No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Regulation of Expression of Bacterial Genes for Bioluminescence
... Mutations in this region block expression of the V. fischeri lux system (43). The luxR gene product has been proposed to function as a receptor for the autoinducer (46). This complex then stimulates transcription of the right operon. ...
... This autoinducer is species specific, causing the induction of luminescence in V. fischeri and V. logei but not in other strains (43). A mechanism involving both positive and negative feedback loops (Fig. 5) has been proposed to explain the induction of luminescence in V. fischeri (46). The autoinducer is produced at a low constitutive rate during the early stages of growth. ...
... High levels of the autoinducer-receptor (luxR gene product) complex are also proposed to turn off or limit expression of the left operon containing luxR (46). However, the results from different laboratories supporting a role for this complex in a negative feedback loop are not in agreement about whether the regulation is at a transcriptional or translational level (38,46). ...
The cloning and expression of the lux genes from different luminescent bacteria including marine and terrestrial species have led to significant advances in our knowledge of the molecular biology of bacterial bioluminescence. All lux operons have a common gene organization of luxCDAB(F)E, with luxAB coding for luciferase and luxCDE coding for the fatty acid reductase complex responsible for synthesizing fatty aldehydes for the luminescence reaction, whereas significant differences exist in their sequences and properties as well as in the presence of other lux genes (I, R, F, G, and H). Recognition of the regulatory genes as well as diffusible metabolites that control the growth-dependent induction of luminescence (autoinducers) in some species has advanced our understanding of this unique regulatory mechanism in which the autoinducers appear to serve as sensors of the chemical or nutritional environment. The lux genes have now been transferred into a variety of different organisms to generate new luminescent species. Naturally dark bacteria containing the luxCDABE and luxAB genes, respectively, are luminescent or emit light on addition of aldehyde. Fusion of the luxAB genes has also allowed the expression of luciferase under a single promoter in eukaryotic systems. The ability to express the lux genes in a variety of prokaryotic and eukaryotic organisms and the ease and sensitivity of the luminescence assay demonstrate the considerable potential of the widespread application of the lux genes as reporters of gene expression and metabolic function.
... Besides these considerations, control of the luminescence system by autoinducer is complex. Expression of luxR is negatively autoregulated by autoinducer and the LuxR protein at post-transcriptional (Engebrecht and Silverman, 1986) and transcriptional levels Greenberg, 1985, 1988;Dunlap and Ray, 1989). Furthermore, the presence of the lux[ gene can suppress the synthesis of LuxR (Engebrecht and Silverman, 1984;Kaplan and Greenberg, 1987). ...
... In vitro run off transcription studies would be valuable to help determine if this is the case or if there may in fact be a steric interaction between these two antagonistically interacting regulatory proteins. Additional unresolved aspects of lux gene regulation are the mechanism of posttranscriptional negative autoregulation of luxR (Engebrecht and Silverman, 1986), the possibility of the involvement of DNA looping (Devine et al., 1989), and whether autoinducer interacts directly with the LuxR protein or instead operates through a second messenger cascade system at the cell membrane. Figure 4 is a model summarizing current understanding of lux gene transcriptional control and showing the positive and negative transcriptional effects of CAMP-CRP and autoinducer-LuxR. ...
... The regulation of bioluminescence in the marine bacterium Vibrio fischeri has been studied extensively through cloning and genetic manipulation of the lux system in Escherichia coli (3)(4)(5)(8)(9)(10). Expression of the lux genes in V. fischeri is controlled by a unique form of positive feedback regulation called autoinduction, and this pattern of regulation is duplicated by the cloned system in E. coli (8,10). ...
... The regulation of bioluminescence in the marine bacterium Vibrio fischeri has been studied extensively through cloning and genetic manipulation of the lux system in Escherichia coli (3)(4)(5)(8)(9)(10). Expression of the lux genes in V. fischeri is controlled by a unique form of positive feedback regulation called autoinduction, and this pattern of regulation is duplicated by the cloned system in E. coli (8,10). The autoinduction response is mediated by the production and accumulation of a small molecule, autoinducer, which is synthesized in the presence of the luxI gene product. ...
A lethal genetic selection utilizing the bacteriophage lambda lysis genes (S, R, RZ) has been developed and used in conjunction with a luminescence screen to allow the isolation and characterization of six missense mutations and two nonsense mutations in the luxR gene from Vibrio fischeri ATCC 7744. A transcriptional fusion of the lysis genes in operonR downstream of a truncated luxI gene allows control of cell lysis by the addition of synthetic autoinducer to the growth medium. The six missense mutations isolated resulted in changes in the LuxR protein of Asp at position 79 to Asn (hereafter designated as D79N), V82I, V109L, L118F, S123I, and H217Y. Variant LuxR proteins with amino acid changes of D79N, V82I, V82L, and H127Y were shown to require higher concentrations of autoinducer to elicit a certain amplitude response than is required by the wild-type protein. We believe that the clustering of a total of seven randomly generated missense mutations in a 49-amino-acid region of the LuxR primary sequence defines a critical portion of the LuxR protein. The observation that proteins with lesions in this region responded to elevated levels of autoinducer suggests that the autoinducer-binding site is constructed, at least in part, from several amino acid residues within the 79-to-127 region of the LuxR protein.
... It is possible that removal of luxR from control by its native promoter and the use of catabolite repression mutants helped reveal the negative autoregulation of luxR at the transcriptional level (Table 4). These findings do not preclude the possibility that there is also posttranscriptional negative autoregulation of luxR as has been suggested elsewhere (10). ...
... Thus, the LuxR protein will be adjusted continually to levels appropriate for activity at any given concentration of autoinducer. This model is based in large part on (Fig. 4) (perhaps a posttranscriptional level) in luxR regulation (10,16). Clearly, this idea remains to be tested. ...
