ArticlePDF Available

Ankyrin-mediated self-protection during cell invasion by the bacterial predator Bdellovibrio bacteriovorus

Authors:

Abstract and Figures

Predatory Bdellovibrio bacteriovorus are natural antimicrobial organisms, killing other bacteria by whole-cell invasion. Self-protection against prey-metabolizing enzymes is important for the evolution of predation. Initial prey entry involves the predator's peptidoglycan DD-endopeptidases, which decrosslink cell walls and prevent wasteful entry by a second predator. Here we identify and characterize a self-protection protein from B. bacteriovorus, Bd3460, which displays an ankyrin-based fold common to intracellular pathogens of eukaryotes. Co-crystal structures reveal Bd3460 complexation of dual targets, binding a conserved epitope of each of the Bd3459 and Bd0816 endopeptidases. Complexation inhibits endopeptidase activity and cell wall decrosslinking in vitro. Self-protection is vital - ΔBd3460 Bdellovibrio deleteriously decrosslink self-peptidoglycan upon invasion, adopt a round morphology, and lose predatory capacity and cellular integrity. Our analysis provides the first mechanistic examination of self-protection in Bdellovibrio, documents protection-multiplicity for products of two different genomic loci, and reveals an important evolutionary adaptation to an invasive predatory bacterial lifestyle.
Content may be subject to copyright.
ARTICLE
Received 23 Jul 2015 |Accepted 12 Oct 2015 |Published 2 Dec 2015
Ankyrin-mediated self-protection during
cell invasion by the bacterial predator
Bdellovibrio bacteriovorus
Carey Lambert1,*, Ian T. Cadby2,*, Rob Till1, Nhat Khai Bui3, Thomas R. Lerner1,w, William S. Hughes2,
David J. Lee2, Luke J. Alderwick2, Waldemar Vollmer3, R. Elizabeth Sockett1& Andrew L. Lovering2
Predatory Bdellovibrio bacteriovorus are natural antimicrobial organisms, killing other bacteria
by whole-cell invasion. Self-protection against prey-metabolizing enzymes is important
for the evolution of predation. Initial prey entry involves the predator’s peptidoglycan
DD-endopeptidases, which decrosslink cell walls and prevent wasteful entry by a second
predator. Here we identify and characterize a self-protection protein from B. bacteriovorus,
Bd3460, which displays an ankyrin-based fold common to intracellular pathogens of
eukaryotes. Co-crystal structures reveal Bd3460 complexation of dual targets, binding a
conserved epitope of each of the Bd3459 and Bd0816 endopeptidases. Complexation inhibits
endopeptidase activity and cell wall decrosslinking in vitro. Self-protection is vital — DBd3460
Bdellovibrio deleteriously decrosslink self-peptidoglycan upon invasion, adopt a round mor-
phology, and lose predatory capacity and cellular integrity. Our analysis provides the first
mechanistic examination of self-protection in Bdellovibrio, documents protection-multiplicity
for products of two different genomic loci, and reveals an important evolutionary adaptation
to an invasive predatory bacterial lifestyle.
DOI: 10.1038/ncomms9884 OPEN
1Centre for Genetics and Genomics, School of Biology, Nottingham University, Medical School, Queen’s Medical Centre, Nottingham NG7 2UH, UK.
2Institute for Microbiology and Infection, School of Biosciences, University of Birmingham, Birmingham B15 2TT, UK. 3Centre for Bacterial Cell Biology,
Institute for Cell and Molecular Biosciences, Newcastle University, Richardson Road, Newcastle upon Tyne NE2 4AX, UK. wPresent address: Francis Crick
Institute, London NW1 2BE, UK. * These authors contributed equally to this work. Correspondence and requests for materials should be addressed to R.E.S.
(email: liz.sockett@nottingham.ac.uk) or to A.L.L. (email: a.lovering@bham.ac.uk).
NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications 1
Bdellovibrio are deltaproteobacteria that enter and kill
diverse pathogenic Gram-negative bacterial species and
have been tested as possible whole-cell antibacterial
agents1,2.Bdellovibrio bacteriovorus is a periplasmic predator
that enters through the outer membrane of prey and metabolizes
the ‘infected’ cell from within3. The intracellular lifestyle of
B. bacteriovorus requires many specialized adaptations4, one of
which is the formation of the osmotically-stable bdelloplast,
wherein the (usually) rod-shaped prey cell becomes rounded up
immediately after Bdellovibrio instigates prey invasion5. This
rounding is caused by prey peptidoglycan cell wall modification,
catalysed by Bdellovibrio enzymes6. The B. bacteriovorus genome
encodes many predation-associated genes, additional to those for
self cell wall maintenance. These gene products modify prey
peptidoglycan in sequential, but different, ways to facilitate
bdelloplast formation: withstanding initial predator-invasion
without breaking; accommodating the invasive Bdellovibrio
growing within; withstanding and becoming ready for final lysis
when Bdellovibrio replication is complete. Although these cell
cycle concepts and associated cell wall modifications are predicted
and seen microscopically as events, few activities have
been directly attributed to specific Bdellovibrio predatory gene
products. Previously, we assigned prey cell rounding to the action
of two secreted Bdellovibrio peptidoglycan DD-endopeptidases,
Bd0816 and Bd3459, that act to modify the invaded cell wall via
hydrolysis of the structural 3-4 peptide crosslinks6. The prey
morphology-change catalysed by these enzymes functioned as an
‘occupancy signal’, preventing wasteful entry by successive
predators and speeding up prey invasion6. Thus, rounded prey-
bdelloplast formation, catalysed by the pair of DD-endopeptidase
enzymes (Bd3459, Bd0816) was found to promote a 1:1 predator
to prey cell ratio and drive population fitness, preventing
self-competition between individual Bdellovibrio for the same
prey cell. This feature is important as although the long range
encounter between predator Bdellovibrio and a cloud of potential
prey involves chemotaxis7; the final short range encounter cannot
be guided by chemotaxis as bacteria do not sense chemotactically
along their cell bodies at short range8. Thus, several Bdellovibrio
will arrive at a single prey cell as they cannot use self or prey
sensing to prevent this. Furthermore, Bdellovibrio are released as
a cloud of predators by lysis of an adjacent infected bdelloplast.
However, the ‘occupancy signal’ of DD-endopeptidase-mediated
rounding does prevent multiple entry to a single prey cell. Thus
these DD-endopeptidase enzymes are vital to predation efficiency
but they also target peptidoglycan, which is common to both
predator and prey; the evolutionary fitness benefit of eliminating
auto-competition brings with it a risk of self-damage which must
be mitigated.
Structure and activity analyses of DD-endopeptidase Bd3459
revealed a highly active enzyme with an open active site adapted
for prey peptidoglycan diversity, rather than self-wall main-
tenance (this was also inferred for the homologous Bd0816). This
raised the intriguing question of how Bdellovibrio protects its own
cell wall from modification/destruction by Bd3459 and Bd0816
passing through its own periplasm when invading prey6. To this
end, we instigated a search to find a potential ‘self-protection
protein’ that could act to block endopeptidase activity in the
predator, while such DD-endopeptidases were being secreted,
past their own peptidoglycan cell wall to that of the prey.
Here we show that Bdellovibrio bacteriovorus utilizes a
small ankyrin repeat protein, Bd3460, to protect itself from
endopeptidase activities during entry of prey. We demonstrate
that endopeptidase complexation by Bd3460 prevents cell wall
decrosslinking, and that both the Bd0816 and Bd3459 targets
bind this self-protection protein via a common epitope. Predators
lacking this protection are observed to deleteriously self-round
upon cell contact and endopeptidase induction; thus forming an
abortive ‘spheroplast-like shape’ at the entry pore and negating
prey cell entry & killing.
Results
Characterization of a Bdellovibrio self-protection protein.
Reasoning that protective protein(s) should act on both
DD-endopeptidase gene products in the periplasm, we examined
the gene neighbourhoods of bd0816 and of bd3460 initially
looking for a common pair of potential ‘immunity genes’, which
we didn’t find. Gene bd0816 is preceded by a small 150 bp gene
without a signal peptide; bd3460 however encodes a small 23 kDa
protein, with predicted ankyrin repeats on a signal peptide.
Ankyrin-repeat proteins (ARPs) are often involved in protein-
protein interactions and can be found in several toxins and their
associated immunity proteins9,10. Interestingly, ARPs are rare in
bacteria, but are enriched in intracellular parasites of eukaryotes
where they are chiefly used to modulate host cell processes11.
The bd3459 endopeptidase/bd3460 ARP gene synteny, albeit with
ARP expressed after the protein it should protect against
(see explanation later), is shared in other periplasmic predator
genomes12, and is absent in related strains exhibiting epibiotic
predation (which adhere to prey but do not invade13). This
cumulative evidence suggested that Bd3460 could represent the
first self-protection protein identified in predatory bacteria, a
hypothesis we test and validate in the present study.
Co-transcription of bd3459 and bd3460 was established via
semi-quantitative RT-PCR (Supplementary Fig. 1, showing peak
expression at prey invasion timepoints). Co-purification of tagged
Bd3459/Bd0816 and untagged Bd3460 indicated a 1:1 complex
formation in-vitro. These interactions were confirmed and
quantified using intrinsic tryptophan fluorescence emission
measurements (Supplementary Fig. 2); with an estimated
affinity of Bd3460 for Bd3459 of 26.8 uM. Acylation of the
DD-endopeptidase active site serine by the specific inhibitor
penicillin G caused an approximate 2-fold reduction in affinity of
Bd3460 for Bd3459.
We utilized an identical assay to our original Bd3459
characterization6, wherein isolated peptidoglycan from a
pentapeptide-rich strain of Esherichia coli is incubated with
enzyme and modifications are monitored via endpoint HPLC
analyses. Purified recombinant Bd3460 completely inhibited the
endopeptidase activity of Bd3459, as expected for a functional
immunity protein (Supplementary Fig. 3).
Gene bd3460 lies downstream of bd3459 raising the questions:
how does it protect the cell when bd3459 is transcribed, and
translated before it; and how may Bd3460 protect against Bd0816
transcribed and translated from a gene locus elsewhere on
the genome? Monitoring fluorescence of Bd3460::mCherry
throughout the predatory cycle showed that Bd3460 is expressed
in pre-invasive Bdellovibrio (Fig. 1), and expression increased
slightly during Bdellovibrio prey-entry and rounding (at the time
that Bd3459 and Bd0816 are utilized to effect prey cell wall
decrosslinking). Released, daughter attack-phase Bdellovibrio
maintained Bd3460::mCherry fluorescence, indicating that
constant Bd3460 availability is the mechanism by which the
Bdellovibrio cell is protected from the upstream, earlier expressed
Bd3459 and Bd0816 upon the next prey encounter and invasion.
Prey-expression of Bd3460 protects against decrosslinking.
That Bd3460 does antagonize Bd3459 activity in an intracellular
niche was shown by the observation that expression of Bd3460 in
E. coli prey significantly reduced the rounding of prey when
attacked by wild-type Bdellovibrio (Fig. 2a). This effect was
also seen for mutant Bdellovibrio with single deletions of either
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884
2NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications
bd0816 or bd3459, providing evidence that activity of both DD-
endopeptidases is antagonized by Bd3460.
