 4 (b, d or e), (Jinneman and Hill, 2001),
(Table 1). The 100-bp ladder (Promega or Invitrogen) was used as
molecular size marker and L. monocytogenes (ATCC 19115) was
used as PCR control.
Serotyping reaction mixture
Primer sets D1 and D2 were used for classifying into divisions, and
primer sets FlaA and GLT were used for PCR subtyping; the
reaction mixture consisted of: 25 l reaction volume, 50 pmol/l of
each primer, 1U of GoTaq Flexi DNA polymerase, 1X of Green
PCR Buffer, 0.2 mm of each dNTP, 2.5 mM MgCl2 and 5 l of
sample DNA (Borucki and Call, 2003). For PCR subtyping of
serotype 4 of division 3, the primer set MAMA-C was used; the
reaction mixture consisted of: reaction volume of 50 l, 0.5 mol of
each primer, 2U TaqDNApol, 1X PCR buffer, 200 M of each
dNTP, 2.0 mM MgCl2 and 2 l of sample DNA (Rasmussen et al.,
1991; Rasmussen et al., 1995; Jinneman and Hill, 2001). Cycles
and temperatures of the amplifications are listed in Table 1.
ERIC-PCR reaction mixture
ERIC1R/ERIC2 primers were used for the ERIC-PCR
(Enterobacterial Repetitive Intergenic Consensus) of all the isolates
(Table 1). For the amplification mixture we used 75 ng of template
DNA in 25 µl of a solution containing 25 pmol of each primer, 0.25
Ruiz-Bolivar et al. 1589
mM of each dNTP, 2.5 mM MgCl2, 2% (v/v) DMSO and 1µ of
GoTaq Flexi DNA polymerase (Promega), (Jersek et al., 1999;
Chung-Hsi and Chinling, 2006).
Analysis of ERIC-PCR products
The gel was photographed under UV light in the Geldoc (BioRad),
which allowed the standardization of gel alignments involving
internal reference bands. The similarities between DNA fingerprints
were calculated using the Jaccard’s coefficient (Sj). The proportion
of bands common to two strains, A and B, is defined as:
)( ABBA
AB
Sj
ηηη
η
−+
=
Where: ηAB is the number of bands common to A and B, and ηA
and ηB are the total number of bands for A and B respectively. The
Jaccard’s coefficient is represented as a value between 0 and 1,
where 1 represents 100% of similarity (presence and position) of all
the bands in the comparison of the two DNA fingerprints, and 0 is
the total absence of band similarity (Jaccard, 1901; Jersek et al.,
1999; Poutou et al., 2000; Chung-Hsi and Chinling, 2006). Based
on the banding, we constructed a dendrogram to analyze the
similarities among isolates and to identify clusters, using the
UPGMA algorithm and the NTSYSpc software version 2.20 b.
RESULTS
Genus and species identification
PCR of gDNA (Figure 1A) of biochemical and phenotypic
presumptive L. monocytogenes isolates using sets of
primers U1/L1 - LR/LF showed the presence of two PCR
products, 938 bp and 750 bp, confirming the genus and
species respectively in all the isolates studied. Both L.
monocytogenes (ATCC 19115) and L. innocua (L5)
strains used as controls amplified the expected bands
(Figure 1B).
Antimicrobial susceptibility evaluation
The antimicrobial susceptibility testing of L.
monocytogenes isolates was carried out simultaneously
to the disinfectant tolerance test. Susceptibility,
resistance and intermediate patterns can be seen in
Table 1. Considering that L. monocytogenes is resistant
to cephalosporins from 3rd to 6th generation and that
resistance to cephalosporins included in the panel has
been reported (Charpentier and Courvalin, 1999; Troxler
et al., 2000), the results of antibiotic susceptibility to CFT,
CPE, CFR and CRM were excluded from Table 2.
Based on breakpoints established by CLSI (Clinical and
Laboratory Standards Institute, 2008; 2010) for
Staphylococcus spp. and Enterococcus spp., 35.5%
(16/45) of isolates were classified as multi-resistant.
Among the phenotypes of multidrug resistance we found
RIF, CD, AZI, E, MER, TMP/SMX and CP. Only 7%
(3/45) of multi-resistant isolates showed simultaneous
1590 Afr. J. Microbiol. Res.
Figure 1. Agarose gels in 1X TAE, processed in Quantity One V. 4.6.9. (BioRad). Electrophoresis. A: Extraction of
DNA from different isolates, B: PCR for genus and species identification, C and D: PCR for serotyping, E: ERIC-PCR
of the isolates Controls: Lanes B-11, C-24, E-b and E-o: L. monocytogenes (ATCC 19115), Lane B-17: L. innocua
(L5); Lanes B-12 and B-22: 100 bp molecular size marker (Invitrogen), Lanes C-23, C-30, C-38, E-a and E-ñ: 100 bp
molecular size marker (Promega); Lanes E-n and E-z: λ-Hind III molecular size marker (Promega). Lanes B-13, C-24,
D-54, Ed and Es: PCR Reagents control. Electrophoresis B: Lane 14: LMA-PUJ-13 (cow's milk, Bogotá), Lane 15:
LMA-PUJ-39 (cheese, Pamplona), Lane 16: LMA-PUJ-139 (spinach, Funza); Lane 18: LMA-PUJ-118, Lane 19: LMA-
PUJ-128, Lane 20: LMA-PUJ-130, Lane 21: LMA-PUJ-133.Electrophoresis C: Lane 24: LMA-PUJ-175 vs. U1-L1/LF-
LR primers, Lane 26: LMA-PUJ-58 and Lane 27: LMA-PUJ-62, vs. D1 primers, Lane 28: LMA-PUJ-71 and Lane 29:
LMA-PUJ-74, vs. D2 primers, Lane 31: LMA-PUJ-71 and Lane 32: LMA-PUJ-74, vs. FlaA primers, Lane 33: LMA-PUJ-
54 and Lane 34: LMA-PUJ-62 vs. GLT primers, Lane 35: LMA-PUJ-196 vs. MAMA-C primers, Lane 36: LMA-PUJ-142
vs. GLT primers, Lane 37: LMA-PUJ-226 vs. MAMA-C primers. Electrophoresis D: Lane 39: LMA-PUJ-54 vs. GLT
primers, Lane 40: LMA-PUJ-58 vs. D1 primers. Isolates that did not amplify with the MAMA-C primers, Lane 41: LMA-
PUJ-17, Lane 42: LMA-PUJ-55, Lane 43: LMA-PUJ-58, Lane 44: LMA-PUJ-130, Lane 45: LMA-PUJ-151, Lane 46:
LMA-PUJ-156, Lane 47: LMA-PUJ-161, Lane 48: LMA-PUJ-163, Lane 49: LMA-PUJ-169, Lane 50: LMA-PUJ-169,
Lane 51: LMA-PUJ-191, Lane 52: LMA-PUJ-192, Lane 53: LMA-PUJ-226.