Expression of the Vibrio fischeri luminescence genes (lux genes) requires two transcriptional activators: the V. fischeri luxR gene product with autoinducer and the cyclic AMP (cAMP) receptor protein (CRP) with cAMP. It has been established that autoinducer and the luxR gene product are required for transcriptional activation of the luxICDABE operon, which contains a gene required for autoinducer synthesis and genes required for light emission. However, the role of cAMP-CRP in the induction of luminescence is not clear. We examined transcriptional control of the lux genes in Escherichia coli, using catabolite repression mutants carrying lux DNA-containing plasmids. Transcriptional fusions between the lacZ gene on Mu dI and luxR were used to assess luxR promoter activity, and the luxAB genes (which encode the two luciferase subunits) were used as a natural reporter of luxICDABE promoter activity. A plasmid containing luxR under control of the cAMP-CRP-independent tac promoter was constructed to direct the synthesis of the luxR gene product in cells containing compatible luxR::Mu dI insertion mutant plasmids. In E. coli, cAMP-CRP activated transcription of luxR and concurrently decreased luxICDABE transcription. In the presence of relatively high levels of the luxR gene product, cAMP and CRP were not required for induction of the luxICDABE operon. The luxR gene product in the presence of autoinducer activated transcription of the luxICDABE operon, as has been shown previously, and we demonstrate that it also decreased luxR transcription. Apparently, control of the V. fischeri luminescence genes involves a regulatory circuit in which cAMP and CRP activate luxR transcription and in turn the luxR gene product activates transcription of the operon responsible for light emission (uxICDABE). Furthermore, in lux gene regulation cAMP-CRP and autoinducer-LuxR protein appear to function as transcriptional antagonists.
... Communication among bacteria using chemical signaling molecules is not a new concept but has been established long ago (1). An established intra-and inter-species cellto-cell communication among bacteria had changed an age-long belief of their existence in planktonic forms without any communication between them. ...
Currently, most of the developed and developing countries are facing the problem of infectious diseases. The genius way of an exaggerated application of antibiotics led the infectious agents to respond by bringing a regime of persisters to resist antibiotics attacks prolonging their survival. Persisters have the dexterity to communicate among themself using signal molecules via the process of Quorum Sensing (QS), which regulates virulence gene expression and biofilms formation, making them more vulnerable to antibiotic attack. Our review aims at the different approaches applied in the ordeal to solve the riddle for QS inhibitors. QS inhibitors, their origin, structures and key interactions for QS inhibitory activity have been summarized. Solicitation of a potent QS inhibitor molecule would be beneficial, giving new life to the simplest antibiotics in adjuvant therapy.
... The autoinducer, identified as N-P-ketocaproyl homoserine lactone, is a freely diffusible molecule that accumulates in the growth medium as cell density increases (6,11). It has been proposed that the autoinducer establishes a positive feedback loop by binding to a receptor protein and stimulating transcription of the luxICDABEG operon (9). The receptor protein is encoded by the luxR gene, which is located immediately upstream of the lux operon but is transcribed in the opposite direction (8). ...
Expression of the lux operon from the marine bacterium Vibrio harveyi is dependent on cell density and requires an unlinked regulatory gene, luxR, and other cofactors for autoregulation. Escherichia coli transformed with the lux operon emits very low levels of light, and this deficiency can be partially alleviated by coexpression of luxR in trans. The V. harveyi lux promoter was analyzed in vivo by primer extension mapping to examine the function of luxR. RNA isolated from E. coli transformed with the Vibrio harveyi lux operon was shown to have a start site at 123 bp upstream of the first ATG codon of luxC. This is in sharp contrast to the start site found for lux RNA isolated from V. harveyi, at 26 bp upstream of the luxC initiation codon. However, when E. coli was cotransformed with both the lux operon and luxR, the start site of the lux mRNA shifted from -123 to -26. Furthermore, expression of the luxR gene caused a 350-fold increase in lux mRNA levels. The results suggest that LuxR of V. harveyi is a transcriptional activator stimulating initiation at the -26 lux promoter.
... High levels of LuxR protein and VAI-1 apparently could place a cap on lux operon expression. VAI-1 and LuxR repress luxR expression posttranscriptionally and transcriptionally (Engebrecht and Silverman, 1986; Dunlap and Greenberg, 1988; Dunlap and Ray, 1989; Shadel and Baldwin, 1991; 1992a). Conversely, luxR expression can be activated by low levels of VAI-1 and LuxR in both a cAMP/CRP-dependent and cAMP/CRP-independent manner (Shadel and Baldwin, 1991; 1992a; 1992b). ...
Luminescence in Vibrio fischeri is controlled by a population density-responsive regulatory mechanism called quorum sensing. Elements of the mechanism include: LuxI, an acyl-homoserine lactone (acyl-HSL) synthase that directs synthesis of the diffusible signal molecule, 3-oxo-hexanoyl-HSL (V. fischeri autoinducer-1, VAI-1); LuxR, a transcriptional activator protein necessary for response to VAI-1; GroEL, which is necessary for production of active LuxR; and AinS, an acyl-HSL synthase that catalyzes the synthesis of octanoyl-HSL (VAI-2). The population density-dependent accumulation of VAI-1 triggers induction of lux operon (luxICDABEG; genes for luminescence enzymes and for LuxI) transcription and luminescence by binding to LuxR, forming a complex that facilitates the association of RNA polymerase with the luxoperon promoter. VAI-2, which apparently interferes with VAI-1 binding to LuxR, operates to limit premature luxoperon induction. Hierarchical control is imposed on the system by 3':5'-cyclic AMP (cAMP) and cAMP receptor protein (CRP), which are necessary for activated expression of luxR. Several non-lux genes in V. fischeri are controlled by LuxR and VAI-1. Quorum regulation in V. fischeri serves as a model for LuxI/LuxR-type quorum sensing systems in other gram-negative bacteria.
The integration of signals from the bacterial environment, through a network of cellular transduction mechanisms, determines the profile of genes expressed and thereby the bacterial phenotype. Quorum sensing transmits one such signal, i.e. population density, by relying on the accumulation of a small extracellular signal molecule to modulate transcription of target operons.