High-level expression of Bd3459 from a vector with a tightly
controlled promoter in E. coli cells has previously been shown to
induce bacterial lysis6, with cells rounding up, swelling and finally
bursting. Simultaneous co-expression of Bd3460 resulted in
significant protection from the lytic effect of Bd3459 induction,
with a larger proportion of E. coli cells remaining rod-shaped and
growing by binary fission. That a proportion of the cells were still
deformed and lysed shows that there was an imbalance of the two
interacting species which led to active unbound Bd3459 protein
damaging the cells (Supplementary Fig. 4).
Predator Dbd3460 mutants self-round upon prey recognition.
Attempts to delete bd3460 in predatory Bdellovibrio cells14, grown
on prey, yielded only wild-type revertants or merodiploid strains.
However bd3460 deletions were readily obtained in HI
(host/prey—independent) Bdellovibrio cells grown on artificial
media without prey present. As Bdellovibrio does not prey on
itself, there is no induction, under HI conditions, of Bd3459/
Bd0816, thus the absence of Bd3460 was not detrimental in these
circumstances. The HI strain with the bd3460 deletion was then
offered prey (HI Bdellovibrio do retain predatory abilities14). For
wild-type Bdellovibrio this leads to prey binding, recognition and
invasion (Fig. 3a). However, for the Bd3460 mutant there was a
period of prey-binding and then after 41.5±26.5 min of
attachment the Bdellovibrio cell suddenly (within 3.3±1.4 min)
rounded up (example in Fig. 3b). Thus the Bd3459/Bd0816
DD-endopeptidase enzymes acted upon the self-cell wall of the
Bdellovibrio Dbd3460 mutant. These enzymes were still secreted
from the Dbd3460 mutant into the prey as evidenced by prey
rounding (Fig. 3b). In addition, other damage was observed, such
as leakage of the prey cell contents at the point of Bdellovibrio
contact (Supplementary Fig. 5). This suggests that the predator
was still breaching the prey outer membrane, but was unable to
enter due to its own rounded deformation. The expression of
either Bd0816 or Bd3459 from the Bdellovibrio was sufficient to
cause predator self-rounding in the absence of Bd3460. Double
mutants of Bd3460/Bd3459 and Bd3460/Bd0816 could only be
isolated as host-independent isolates and also rounded up upon
contact with prey cells (Supplementary Fig. 6). Triple mutants of
bd3460/bd3459/bd0816 were readily obtained and were capable of
prey entry similar to wild-type in lab conditions (Supplementary
Fig. 6). These observations fit with electron micrographs of prey
entry, wherein wild-type Bdellovibrio is seen to deform and
‘squeeze’ through an entry pore thinner than the predator cell
width15,16.
Structure of the Bd3460 self-protection ankyrin repeat protein.
The structure of the exported, periplasmic region of Bd3460
(amino acids 26–220, hereafter referred to simply as Bd3460) was
determined from X-ray diffraction data extending to 1.85 Å
resolution (data collection and refinement statistics are provided
in Supplementary Table 1). The structure is comprised of six
sequential ankyrin repeats (AR1–AR6), which stack together to
form the conventional ‘cupped hand’ fold representative of ARPs,
with the short b-strand ‘fingers’ projecting out from the concave
‘palm’ (Fig. 4a). The repeat regions largely conform to the 33
amino acid length of regular ARP motifs, with the longest loop
present between AR3 and AR4 (Fig. 4a, sequence representation
in Supplementary Fig. 7). The region surrounding the AR3:AR4
loop at the ‘centre’ of Bd3460 displays three major deviations
from the ankyrin structural consensus. Firstly amino acids
V126 to G131 form an extended loop that differs from the usual
tight turn present between the fingers of the other repeats of
Bd3460/standard ARPs. Secondly, the crossover region at the end
of AR4 (K154 to N158) is a-helical in nature much like that
observed in the ARP IkBa(ref. 17). Thirdly, the repeats of
Bd3460 can be grouped such that AR1:4 and AR5:6 stack with a
regular angular periodicity, but AR5 is twisted with respect to
AR4. This 4 þ2 arrangement of repeats results in a partial cleft
between these two subdomains, lined by D132, M136, A139,
Q140, A167, A170 and V171. The cumulative effect of the three
deviations from consensus structure is that the central AR3:AR4
loop projects further from the core of Bd3460 than the other
loops, and at a relatively more acute angle. Bd3460 displays
conformational sampling such that chains A to E adopt different
relative flexation between AR4 and AR5 (Fig. 4b).
Architecture of Bd3460 in complex with multiple targets.We
next utilized a modified version of our original Bd3459 construct
(starting post signal peptide with K38 mutated to become the new
N-terminal methionine) that represents a more ‘native’ signal
peptide-processed form of the DD-endopeptidase6. This version
(hereafter simply referred to as Bd3459), was co-expressed with
the exported domain of Bd3460 and the structure of this complex
determined to 1.36 Å resolution (Fig. 5a). The Bd3459:Bd3460
interaction reveals that AR1-3 of the self-protection protein are
located over the endopeptidase active site cleft, whereas AR4-6
contact the final a-helix of the transpeptidase domain
(a9, Fig. 5b). This orientation of binding situates the ankyrin
‘cupped hand’ loops toward the rear face of the enzyme, such that
the active site is blocked by the helix-turn-helix section of the
AR repeats—this inhibition mode is B180°to that commonly
observed for AR-mediated protein interactions, but has precedent
in some ARP complexes e.g., p16Ink4a:Cdk6 (ref. 18).
The Bd3459:Bd3460 interface buries 2372 Å2of surface area,
and is largely polar in nature; 13 hydrogen-bonds, 1 salt bridge,
125 non-bonded contacts; indicating complexation largely via
shape complementarity. Upon comparison with our structures of
the uncomplexed proteins, Bd3459 does not alter in conformation
upon binding, whereas Bd3460 undergoes further flexation
around the region between AR4-AR5 (Fig. 4b). This observation
explains the 4 þ2 arrangement of the repeats, such that the gap
between AR4 and AR5 allows Bd3460 to undergo an induced
fit and contact a patch of Bd3459 around the 346-351 loop
and C-terminal end of helix a9. This interaction would not be
possible if Bd3460 retained the extended conformation of the
MergePhaseFluorescence
T=30T=0 T=180T=60 T=240
Figure 1 | Periplasmic localization of Bd3460 protein. Epifluorescence
phase contrast microscopy of Bdellovibrio with a Bd3460::mCherry tag.
Fluorescence is seen in the small, attack phase cells at times 0 and
240 min, and increases as the Bdellovibrio enter the prey, which rounds up
to form a ‘bdelloplast’. As the Bdellovibrio cell grows inside the bdelloplast,
the fluorescence becomes dissipated in the larger, cylindrical cell
(T¼180 min). Scale bar, 1 mm.
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884 ARTICLE
NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications 3
uncomplexed state. To the best of our knowledge, this
significant conformational rearrangement following ARP target
complexation is unique.
The use by B. bacteriovorus (and related periplasmic predators)
of multiple DD-endopeptidases to decrosslink prey wall, and
our observation of specific neutralization of Bd3459 by Bd3460
raised the question as to whether a similar mechanism is used to
protect against Bd0816. Bd0816 expression was toxic but was
circumvented by mutating the active site Serine residue to
Alanine (S58A). The resulting 2.48 Å structure of the
Bd0816:Bd3460 complex reveals a conserved mode of binding
between the ARP self-protection protein and both predatory
DD-endopeptidase targets (Fig. 6a,b).
The Bd0816:Bd3460 complex could be superimposed onto the
Bd3459:Bd3460 co-ordinates with an RMSD for equivalent atoms
of 0.76–0.94 Å (using different heterodimers of Bd0816:Bd3460
from the asymmetric unit), the conformation of Bd3460 being in
agreement with the induced-fit observation outlined above.
Bd0816 is largely structurally equivalent to Bd3459, with a few
small differences in surface-exposed loops (Fig. 6b; loops involved
in Bd0816 oligomerization). It is striking that we observe a
trimeric form of Bd0816 (burying 1,041 A2of surface area per
monomer, on the borderline for statistically significant
oligomers19). In-vitro characterization of the Bd0816:Bd3460
complex suggests the 1:1 heterodimer likely represents the
dominant form in solution (Supplementary Fig. 8). Comparison
of the residues involved in both complexes illustrates that the
endopeptidase:self-protection protein interface is conserved
(Fig. 6c), and is likely to be representative of protection
mechanisms in related predators. The B. bacteriovorus
housekeeping self endopeptidase Bd3244 (required for growth
in walled bacteria) has notable sequence differences to the
predation endopeptidases6, several of these map onto the Bd3460
interface unique to the predatory enzymes, indicating that
0.9
a
b
0.85 ***
*** ** ** **
**
**
***
*
0.8
HD100+IPTG
HD100–IPTG
0.75
0.7
0.65
Round coefficient
Attachment time (min)
Entry time (min)
0.6
0.55
0.5
45 9
8
7
6
5
4
3
2
1
0
40
35
30
25
20
15
10
5
0
E. coli (pBd3460)
+/– IPTG:
E. coli (pBd3460)
+/– IPTG:
E. coli (pBd3460)
+/– IPTG:
E. coli (pBd1180)
+ IPTG:
Bdellovibrio strain:
Bdellovibrio strain: Bdellovibrio strain:
Bd3459
HD100 ΔBd3459 ΔBd0816
ΔBd3459+IPTG
HD100+IPTG
HD100–IPTG
ΔBd3459+IPTG
ΔBd3459–IPTG
ΔBd0816–IPTG
ΔBd0816+IPTG
HD100+IPTG
HD100–IPTG
ΔBd3459+IPTG
ΔBd3459–IPTG
ΔBd0816–IPTG
ΔBd0816+IPTG
ΔBd3459–IPTG
ΔBd0816+IPTG
ΔBd0816–IPTG
HD100 (1180)+IPTG
HD100
HD100 HD100
ΔBd3459 ΔBd3459ΔBd0816 ΔBd0816
Bd0816
Bd3459
Bd0816
Bd3459
Bd0816
++
+
+
+
+
+
+
+
+
+
+–+–+
+
+
+
+
+
+–
+++
Figure 2 | Heterologous Bd3460 protects prey from rounding and affects predator entry. (a) Graphs showing the average roundness coefficient of
bdelloplasts from phase contrast images. Roundness analysis was carried out on wild-type and endopeptidase knockout-mutant Bdellovibrio infected E. coli
prey cells heterologously expressing Bd3460. Images were taken 90min post-invasion and the roundness of infected prey cells were analysed using ImageJ
software. Roundness of bdelloplasts is reduced in all cases by IPTG induction of bd3460. A negative control of induction of bd1180, a different ankyrin repeat
protein, did not reduce roundness, giving values similar to wild type (0.85 c.f. 0.90 published in Lerner et al.6) Error bars show 95% confidence intervals
and statistical analysis of the means were compared with WT (*Po0.05; ***Po0.001 as determined by Student’s t-test). Data are taken from at least
two independent experiments (n460). (b) Histograms of mean times for attachment (lefthand panel) and invasion (righthand panel) by B. bacteriovorus
HD100 wild type (straight line fill), DBd0816 (diagonal line fill) and DBd3459 (solid fill) strains infecting E. coli S17-1 (pBd3460). Mean attachment time
was measured from initial Bdellovibrio contact with the outside of prey cell to the start of traversal through the prey cell wall. Mean invasion time was
measured from the start of traversal through the prey cell wall to not being visible outside the prey cell, that is, being completely within the prey cell. At
least two independent experiments were carried out (n450) with error bars showing 95% confidence intervals and statistical analyses shown (**Po0.01
***Po0.001 in Student’s t-test).
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884
4NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications
self-wall maintenance would not be compromised by off-target
complexation by Bd3460. The action of Bd3460 to neutralize two
differing targets suggests intricate co-evolution, analysis of which
will be revealed by large-scale sequencing of further predatory
genomes.