Ruiz-Bolivar et al. 1591
Table 2. Antimicrobial susceptibility of L. monocytogenes isolates.
Breakpoint (mg/ml) Isolates # (%)
Antimicrobial R I S MIC Range MIC50 MIC90 R I S NS
PEN - - 2 0.25 – 8 1 4 0(0) 0(0) 44 (97.8) 1 (2.2)
AM - - 2 0.25 – 2 0.5 2 0(0) 0(0) 45 (100) 0 (0)
TMP/SMX 4/76 1/19 - 2/38 0.5/9.5 0.125 – 1 0.25 0.25 0(0) 1(2.2) 44 (97.8) 0 (0)
AMOX/CLAV 32 4 8 0.125 – 1 0.5 0.5 0(0) 0(0) 45(100) 0 (0)
MER 16 8 4 0.12 – 8 4 8 0(0) 13(28.9) 32(71.1) 0 (0)
RIF 4 2 1 0.5 – 4 0.5 4 15(33.3) 1(2.2) 29(64.4) 0 (0)
CP 4 2 1 0.12 – 2 0.5 2 0(0) 7(15.6) 38(84.4) 0 (0)
CD 4 1-2 0.5 0.25 – 8 4 4 33(73.3) 2(4.4) 10(22.3) 0 (0)
AZI 8 4 2 0.125 – 8 0.25 2 2(4.4) 0(0) 43(95.6) 0 (0)
E 8 1-4 0.5 0.125 – 8 0.25 1 1(2.2) 1(2.2) 43(95.6) 0 (0)
C 32 16 8 4 – 8 4 4 0(0) 0(0) 45(100) 0 (0)
TET 16 8 4 0.1 – 8 1 8 0(0) 8(17.8) 37(82.2) 0 (0)
VA* 16 4-8 2 0.25 – 4 1 2 0(0) 0 (0) 45(100) 0 (0)
VA 32 8-16 4 0.25 – 4 1 2 0(0) 0(0) 45(100) 0 (0)
R: resistant, I: intermediate, S: susceptible, NS: non susceptible. L. monocytogenes breakpoints were used for PEN, AM and TMP / SMX. For the
other antimicrobials we used breakpoints for Staphylococcus spp. and Enterococcus spp.*: Breakpoints for Staphylococcus spp. : Breakpoints for
Enterococcus spp. (Clinical and Laboratory Standards Institute, 2008, Clinical and Laboratory Standards Institute, 2010).
resistance to CD and E (Figure 2).
The geographic provenance of multi-resistant isolates
was as follows: 19% (3/4) from Madrid (Colombia), 71.4%
(5/7) from Pamplona (Colombia), 69% (9/13) from
Bogotá, 25% (5/20) from Funza, and 100% (1/1) from
Cali.
Sodium hypochlorite and Tego-51 tolerance
evaluation
Tolerance to two commonly used disinfectants in the
domestic industry was evaluated. Isolates showed
tolerance variability with different concentrations and
exposure times to the disinfectants sodium hypochlorite
(halogen) and Tego-51 (amphoteric disinfectant), as
evidenced by the MICs obtained (Table 3).
The variability in the MICs found for sodium
hypochlorite was: 71% (32/45) isolates had values 200
ppm/10-15 min (Table 4) and only 29% (13/45) had MICs
> 200 ppm/5-10 min. The distribution by sample type or
origin of the isolates with MICs > 200 ppm of sodium
hypochlorite is shown in Table 4.
Molecular serotyping
Molecular serotyping showed that 73% (33/45) of the
isolates were 4b/4d/4e (division I), 16% (7/45) were
½b/3b (division I), 7% (3/45) were ½a/3a (division II)
and 4% (2/45) were ½c/3c (division II). There were no
isolates belonging to division III. L. monocytogenes
ATCC 19115 was serotyped ½b (division I), (Figures 1C,
1D) as expected.
ERIC-PCR
The ERIC-PCR analysis showed a total of 28
polymorphic bands ranging from 100 bp to 2810 bp
(Figure 1E). These results generated a set of zeros and
ones (0s and 1s) that were the data used to construct a
dendrogram using the Jaccard’s coefficient to show the
genetic similarities among isolates (Figure 2).
Only 84.4% (38/45) of the isolates amplified with the
ERIC primers. The dendrogram showed three major
groups (1, 2 and 3), (Figure 2), separated at Sj = 20%;
this first cluster grouped isolates irrespectively.
Additionally, there were 3 clusters with 100% of similarity:
A, B and C.
The cluster A grouped 3 isolates, one from spinach
(serotype 4b/4d), one from lettuce (serotype 4b/4d) and
one from milk (serotype ½ a/3a), all of them of division I,
with varying antimicrobial resistance patterns and a high
geographical proximity.
The cluster B 2 isolates from vegetables (spinach and
lettuce), both 4b/4d serotype, from the same geographi-
cal area and with resistance to CD. The cluster C is much
more distant from other isolates, grouped 2 isolates from
spinach, and presented the same characteristics as the
cluster B.