— Luminescence in the marine symbiotic bacterium Vibrio fischeri is subject to control by autoinduction, a regulatory mechanism that activates light production at high population density and suppresses light production at low population density. Several genetic, physiological and environmental factors contribute to autoinduction. Primary among these are a self-produced, membrane-permeable compound, N-3-oxohexanoyI-L-homoserine lactone, called autoinducer, which accumulates in a population density-dependent manner during growth of V. fischeri, and a transcriptional activator protein, LuxR, which with autoinducer activates transcription of the luminescence (lux) genes (luxICDABEG; encoding proteins for autoinducer synthesis and light production). Additional genetically defined regulatory elements involved in autoinduction include 3′:5′-cyclic AMP (cAMP), which via cAMP receptor protein activates transcription of luxR, and the GroESL proteins, which stabilize LuxR in its active form. Evidence exists also for the involvement of LexA protein, for a second autoinducer, N-octanoyl-l-homoserine lactone, and under anaerobic conditions for Fnr protein. Besides these regulatory elements, nutrient limitation, presence of glucose, availability of iron and oxygen, temperature, salts and an au-toinducer-LuxR protein-independent modulation also contribute to the autoinduction phenomenon. The multiplicity of genetic, physiological and environmental factors indicates that luminescence autoinduction is mediated by a complex regulatory circuitry, one that is highly integrated with and responsive to the physiological and ecological status of the cells. Long thought to be unique to V. fischeri and certain closely related marine luminous bacteria, luminescence autoinduction is now viewed as a model for understanding population density-responsive control of gene expression in a wide variety of terrestrial and marine bacteria in which N-acyl-l-homoserine lactones and homologs of Luxl and LuxR recently have been found.
The marine symbiotic bacterium Vibrio fischeri is striking for its ability both to emit light and to dramatically regulate light emission using a cell-to-cell signalling mechanism called autoinduction. The latter is mediated by a signal molecule called the 'autoinducer'. The mechanistic bases of both luminescence and autoinduction are well known in V. fischeri, but this knowledge is mostly derived from studies of the cloned luminescence and autoinduction genes expressed in Escherichia coli. In this study, luminescence and autoinduction mutations were systematically generated in V. fischeri to explore aspects of luminescence and autoinduction not addressable in E. coli, such as the adaptive significance of luminescence. Most dramatically, the mutants revealed the presence of multiple autoinducers and autoinducer synthases in V. fischeri. One of the autoinducers (autoinducer-2, or AI-2) was chemically purified and shown to be N-octanoyl-L-homoserine lactone. The genetic locus encoding the AI-2 synthase was cloned and designated ain (autoinducer). Manipulation of ain and AI-2 in V. fisclieri demonstrated that the function of AI-2 appears to be to inhibit rather than to promote autoinduction.
All Gram-negative and Gram-positive bacteria that swarm differentiate elongated, hyper-flagellated, rod-shaped cells. Bacteria that lack flagella and cannot swim in liquid can nevertheless generate compact, organized, highly dynamic swarms on agar surfaces. Typically, these bacteria grow as elongated rods and they have polar engines, such as retractile type IV pili or other gliding engines to propel themselves over a moist surface. Myxobacteria are, perhaps, the best-studied non-flagellated swarmers. They are among the most socially adept and ubiquitous of bacteria that live in cultivated soil. They feed as an organized multicellular swarm on a wide variety of other soil bacteria. A feeding swarm spreads outward, forming regular multicellular structures as it expands. Shortly before potential prey have been completely consumed in their neighborhood, a swarm ceases growth with expansion and builds multilayered fruiting bodies with dormant spores. Both swarming/growth and starvation-induced fruiting body development depend upon the specificity and effectiveness of signals passed between cells. Some signals are small, diffusible molecules like a set of amino acids for the A-signal; others are particular proteins displayed on the surface of the outer membrane like the C-signal. A proposed signal that would be essential for the formation of multicellular rafts and multilayered mounds consists of contact junctions between pairs of cells that persist for a rather short time before disconnecting. When consumption outruns the available food supply, cells change their behavior: The swarm stops outward expansion and retreats, migrating inward to build hundreds of fruiting bodies, each containing about 105 spores. Sensing a deficiency of any amino-acylated tRNA, the swarm initiates its program of fruiting body development. For development, the swarm allocates some remaining resources to DNA synthesis in order that each spore will contain two complete copies of the genome. Energy reserves are also allocated to developmental protein synthesis. Myxococcus xanthus uses the stringent response to initiate a cascade of enhancer-binding proteins (EBPs) that organizes smooth transitions from exponential growth to preaggregation and then to mound building. EBPs are specific transcriptional activators that work with sigma-54-RNA polymerase to activate transcription at designated sigma-54 promoters. Expression of a downstream EBP is activated at the proper time by a preceding EBP in the cascade, ensuring the correct developmental order. Since EBPs typically activate gene expression in response to an environmental cue, it is thought that several of the cascade’s sensor kinases measure the level of particular intermediary metabolites indicative of approaching starvation. Early detection of starvation’s approach seems to limit spore formation because only 0.1–1% of the cells initiating fruiting body development become spores. Two EBPs initiate accumulation of the ppGpp starvation signal to manage the transition from growth to fruiting body development. Two other EBPs manage the subsequent preaggregation stage, while another two regulate gene expression for cell aggregation. The A-signal indicates that there are enough cells to build a fruiting body; the C-signal directs fruiting body construction and sets the time at which each motile rod-shaped cell becomes a spherical, nonmotile spore that is resistant to solar radiation. Later, when fresh prey bacteria return to the neighborhood of a fruiting body, the myxospores germinate, and the cells begin to elongate to feed on the new prey. M. xanthus assembles a new swarm that expands because cells reverse their gliding direction every 8–9 min, determined by a pacemaking oscillator. The pacemaker, in turn, drives a G-protein switch that coordinately exchanges the A- and the S-engines to opposite cell poles, and reverses the direction of gliding. Periodic reversals help the cells build multicellular structures of 102–103 cells. The ability of growing swarms of M. xanthus to build mounds is used by starving cells to build their large, mounded fruiting bodies. At each stage, building multicellular structures to precise specifications relies on the signals passed between cells.
Thesis (Ph. D.)--Massachusetts Institute of Technology, Dept. of Biology, 1995. Includes bibliographical references (leaves 79-80).
Expression of the lux operon from the marine bacterium Vibrio harveyi is dependent on cell density and requires an unlinked regulatory gene, luxR, and other cofactors for autoregulation. Escherichia coli transformed with the lux operon emits very low levels of light, and this deficiency can be partially alleviated by coexpression of luxR in trans. The V. harveyi lux promoter was analyzed in vivo by primer extension mapping to examine the function of luxR. RNA isolated from E. coli transformed with the Vibrio harveyi lux operon was shown to have a start site at 123 bp upstream of the first ATG codon of luxC. This is in sharp contrast to the start site found for lux RNA isolated from V. harveyi, at 26 bp upstream of the luxC initiation codon. However, when E. coli was cotransformed with both the lux operon and luxR, the start site of the lux mRNA shifted from -123 to -26. Furthermore, expression of the luxR gene caused a 350-fold increase in lux mRNA levels. The results suggest that LuxR of V. harveyi is a transcriptional activator stimulating initiation at the -26 lux promoter.