The DD-endopeptidase substrate peptidoglycan is a large (and
branched) molecule, and our structures indicate that the binding
interface of the endopeptidase:Bd3460 complexes blocks substrate
turnover without the need for extensive, active site-centered
contacts (for example, like those observed in the b-lactamase-
inhibitory protein:TEM b-lactamase complex20). The availability
of the active site catalytic serine of the endopeptidase in the
Bd3460-bound form (Fig. 5c) agrees well with the finding that
acylation of Bd3459 with penicillin G had only a minor effect on
complex formation. Indeed, we were able to demonstrate this
further by acylating pre-grown Bd3459:Bd3460 complex crystals
with penicillin G (Supplementary Fig. 9), hence Bd3459 retains
activity and acylation propensity in complex and endopeptidase
function is blocked via steric occlusion with Bd3460.
Model for self-protection during prey invasion by predators.
The in vivo and in vitro evidence suggest a model where Bd3460
is exported to the periplasm and persists there, acting to inhibit
Bd3459 and Bd0816 function after folding in the periplasm and
before reaching the cell wall target in prey. The protein complexes
show that the interaction face involves the signal peptide cleavage
site for Bd3459/Bd0816, hence binding may potentially be
strongest to the mature form of these enzymes and thus not
interfere with secretion and/or processing by signal peptidase,
with Bd3460 forming protective complexes only in the periplasm.
The simplest scenario for self-protection, coupled to effective
rounding of prey, would be to retain Bd3460 and differentially
secrete Bd3459/Bd0816. The induced fit of Bd3460 upon binding
the DD-endopeptidases could potentially be exploited to lessen
any interaction and aid Bd3459/Bd0816 ‘stripping’ during final
export into prey. Periplasmically retained Bd3460 (visualized as
an abundant Bd3460:mCherry fluorescent signal) would be able
to inhibit Bd0816, compensating for its expression from its
genetic locus outside of the bd3459/bd3460 operon.
Heterologous expression of Bd3460 in prey did not abolish
predator entry (as for the double endopeptidase mutant
Bdellovibrio) although deletion of Bd3460 in Bdellovibrio
produced a cell that puffed up and did not enter prey.
Furthermore it is clear that prey naturally acquiring the gene to
express Bd3460 in their periplasm would not be immune
from Bdellovibrio entry, consistent with the observations that
Bdellovibrio have a wide prey range and that natural resistance
is not seemingly easily acquired4. The ‘puffing up’ of the
DBd3460 Bdellovibrio after a period of binding to and
recognizing the prey cell may represent a useful tool to discern
prey recognition.
The acquisition/source of the bd3460 gene during the evolution
of invasive predatory Bdellovibrio is as yet unknown. The ankyrin
repeat residue conservation complicates homology searches, but
the highest-ranked BLAST hit for Bd3460 from a non-predatory
bacterium is an ARP from the spirochete Leptospira kirschneri
(UniProt accession code K6IH47; in an operon with a protease).
Ancient lateral gene transfer to the Bdellovibrio genome of genes
from spirochaete genomes has been noted by Gophna et al.21 and
is predicted to represent key stages in the evolution of predation.
Wild-type predator
a
b
c
ΔBd3460 predator
Bb
Δ3460
T=0 T=7
T=17.5 T=45
T=5T=0
T=53 T=58
Bb
wt Round
Rod
Round
Round
Prey
Prey
Figure 3 | DBd3460 Bdellovibrio self-round upon initiating prey cell
entry. Epifluorescence phase contrast microscopy of Bdellovibrio (small,
phase dark, comma-shaped cells) preying upon E. coli prey cells which have
periplasms constitutively fluorescently labelled by a pMal::mCherry fusion.
A cartoon representation is presented above each. (a) Control using host
independent strain HID22 which is wild-type for Bd3460 (Bb wt) and
shows typical attachment to and entry into the prey cell which is rounded
up in the process. (b)DBd3460 host independent strain (Bb D3460)
attaches to the prey cell in a manner similar to the wild-type control, but
then rounds up itself, preventing entry into the prey cell. (c) Representative
electron micrographs showing the different stages of attachment,
Bdellovibrio rounding, and prey rounding. Scale bars, 1 mm ; time is
indicated in minutes.
AR1
a
b
N
N
AR2 AR3 AR4 AR5
AR6
α*
C
Y174
C
Q210
Figure 4 | Structure of the endopeptidase self-protection protein
Bd3460. (a) Sequential ankyrin repeats (AR) form the core of Bd3460,
with a crossover helix (a*) between AR4/5; the AR4:AR5 packing differs
from the other repeats, leading to a ‘4 þ2’ arrangement. (b) View B90°
from that in a, demonstrating relative flexation between the extended
(orange, unbound chain A) and endopeptidase target-complexed (blue)
forms of Bd3460, residues Y174 and Q210 represented in stick form to
guide interpretation (AR1-4 conformation common to all forms, coloured
white; chains B–E of unbound form represent states of intermediate
conformation and are rendered transparent for clarity).
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884 ARTICLE
NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications 5
The acquisition and diversification of an ancient ARP may have
increased selection for the gene duplication and diversification of
a housekeeping DD-endopeptidase (like the modern Bd3244 for
self-wall modification and growth) and its recombination at the
ARP gene locus. Ultimate co-expression of the two may have
allowed the predatory DD-endopeptidase gene(s) to evolve from
the housekeeping form without causing damage to the predator
cell wall. The prevalence of ARPs as effectors in intracellular
parasites and symbionts such as Coxiella,Wolbachia and
Legionella is also of note10,11, and a recent report detected
homology between the mevalonate-metabolizing proteins of
Bdellovibrio and Legionella pneumophila, suggesting that gene
transfer between the two is possible22. Other ARPs can be
identified in the B. bacteriovorus HD100 genome, one of
which (Bd1180) is in an operon with the peptidoglycan
LD-transpeptidase Bd1181 (ref. 23), hence our identification of
ankyrin repeat protein Bd3460 as a key player in self-protection
may lead us to identify important enzymes in the predatory
process by locating putative immunity protein:effector pairs and
we predict that Bd1181 and Bd1180 will act in a similar paired
way to manipulate prey while protecting self.
In summary, we conclude that we have identified and
characterized the first ever self-protection protein encoded
by predatory bacteria—ankyrin repeat protein Bd3460 from
Bdellovibrio inhibits the prey wall decrosslinking enzymes
Bd3459/Bd0816 and in doing so protects the predator from
the shape transition that this catalyses in prey. The Bd3459/
Bd0816:Bd3460 relationship is integral to Bdellovibrio
predation, regulating prey entry and self-protection (Bd3460)
and also niche formation and population fitness (Bd3459/
Bd0816). We therefore regard the Bd3459/Bd0816:Bd3460
interaction as a key predatory adaptation and a significant step
in understanding the hierarchical biochemical timeline of staged
prey recognition and invasion and the evolution of an
intracellular lifestyle.
Methods
RNA isolation from predatory cycle and RT-PCR analysis.Synchronous
predatory infections of B. bacteriovorus HD100 by predation with MOI42in
100 ml 2 mMCaCl
2
/25mMHEPES buffer pH 7.6 on E. coli S17-1 as well as S17-1
alone were set up as previously described24. Samples were taken throughout the
timecourse and total RNA isolated from them. RNA was isolated from the samples
using a Promega SV total RNA isolation kit with the RNA quality being verified by
an Agilent Bioanalyser using the RNA Nano kit. RT-PCR was performed with the
Qiagen One-step RT-PCR kit with the following reaction conditions: One cycle
50 °C for 30 min, 95 °C for 15 min, then 25 cycles of 94 °C for 1 min, 48 °C for
1 min, 72 °C for 2 min and finally a 10 min extension at 72 °C after the 30 cycles,
and finally a 4 °C hold. All experiments were carried out with at least two biological
repeats. Primers used to anneal to bd3460 were 50-TTTCCTCGCGGGCCTTC
TGC-30and 50-GGCCAGATCACCTTGTTCCGCC-30. Primers used to anneal to
bd3459 were 50-ACAAGTCCCGCTCTGACTGGG-30and 50-GTACTTGATTGC
TTTTGGTCCGCCG-30.
Fluorescent tagging of Bd3460.The bd3460 gene was cloned into the
pK18mobsacB mobilizable vector in such a way as to fuse the gene at the
C-terminus with the mCherry gene, using the NEB Gibson assembly kit. The
primers used to amplify bd3460 were: 50-CGACGGCCAGTGCCAATGAAAAAAT
CCTATCTGCTG-30and 50-CTCACCATTTTCTTTTTGGAGAGAGCTTTTG-30
and to amplify mcherry: 50-CAAAAAGAAAATGGTGAGCAAGGGCGAG-30
and 50-CTATGACCATGATTACGTTACTTGTACAGCTCGTCCATG-30. This
construct was introduced to Bdellovibrio via conjugation from E. coli S17-1 donor
strain, mating overnight at 29°C with B. bacteriovorus HD100 on a nitrocellulose
filter on a PY (10 g l 1peptone, 3 g l 1yeast extract) agar plate, before selection
for exconjugants by 50 mgml1kanamycin sulphate in YPSC double layer agar
plates (1 g l 1peptone, 1 g l 1yeast extract, 0.5 g l1anhydrous sodium acetate,
0.25 g l 1M
g
SO
4
.7H
2
O, pH 6.8), as described previously25,26.
Heterologous expression of Bd3460 and roundness measurement.Phase
contrast time-lapse microscopy was carried out on predation by Bdellovibrio of
E. coli S17-1 harbouring the pET26b expression vector with the bd3460 gene under
the control of an IPTG inducible promoter. The prey E. coli were grown in YT
broth (8 g l 1bacto-tryptone, 5 g l 1yeast extract, 5 g l 1NaCl, pH 7.5) for 16 h
with shaking at 200 r.p.m. with kanamycin sulphate selection at 50 mgml1either
with or without 200 mgml1IPTG induction before being washed and con-
centrated five times in Ca/HEPES buffer by centrifugation for 2 min at 17,000g.