DISCUSSION
Genus and species identification
The identification of the genus was done with the primers
L1/U1 that detect a sequence of the 16S rDNA and
amplify a 938-bp fragment. On the other side, primers
1592 Afr. J. Microbiol. Res.
A
B
C
I
II
III
A
B
C
A
B
C
A
B
C
I
II
III
Figure 2. Dendrogram resulting from analysis of ERIC-PCR performed on isolates of L. monocytogenes obtained from different sources. The labels of amplified samples are coded as follows: isolate
code (black font); source (black font) (M: milk, S: spinach, L: lettuce, V: cow, Ch: cheese, P: poultry, H: human); serotype code (red font); antimicrobial susceptibility patterns (blue font); tolerance to
disinfectants sodium hypochlorite (H) (black font) and Tego-51 (T) (green font); geographic provenance of the isolate (black font, in parenthesis).
Ruiz-Bolivar et al. 1593
Table 3. Tolerance to sodium hypochlorite and Tego-51.
Disinfectant MIC # isolates (%)
12.5/10 2 (4.4)
25/10 3 (6.7)
50/10 3 (6.7)
50/15 4 (8.9)
100/10 4(8.9)
100/15 6 (13.3)
200/10 7 (15.6)
200/15 3 (6.7)
400/5 5 (11.1)
400/10 5 (11.1)
400/15 1 (2.2)
600/10 1 (2.2)
Hypochlorite (ppm/min)
800/10 1 (2.2)
0.125/15 2 (4.4)
0.25/5 4(8.9)
0.5/5 2 (4.4)
0.75/5 4(8.9)
0.75/10 1 (2.2)
0.9/5 6 (6)
1/5 7 (15.6)
1/10 1 (2.2)
1.5/5 14 (31.1)
1.5/10 3 (6.7)
Tego-51 ((% v/v) /min )
2/10 1 (2.2)
Bold font: minimum and maximum recommended concentrations for use in the food industry.
Table 4. Distribution of L. monocytogenes isolates with a MIC higher than the recommended for sodium hypochlorite.
Origin Source distribution, origin and tolerance to sodium hypochlorite. # Isolates (MIC ppm/min), (%)
(# of isolates) Bogotá Cali Madrid (Colombia) Funza Pamplona (Colombia)
2 (400/5), (13.3%)
Spinach (15) 0(0), (0) 0(0), (0) 0(0), (0) 1 (400/10), (6.7%) 0(0), (0)
Milk (5) 0(0), (0) 0(0), (0) 1 (400/15), (20%) 0(0), (0) 0(0), (0)
1 (400/5), (20%)
Lettuce (5) 0(0), (0) 0(0), (0) 0(0), (0) 1 (400/10), (20%) 0(0), (0)
1 (400/5), (33.3%)
Poultry (3) 1 (400/10), (33.3%) 0(0), (0) 0(0), (0) 0(0), (0) 0(0), (0)
1 (400/5), (9.1%)
1 (400/10), (9.1%)
Cheese (11) 1 (600/10), (9.1%) 0(0), (0) 0(0), (0) 0(0), (0)
1 (800/10), (9.1%)
Animal (1) 0(0), (0) 0(0), (0) 1 (400/10), (100%) 0(0), (0) 0(0), (0)
Human (5) 0(0), (0) 0(0), (0) 0(0), (0) 0(0), (0) 0(0), (0)
1594 Afr. J. Microbiol. Res.
LF/LR detect a region of the hlyA gene coding for
hemolysine O (LLO) and amplify a 750-bp band (Figure
1B). L. monocytogenes ATCC 19115 showed the same
banding result as expected, whereas L. innocua only
showed the 938-bp band (Figure 1B).
Antimicrobial susceptibility evaluation
The therapy choices for effective treatment of human
listeriosis are penicillin, ampicillin and trimethoprim/
sulfamethoxazole (Clinical and Laboratory Standards
Institute, 2008). Our L. monocytogenes isolates displayed
between 97.8% and 100% of susceptibility to those
antimicrobials (Table 2). Only 2.2% (1/45) of the isolates
were non susceptible to penicillin with a MIC of 4 g ml-1
(Table 2). Recent studies have reported high levels or
intermediate levels of resistance to penicillin compared
with our results (Santos Mantilla et al., 2008; Chen et al.,
2010; Pesavento et al., 2010).
The penicillin MIC90 was 4 g ml-1, exceeding the
susceptibility breakpoint (Table 2). This finding suggests
an antimicrobial resistance increase of some L.
monocytogenes isolates when compared with reports on
clinical isolates (Martínez-Martínez et al., 2001) that
showed MIC90 = 1 g ml-1.
In our study, only one isolate was intermediate (MIC 1
g ml-1) for TMP/SMX, (Table 2). Our results agree with
recent publications that report resistance levels between
0.6% and 1.6% (Lyon et al., 2008; Conter et al., 2009);
however, some authors have reported up to 66% of
resistance (Yücel et al., 2005). A MIC90 lower than the
TMP/SMX susceptibility breakpoint proves the antibiotic
effectiveness (Table 2).
The majority of isolates were susceptible to one or
another antimicrobial of therapeutic primary choice, which
is an encouraging result in terms of possible treatment.
All the other antimicrobials except vancomycin have
common breakpoints with Staphylococcus spp. and
Enterococcus spp. (Clinical and Laboratory Standards
Institute, 2008, 2010); for this reason, they were used for
interpreting the susceptibility pattern.
Meropenem shows that 28.9% of isolates are
intermediate (Table 2). Apparently it has been used few
times for antimicrobial susceptibility testing o treatment;
however, failure of clinical treatment against L.
monocytogenes has been reported before (Stepanovi et
al., 2004).
As a wide-spectrum antimicrobial, rifampin acts on the
RNA polymerase in Mycobacteria and Gram-positives
(Wehrli, 1983). RIF resistance has been documented
before (Facinelli et al., 1991; Morse et al., 1999; Conter
et al., 2007; Santos Mantilla et al., 2008; Conter et al.,
2009).
In our study we found 33.3% of resistance
intermediates (Table 2), a finding that should be
considered as alarming because rifampin is the major
choice in therapeutic treatment against Mycobacterium
tuberculosis when no multidrug-resistance pattern is
detected (Tobón, 2001; Miranda et al., 2006a),
additionally, it is not convenient to have RIFR strains that
could exchange genetic material indirectly with M.
tuberculosis through other microorganisms.