Iron influences liminescence in Vibrio fischeri; cultures iron-restricted for growth rate induce luminescence at a lower optical density (OD) than faster growing, iron-replete cultures. An iron restriction effect analogous to that in V. fischeri (slower growth, induction of luminescence at a lower OD) was established using Escherichia coli tonB and tonB
+ strains transformed with recombinant plasmids containing the V. fischeri lux genes (luxR luxICD ABEG) and grown in the presence and absence of the iron chelator ethylenediamine-di (o-hydroxylphenyl acetic acid) (EDDHA). This permitted the mechanism of iron control of luminescence to be examined. A fur mutant and its parent strain containing the intact lux genes exhibited no difference in the OD at induction of luminescence. Therefore, an iron-binding repressor protein apparently is not involved in iron control of luminescence. Furthermore, in the tonB and in tonB
+ strains containing lux plasmids with Mu dI(lacZ) fusions in luxR, levels of β-galactosidase activity (expression from the luxR promoter) and luciferase activity (expression from the luxICDABEG promoter) both increased by a similar amount (8–9 fold each for tonB, 2–3 fold each for tonB
+) in the presence of EDDHA. Similar results were obtained with the luxR gene present on a complementing plasmid. The previously identified regulatory factors that control the lux system (autoinducer-LuxR protein, cyclic AMP-cAMP receptor protein) differentially control expression from the luxR and luxICDABEG promoters, increasing expression from one while decreasing expression from the other. Consequently, these results suggest that the effect of iron on the V. fischeri luminescence system is indirect.
The Vibrio fischeri luminescence (lux) genes are regulated by the 250-amino-acid-residue LuxR protein and a V. fischeri metabolite termed autoinducer. The V. fischeri lux regulon consists of two divergently transcribed units. Autoinducer and LuxR activate transcription of the luxICDABE operon and autoregulate the luxR transcriptional unit. LuxR proteins with C-terminal truncations of up to 40 amino acid residues coded by plasmids with luxR 3'-deletion mutations are functional in negative autoregulation as demonstrated by using a luxR::lacZ transcriptional fusion as a luxR promoter probe in Escherichia coli. The truncated LuxR proteins showed little or no ability to activate transcription of luxICDABE, as indicated by using luminescence as a sensitive indicator of promoter strength in E. coli. Besides having no detectable activity as positive regulators of luxICDABE, LuxR proteins with C-terminal truncations of more than 40 amino acid residues had reduced or no detectable activity as negative autoregulators. The results suggest that amino acid residues in LuxR prior to no. 211 are sufficient for lux DNA binding. Residues in the region of 211 to 250 constitute a C-terminal tail that appears to be involved in activation of luxICDABE transcription either by interacting physically with the transcription initiation complex or by affecting lux DNA in the vicinity of the promoter.
Regulation of the genes required for bioluminescence in the marine bacterium Vibrio fischeri (the lux regulon) is a complex process requiring coordination of several systems. The primary level of regulation is mediated by a positive regulatory protein, LuxR, and a small diffusible molecule, N-(3-oxo-hexanoyl)-homoserine lactone, termed autoinducer. Transcription of the luxR gene, which encodes the regulatory protein, is positively regulated by the cyclic AMP-CAP system. The lux regulon of V. fischeri consists of two divergently transcribed operons designated operonL and operonR. Transcription of the rightward operon (operonR; luxICDABE), consisting of the genes required for autoinducer synthesis (luxI) and light production (luxCDABE), is activated by LuxR in an autoinducer-dependent fashion. The leftward operon (operonL) consists of a single known gene, luxR. The LuxR protein has also been shown to decrease transcription of operonL through an autoinducer-dependent mechanism, thereby negatively regulating its own synthesis. In this paper we demonstrate that the autoinducer-dependent repression of operonL transcription requires not only LuxR but also DNA sequences within operonR which occur upstream of the promoter for operonL. In the absence of these DNA sequences, the LuxR protein causes an autoinducer-dependent activation of transcription of operonL. The lux operator, located in the control region between the two operons, was required for both the positive and negative autoinducer-dependent responses. By titration of high levels of LuxR supplied in trans with synthetic autoinducer, we found that low levels of autoinducer could elicit a positive response even in the presence of the negative-acting DNA sequences, while higher levels of autoinducer resulted in a negative response. Without these DNA sequences in operonR, LuxR and autoinducer stimulated transcription regardless of the level of autoinducer. These results suggest that a switch between stimulation and repression of operonL transcription is mediated by the levels of the LuxR-autoinducer complex, which in these experiments reflects the level of autoinducer in the growth medium.
The cloning and expression of the lux genes from different luminescent bacteria including marine and terrestrial species have led to significant advances in our knowledge of the molecular biology of bacterial bioluminescence. All lux operons have a common gene organization of luxCDAB(F)E, with luxAB coding for luciferase and luxCDE coding for the fatty acid reductase complex responsible for synthesizing fatty aldehydes for the luminescence reaction, whereas significant differences exist in their sequences and properties as well as in the presence of other lux genes (I, R, F, G, and H). Recognition of the regulatory genes as well as diffusible metabolites that control the growth-dependent induction of luminescence (autoinducers) in some species has advanced our understanding of this unique regulatory mechanism in which the autoinducers appear to serve as sensors of the chemical or nutritional environment. The lux genes have now been transferred into a variety of different organisms to generate new luminescent species. Naturally dark bacteria containing the luxCDABE and luxAB genes, respectively, are luminescent or emit light on addition of aldehyde. Fusion of the luxAB genes has also allowed the expression of luciferase under a single promoter in eukaryotic systems. The ability to express the lux genes in a variety of prokaryotic and eukaryotic organisms and the ease and sensitivity of the luminescence assay demonstrate the considerable potential of the widespread application of the lux genes as reporters of gene expression and metabolic function.