Bdellovibrio cultures were grown for 16 h as a prey lysate in 50 ml Ca/HEPES buffer
on 3 ml E. coli S17-1 prey as described previously22,24 before being concentrated
AR6
AR1
b
c
a
*
AR6
A207 S208 N209
Q210
T176
D211
R173
Y174
R137
G128
A127
G95
E97
S391
K390
D389
S393
G396
V397
Q400
N404
S407
Q408
N411
G414
K374
P416
V349
G348
G347
K403
W346
S345
S399
K154 P155
W395
Y388
R392
V297
N94
N93
T62
F102
M64
K31 Q39
Q140
T105
N141
N142
Y109
D107
N106
M72
G74
N75
G40
E38
*
Figure 5 | Details of the Bd3459 endopeptidase:Bd3460 auto-immunity protein complex. (a) An extensive interaction places all six ankyrin repeats
of Bd3460 (ribbon form, red) over the upper, transpeptidase lobe of Bd3459 (ribbon form, helices sky blue, strands yellow; active site serine in stick form
and denoted by asterisk; active site extended loop, dark blue). A small pocket of solvent exists at the protein interface. (b) Orthogonal view from a,
demonstrating that AR1:6 of Bd3460 effectively wrap around the final helix of the Bd3459 transpeptidase domain, interacting via the helix-turn-helix
section of the repeats. (c) Interacting partners have been rotated like an open book from orientation in a, Bd3459 90°to left, Bd3460 90°to right.
The interaction face of Bd3459 (blue) is comprised of two continuous regions that abut, but do not comprise the active site cleft (catalytic serine coloured
red). In contrast, the interacting face of Bd3460 (pink) is formed from a single face of the protein.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884
6NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications
50 times in Ca/HEPES buffer by centrifugation for 2 min at 17,000g. The
concentrated preparations of predator and prey were mixed and immediately
added to a microscope slide with a layer of 0.3% agarose in Ca/HEPES buffer to
immobilise the prey cells. Immobilized cells were visualized using a Nikon Eclipse
E600 microscope using a 100 objective lens (numerical aperture (NA), 1.25) and
an exposure time of 0.1 s. Images were acquired using a Hamamatsu Orca ER
camera and the Simple PCI software (version 6.2 from Digital Pixel). An H101A xy
motorized stage (Prior Scientific) allowed precise revisiting of different locations on
the slide (minimum step size, 0.01 mm), and a frictional z-axis controller (minimum
step size, 2 nm) in conjunction with the Simple PCI software allowed fine
autofocusing on immobilized developing bdelloplasts. Images were enhanced using
either (or both) the ‘sharpen’ and ‘smooth’ tools in the Image J software to provide
additional clarity. To investigate the differing bdelloplast shapes quantitatively,
traces of the bdelloplasts in 90 min images were made and measures of ellipticity
were taken using the Image J software to find an average ‘roundness’ coefficient for
each invading Bdellovibrio strain and prey combination.
Co-expression of Bd3459 and Bd3460 in E. coli.The bd3460 gene was intro-
duced into the pET26b vector by recombineering, using the primers 50-CCTCGC
TGCCCAGCCGGCGATGGCCTCAGGGAAGTCCAGCAAGGCCTTG-30and
50-CTCAGTGGTGGTGGTGGTGGTGCTCGAGTTATTTCTTTTTGGAGAGAG
CTTTTGC-30. An apramycin resistance cassette was then introduced in place of
the kanamycin resistance cassette. The Bd3459 construct in the pBADHisA vector,
with Bd3459 under control of a promoter inducible by arabinose, has been described
previously6, and was modified to introduce an apramycin resistance cassette in place
of the ampicillin or kanamycin resistance cassette. The two vectors could then be
maintained in E. coli with apramycin and kanamycin selection. E. coli Top10
(Bd3459pBADapra þBd3460pET26bkan) were backdiluted to OD
600
of 1.0, pre-
incubated 1 h with selection (with or without IPTG), then 10ul was put on pads
consisting of 1% agarose YT þ0.2% arabinose on slides for microscopy with images
acquired every 150 s with the microscopy setup as above. Images at every hour were
then analysed by manually scoring cells as intact or damaged and numbers were
expressed as a percentage. As a result of cell growth, it was not possible to accurately
score images after 4 h as large damaged cells merged together. A minimum of two
biological repeats and N¼220–1,062 for each timepoint, with more cells counted at
the later timepoints. T-test gave values of Po0.001 for t¼2, 3 and 4 h.
Cloning of Bd3460 and co-expressed endopeptidases.Overexpression con-
structs were generated by a restriction-free cloning strategy27. In brief, nucleotide
primer pairs complementary to both the target gene (at the 30end of each primer)
and destination vector (at the 50end of each primer) were used to generate PCR
products which were subsequently inserted into plasmids by a second PCR
reaction.
Primer pairs 50-GTTTAACTTTAAGAAGGAGATATACATATGTCAGGGA
AGTCCAGCAAGGCCTTG-30and 50-GTGGTGGTGGTGGTGGTGCTCGAGT
TTCTTTTTGGAGAGAGCTTTTGC-30were used to amplify the region encoding
the predicted secreted form of Bd3460 (starting at Ser26 with mutation of Ala25 to
become the new N-terminal methionine, and placing a non-cleavable LEH
8
peptide
tag on the C-terminal end of the protein) for cloning into a modified version of the
expression plasmid pET41 (Novagen, altered to remove glutathione S-transferase
(GST)).
A new variant of the predicted secreted form of Bd3459 was also cloned into
modified pET41 using primers 50-TTTAACTTTAAGAAGGAGATATACATA
TGAAAGTTTACTTGAATTCCATGTGCC-30and 50-TTAGTGGTGGTGGTGG
TGGTGGTGGTGCTCG AGTTTCTTCTCTGTCGTGATAGTGTTC-30, yielding
a construct similar to that described previously but starting with codon K38M
as opposed to A37M6. Bd0816 was cloned into modified pET41 using primers
50-TTTAACTTTAAGAAGGAGATATACATATGGTTTATGTCAATTCCGT
CTG-30and 50-TTAGTGGTGGTGGTGGTGGTGGTGGTGCTCGAGCTTCT
TGGAAAGATTCACAAC-30, starting at K26M.
ab
c
Figure 6 | Complexation of the Bd3460 self-protection protein with the second endopeptidase partner Bd0816. (a) Heterohexameric Bd0816
3
:Bd3460
3
complex, with a single pair (Bd0816, orange; Bd3460, red) in bold and remainder of hexamer transparent (Bd0816, yellow; Bd3460, pink).
(b) Superimposition (using Bd3460, transparent) of the related Bd3459 and Bd0816 endopeptidases (blue and orange, respectively). The largest structural
difference between the two targets forms part of the Bd0816 trimer interface (circled)—generally the folds show high equivalence. (c) Bd0816/Bd3459:
Bd3460 interaction face comparison; Bd3459 (blue) and Bd0816 (orange) display a common, conserved interface (labels in bold type, standard stick form;
located largely at the final transpeptidase domain ahelix highlighted in Fig. 5b) at the core of the interaction, surrounded by a less conserved ‘halo’ of
variant interacting residues (labels in normal type, transparent stick form).
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884 ARTICLE
NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications 7
For co-expression of proteins, Bd3460 was cloned into pCDF-Duet1 (Novagen)
using primers 50-GTTAAGTATAAGAAGGAGATATACATATGTCAGGGAAG
TCCAGCAAGGCC-30and 50-GGTGGCAGCAGCCTAGGTTAATTATTTCTT
TTTGGAGAGAGCTTTTGC-30. The resultant plasmid, which contained Bd3460
sequences as described above (but not fused to a purification tag) was used as the
destination vector for sequential cloning of Bd3459 (50-GTTTAACTTTAAGAAG
GAGATATACCAT GGTTTACTTGAATTCCATGTGCCATATGG-30and
50-CGATTACTTTCTGTTCGACTTAAGCATTAGTGGTGGTGGTGGTGGTG
GTGGTGCTC-30) or Bd0816 (primers 50GTTTAACTTTAAGAAGGAGATA
TACCAT GGTTTATGTCAATTCCGTCTG-30and 50-CGATTACTTTCTGTTC
GACTTAAGCATTAGTGGTGGTGGTGGTGGTGGTGGTGCTC-30). Bd3459
and Bd0816 fragments for this second cloning stage were amplified from the
corresponding pET41 derived plasmids to provide C-terminally H
8
tagged
endopeptidases.
The Bd3459 S70A and Bd0816 S58A mutants were generated via standard
Quikchange protocol (Stratagene). All constructs were confirmed by sequencing,
and introduced into the E. coli expression strain T7 express (New England
BioLabs).
Protein expression and purification.For purification of Bd3460, cells were grown
at 37 °C until reaching an OD
600
of B0.6, then gene expression induced with 1 mM
IPTG for 20 h at 20 °C. Harvested cells (B12 g from 1 l cell culture in TB
medium) were resuspended by tumbling in 45 ml resuspension buffer (20 mM
Hepes pH 7.2, 0.25M NaCl, 5% w/v glycerol, 20 mM imidazole and 10 mM sodium
cholate) and lysed using sonication. Unbroken cells were pelleted by centrifugation
at 6,000gfor 20 min, the supernatant clarified by a second centrifugation at
200,000gfor 1 h and the final supernatent applied to a 1 ml Hi-Trap His column,
pre-equilibrated in modified buffer A (lacking sodium cholate). Fractions were
eluted in a stepwise manner, using buffer A containing 40 and 300 mM imidaz ole.
Approximately pure fractions of Bd3460 were dialysed overnight in buffer B
(10 mM Hepes pH 7.2, 0.25 M NaCl) and concentrated to a protein concentration
of B20 mg ml 1. Bd3459 (original construct) and Bd3459 new variant (K38M
start, S70A) were both expressed and purified as reported previously for Bd3459
(ref. 6).
Similar strategies were employed for the overexpression and purification of the
Bd3459/Bd3460 and Bd0816 S58A/Bd 3460 complexes. Buffer C (20 mM imidazole
pH 8.0, 0.4 M NaCl, 0.05% w/v Tween20) was used for resuspensio n of cells and in
the place of buffer A for the purification of complexes. Purified complexes were
dialysed overnight into buffer D (20 mM Bis-Tris pH 6.5, 0.2 M NaCl) and were
concentrated to B25 and B30 mg ml 1for the Bd3459/Bd3460 and Bd0816
S58A/Bd3460 complexes, respectively.
Analytical gel filtration experiments were performed on a HiLoad 26/60
Superdex 200 column (GE Healthcare) using buffer D (20 mM Bis-Tris pH 6.5,
0.5 M NaCl).
Crystallization and structure determination.Crystals were grown by the
hanging drop method at 18 °C, using 1 ml of protein solution mixed with an equal
volume of reservoir solution. Initial apo-Bd3460 crystallization conditions were
identified in Midas screen II condition #27 (40% v/v glycerol ethoxylate28).
Crystals of Bd3459 S70A were grown in JCSG-plus screen II condition #33
(0.1 M potassium thiocyanate; 30% w/v PEG 2000 MME). The Bd3459/Bd3460 and
Bd0816 S58A/Bd3460 complexes crystallized in JCSG-plus screen II conditions #14
(0.1 M citrate, pH 5.0; 3.2 M ammonium sulphate) and #47 (0.1M Hepes, pH 7.5;
0.2 M MgCl
2
; 25% w/v PEG 3350), respectively. Crystals of the Bd3459M/Bd3460
complex were incubated with reservoir solution supplemented with 2 mM
penicillin G for one hour to yield an additional, acylated complex structure.