Ciprofloxacin MIC90 values (2 g ml-1) similar to that
found in our present study (Table 2) have been reported
for clinical isolates of L. monocytogenes (Martínez-
Martínez et al., 2001). Although the frequency of 15.6%
of intermediates found in our study is not comparable
with lower frequencies found by other authors (1.6%-
2.4%), (Li and Logue, 2006; Conter et al., 2009), our
results agree with the recently reported reduction on
susceptibility to ciprofloxacin (De Nes et al., 2010).
Clindamycin, erythromycin and chloramphenicol
interfere with the protein synthesis by binding to the
bacterial 50 S ribosomal subunit, and this is why a cross-
resistance among them can sometimes be detected
(Depardieu et al., 2007). In our study, 73% of isolates
displayed a strong resistance against clindamycin. A
2.2% of resistance for erythromycin was found, whereas
100% of isolates were chloramphenicol-susceptible.
An inducible-clindamycin resistance phenomenon has
been described in Staphylococcus spp. clinical isolates
(Clinical and Laboratory Standards Institute, 2010)
through the expression of the ermM for erythromycin
resistance which provokes therapeutic failure when an
ER/CDI or an ER/CDS strain causing infection is being
treated with clindamycin (Clinical and Laboratory
Standards Institute, 2010). In spite that it is not yet
possible to extrapolate this phenomenon to L.
monocytogenes, it is important to note that in our present
study only 3 out of 45 isolates (7%) displayed both
clindamycin and erythromycin resistance, suggesting a
possible modification of the 23S rRNA in these isolates
(Brisson-Noel et al., 1988; Davis and Jackson, 2009).
Tetracycline resistance in L. monocytogenes varies
widely and it is frequently found in strains from different
sources (Harvey and Gilmour, 2001; Pourshaban et al.,
2002; Conter et al., 2007; Ruiz-Bolivar et al., 2008).
Considering that intermediates have the possibility of
becoming into resistant, our results (17.8%
intermediates) agree with those of Li et al. (2006), who
found 18.6% of resistance (Table 2). Despite some other
reports on susceptibility, tetracycline is not considered a
primary choice drug for listeriosis treatment and its use is
not recommended in children and pregnant women.
Disinfectant tolerance evaluation
The cell wall of Gram-positives consists essentially of
peptidoglycan and teichoic acid. Neither compound
appears to act as an effective barrier against the entry of
antiseptics and disinfectants. Large molecules can easily
cross the cell wall, which may explain the sensitivity of
these organisms to many antibacterial agents. However,
the plasticity of the bacterial cell envelope is a
phenomenon that can be affected by the rate of growth,
nutrients that affect the physiological state of cells, the
thickness and the loss of peptidoglycan (McDonnell and
Russell, 1999).
In this study we evaluated the tolerance of L.
monocytogenes isolates from different origins to sodium
hypochlorite (NaOCl) and Tego-51 (C18H40ClN3O2), two
commonly used disinfectants in the domestic industry.
Sodium hypochlorite neutralizes the amino acids forming
salt and water, leading to the formation of chloramines
that interfere with cell metabolism, and breaks down fatty
acids generally affecting the integrity of the plasma
membrane, causing irreversible enzyme inhibition and
altered phospholipid metabolism (Estrella et al., 2002).
Moreover, Tego-51 is an amphoteric surfactant that
reduces surface tension of the membrane affecting the
permeability and the exchange of substances and
nutrients. The properties of the membranes of
microorganisms differ depending on their chemical
composition; in this way, the effect of disinfectants will not
be the same in Gram-positives and Gram-negatives
(Copello et al., 2008).
In general, it has been shown that several of the
sanitizing agents and disinfectants used in the food
industry are effective against L. monocytogenes in cell
suspension, but the formation of biofilms and the
presence of organic matter significantly decrease the
effectiveness of disinfectants (Norwood and Gilmour,
1990; Seok and Schraft, 2000; Aarnisalo et al., 2007;
Kastbjerg and Gram, 2009).
Sodium hypochlorite tolerance
This study proposes a dilution test as an alternative
methodology to assess the tolerance of L.
monocytogenes strains to disinfectants, based on the
increase in optical density (OD600 nm) and by calculating
the concentration of cells ml-1 from a McFarland
calibration curve and Makino equivalence. Our results
showed variation in susceptibility to disinfectants among
isolates, taking into account that different MICs were
found for the disinfectants tested (Table 3).
Only 28.8% (13/45) of the isolates showed MICs higher
than those commonly used in industry, which is an
encouraging finding, but it is known that L.
monocytogenes tends to form biofilms that increase its
tolerance to hypochlorite up to 2,500 ppm (Lundén et al.,
2003).
Biofilm resistance to biocide action seems to depend
on its structure. As the biofilm gets older and thicker,
resistance will be lost as the biofilm structure disassem-
bles during the disinfection procedures. Consequently,
the effectiveness of disinfection will be directly related to
the ability of pre-cleaning to remove and break down the
extra-cellular matrix. Similarly, it was found that sodium
hypochlorite and anionic sanitizers are better than
Ruiz-Bolivar et al. 1595
quaternary ammonium compounds and iodine in cleaning
stainless steel surfaces to eliminate extra-cellular
polymeric substances excreted by Listeria (Herrera,
2004).
One of the 2 previous officially unpublished studies
showed that 1,000 ppm of hypochlorite were required for
inhibiting the growth of L. monocytogenes cell sus-
pensions. The second one showed that concentrations of
sodium hypochlorite of about 250 and 500 ppm inhibited
the growth of L. monocytogenes, although that study
included only 5 isolates and tested only 5 concentrations.
Another recent study has evaluated 25 L.
monocytogenes isolates by comparing their response to
sodium hypochlorite and Tego-51 besides other
disinfectants. Tolerance was found between 100 and 200
ppm for sodium hypochlorite. In the case of Tego-51, the
sensitivity found was of 0.25% (Molina-Moreno et al.,
2009).
Results obtained in our study are consistent with those
of previous reports (Molina-Moreno et al., 2009), although
methodologies used to determine the tolerance or
sensitivity differed among studies.
Tego-51 tolerance
It is encouraging that only one isolate showed a Tego-51
tolerance above the manufacturer's recommended
concentration (Table 3). Our study included 21 isolates
that were studied in a parallel research that tested the
Tego-51 tolerance by other methods (Molina-Moreno et
al., 2009).