Mutagenesis with transposon mini-Mulac was used previously to identify a regulatory locus necessary for expression of bioluminescence genes, lux, in Vibrio harveyi (M. Martin, R. Showalter, and M. Silverman, J. Bacteriol. 171:2406-2414, 1989). Mutants with transposon insertions in this regulatory locus were used to construct a hybridization probe which was used in this study to detect recombinants in a cosmid library containing the homologous DNA. Recombinant cosmids with this DNA stimulated expression of the genes encoding enzymes for luminescence, i.e., the luxCDABE operon, which were positioned in trans on a compatible replicon in Escherichia coli. Transposon mutagenesis and analysis of the DNA sequence of the cloned DNA indicated that regulatory function resided in a single gene of about 0.6-kilobases named luxR. Expression of bioluminescence in V. harveyi and in the fish light-organ symbiont Vibrio fischeri is controlled by density-sensing mechanisms involving the accumulation of small signal molecules called autoinducers, but similarity of the two luminescence systems at the molecular level was not apparent in this study. The amino acid sequence of the LuxR product of V. harveyi, which indicates a structural relationship to some DNA-binding proteins, is not similar to the sequence of the protein that regulates expression of luminescence in V. fischeri. In addition, reconstitution of autoinducer-controlled luminescence in recombinant E. coli, already achieved with lux genes cloned from V. fischeri, was not accomplished with the isolation of luxR from V. harveyi, suggesting a requirement for an additional regulatory component.
Past work has shown that transformed Escherichia coli is not a suitable vehicle for studying the expression and regulation of the cloned luminescence (lux) genes of Vibrio harveyi. Therefore, we have used a conjugative system to transfer lux genes cloned into E. coli back into V. harveyi, where they can be studied in the parental organism. To do this, lux DNA was inserted into a broad-spectrum vector, pKT230, cloned in E. coli, and then mobilized into V. harveyi by mating aided by the conjugative plasmid pRK2013, also contained in E. coli. Transfer of the wild-type luxD gene into the V. harveyi M17 mutant by this means resulted in complementation of the luxD mutation and full restoration of luminescence in the mutant; expression of transferase activity was induced if DNA upstream of luxC preceded the luxD gene on the plasmid, indicating the presence of a strong inducible promoter. To extend the usefulness of the transfer system, the gene for chloramphenicol acetyltransferase was inserted into the pKT230 vector as a reporter. The promoter upstream of luxC was verified to be cell density regulated and, in addition, glucose repressible. It is suggested that this promoter may be the primary autoregulated promoter of the V. harveyi luminescence system. Strong termination signals on both DNA strands were recognized and are located downstream from luxE at a point complementary to the longest mRNA from the lux operon. Structural lux genes transferred back into V. harveyi under control of the luxC promoter are expressed at very high levels in V. harveyi as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis: the gene transfer system is thus useful for expression of proteins as well as for studying the regulation of lux genes in their native environment.
Regulation of expression of bioluminescence from the Vibrio fischeri lux regulon in Escherichia coli is a consequence of a unique form of positive feedback superimposed on a poorly defined cis-acting repression mechanism. The lux regulon consists of two divergently transcribed operons. The leftward operon contains only a single gene, luxR, which encodes a transcriptional activator protein. The rightward operon contains luxI, which together with luxR and the 218 base pairs separating the two operons comprises the primary regulatory circuit, and the five structural genes, luxC, luxD, luxA, luxB and luxE, which are required for the bioluminescence activity. Transcription of luxR from PL is stimulated by binding of the E. coli crp gene product to the sequence TGTGACAAAAATCCAA upstream of the presumed promoter. Binding of pure E. coli CAP protein in a cAMP-dependent reaction to the V. fischeri lux regulatory region has been demonstrated by in vitro footprinting. The luxI gene product is an enzyme which catalyses a condensation reaction of cytoplasmic substrates to yield the autoinducer, N-(3-oxo-hexanoyl) homoserine lactone. Accumulation of autoinducer, which is freely diffusible, results in formation of a complex with LuxR. The complex binds to the sequence ACCTGTAGGATCGTACAGGT upstream of PR to stimulate transcription of the rightward operon. Increased transcription from PR should yield increased levels of LuxI and higher levels of autoinducer which would further activate LuxR. The LuxR binding site is also a LexA binding site, as demonstrated by in vitro footprinting. Basal transcription from both PL and PR is repressed by sequences within the luxR coding region.(ABSTRACT TRUNCATED AT 250 WORDS)
Vibrio fischeri strain Y-1 (ATCC 33715) emits light with a lambda max of 545 nm rather than the 485-nm emission typical of other strains of V. fischeri. The yellow emission is due to the interaction of the enzyme luciferase with a yellow fluorescent protein (YFP). On the basis of the N-terminal amino acid sequence of YFP, a mixed-sequence oligonucleotide probe was synthesized and used to isolate a 1.6-kbp HindIII fragment containing the first 208 bases of the gene that codes for YFP (luxY). Another synthetic oligonucleotide complementary to bases 167-184 of the YFP coding sequence was used to isolate a second (ca. 1.9 kbp) DNA fragment generated by digestion with both EcoRI and ClaI that contained the remainder of the luxY gene. The intact luxY gene, which encoded a 22,211-dalton polypeptide composed of 194 amino acid residues, was reconstructed from the two primary clones and is contained within a 765-bp SspI-XhoII fragment. Both strands of the entire luxY coding sequence were determined from the reconstructed gene, while the region surrounding the junction used in the reconstruction was also determined from the original partial clones. As with other genes that have been studied from V. fischeri, the luxY gene was unusually AT-rich. The sequence of luxY did not bear any apparent similarity to any of the sequences contained in the current GenBank database. Escherichia coli containing a plasmid with the luxY gene expresses a protein that reacts with antibody raised to authentic YFP.
The 5' and 3' ends of the lux mRNA of Vibrio harveyi, which extends over 8 kilobases, have been mapped, and two new genes, luxG and luxH, were identified at the 3' end of the lux operon. Both S1 nuclease and primer extension mapping demonstrated that the start site for the lux mRNA was 26 bases before the initiation codon of the first gene, luxC. The promoter region contained a typical -10 but not a recognizable -35 consensus sequence. By using S1 nuclease mapping the mRNA was found to be induced in a cell density- and arginine-dependent manner. The DNA downstream of the five known V. harveyi lux genes, luxCDABE, was sequenced and found to contain coding regions for two new genes, designated luxG and luxH, followed by a classical rho-independent termination signal for RNA polymerase. luxG codes for a protein of 233 amino acids with a molecular weight of 26,108, and luxH codes for a protein of 230 amino acids with a molecular weight of 25,326. The termination signal is active in vivo as demonstrated by 3' S1 nuclease mapping, confirming that the two genes are part of the V. harveyi lux operon. Comparison of the luxG amino acid sequence with coding regions immediately downstream from luxE in other luminescent bacteria has demonstrated that this gene may be a common component of the luminescent systems in different marine bacteria.