All crystals were directly flash cooled in liquid nitrogen and diffraction data
were collected at the Diamond Light Source, Oxford. Data were processed using
XDS29 and SCALA, and data file manipulations performed using the CCP4 suite of
programs30. A heavy atom derivative was obtained by growing Bd3460 crystals
directly in the presence of 300 mM Potassium Iodide (data collected on a home
source, CuK
a
, Rigaku Micromax generator). Phasing of the derivative was
accomplished using a combination of SHARP31 and PHENIX32 (FOM of 0.43,
20 I sites); the resultant phases were improved by applying manually derived
non-crystallographic symmetry operators (five independent chains are present in
the unit cell). After autobuilding in PHENIX, the remaining parts of the molecule
were built manually using COOT33 and model refinement used PHENIX32
and the PDB-REDO server34. Complex structures were phased using molecular
replacement with the Bd3460 and Bd3459Misolated structures and the program
PHASER35 and built/refined as outlined above. The final models are of excellent
stereochemical quality (Table 1).
The closest non-synthetic structural neighbor of Bd3460 (as calculated by
DALI36) is the uncharacterized ARP EF0377 from Enterococcus faecalis (PDB 3hra,
RMSD 2.5 Å over 167AA alignment), although Bd3460 shares slightly higher
structural homology to various DARPins (designed ankyrin repeat proteins,
engineered for affinity purposes, for example, PDB codes 4hb5, 3nog).
All structural figures were generated using the program Chimera37.
Enzyme activity measurements.Incubation of Bd3459 with isolated sacculi
(±the presence of Bd3460) and subsequent HPLC analysis of cellosyl products
(muropeptides) utilized an identical protocol to that documented in the original
Bdellovibrio endopeptidase study6.
Tryptophan fluorescence ligand binding measurements.Intrinsic tryptophan
fluorescence ligand binding experiments were carried out using a Hitachi F-7000
fluorescence spectrophotometer. The excitation wavelength was set at 280 nm and
the fluorescence emission (F
emission
) spectra was recorded between 300–400 nm.
Purified Bd3459 was diluted with buffer B (Hepes switched to Tris) to a final
concentration of 10 mM loaded into a quartz cuvette (final volume of 400 ml)
equilibrated to a chamber temperature of 25 °C. Bd3460 was sequentially titrated
against Bd3459 with F
emission
recorded between each addition. On occasions,
0.75 mM penicillin G was pre-incubated with Bd3459 before being titrated with
Bd3460. GraphPad Prism software was used to plot the change in fluorescence
Table 1 | Data collection and refinement statistics.
Bd3460 native Bd3460 iodine
derivative
Bd3459 K38M,S70A
variant
Bd3459:Bd3460
complex
Bd0816:Bd3460
complex
Bd3459:Bd3460
PenG
Accession code 5CEA 5CEB 5CEC 5CER 5CED
Data collection
Space group P2
1
2
1
2
1
P2
1
2
1
2
1
P1 P2
1
2
1
2
1
P2
1
2
1
2P2
1
2
1
2
1
Cell dimensions
a,b,c(Å) 57.43, 99.64,
173.70
57.13, 99.18, 173.33 55.93, 65.04, 73.82 51.61, 59.17, 192.27 212.32, 237.45,
90.90
51.54, 59.16,
192.04
a,b,g(°) 90, 90, 90 90, 90, 90 63.89, 83.27, 83.20 90, 90, 90 90, 90, 90 90, 90, 90
Resolution (Å) 1.85 (1.95–1.85)* 2.4 (2.53–2.4) 1.93 (1.98–1.93) 1.36 (1.4–1.36) 2.48 (2.54–2.48) 2.02 (2.07–2.02)
R
sym
7.0 (49.3) 6.3 (31.0) 3.6 (76.6) 3.2 (51.6) 15.6 (75.3) 6.7 (67.2)
R
pim
6.0 (42.9) 1.6 (26.7) 2.5 (54.9) 2.0 (41.9) 4.6 (21.5) 3.1 (30.8)
CC 1/2w0.99 (0.65) 0.99 (0.79) 0.99 (0.78) 0.99 (0.78) 0.99 (0.85) 0.99 (0.80)
I,/sI10.0 (2.5) 34.4 (2.7) 16.2 (1.6) 23.4 (2.4) 15.1 (3.8) 16.2 (2.8)
Completeness(%) 99.0 (100.0) 89.5 (47.8) 85.7 (79.2) 97.2 (77.8) 99.0 (99.5) 99.9 (99.9)
Redundancy 3.8 (3.7) 13.9 (2.0) 3.8 (3.7) 6.0 (3.7) 13.5 (14.0) 6.5 (6.7)
Refinement
Resolution (Å) 1.85 1.93 1.36 2.48 2.02
R
work
/R
free
17.8/21.0 19.8/23.2 14.3/16.9 21.7/24.9 17.3/20.7
r.m.s. deviations
Bond lengths (Å) 0.017 0.016 0.011 0.014 0.014
Bond angles (°) 1.75 1.63 1.44 1.68 1.60
*Values in parentheses are for highest resolution shell.
wCC 1/2 is the correlation coefficient between two random half data sets.
ARTICLE NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884
8NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications
emission (DF
emission
)atl
340nm
versus [Bd3460] and data were fitted to a one
site-specific binding isotherm (DF
emission
¼F
max
L/(K
d
þL), where F
max
indicates
the maximum change in fluorescence emission, K
d
is the binding constant and Lis
the concentration of ligand (Bd3460).
References
1. Sockett, R. E. & Lambert, C. Bdellovibrio as therapeutic agents: a predatory
renaissance? Nat. Rev. Microbiol. 2, 669–675 (2004).
2. Shatzkes, K. et al. Examining the safety of respiratory and intravenous
inoculation of Bdellovibrio bacteriovorus and Micavibrio aeruginosavorus in a
mouse model. Sci. Rep. 5, 12899 (2015).
3. Starr, M. P. in Symposium of the Society for Experimental Biology 29,
93–104 (1975).
4. Sockett, R. E. Predatory lifestyle of Bdellovibrio bacteriovorus.Annu. Rev.
Microbiol. 63, 523–539 (2009).
5. Stolp, H. & Starr, M. P. Bacteriolysis. Annu. Rev. Microbiol. 19, 79–104 (1965).
6. Lerner, T. R. et al. Specialized peptidoglycan hydrolases sculpt the intra-
bacterial niche of predatory Bdellovibrio and increase population fitness. PLoS
Pathog. 8, e1002524 (2012).
7. Lambert, C., Smith, M. C. & Sockett, R. E. A novel assay to monitor
predator-prey interactions for Bdellovibrio bacteriovorus 109 J reveals a role
for methyl-accpeting chemotaxis proteins in predation. Environ. Microbiol. 5,
127–132 (2003).
8. Berg, H. C. & Purcell, E. M. Physics of chemoreception. Biophys. J. 20, 193–219
(1977).
9. Zhang, D., de Souza, R. F., Anantharaman, V., Iyer, L. M. & Aravind, L.
Polymorphic toxin systems: comprehensive characterization of trafficking
modes, processing, mechanisms of action, immunity and ecology using
comparative genomics. Biol. Direct. 7, 18 (2012).
10. Al-Khodor, S., Price, C. T., Kalia, A. & Abu Kwaik, Y. Functional diversity of
ankyrin repeats in microbial proteins. Trends Microbiol. 18, 132–139 (2010).
11. Pan, X., Luhrmann, A., Satoh, A., Laskowski-Arce, M. A. & Roy, C. R. Ankyrin
repeat proteins comprise a diverse family of bacterial type IV effectors. Science
320, 1651–1654 (2008).
12. Crossman, L. C. et al. A small predatory core genome in the divergent marine
Bacteriovorax marinus SJ and the terrestrial Bdellovibrio bacteriovorus.ISME J.
7, 148–160 (2013).
13. Pasternak, Z. et al. In and out: an analysis of epibiotic vs periplasmic bacterial
predators. ISME J. 8, 625–635 (2014).
14. Capeness, M. J. et al. Activity of Bdellovibrio hit locus proteins, Bd0108 and
Bd0109, links Type IVa pilus extrusion/retraction status to prey-independent
growth signalling. PloS ONE 8, e79759 (2013).
15. Abram, D. & Davis, B. K. Structural properties and features of parasitic
Bdellovibrio bacteriovorus.J. Bacteriol. 104, 948–965 (1970).
16. Evans, K. J., Lambert, C. & Sockett, R. E. Predation by Bdellovibrio
bacteriovorus HD100 requires type IV pili. J. Bacteriol. 189, 4850–4859 (2007).
17. Jacobs, M. D. & Harrison, S. C. Structure of an IkappaBalpha/NF-kappaB
complex. Cell 95, 749–758 (1998).
18. Russo, A. A., Tong, L., Lee, J. O., Jeffrey, P. D. & Pavletich, N. P. Structural basis
for inhibition of the cyclin-dependent kinase Cdk6 by the tumour suppressor
p16INK4a. Nature 395, 237–243 (1998).
19. Krissinel, E. & Henrick, K. Inference of macromolecular assemblies from
crystalline state. J. Mol. Biol. 372, 774–797 (2007).
20. Strynadka, N. C., Jensen, S. E., Alzari, P. M. & James, M. N. A potent new
mode of beta-lactamase inhibition revealed by the 1.7 A X-ray crystallographic
structure of the TEM-1-BLIP complex. Nat. Struct. Biol. 3, 290–297 (1996).
21. Gophna, U., Charlebois, R. L. & Doolittle, W. F. Ancient lateral gene transfer
in the evolution of Bdellovibrio bacteriovorus.Trends Microbiol. 14, 64–69
(2006).
22. Pasternak, Z. et al. By their genes ye shall know them: genomic signatures of
predatory bacteria. ISME J. 7, 756–769 (2013).
23. Rendulic, S. et al. A predator unmasked: life cycle of Bdellovibrio bacteriovorus
from a genomic perspective. Science 303, 689–692 (2004).
24. Lambert, C. et al. Characterizing the flagellar filament and the role of motility
in bacterial prey-penetration by Bdellovibrio bacteriovorus.Mol. Microbiol. 60,
274–286 (2006).
25. Fenton, A. K., Lambert, C., Wagstaff, P. C. & Sockett, R. E. Manipulating each
MreB of Bdellovibrio bacteriovorus gives diverse morphological and predatory
phenotypes. J. Bacteriol. 192, 1299–1311 (2010).
26. Lambert, C. & Sockett, R. E. Laboratory maintenance of Bdellovibrio.Curr.
Protoc. Microbiol. Chapter 7, Unit 7B 2 (2008).
27. van den Ent, F. & Lowe, J. RF cloning: a restriction-free method for inserting
target genes into plasmids. J. Biochem. Biophys. Methods 67, 67–74 (2006).
28. Grimm, C., Chari, A., Reuter, K. & Fischer, U. A crystallization screen based on
alternative polymeric precipitants. Acta. Crystallogr. D Biol. Crystallogr. 66,
685–697 (2010).