Our results agreed with those of 76.2% (16/21) of
isolates and only 23.8% (5/21) did not coincide. Human
isolates from all patients showed MICs within the limits
employed in the industry, but the recommendation for the
use of Tego-51 in hospitals is 0.01% for 30 s; however, to
ensure the effectiveness against pathogens such as P.
mirabilis or B. subtilis, concentrations above 0.1% (v/v)
are recommended for an effective disinfection of hospital
instruments and floors (Suk et al., 1997).
Romanova et al. (2006) showed that MRDL, one of the
two efflux pumps identified in Listeria, is involved in the
adaptation to benzalkonium chloride (Romanova et al.,
2006). Other efflux pumps confering resistance to
disinfectants have been described in S. aureus and S.
epidermidis (McDonnell and Russell, 1999).
On the other hand, plasmids carrying genes for
resistance to disinfectants have been found in S. aureus
(MRSA), Corynebacterium jeikeium, Enterococcus
faecium and Streptococcus mutans. Considering that L.
monocytogenes exchanges genetic material either
directly or indirectly with some of those microorganisms,
it is appropriate to think about the possibility of acquiring
molecular mechanisms of resistance to disinfectants;
however, we did not find any MICs values in our study
that could raise suspicion about the presence of any of
1596 Afr. J. Microbiol. Res.
the above mechanisms of resistance to disinfectants.
Molecular serotyping
Only certain serotypes occur more often in food or in
infecting humans or animals, which are differentiated by
the antigenic determinants expressed on the cell wall
from lipoteichoic acids of membrane proteins of the
flagella and fimbriae (Graves et al., 1999). Although 12
serotypes can cause disease, only 95% of the L.
monocytogenes isolated from human listeriosis cases
corresponded mainly to 3 serotypes: ½a, ½b, and 4b
(Kathariou, 2002). Apparently there are geographical
differences in the overall distribution of serotypes, being
the serotype 4b predominant in Europe and the serotypes
½a, ½b and 4b predominant in Canada and the United
States (Torres et al., 2004; Taillefer et al., 2010). We also
know that strains with serotype 4b were the source of all
the outbreaks reported in Europe and North America
during the past 25 years (Schmid et al., 2003; 2005; Orsi
et al., 2011; Taillefer et al., 2010).
In Colombia, there are few published data or easily
accessible documents with information about the pre-
sence and distribution of L. monocytogenes serotypes.
This is one of the first studies that carries out a molecular
serotyping of isolates from different sources. Our findings
show that despite the non epidemiological distribution of
the n the most frequent serotype is 4b/4d, which is
present in isolates from all the different sources. Serotype
½c/3c was found in a human source and a food source
(cheese), ½b/3b was found in food (lettuce, milk and
cheeses), and ½a/3a was found in animal (cow) and food
(milk) sources.
Strains with serotype 4b have presented incidences
between 50% and 70% in clinical cases, and have been
also identified in sporadic infections, are common
sources of epidemics, and are representative of perinatal
listeriosis showing the ability to cross the placental barrier
(Marakusha et al., 1996).
Serotypes 4b and ½c have been found in sporadic
cases of listeriosis and epidemics. Serotype ½b has been
found in non-pregnant women with severe disease,
corresponding in some studies to up to 10% of the cases
(Torres et al., 2004). An investigation in Los Angeles
discovered an incidence of 31% of serotype ½b, except
those associated with episodes of foodborne diseases
(FBD). This serotype was identified in 65% of patients
infected with human immunodeficiency virus (HIV),
considering a possible association with diet or sexual
practices. Serotype ½b may be relatively non-infectious
for individuals in other risk categories. This serotype
seems to be genetically close to serotype 4b and very
different from serotype ½a; however, both serotypes ½
and 4b represent distinct lineages that vary in the
composition of their antigens and possibly in their
virulence and ecological niches (Kathariou, 2002).
Our results revealed that in a small sample there are
several serotypes circulating in an interchangeable way,
a finding that deserves importance for the soon beginning
of epidemiological studies.
ERIC-PCR fingerprinting
Different ERIC-PCR fingerprints were found (Figure 1E
and 2). No isolates were grouped according to phenol-
type, suggesting an extensive intra-serotypic variation
and showing a wide dispersion of ERIC-PCR patterns.
This consideration is supported by the fact that isolates
formed interchangeable groups: group 1 (vegetables and
milk: serotypes 4b/4d, ½b/3b and ½a/3a), group 2
(chicken, vegetables and dairy products: serotypes 4b/4d
and ½b/3b), and group 3 (human, plant and dairy
products: serotypes ½b/3b, 4b/4d and ½c/3c). Similarly,
no significant association was found based on the source
of all isolates (food, animal or human source).
The ERIC-PCR technique has been used to analyze
isolates of L. monocytogenes in experimental conditions
that allow the strains to be grouped according to the
source of isolation with an Sj <20% (Jersek et al., 1999),
but our study showed no similarity among strains isolated
from humans or animals and strains isolated from food.
On the other hand, Chen et al. (2010) used the ERIC-
PCR for genotyping the tetM gene in isolates of L.
innocua from fish, finding in the strains that they
investigated that the genotypes of this gene are unique
and the similarity between them is low, which coincides to
some extent with our results.
Conclusion
In a small sample without any epidemiological distribu-
tion, several L. monocytogenes serotypes that have been
associated by other authors to different situations
(outbreaks, foods, surfaces, etc.) were found to be in
circulation in Colombia without any specific association to
source or city. Our isolates revealed different degrees of
tolerance to both disinfectants commonly used in
industry, and showed that Tego-51 continues to be more
effective, but noting that our test was performed in cell
suspensions, which led to the assumption that biofilm
tolerance may be higher. In terms of antimicrobial
susceptibility, the antibiotics of choice are still effective;
however, we must emphasize that in vitro resistance to
RIF and CD, as well as intermediate susceptibility to
MER, TET and CP was high.