Expression of Vibrio fischeri luminescence genes requires an inducer, termed autoinducer, and a positive regulatory element, the luxR gene product. A plasmid containing a tac promoter-controlled luxR was mutagenized in vitro with hydroxylamine, and luxR mutant plasmids were identified by their inability to complement a luxR deletion mutation in trans. Sixteen luxR mutant plasmids were obtained, ten of which encoded full-length but inactive luxR gene products as demonstrated by a Western immunoblot analysis. The effects of 1 of the 10 mutations could be overcome by the addition of autoinducer at a high concentration. The mutations in each of the 10 mutant plasmids that directed the synthesis of an inactive LuxR protein were identified by DNA sequencing. Of the 10 proteins encoded by the mutant luxR plasmids, 9 differed from the normally active LuxR in only a single amino acid residue. The amino acid residue substitutions in the proteins encoded by the nine mutant luxR genes clustered in two regions. One region around the middle of the polypeptide encoded by luxR was hypothesized to represent an autoinducer-binding domain, and the other region towards the carboxy terminus of the gene product was hypothesized to constitute a lux operator DNA-binding domain or a lux operator DNA recognition domain.
In bioluminescent bacteria very few agents have been reported that can selectively inhibit the luminescence. In sensitivity tests with Photobacterium phosphoreum, using 55 different antibiotics, it was found that sulfamethizole, an inhibitor of dihydropteroate synthetase and the formation of folic acid, inhibited bioluminescence more than growth. Likewise, in mutants requiring thymine for growth, the luminescence per cell was much less in a medium low in thymine. In neither case could the decreased specific luminescence be attributed to a decrease in the cellular level of luciferase or aldehyde factor; the involvement of additional but unidentified factors in the regulation of in vivo bioluminescence is postulated.
Mutants of Vibrio fischeri MJ-1 (wild type) apparently deficient in adenylate cyclase (cya-like) or cyclic AMP receptor protein (crp-like) were isolated and characterized. Compared with MJ-1, the mutants produced low levels of luminescence and luciferase. Addition of cyclic AMP restored wild-type levels of luminescence and luciferase in the cya-like mutant but not in the crp-like mutant. The results are consistent with the hypothesis that in V. fischeri cyclic AMP and cyclic AMP receptor protein are required for induction of the luminescence system.
Mutagenesis with transposon mini-Mulac was used to identify loci containing genes for bioluminescence (lux) in the marine bacterium Vibrio harveyi. Transposon insertions which resulted in a Lux- phenotype were mapped to two unlinked regions of the genome. Region I contained the luxCDABE operon which was previously shown to encode the enzymes luciferase and fatty acid reductase, which are required for light production. The other locus, region II, which was identified for the first time in this study, appeared to have a regulatory function. In Northern blot analysis of mRNA from mutants with defects in this region, no transcription from the luxCDABE operon could be detected. Strains with transposon-generated lux::lacZ gene fusions were used to analyze control of the transcription of these regions. Expression of luminescence in the wild type was strongly influenced by the density of the culture, and in strains with the lacZ indicator gene coupled to the luxCDABE operon, beta-galactosidase synthesis was density dependent. So, transcription of this operon is responsive to a density-sensing mechanism. However, beta-galactosidase synthesis in strains with lacZ fused to the region II transcriptional unit did not respond to cell density. The organization and regulation of the lux genes of V. harveyi are discussed, particularly with regard to the contrasts observed with the lux system of the fish light-organ symbiont Vibrio fischeri.
The effect of a mutation in luxI (autoinducer synthetase gene) on transcription of luxR in the cloned Vibrio fischeri lux system (luxR, luxICDABE) was examined in Escherichia coli. For the luxI mutant, transcription from the luxR promoter (monitored with beta-galactosidase levels from a luxR::lacZ fusion, with LuxR supplied in trans) decreased fivefold, to levels of the luxI+ strain, only in the presence of added autoinducer. The results demonstrate that, as has been shown at the translational level, autoinducer is required for negative autoregulation of luxR at the transcriptional level.
We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the α and β subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN.
In recent years it has become clear that the production of N-acyl homoserine lactones (N-AHLs) is widespread in Gram-negative bacteria. These molecules act as diffusible chemical communication signals (bacterial pheromones) which regulate diverse physiological processes including bioluminescence, antibiotic production, plasmid conjugal transfer and synthesis of exoenzyme virulence factors in plant and animal pathogens. The paradigm for N-AHL production is in the bioluminescence (lux) phenotype of Photobacterium fischeri (formerly classified as Vibrio fischeri) where the signalling molecule N-(3-oxohexanoyl)-L-homoserine lactone (OHHL) is synthesized by the action of the LuxI protein. OHHL is thought to bind to the LuxR protein, allowing it to act as a positive transcriptional activator in an autoinduction process that physiologically couples cell density (and growth phase) to the expression of the bioluminescence genes. Based on the growing information on LuxI and LuxR homologues in other N-AHL-producing bacterial species such as Erwinia carotovora, Pseudomonas aeruginosa, Yersinia enterocolitica, Agrobacterium tumefaciens and Rhizobium leguminosarum, it seems that analogues of the P. fischeri lux autoinducer sensing system are widely distributed in bacteria. The general physiological function of these simple chemical signalling systems appears to be the modulation of discrete and diverse metabolic processes in concert with cell density. In an evolutionary sense, the elaboration and action of these bacterial pheromones can be viewed as an example of multicellularity in prokaryotic populations.