29. Kabsch, W. Integration, scaling, space-group assignment and post-refinement.
Acta Crystallogr. D Biol. Crystallogr. 66, 133–144 (2010).
30. Winn, M. D. et al. Overview of the CCP4 suite and current developments. Acta.
Crystallogr. D. Biol. Crystallogr. 67, 235–249 (2011).
31. Vonrhein, C., Blanc, E., Roversi, P. & Bricogne, G. Automated structure
solution with autoSHARP. Methods Mol. Biol. 364, 215–230 (2007).
32. Zwart, P. H. et al. Automated structure solution with the PHENIX suite.
Methods Mol. Biol. 426, 419–435 (2008).
33. Emsley, P. & Cowtan, K. Coot: model-building tools for molecular graphics.
Acta. Crystallogr. D. Biol. Crystallogr. 60, 2126–2132 (2004).
34. Joosten, R. P., Long, F., Murshudov, G. N. & Perrakis, A. The PDB_REDO
server for macromolecular structure model optimization. IUCrJ 1, 213–220
(2014).
35. McCoy, A. J. et al. Phaser crystallographic software. J. Appl. Crystallogr. 40,
658–674 (2007).
36. Holm, L. & Sander, C. Dali: a network tool for protein structure comparison.
Trends Biochem. Sci. 20, 478–480 (1995).
37. Pettersen, E. F. et al. UCSF Chimera—a visualization system for exploratory
research and analysis. J. Comput. Chem. 25, 1605–1612 (2004).
Acknowledgements
We are grateful to Klaus Futterer for many interesting discussions and Ana Clark for
investigative work in the initial stages of the project. This work was supported by BBSRC
grant BB/J015229/1 awarded to R.E.S. and A.L.L., and the Wellcome Trust Senior
Investigator Award (101824/Z/13/Z) to W.V. We thank beamline staff at Diamond light
source, Didcot UK.
Author contributions
C.L. performed experiments for heterologous expression studies in E. coli, heterologous
expression abrogating effects on predation, cloning and microscopy for fluorescence
tagging, generated mutants and microscopy of mutant phenotypes and RT-PCR repeats.
A.L. and I.C. cloned constructs, expressed, purified and crystallized proteins, collected
data and determined/refined/interpreted structures. R.T. screened for and confirmed
mutants and performed fluorescent microscopy. T.L. performed initial RT-PCR. K.B.
analysed muropeptide turnover; W.S.H. and L.J.A. performed fluorescence experiments
quantifying protein interactions; D.J.L. cloned constructs; A.L.L. and R.E.S. designed the
study and wrote the manuscript with C.L., W.V. and I.C.
Additional information
Accession codes: Crystallographic data have been deposited in the RCSB Protein Data
Bank under accession codes 5CEA (Bd3460), 5CEB (Bd3459 K38M new construct),
5CEC (Bd3459:Bd3460 complex), 5CED (Bd3459:Bd3460 complex acylated with peni-
cillin G) and 5CER (Bd0816:Bd3460 complex).
Supplementary Information accompanies this paper at http://www.nature.com/
naturecommunications
Competing financial interests: The authors declare no competing financial interests.
Reprints and permission information is available online at http://npg.nature.com/
reprintsandpermissions/
How to cite this article: Lambert, C. et al. Ankyrin-mediated self-protection during cell
invasion by the bacterial predator Bdellovibrio bacteriovorus.Nat. Commun. 6:8884
doi: 10.1038/ncomms9884 (2015).
This work is licensed under a Creative Commons Attribution 4.0
International License. The images or other third party material in this
article are included in the article’s Creative Commons license, unless indicated otherwise
in the credit line; if the material is not included under the Creative Commons license,
users will need to obtain permission from the license holder to reproduce the material.
To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/
NATURE COMMUNICATIONS | DOI: 10.1038/ncomms9884 ARTICLE
NATURE COMMUNICATIONS | 6:8884 | DOI: 10.1038/ncomms9884 | www.nature.com/naturecommunications 9

Supplementary resource (1)

... Stage IV -Formation du bdelloplaste et croissance : En plus des protéases, Lambert et al. (2015) ont décrit l'activité de la glycanase qui permet de solubiliser les peptidoglycanes de la proie au début et en cours d'invasion. En effet, deux peptidoglycanes (DD-endopeptidases Bd0816 et Bd3459) rompent les liaisons covalentes entre les chaines de polymère (« decrosslinking ») de la paroi cellulaire en hydrolysant la structure 3-4 peptide crosslinks. ...
... La phase de croissance intrapériplasmique est alors entamée (Chauhan et al., 2009a). Le signal d'occupation généré par la DD-endopeptidase provoque la formation du « bdelloplaste » (Lambert et al., 2015). Précisément, la proie infectée est convertie en une structure hybride proie-prédateur (Van Essche et al., 2011), et la forme de la proie change à cause d'un procédé impliquant une hydrolyse des liaisons peptidiques de la paroi cellulaire et de la dégradation des biopolymères Dans certains cas, la morphologie initiale de la proie peut être maintenue tout au long du processus de prédation (Chen et Williams, 2012). ...
... Malgré l'observation de cette préférence de prédation, aucun mécanisme tel que la présence de sites récepteurs ou de signaux de chimiotaxie n'a été identifiés pour l'expliquer (Rogosky et al., 2006). En général, la chimiotaxie chez les BALOs joue un rôle mineur (Lambert et al., 2015). La question est donc de savoir comment les BALOs arrivent à intercepter leurs proies ? ...
Thesis
Bdellovibrio and like organisms (BALOs) are a functional group of Gram-negative bacteria belonging to the classes of Oligoflexia and Alpha-proteobacteria. The main characteristic of BALOs is that they are obligate bacterial predators. In other words, their reproduction and growth depend entirely on the capture of prey, which is not the case for other predatory bacteria for which this mode of survival is optional. Defined by two possible cycles of reproduction, known as periplasmic or epibiotic growth, BALOs seem relatively ubiquitous and their presence has been reported in contrasting environments. As an example, they have been detected, sometimes in high abundance, in soils, fresh and salt water, or in highly anthropized environments such as wastewater treatment plants. Given their attributes, BALOs could exert a significant biological control over microbial populations, particularly on pathogenic bacteria.To date, the majority of studies on the diversity, distribution and quantitative importance of BALOs have been carried out in soils and salt water. Our work, through the C-BALO project has consisted in exploring mainly fresh waters, represented here by the natural large and deep peri-alpine lakes (Annecy, Bourget and Geneva), but also two marine sites (SOLA and MOLA in the Bay of Banyuls, NW Med. Sea). C-BALO aimed at examining, on different time and space scales, the ubiquity, diversity, quantitative importance and potential functional role of the main families of BALOs of the Oligoflexia group. To do so, we employed various molecular biology and microbiology techniques. An important work has focused on the design and testing of a new set of primers specific to BALOs. This work was performed to take into account recent advances in BALOs classification and for an application in high throughput sequencing and quantitative PCR. We were then able to reveal that Bdellovibrionaceae, Peredibacteraceae and Bacteriovoracaceae are present in all the studied habitats. Moreover, that they were characterized by different patterns and marked dynamics, with Peredibacteraceae being the most abundant family and Bacteriovoracaceae the least abundant. In parallel, we were able to reveal an unsuspected diversity within BALOs, especially for Peredibacteraceae and Bdellovibrionaceae, which encompassed more than a hundred OTUs. Furthermore, abundance and diversity of BALOs seemed to be poorly dependent on environmental variables (e.g., physico-chemical parameters), suggesting the importance of biotic interactions such as quantity and quality of prey, competition for prey, predation by flagellates and ciliates, or parasitism by phages, the latter we show to possibly have a significant impact on the dynamics of BALOs. Finally, a few active members of the Bdellovibrionaceae family were isolated from Lake Geneva, again pointing to an important impact of this group of bacteria in the control of bacterial populations, a functional role that has yet to be clarified.
... (3) periplasmic life cycle (a) stage IVformation of the bdelloplast and growth In addition to proteases, Lambert et al. (Lambert et al. 2015) described the activity of glycanase, which disrupts the peptidoglycans of the prey at the beginning and during the invasion. Two peptidoglycans (i.e. ...
... The bd3460 gene for ankyrin is preexpressed before the invasion and its expression gradually increases during the invasion. This gene was probably acquired by the predator via horizontal gene transfer from spirochaetes (Lambert et al. 2015). Once in its host periplasm, the predator discards its flagellum (Fenton et al. 2010) and shift into a sessile form: the growth phase (Karunker et al., 2013). ...
... Once in its host periplasm, the predator discards its flagellum (Fenton et al. 2010) and shift into a sessile form: the growth phase (Karunker et al., 2013). The occupancy signal generated by the DD-endopeptidase prevents entry by successive predators and permits the formation of the bdelloplast (Lambert et al. 2015). Specifically, the infected prey is converted into a hybrid prey-predator structure (Van Essche et al. 2011), and the shape of the prey changes due to hydrolysis of the peptide bonds in the cell wall and degradation of biopolymers. ...
Article
Almost sixty years ago, Bdellovibrio and like organisms (BALOs) were discovered as the first obligate bacterial predators of other bacteria known to science. Since then, they were shown to be diverse and ubiquitous in the environment, and to bear astonishing ecological, physiological, and metabolic capabilities. The last decade has seen important strides made in understanding the mechanistic basis of their life cycle, the dynamics of their interactions with prey, along with significant developments towards their use in medicine, agriculture, and industry. This review details these achievements, identify current understanding and knowledge gaps to encourage and guide future BALO research.
... Based on previous reports, all characterized Bdellovibrionota predate bacterial species (40), whereas Chlamydiae and Dependentiae are likely to be parasites of protist or arthropod species (41,42,90), such as populations of springtails (Collembola) identified within the same sampling area (91). Signature genes associated with the symbiotic lifestyles of each MAG were detected, for example, host-targeted peptidoglycan metalloendopeptidases and selfprotection proteins that Bdellovibrionota use to invade cells of bacterial prey (92,93) as well as ankyrin repeat and WD40 repeat proteins implicated in modulation of eukaryotic hosts by Dependentiae (42, 90) (Dataset S5). Also in line with an obligately symbiotic lifestyle, several lineages have ultra-small genomes when adjusted for completeness, namely, the eight Patescibacteria MAGs (average 1.3 Mbp), three Dependentiae MAGs (average 1.8 Mbp), and a Rickettsiaceae MAG (1.3 Mbp) (Dataset S5), and are predicted to be auxotrophic for multiple amino acids. ...