ACKNOWLEDGMENTS
This research was financed by the Laboratorio de
Microbiología de Alimentos del Grupo de Biotecnología
Ambiental e Industrial (GBAI) and the Unidad de
Investigaciones Agropecuarias (UNIDIA) of the Facultad
de Ciencias at the Pontificia Universidad Javeriana
(Project ID: 00003436), Bogotá, Colombia and the
Instituto de Investigaciones Biológicas del Trópico (IIBT)
of the Facultad de Medicina Veterinaria at the
Universidad de Córdoba, Montería, Colombia. Special
thanks to María C. Vanegas López and Gilma J. Luna-
Cortés for providing isolates used in this study and to the
staff and students of Laboratorio de Microbiología de
Alimentos at the Pontificia Universidad Javeriana.
REFERENCES
Aarnisalo K, Lundén J, Korkeala H, Wirtanen G (2007). Susceptibility of
Listeria monocytogenes strains to disinfectants and chlorinated
alkaline cleaners at cold temperatures. LWT., 40: 1041-1048.
Bansal NS (1996). Development of a polymerase chain reaction assay
for the detection of Listeria monocytogenes in foods. Appl. Microbiol.,
22: 353 - 356.
Borucki MK, Call DR (2003). Listeria monocytogenes serotype
identification by PCR. J. Clin. Microbiol., 41: 5537-5540.
Brisson-Noel A, Delrieu P, Samain D, Courvalin P (1988). Inactivation of
lincosamide antibiotics in Staphylococcus: identification of
lincosaminide o-nucleo-tidyltransferases and comparison of the
corresponding resistance genes. J. Biol. Chem., 263: 15880-15887.
Clinical and Laboratory Standards Institute (2008). Methods for
antimicrobial diluction and disk susceptibility testing of infrequently
isolated of fastidious bacteria; approved guideline. M45-A.
Clinical and Laboratory Standards Institute (2010). Performance
standards for antimicrobial susceptibility testing; twentieth
informational supplement. M100-S20.
Comi G, Frigerio R, Cantoni C (1992). Listeria monocytogenes
Serotypes in Italian meat products. Lett. Appl. Microbiol., 15: 168-
171.
Conter M, Paludi D, D’Orio V, Vergara A, Ianieri A (2007). Antimicrobial
susceptibility of Listeria monocytogenes isolated from food and food-
processing environment. Ann. Fac. Medic. Vet. di Parma, 27: 157-
164.
Conter M, Paludi D, Zanardi E, Ghidini S, Vergara A, Ianieri A (2009).
Characterization of antimicrobial resistance of foodborne Listeria
monocytogenes. Int. J. Food Microbiol., 128: 497-500.
Copello GJ, Teves S, Degrossi J, D’Aquino M, Desimone MF, Díaz LE
(2008). Proving the antimicrobial spectrum of an amphoteric
surfactant-sol-gel coating: a food-borne pathogen study. J. Indian
Microbiol. Biotechnol., 35: 1041-1046.
Charpentier E, Courvalin P (1999). Antibiotic resistance in Listeria spp.
Antimicrob. Age. Chemother., 43: 2103-2108.
Chen BY, Pyla R, Kim TJ, Silva JL, Jung YS (2010). Antibiotic
resistance in Listeria species isolated from catfish fillets and
processing environment. Lett. Appl. Microbiol., 50: 626–632.
Chung-Hsi C, Chinling W (2006). Genetic relatedness between Listeria
monocytogenes isolates from seafood and humans using PFGE and
REP-PCR. Int. J. Food Microbiol., 110: 135-148.
Davis JA, Jackson CR (2009). Comparative antimicrobial susceptibility
of Listeria monocytogenes, L. innocua, and L. welshimery. Microb.
Drug Res., 15: 27-32.
De Nes F, Pelicioli Riboldi G, Guedes Frazzon AP, Alves d’Azevedo P,
Frazzon J (2010). Antimicrobial resistance and investigation of the
molecular epidemiology of Listeria monocytogenes in dairy products.
Rev. Soc. Bras. Med. Trop., 3: 382-385.
Depardieu F, Podglajen I, Leclercq R, Collatz E, Courvalin P (2007).
Modes and mdulations of atibiotic rsistance gene expression. Clin.
Microbiol. Rev., 20: 79-114.
Espaze EP, Rocourt J, Courtieu AL (1991). La Listerióse en France en
1989. Etude à partir des suches aressées au Centre National de
Référence. Bull. Epidémiol. Hebdomaire, 3: 9-10.
Estrella C, Estrella CRA, Barbin EL, Spano JCE, Marchesan MA,
Pécora JD (2002). Mechanism of action of sodium hypochlorite. Braz.
Dent. J., 13: 113-117.
Facinelli B, Giovanetti E, Varaldo PE, Casolari C, Fabio U (1991).
Ruiz-Bolivar et al. 1597
Antibiotic resistance in foodborne listeria. Lancet, 338: 1272.
Fasehun F (1999). The antibacterial paradox: essential drugs,
effcetiveness, and cost. Bullet. World Health Organ., 77: 211-216.
Gallegos JM, Vanegas MC, Albarracín Y, Máttar S, Poutou RA,
Carrascal AK (2008). Frequency of isolation of Listeria spp., in
different retail foods in Colombia. APRA, 4: 9-18.
Graves L, Swaminathan B, Hunter S (1999). Subtyping Listeria
monocytogenes in Listeria, Listeriosis and Food Safety, Marcel
Dekker Inc, New York.
Graves LM, Helsel LO, Steigerwalt AG, Morey RE, Daneshvar MI, Roof
SE, Orsi RH, Fortes ED, Milillo SR, den Bakker HC, Wiedmann M,
Swaminathan B, Sauders BD (2010). Listeria marthii sp. nov.,
isolated from the natural environment, Finger Lakes National Forest.
Int. J. Syst. Evol. Microbiol., 60: 1280-1288.
Harvey J, Gilmour A (2001). Characterization of Recurrent and Sporadic
Listeria monocytogenes isolates from raw milk and nondairy foods by
pulsed-field gel electrophoresis, monocin typing, plasmid profiling,
and cadmium antibiotic resistance determination. Appl. Environ.
Microbiol., 67: 840-847.
Herrera MT (2004). Infectious process and resistance bifilm role. NOVA,
2: 71-80.
Jaccard P (1901). Étude comparative de la distribution floral dans une
portion des Alpes et des jura. Bull. Soc. Vaudoise Sci. Nat., 37: 547-
555.