In Pseudomonas aeruginosa, the transcriptional activator LasR and the Pseudomonas autoinducer PAI, are necessary for efficient transcriptional activation of the lasB gene, encoding elastase (L. Passador, J. M. Cook, M.J. Gambello, L. Rust, and B. H. Iglewski, Science 260:1127-1130, 1993). The transcriptional start points of lasI in Escherichia coli and P. aeruginosa were determined by S1 nuclease mapping. In the presence of both LasR and PAI, the start site, T1, is located at position -25 relative to the ATG translational start codon. A minor transcriptional start, T2, is found at position -13 when lasI is transcribed in the absence of either LasR or PAI in P. aeruginosa and E. coli, respectively. To begin to closely examine the regulation of lasI, whose product is involved in the synthesis of PAI, a lasI-lacZ fusion on a lambda phage was constructed to form monolysogens of E. coli MG4. Lysogens supplied only with either lasI or lasR via multicopy plasmids demonstrated no significant increase in beta-galactosidase expression compared with control levels. Lysogens in which both lasR and lasI were supplied in multicopy exhibited a 62-fold increase in expression, and a lysogen in which lasR was supplied in trans and which was grown in the presence of exogenous PAI exhibited a 60-fold increase. Thus, LasR and PAI are necessary for the full expression of lasI in E. coli. The interchangeability of the P. aeruginosa and Vibrio fischeri homologs LasR and LuxR and their respective autoinducers, PAI and VAI, as activators of lasI-lacZ was examined. Only the combination of LasR and PAI significantly increased the expression of lasI. The comparison of lasI-lacZ and lasB-lacZ expression lysogens grown in the presence of lasR and PAI revealed that half-maximal expression of lasI required 0.1 nM PAI, in contrast to the 1.0 nM PAI necessary for lasB half-maximal expression. These results suggest an autoinduction regulatory hierarchy in which LasR and low PAI concentrations primarily activate lasI expression in a regulatory loop. With the accumulation of PAI, secondary activation of virulence product genes such as lasB occurs.
The bioluminescent bacteria comprise one of several groups of luminous organisms. Significant differences exist between the bioluminescence reactions of different organisms, including the structure and properties of the luciferases and substrates. Molecular oxygen is the only common feature of bioluminescence reactions, indicating that the luminescent systems in most organisms may have evolved independently. Luminescent bacteria are present in marine environment, freshwater, and terrestrial habitats. They can occur as free-living forms, saprophytes, commensal symbionts, parasites of animals, and specific light-organ symbionts. The luminescence produced by these bacteria, because of its inherent beauty and ease of detection, has attracted scientific attention. With the use of molecular approaches to study the luminescence systems of these bacteria, population biology, ecology, and molecular mechanisms of luminescence (lux) gene regulation can be studied. This chapter describes the current status of bioluminescent systems of luminous bacteria, emphasizing the biochemistry, lux gene organization, and the physiological and genetic regulation of lux gene expression. The effects of oxygen on luminescence illustrate the application of bacterial luminescence system as a sensor of specific molecules that affect metabolic function and gene expression. Knowledge of the basic biochemistry, molecular biology, and physiology of luminescent bacteria is thus not only of interest but of importance for future scientific endeavors.
Guidelines for submitting commentsPolicy: Comments that contribute to the discussion of the article will be posted within approximately three business days. We do not accept anonymous comments. Please include your email address; the address will not be displayed in the posted comment. Cell Press Editors will screen the comments to ensure that they are relevant and appropriate but comments will not be edited. The ultimate decision on publication of an online comment is at the Editors' discretion. Formatting: Please include a title for the comment and your affiliation. Note that symbols (e.g. Greek letters) may not transmit properly in this form due to potential software compatibility issues. Please spell out the words in place of the symbols (e.g. replace “α” with “alpha”). Comments should be no more than 8,000 characters (including spaces ) in length. References may be included when necessary but should be kept to a minimum. Be careful if copying and pasting from a Word document. Smart quotes can cause problems in the form. If you experience difficulties, please convert to a plain text file and then copy and paste into the form.
Population density-dependent expression of luminescence in Vibrio fischeri is controlled by the autoinducer N-3-oxohexanoyl-L-homoserine lactone (autoinducer 1 [AI-1]), which via LuxR activates transcription of the lux operon (luxICDABEG, encoding the putative autoinducer synthase [LuxI] and the luminescence enzymes). We recently identified a novel V. fischeri locus, ainS, necessary for the synthesis of a second autoinducer, N-octanoyl-L-homoserine lactone (AI-2), which via LuxR can activate lux operon transcription in the absence of AI-1. To define the regulatory role of AI-2, a luxI ainS double mutant was constructed; in contrast to the parental strain and a luxI mutant, the luxI ainS mutant exhibited no induction of luminescence and produced no detectable luminescence autoinducer, demonstrating that V. fischeri makes no luminescence autoinducers other than those whose synthesis is directed by luxI and ainS. A mutant defective only in ainS exhibited accelerated luminescence induction compared with that of the parental strain, indicating that AI-2 functions in V. fischeri to delay luminescence induction. Consistent with that observation, the exogenous addition of AI-2 inhibited induction in a dose-dependent manner in V. fischeri and Escherichia coli carrying the lux genes. AI-2 did not mediate luxR negative autoregulation, alone or in the presence of AI-1, and inhibited luminescence induction in E. coli regardless of whether luxR was under the control of its native promoter or a foreign one. Increasing amounts of AI-1 overcame the inhibitory effect of AI-2, and equal activation of luminescence required 25- to 45-fold-more AI-2 than AI-1. We conclude that AI-2 inhibits lux operon transcription. The data are consistent with a model in which AI-2 competitively inhibits the association of AI-1 with LuxR, forming a complex with LuxR which has a markedly lower lux operon-inducing specific activity than that of AI-1-LuxR. AI-2 apparently functions in V. fischeri to suppress or delay induction at low and intermediate population densities.
The growth of Pseudomonas aureofaciens PGS12 was followed in nutrient broth (NB), on nutrient agar (NA), and on plant roots by monitoring cell numbers, the production of the autoinducer hexanoyl-homoserine lactone (HHL), and the antibiotic phenazine-1-carboxylic acid (PCA). In NB, as the growth rate declined in transition phase, HHL synthesis increased rapidly, shortly followed by PCA production. During stationary phase, HHL concentration declined rapidly while PCA concentration continued to increase slowly. The luxAB reporter genes were inserted in the phzB gene of the phenazine operon and phenazine transcriptional activity was monitored using measurement of luminescence. Levels and pattern of light output were similar to HHL accumulation and indicated that gene expression was maximal in transition phase and silenced in stationary phase. PCA production continued in stationary phase, suggesting that the protein products of the phenazine operon were maintained in the cell after down regulation. HHL accumulation was 60 times higher on NA than in NB per equivalent volume because of a 60-fold increase in cell density on NA. Higher levels of PCA per cell (6.8 times) and per equivalent volume (360-fold) accumulated in a colony compared to that found in broth. HHL remained at a high concentration in a colony for a longer period compared to a short burst in NB, and this may explain the increased PCA production. In contrast, on wheat seedlings and bean plant roots, bacterial growth was observed, but neither HHL nor PCA was detected; however, transcriptional activity of the phzB::luxAB reporter occurred on the bean plant roots.