Article
Full-text available
Numerous diverse microorganisms reside in the cold desert soils of continental Antarctica, though we lack a holistic understanding of the metabolic processes that sustain them. Here, we profile the composition, capabilities, and activities of the microbial communities in 16 physicochemically diverse mountainous and glacial soils. We assembled 451 metagenome-assembled genomes from 18 microbial phyla and inferred through Bayesian divergence analysis that the dominant lineages present are likely native to Antarctica. In support of earlier findings, metagenomic analysis revealed that the most abundant and prevalent microorganisms are metabolically versatile aerobes that use atmospheric hydrogen to support aerobic respiration and sometimes carbon fixation. Surprisingly, however, hydrogen oxidation in this region was catalyzed primarily by a phylogenetically and structurally distinct enzyme, the group 1l [NiFe]-hydrogenase, encoded by nine bacterial phyla. Through gas chromatography, we provide evidence that both Antarctic soil communities and an axenic Bacteroidota isolate (Hyme-nobacter roseosalivarius) oxidize atmospheric hydrogen using this enzyme. Based on ex situ rates at environmentally representative temperatures, hydrogen oxidation is theoretically sufficient for soil communities to meet energy requirements and, through metabolic water production, sustain hydration. Diverse carbon monoxide oxidizers and abundant methanotrophs were also active in the soils. We also recovered genomes of microorganisms capable of oxidizing edaphic inorganic nitrogen, sulfur, and iron compounds and harvesting solar energy via microbial rhodopsins and conventional photosystems. Obligately symbiotic bacteria, including Patescibacteria, Chlamydiae, and predatory Bdellovibrionota, were also present. We conclude that microbial diversity in Antarctic soils reflects the coexistence of metabolically flexible mixotrophs with metabolically constrained specialists.
... In bacteria, ankyrin repeat-containing proteins have been characterised to act as immunity proteins (ImmAnk) against decrosslinking enzymes and a wide range of T6SS-associated toxin domains, including Tox-AHH (Zhang et al., 2012;Lambert et al., 2015). Both predicted ankyrin repeat-containing proteins, CJ488_0979 and CJ488_0983, were found adjacent to the putative Tox-REase-7 effectors, CJ488_0980 and CJ488_0982, and are predicted to encode the cognate immunity proteins to the respective effectors, presenting two identical effector-immunity pairs. ...
Article
The Type VI Secretion System (T6SS) has important roles relating to bacterial antagonism, subversion of host cells, and niche colonisation. Campylobacter jejuni is one of the leading bacterial causes of human gastroenteritis worldwide and is a commensal coloniser of birds. Although recently discovered, the T6SS biological functions and identities of its effectors are still poorly defined in C. jejuni. Here, we perform a comprehensive bioinformatic analysis of the C. jejuni T6SS by investigating the prevalence and genetic architecture of the T6SS in 513 publicly available genomes using C. jejuni 488 strain as reference. A unique and conserved T6SS cluster associated with the Campylobacter jejuni Integrated Element 3 (CJIE3) was identified in the genomes of 117 strains. Analyses of the T6SS-positive 488 strain against the T6SS-negative C. jejuni RM1221 strain and the T6SS-positive plasmid pCJDM202 carried by C. jejuni WP2-202 strain defined the “T6SS-containing CJIE3” as a pathogenicity island, thus renamed as Campylobacter jejuni Pathogenicity Island-1 (CJPI-1). Analysis of CJPI-1 revealed two canonical VgrG homologues, CJ488_0978 and CJ488_0998, harbouring distinct C-termini in a genetically variable region downstream of the T6SS operon. CJPI-1 was also found to carry a putative DinJ-YafQ Type II toxin-antitoxin (TA) module, conserved across pCJDM202 and the genomic island CJIE3, as well as several open reading frames functionally predicted to encode for nucleases, lipases, and peptidoglycan hydrolases. This comprehensive in silico study provides a framework for experimental characterisation of T6SS-related effectors and TA modules in C. jejuni.
... In bacteria, ankyrin repeat-containing proteins have been characterised to act as immunity proteins (ImmAnk) against decrosslinking enzymes and a wide range of T6SS-associated toxin domains, including Tox-AHH (Zhang et al., 2012;Lambert et al., 2015). Both predicted ankyrin repeat-containing proteins, CJ488_0979 and CJ488_0983, were found adjacent to the putative Tox-REase-7 effectors, CJ488_0980 and CJ488_0982, and are predicted to encode the cognate immunity proteins to the respective effectors, presenting two identical effector-immunity pairs. ...
Article
Full-text available
The Type VI Secretion System (T6SS) has important roles relating to bacterial antagonism, subversion of host cells, and niche colonisation. Campylobacter jejuni is one of the leading bacterial causes of human gastroenteritis worldwide and is a commensal coloniser of birds. Although recently discovered, the T6SS biological functions and identities of its effectors are still poorly defined in C. jejuni. Here, we perform a comprehensive bioinformatic analysis of the C. jejuni T6SS by investigating the prevalence and genetic architecture of the T6SS in 513 publicly available genomes using C. jejuni 488 strain as reference. A unique and conserved T6SS cluster associated with the Campylobacter jejuni Integrated Element 3 (CJIE3) was identified in the genomes of 117 strains. Analyses of the T6SS-positive 488 strain against the T6SS-negative C. jejuni RM1221 strain and the T6SS-positive plasmid pCJDM202 carried by C. jejuni WP2-202 strain defined the “T6SS-containing CJIE3” as a pathogenicity island, thus renamed as Campylobacter jejuni Pathogenicity Island-1 (CJPI-1). Analysis of CJPI-1 revealed two canonical VgrG homologues, CJ488_0978 and CJ488_0998, harbouring distinct C-termini in a genetically variable region downstream of the T6SS operon. CJPI-1 was also found to carry a putative DinJ-YafQ Type II toxin-antitoxin (TA) module, conserved across pCJDM202 and the genomic island CJIE3, as well as several open reading frames functionally predicted to encode for nucleases, lipases, and peptidoglycan hydrolases. This comprehensive in silico study provides a framework for experimental characterisation of T6SS-related effectors and TA modules in C. jejuni.
... In that sense, the Vamp_311_38 enzyme seems more similar to the "predatory" Bdellovibrio ones. Interestingly, the "predatory" endopeptidase Bd3459 and the regulatory inhibitor Bd3460 are contiguous in the genomes of Bdellovibrio and other periplasmic predators but not in epibiotic predators 32 . Vampirococcus confirms this pattern since, although it possesses several ankyrin-repeat-containing proteins, none of them is encoded adjacent to the DD endopeptidase genes. ...
Article
Full-text available
The Candidate Phyla Radiation (CPR) constitutes a large group of mostly uncultured bacterial lineages with small cell sizes and limited biosynthetic capabilities. They are thought to be symbionts of other organisms, but the nature of this symbiosis has been ascertained only for cultured Saccharibacteria, which are epibiotic parasites of other bacteria. Here, we study the biology and the genome of Vampirococcus lugosii, which becomes the first described species of Vampirococcus, a genus of epibiotic bacteria morphologically identified decades ago. Vampirococcus belongs to the CPR phylum Absconditabacteria. It feeds on anoxygenic photosynthetic gammaproteobacteria, fully absorbing their cytoplasmic content. The cells divide epibiotically, forming multicellular stalks whose apical cells can reach new hosts. The genome is small (1.3 Mbp) and highly reduced in biosynthetic metabolism genes, but is enriched in genes possibly related to a fibrous cell surface likely involved in interactions with the host. Gene loss has been continuous during the evolution of Absconditabacteria, and generally most CPR bacteria, but this has been compensated by gene acquisition by horizontal gene transfer and de novo evolution. Our findings support parasitism as a widespread lifestyle of CPR bacteria, which probably contribute to the control of bacterial populations in diverse ecosystems.
Article
Rickettsia spp. are obligate intracellular bacterial pathogens that have evolved a variety of strategies to exploit their host cell niche. However, the bacterial factors that contribute to this intracellular lifestyle are poorly understood. Here, we show that the conserved ankyrin repeat protein RARP-1 supports Rickettsia parkeri infection. Specifically, RARP-1 promotes efficient host cell entry and growth within the host cytoplasm, but it is not necessary for cell-to-cell spread or evasion of host autophagy. We further demonstrate that RARP-1 is not secreted into the host cytoplasm by R. parkeri. Instead, RARP-1 resides in the periplasm, and we identify several binding partners that are predicted to work in concert with RARP-1 during infection. Altogether, our data reveal that RARP-1 plays a critical role in the rickettsial life cycle. IMPORTANCE Rickettsia spp. are obligate intracellular bacterial pathogens that pose a growing threat to human health. Nevertheless, their strict reliance on a host cell niche has hindered investigation of the molecular mechanisms driving rickettsial infection. This study yields much-needed insight into the Rickettsia ankyrin repeat protein RARP-1, which is conserved across the genus but has not yet been functionally characterized. Earlier work had suggested that RARP-1 is secreted into the host cytoplasm. However, the results from this work demonstrate that R. parkeri RARP-1 resides in the periplasm and is important both for invasion of host cells and for growth in the host cell cytoplasm. These results reveal RARP-1 as a novel regulator of the rickettsial life cycle.
Article
Combination treatments using Bdellovibrio bacteriovorus PF13 and/or TWPF pre-treatment; solar disinfection (SODIS); and Moringa oleifera flocculation, were investigated for the reduction of antibiotic resistant Klebsiella pneumoniae and Pseudomonas aeruginosa. After the various stages of treatment, culture- and molecular-based methods were employed to quantify the respective bacteria. Results indicated that pre-treatment with the B. bacteriovorus strains did not reduce the P. aeruginosa cell concentration. The subsequent exposure of the pre-treated and non-pre-treated samples to SODIS (6 h) then significantly reduced the P. aeruginosa cell counts and gene copies (EMA-qPCR) by up to 7.50 logs, and 4.37 logs, respectively. In contrast, pre-treatment using both B. bacteriovorus strains (PF13 and TWPF) in combination with SODIS significantly reduced the K. pneumoniae cell counts (8.46 logs) and gene copies (4.40 logs) to below detection limit. While significant log reductions were obtained for the K. pneumoniae samples pre-treated with B. bacteriovorus PF13 or TWPF, and SODIS only (no pre-treatment), K. pneumoniae still persisted. Furthermore, flocculation treatment following SODIS did not significantly reduce the concentration of K. pneumoniae or P. aeruginosa. The antibiogram of the target organisms was compared before and after each treatment stage using the VITEK® 2 Compact System. No difference in the organisms’ susceptibility to the tested antibiotics was observed, with both K. pneumoniae and P. aeruginosa maintaining their MDR and XDR status, respectively. It is thus recommended that the interaction and predation kinetics of employing multiple predatory bacteria as a pre-treatment to SODIS is explored, as these treatments eradicated the MDR K. pneumoniae.