Jersek B, Gilot P, Gubina M, Klun N, Mehle J, Tcherneva E, Rijpens N,
Herman L (1999). Typing of Listeria monocytogenes strains by
repetitive element sequence-based PCR. J. Clin. Microbiol., 37: 103-
109.
Jinneman KC, Hill WE (2001). Listeria monocytogenes lineage group
clasification by MAMA-PCR of the listeriolysin gene. Curr. Microbiol.,
43: 129-133.
Kastbjerg VG, Gram L (2009). Model systems allowing quantification of
sensitivity to disinfectants and comparison of disinfectant
susceptibility of persistent and presumed nonpersistent Listeria
monocytogenes. J. Appl. Microbiol., 106: 1667–1681.
Kathariou S (2002). Listeria monocytogenes virulence and
pathogenicity, a food safety perspective. J. Food Prot., 65: 1811-
1829.
Kells J, Gilmour A (2004). Incidence of Listeria monocytogenes in two
milk processing environments, and assessment of Listeria
monocytogenes blood agar for isolation. Int. J. Food Microbiol., 91:
167-174.
Korkeala H, Siitonen A (2003). Listeria monocytogenes. Isolates from
invasive infections: Variation of sero-and genotypes during an 11
year period in Finland. J. Clin. Microbiol., 41: 1694-1700.
Leclercq A, Clermont D, Bizet C, Grimont PAD, Le Fleche-Mateos A,
Roche SM, Buchrieser C, Cadet-Daniel V, Le Monnier A, Lecuit M,
Allerberger F (2009). Listeria rocourtiae sp. nov. Int. J. Syst. Evol.
Microbiol., 60: 2210-2214.
Li Q, Sherwood JS, Logue CM (2006). Antimicrobial resistance of
Listeria spp. recovered from processed bison. Lett. Appl. Microbiol.,
44: 86-91.
Low JC, Wright F, McLauchlin J, Donachie W (1993). Serotyping and
distribution of Listeria isolates from cases of ovine listeriosis. Vet.
Rec., 133: 165-166.
Lundén JM, Autio TJ, Markkula A, Hellstrom S, Korkeala HJ (2003).
Adaptive and cross-adaptive responses of persistent and non-
persistent Listeria monocytogenes strains to disinfectants. Int. J.
Food Microbiol., 82: 265-272.
Lyon SA, Berrang ME, Fedorka-Cray PJ, Fletcher DL, Meinersmann RJ
(2008). Antimicrobial resistance of Listeria monocytogenes isolated
from a poultry further processing plant. Foodborne Pathog. Dis., 5:
253-259.
Manzano M, Cocolin L, Ferroni P, Cantoni C, Comi G (1997). A simple
and fast PCR protocol to detect Listeria monocytogenes from meat.
J. Sci. Food Agric., 74: 25-30.
Marakusha B, Darwich K, Tartakovskii I (1996). Characteristics of
Listeria mocytogenes Strains isolated in Russia and their typing using
pulse electrophoresis. Zhurnal Mikrobiologii, Epidemiologii, i
Immunobiologii, 3: 60-64.
Martínez-Martínez L, Joyanes P, Suárez AI, Perea EJ (2001). Activities
of gemifloxacin and five other antimicrobials agents against Listeria
1598 Afr. J. Microbiol. Res.
monocytogenes and Coryneform bacteria isolated from clinical samples.
Antimicrob. Agents Chemother., 45: 2390-2392.
McDonnell G, Russell AD (1999). Antiseptics and disinfectants: Activity,
action and resistance. Clin. Microbiol. Rev., 12: 147-179.
Medrano MV, Restrepo S, Vanegas MC (2006). Molecular typing of
Listeria monocytogenes isoalted from clinical and food samples.
Biomédica, 26: 442-450.
Meza RA, Monroy AF, Mercado M, Poutou RA, Rodríguez P, Pedroza
AM (2004). Study of the stability in real time of cryopreserved strain
banks. Univ. Sci., 9: 35-42.
Miranda J, Rios R, Clavijo A, Chacón C, Mattar S (2006a). Preliminary
survey of antimicrobial susceptibility and genetic variability of
Mycobacterium tuberculosis isolates from Colombian Caribbean.
Colombia Méd., 37: 275-286.
Miranda MC, Pérez F, Zuluaga T, Olivera MR, Correa A, Reyes SL,
Villegas MV, Grupo de Resistencia Bacteriana Nosocomial de
Colombia (2006b). Antimicrobial resistance in Gram negative bacteria
isolated from intensive care units of Colombian hospitals, WHONET
2003, 2004 y 2005. Biomédica, 26: 424-433.
Molina-Moreno SN, Mercado-Reyes M, Carrascal-Camacho AK (2009).
Effect of cooking time and temperature on sausages artificially
inoculated with Listeria monocytogenes. Univ. Sci., 14: 198-205.
Morse R, O’hanlon K, Virji M, Collins MD (1999). Isolation of rifampin-
resistant mutants of Listeria monocytogenes and their
characterization by rpoB gene sequencing, temperature sensitivity for
growth, and interaction with an epithelial cell line. J. Clin. Microbiol.,
37: 2913-2919.
Norrung B, Andersen JK (2000). Variations in virulence between
different electrophoretic types of Listeria monocytogenes. Lett. Appl.
Microbiol., 30: 228-232.
Norwood DE, Gilmour A (1990). Adherence of Listeria monocytogenes
strains to stainless steel coupons. Eur. J. Clin. Microbiol., 9: 210-213.
Orsi RH, den Bakker HC, Wiedmann M (2011). Listeria monocytogenes
lineages: Genomics, evolution, ecology, and phenotypic
characteristics. Int. J. Med. Microbiol., 301: 79-96.
Pesavento G, Ducci B, Nieri D, Comodo N, Lo Nostro A (2010).
Prevalence and antibiotic susceptibility of Listeria spp isolated from
raw meat and retail foods. Food Cont., 21: 708-713.
Piffaretti JC, Kressebuch H, Aeschbacher M, Bille J, Bannermann E,
Musser JM, Selander RK, Rocourt J (1989). Genetic characterization
of clones of the bacterium Listeria monocytogenes causing epidemic
disease. PNAS, 86: 3818-3822.