Article
Full-text available
Extant fold-switching proteins remodel their secondary structures and change their functions in response to cellular stimuli, regulating biological processes and affecting human health. Despite their biological importance, these proteins remain understudied. Predictive methods are needed to expedite the process of discovering and characterizing more of these shapeshifting proteins. Most previous approaches require a solved structure or all-atom simulations, greatly constraining their use. Here, we propose a high-throughput sequence-based method for predicting extant fold switchers that transition from α-helix in one conformation to β-strand in the other. This method leverages two previous observations: (a) α-helix ↔ β-strand prediction discrepancies from JPred4 are a robust predictor of fold switching, and (b) the fold-switching regions (FSRs) of some extant fold switchers have different secondary structure propensities when expressed by themselves (isolated FSRs) than when expressed within the context of their parent protein (contextualized FSRs). Combining these two observations, we ran JPred4 on 99-fold-switching proteins and found strong correspondence between predicted and experimentally observed α-helix ↔ β-strand discrepancies. To test the overall robustness of this finding, we randomly selected regions of proteins not expected to switch folds (single-fold proteins) and found significantly fewer predicted α-helix ↔ β-strand discrepancies. Combining these discrepancies with the overall percentage of predicted secondary structure, we developed a classifier to identify extant fold switchers (Matthews correlation coefficient of .71). Although this classifier had a high false-negative rate (7/17), its false-positive rate was very low (2/136), suggesting that it can be used to predict a subset of extant fold switchers from a multitude of available genomic sequences. Graphical Abstract
Article
Full-text available
Bdellovibrio spp. and Micavibrio spp. are Gram-negative predators that feed on other Gram-negative bacteria, making predatory bacteria potential alternatives to antibiotics for treating multi-drug resistant infections. While the ability of predatory bacteria to control bacterial infections in vitro is well documented, the in vivo effect of predators on a living host has yet to be extensively examined. In this study, respiratory and intravenous inoculations were used to determine the effects of predatory bacteria in mice. We found no reduction in mouse viability after intranasal or intravenous inoculation of B. bacteriovorus 109J, HD100 or M. aeruginosavorus. Introducing predators into the respiratory tract of mice provoked a modest inflammatory response at 1 hour post-exposure, but was not sustained at 24 hours, as measured by RT-qPCR and ELISA. Intravenous injection caused an increase of IL-6 in the kidney and spleen, TNF in the liver and CXCL-1/KC in the blood at 3 hours post-exposure, returning to baseline levels by 18 hours. Histological analysis of tissues showed no pathological changes due to predatory bacteria. Furthermore, qPCR detected predators were cleared from the host quickly and efficiently. This work addresses some of the safety concerns regarding the potential use of predatory bacteria as a live antibiotic.
Article
Full-text available
The refinement and validation of a crystallographic structure model is the last step before the coordinates and the associated data are submitted to the Protein Data Bank (PDB). The success of the refinement procedure is typically assessed by validating the models against geometrical criteria and the diffraction data, and is an important step in ensuring the quality of the PDB public archive [Read et al. (2011 ▶), Structure, 19, 1395-1412]. The PDB_REDO procedure aims for 'constructive validation', aspiring to consistent and optimal refinement parameterization and pro-active model rebuilding, not only correcting errors but striving for optimal interpretation of the electron density. A web server for PDB_REDO has been implemented, allowing thorough, consistent and fully automated optimization of the refinement procedure in REFMAC and partial model rebuilding. The goal of the web server is to help practicing crystallo-graphers to improve their model prior to submission to the PDB. For this, additional steps were implemented in the PDB_REDO pipeline, both in the refinement procedure, e.g. testing of resolution limits and k-fold cross-validation for small test sets, and as new validation criteria, e.g. the density-fit metrics implemented in EDSTATS and ligand validation as implemented in YASARA. Innovative ways to present the refinement and validation results to the user are also described, which together with auto-generated Coot scripts can guide users to subsequent model inspection and improvement. It is demonstrated that using the server can lead to substantial improvement of structure models before they are submitted to the PDB.
Article
Full-text available
Bdellovibrio bacteriovorus are facultatively predatory bacteria that grow within gram-negative prey, using pili to invade their periplasmic niche. They also grow prey-independently on organic nutrients after undergoing a reversible switch. The nature of the growth switching mechanism has been elusive, but several independent reports suggested mutations in the hit (host-interaction) locus on the Bdellovibrio genome were associated with the transition to prey-independent growth. Pili are essential for prey entry by Bdellovibrio and sequence analysis of the hit locus predicted that it was part of a cluster of Type IVb pilus-associated genes, containing bd0108 and bd0109. In this study we have deleted the whole bd0108 gene, which is unique to Bdellovibrio, and compared its phenotype to strains containing spontaneous mutations in bd0108 and the common natural 42 bp deletion variant of bd0108. We find that deletion of the whole bd0108 gene greatly reduced the extrusion of pili, whereas the 42 bp deletion caused greater pilus extrusion than wild-type. The pili isolated from these strains were comprised of the Type IVa pilin protein; PilA. Attempts to similarly delete gene bd0109, which like bd0108 encodes a periplasmic/secreted protein, were not successful, suggesting that it is likely to be essential for Bdellovibrio viability in any growth mode. Bd0109 has a sugar binding YD- repeat motif and an N-terminus with a putative pilin-like fold and was found to interact directly with Bd0108. These results lead us to propose that the Bd0109/Bd0108 interaction regulates pilus production in Bdellovibrio (possibly by interaction with the pilus fibre at the cell wall), and that the presence (and possibly retraction state) of the pilus feeds back to alter the growth state of the Bdellovibrio cell. We further identify a novel small RNA encoded by the hit locus, the transcription of which is altered in different bd0108 mutation backgrounds.
Article
Full-text available
Bdellovibrio and like organisms (BALO) are obligate predators of Gram-negative bacteria, belonging to the α- and δ-proteobacteria. BALO prey using either a periplasmic or an epibiotic predatory strategy, but the genetic background underlying these phenotypes is not known. Here we compare the epibiotic Bdellovibrio exovorus and Micavibrio aeruginosavorus to the periplasmic B. bacteriovorus and Bacteriovorax marinus. Electron microscopy showed that M. aeruginosavorus, but not B. exovorus, can attach to prey cells in a non-polar manner through its longitudinal side. Both these predators were resistant to a surprisingly high number of antibiotic compounds, possibly via 26 and 19 antibiotic-resistance genes, respectively, most of them encoding efflux pumps. Comparative genomic analysis of all the BALOs revealed that epibiotic predators have a much smaller genome (ca. 2.5 Mbp) than the periplasmic predators (ca. 3.5 Mbp). Additionally, periplasmic predators have, on average, 888 more proteins, at least 60% more peptidases, and one more rRNA operon. Fifteen and 219 protein families were specific to the epibiotic and the periplasmic predators, respectively, the latter clearly forming the core of the periplasmic 'predatome', which is upregulated during the growth phase. Metabolic deficiencies of epibiotic genomes include the synthesis of inosine, riboflavin, vitamin B6 and the siderophore aerobactin. The phylogeny of the epibiotic predators suggests that they evolved by convergent evolution, with M. aeruginosavorus originating from a non-predatory ancestor while B. exovorus evolved from periplasmic predators by gene loss.The ISME Journal advance online publication, 3 October 2013; doi:10.1038/ismej.2013.164.
Article
Full-text available
The structure of TEM-1 -lactamase complexed with the inhibitor BLIP has been determined at 1.7 A resolution. The two tandemly repeated domains of BLIP form a polar, concave surface that docks onto a predominantly polar, convex protrusion on the enzyme. The ability of BLIP to adapt to a variety of class A -lactamases is most likely due to an observed flexibility between the two domains of the inhibitor and to an extensive layer of water molecules entrapped between the enzyme and inhibitor. A -hairpin loop from domain 1 of BLIP is inserted into the active site of the -lactamase. The carboxylate of Asp 49 forms hydrogen bonds to four conserved, catalytic residues in the -lactamase, thereby mimicking the position of the penicillin G carboxylate observed in the acyl−enzyme complex of TEM-1 with substrate. This -hairpin may serve as a template with which to create a new family of peptide-analogue -lactamase inhibitors.
Article
Full-text available
Predatory bacteria are taxonomically disparate, exhibit diverse predatory strategies and are widely distributed in varied environments. To date, their predatory phenotypes cannot be discerned in genome sequence data thereby limiting our understanding of bacterial predation, and of its impact in nature. Here, we define the 'predatome,' that is, sets of protein families that reflect the phenotypes of predatory bacteria. The proteomes of all sequenced 11 predatory bacteria, including two de novo sequenced genomes, and 19 non-predatory bacteria from across the phylogenetic and ecological landscapes were compared. Protein families discriminating between the two groups were identified and quantified, demonstrating that differences in the proteomes of predatory and non-predatory bacteria are large and significant. This analysis allows predictions to be made, as we show by confirming from genome data an over-looked bacterial predator. The predatome exhibits deficiencies in riboflavin and amino acids biosynthesis, suggesting that predators obtain them from their prey. In contrast, these genomes are highly enriched in adhesins, proteases and particular metabolic proteins, used for binding to, processing and consuming prey, respectively. Strikingly, predators and non-predators differ in isoprenoid biosynthesis: predators use the mevalonate pathway, whereas non-predators, like almost all bacteria, use the DOXP pathway. By defining predatory signatures in bacterial genomes, the predatory potential they encode can be uncovered, filling an essential gap for measuring bacterial predation in nature. Moreover, we suggest that full-genome proteomic comparisons are applicable to other ecological interactions between microbes, and provide a convenient and rational tool for the functional classification of bacteria.
Article
Full-text available
Bacteriovorax marinus SJ is a predatory delta-proteobacterium isolated from a marine environment. The genome sequence of this strain provides an interesting contrast to that of the terrestrial predatory bacterium Bdellovibrio bacteriovorus HD100. Based on their predatory lifestyle, Bacteriovorax were originally designated as members of the genus Bdellovibrio but subsequently were re-assigned to a new genus and family based on genetic and phenotypic differences. B. marinus attaches to Gram-negative bacteria, penetrates through the cell wall to form a bdelloplast, in which it replicates, as shown using microscopy. Bacteriovorax is distinct, as it shares only 30% of its gene products with its closest sequenced relatives. Remarkably, 34% of predicted genes over 500 nt in length were completely unique with no significant matches in the databases. As expected, Bacteriovorax shares several characteristic loci with the other delta-proteobacteria. A geneset shared between Bacteriovorax and Bdellovibrio that is not conserved among other delta-proteobacteria such as Myxobacteria (which destroy prey bacteria externally via lysis), or the non-predatory Desulfo-bacteria and Geobacter species was identified. These 291 gene orthologues common to both Bacteriovorax and Bdellovibrio may be the key indicators of host-interaction predatory-specific processes required for prey entry. The locus from Bdellovibrio bacteriovorus is implicated in the switch from predatory to prey/host-independent growth. Although the locus is conserved in B. marinus, the sequence has only limited similarity. The results of this study advance understanding of both the similarities and differences between Bdellovibrio and Bacteriovorax and confirm the distant relationship between the two and their separation into different families.The ISME Journal advance online publication, 6 September 2012; doi:10.1038/ismej.2012.90.
Article
The inhibitory protein, IκBα, sequesters the transcription factor, NF-κB, as an inactive complex in the cytoplasm. The structure of the IκBα ankyrin repeat domain, bound to a partially truncated NF-κB heterodimer (p50/p65), has been determined by X-ray crystallography at 2.7 Å resolution. It shows a stack of six IκBα ankyrin repeats facing the C-terminal domains of the NF-κB Rel homology regions. Contacts occur in discontinuous patches, suggesting a combinatorial quality for ankyrin repeat specificity. The first two repeats cover an α helically ordered segment containing the p65 nuclear localization signal. The position of the sixth ankyrin repeat shows that full-length IκBα will occlude the NF-κB DNA-binding cleft. The orientation of IκBα in the complex places its N- and C-terminal regions in appropriate locations for their known regulatory functions.