Pourshaban M, Ferrini AM, Mannoni V, Oliva B, Aureli P (2002).
Transferable tetracycline resistance in Listeria monocytogenes from
food in Italy. J. Med. Microbiol., 51: 564-566.
Poutou R, Máttar S, Del Portillo P, Visbal J, Bermúdez A (2000). RAPD
Fingerprinting of enterohaemorrhagic Escherichia coli O157:H7
isolates in Santafé de Bogotá, DC, Colombia. Med. Sci. Res., 28: 29-
32.
Poutou RA, Burbano ME, Sierra SC, Torres KJ, Carrascal AK, Mercado
M (2005). Estandarización de la extracción de ADN y validación de la
PCR-múltiple para detectar Listeria monocytogenes en queso, leche,
carne de res y pollo. Univ. Sci., 10: 61-78.
Rasmussen OF, Beck T, Olsen JE, Dons L, Rossen L (1991). Listeria
monocytogenes isolates can be classified into two major types
according to the sequence of the listeriolysin gene. Infect. Immun.,
59: 3945-3951.
Rasmussen OF, Skouboe P, Dons I, Rossen L, Olsen JE (1995).
Listeria monocytogenes exists in at least three evolutionary lines:
evidence from flagellin, invasive associated protein and listeriolysin O
genes. Microbiol., 141: 2053-2061.
Roberts A, Nightingale K, Jeffers G, Fortes E, Kongo JM, Wiedmann M
(2006). Genetic and phenotypic characterization of Listeria
monocytogenes lineage III. Microbiol., 152: 685-693.
Romanova NA, Wolffs PFG, Brovko LY, Griffiths MW (2006). Role of
efflux pumps in adaptation and resistance of Listeria monocytogenes
to benzalkonium chloride. Appl. Environ. Microbiol., 72: 3498-3503.
Ruiz-Bolivar Z, Poutou-Piñales RA, Carrascal-Camacho AK (2008).
Antimicrobial and disinfectants resistance of Listeria spp. NOVA, 6:
201-218.
Salazar CC, Cunha JSL, Schlatter D (2001). Abortamento de
Repetiçao. Femina, 29: 667-672.
Sambrook J, Russell DW (2001). Molecular Cloning: A Laboratory
Manual, Cold Spring Harbor Laboratory Press, New York.
Santos Mantilla SP, Franco RM, Trindade de Oliveira LA, Barbosa
Santos E, Gouvea R (2008). Antibiotic sensitivity of bacteria of the
genus Listeria spp. isolated from bovine ground meat samples. Braz.
J. Vet. Res. Anim. Sci., 45: 116-121.
Schmid M, Walcher M, Bubert A, Wagner M, Wagner M, Schleifer K
(2003). Nucleic acid-based, cultivation-independent detection of
Listeria spp. and genotypes of Listeria monocytogenes. FEMS
Immunol. Med. Microbiol., 35: 215-225.
Schmid MW, YW Ng E, Lampidisc R, Emmerthc M, Walchera M, Kreftc
J, Goebelc W, Wagnerd M, Schleifera KH (2005). Evolutionary
history of the genus Listeria and its virulence genes. Syst. Appl.
Microbiol., 28: 1-18.
Seok M, Schraft H (2000). Comparative evaluation of adhesion and
biofilm formation of different Listeria monocytogenes strains. Int. J.
Food Microbiol., 62: 103-111.
Stepanovi S, Lazarevi G, Ješi M, Koš R (2004). Meropenem therapy
failure in Listeria monocytogenes infection. Eur. J. Clin. Microbiol.
Infect. Dis., 23: 484-486.
Suk JS, Choi HS, Kim EC (1997). Bactericidal effect of disinfectant
Tego-51(R). Korean J. Nosocomial Infect. Cont., 2: 55-59.
Taillefer C, Boucher M, Laferrière C, Morin L (2010). Perinatal
listeriosis: Canada’s 2008 outbreaks. J. Obst. Gynaecol. Canada, 32:
45-48.
Tobón AM (2001). Tratamiento de la tuberculosis multirresistente.
Infectio., 4-5: 260-265.
Torres KJ, Sierra SC, Poutou RA, Carrascal AK, Mercado M (2005).
Pathogenesis of Listeria monocytogenes, microorganism zoonotic
emergent. Rev. MVZ-Córdoba, 10: 511-543.
Torres KJ, Sierra SC, Poutou RA, Vera H, Carrascal AK, Mercado M
(2004). Incidence and diagnosis of Listeria monocytogenes; zoonotic
and emergent microorganism in the food industry. Rev. UDCA
Actualidad Divulg. Cient., 7: 25-57.
Troxler R, Von Graevenitz A, Funke G, Wiedemann B, Stock I (2000).
Natural antibiotic susceptibility of Listeria species: L. grayi, L.
innocua, L. ivanovii, L. monocytogenes, L. seeligeri and L. welshimeri
strains. Clin. Microbiol. Infect., 6: 525.
Vanegas-López MC, Martínez-León AJ (2008). Serotipificación
molecular de cepas colombianas de Listeria monocytogenes.
Asociación Colombiana de Ciencia y Tecnología de Alimentos. V
Premio ACTA a la Investigación en Alimentos Bogotá, D.C.,
Colomnia.
Ward TJ, Ducey TF, Usgaard T, Dunn KA, Bielawski JP (2008).
Multilocus genotyping assays for single nucleotide polymorphism-
based subtyping of Listeria monocytogenes isolates. Appl. Environ.
Microbiol., 74: 7629-7642.
Wehrli W (1983). Rifampin: Mechanisms of action and resistance. Rev.
Infect. Dis., 5: S407-S411.
Wiedmann M, Bruce JL, Keating C, Johnson AE, McDonough PL, Batt
CA (1997). Ribotypes and virulence gene polymorphisms suggest
three distinct Listeria monocytogenes lineages with differences in
pathogenic potential. Infect. Inmun., 65: 2707-2716.
Yücel N, Cıtak S, Önder M (2005). Prevalence and antibiotic resistance
of Listeria species in meat products in Ankara, Turkey. Food
Microbiol., 22: 241-245.