The synthesis of the luminous system of the marine luminous bacterium Photobacterium fischeri is subject to a complex, self-regulated control system called autoinduction. The bacteria produce an autoinducer which accumulates in the medium at a constant rate (as a function of cell growth). When autoinducer reaches a critical concentration it stimulates, at the level of transcription, the synthesis of the luminous system. Autoinduction is thus viewed as an environmental sensing mechanism, which curtails the synthesis of the luminous system under dilute conditions. For several isolates of P. fischeri it was found that variations in luminescence intensity could be accounted for by correlated variations in autoinducer production.
A mixed-sequence synthetic oligonucleotide probe was used to isolate a clone containing the gene encoding the alpha subunit of bacterial luciferase from Vibrio harveyi and part of the gene coding for the beta subunit. DNA sequence analysis has allowed us to determine that the genes are closely linked on the bacterial chromosome and transcribed in the same direction. Comparison of the sequences in the regions preceding the two structural genes has revealed considerable homology and has identified sites that may be involved in the expression of the genes. Identification of a clone from a clone bank of total genomic DNA from this organism shows that mixed probes can be successfully used to isolate a gene of interest from any bacterium provided some protein sequence for the gene product is available.
The luminous bacteria have been isolated from marine environments all over the world, both from seawater and from the light organs of certain fish and squid, and from nonmarine habitats as well. The recent taxonomic studies have placed the luminous bacteria in several major groups: marine forms in the genera Photobacterium, Beneckea and Alteromonas, and nonmarine forms in the genera Vibrio and Xenorhabdus. Among the marine luminous bacteria, Photobacterium species occur as symbionts within specialized light organs of higher organisms; Beneckea species have not been found associated with light organs, but members of both genera occur as gut symbionts. The ecology of the luminous bacteria and its relationship to the control of synthesis and expression of the luminescent system has recently been reviewed in some detail. This chapter discusses the present understanding of the reaction catalyzed by bacterial luciferase and the enzyme
Bioluminescence and the synthesis of luciferase inVibrio harveyi growing in a minimal medium are repressible by iron; this is not significantly reversed by cyclic adenosine 3',5'-monophosphate (cAMP). Cultures grown with added iron emit less light and possess less luciferase per cell than those grown under conditions of limiting iron; this may have significance in relation to the function of luciferase as an electron carrier. With iron, and with glycerol as the sole carbon and energy source, the addition of glucose causes further repression, both transient and permanent, and this is only partially reversible by cAMP. Without iron, glucose addition results in only a small and transient repression, but this is fully reversible by cAMP. The inability of cAMP to reverse iron-influenced repression may be explained by both a low rate of transport of cAMP into the bacteria and increased intracellular levels of cyclic nucleotide phosphodiesterase.
The flashlight fish, Photoblepharon, possesses headlight-like luminous
organs situated in the orbit just below the eyes. On the basis of direct
field and laboratory studies, it is postulated that the bioluminescence
is used by the fish for many different functions: to assist in obtaining
prey, to deter or escape predators, and for intraspecific communication.
The fish also uses its light to see by.
Highly purified NADH and NADPH:FMN oxidoreductases from Beneckea harveyi have been characterized with regard to kinetic parameters, association with luciferase, activity with artificial electron acceptors, and the effects of inhibitors. The NADH:FMN oxidoreductase exhibits single displacement kinetics while the NADPH:FMN oxidoreductase exhibits double displacement or ping-pong kinetics. This is consistent with the formation of a reduced enzyme as an intermediate in the reaction of catalyzed by the NADPH:FMN oxidoreductase. Coupling of either of the oxidoreductases to the luciferase reaction decreases the apparent Kms for NADH, NADPH, and FMN, supporting the suggestion of a complex between the oxidoreductases and luciferase. The soluble oxidoreductases are more efficient in producing light with luciferase than is a NADH dehydrogenase preparation obtained from the membranes of these bacteria. The soluble enzymes use either FMN or FAD as substrates for the oxidation of reduced pyridine nucleotides while the membrane NADH dehydrogenase is much more active with artificial electron acceptors such as ferricyanide and methylene blue. FMN and FAD are very poor acceptors. The evidence indicates that neither of the soluble oxidoreductases is derived from the membranes. Both enzymes are constitutive and do not depend on the synthesis of luciferase.
The DNA encoding the luciferase alpha and beta subunits in the luminous marine bacterium Vibrio harveyi (strain 392) is contained within a 4.0-kilobase HindIII fragment. DNA from V. harveyi was digested with HindIII, and the resulting fragments were inserted into the HindIII site of plasmid pBR322. The recombinant plasmids were introduced by transformation into Escherichia coli RR1. The colonies were supplied with n-decanal, the substrate for the bioluminescence reaction, and 12 colonies (of ca. 6000 total) were observed to luminesce brightly. One of the recombinant plasmids, pTB7, has been studied in detail. The high level of expression of bioluminescence in pTB7 was the result not of native V. harveyi promoters but rather of a promoter in pBR322 which is within the tetracycline resistance gene but oriented in the direction opposite to the transcription of the tetracycline gene. Using antiluciferase antibody to probe proteins transferred from sodium dodecyl sulfate-polyacrylamide gels to nitro-cellulose paper, we have shown that the E. coli transformants produce luciferase that cross-reacts with antiluciferase antibody and is the same molecular weight as V. harveyi luciferase. No alpha subunit could be detected by using antiluciferase antibody in lysates of a subclone, pTB104, which is identical with pTB7 except for deletion of the beta-subunit gene. Thus, the alpha subunit may be unstable and be degraded unless it is associated with beta. The bioluminescence emission spectra of V. harveyi and of E. coli transformants carrying pTB7 are indistinguishable.(ABSTRACT TRUNCATED AT 250 WORDS)
The expression of the genes for the major outer membrane proteins OmpF and OmpC are osmoregulated. The ompC locus was found to be transcribed bidirectionally under conditions of high osmolarity and a 174-base transcript encoded upstream of ompC was found to inhibit the OmpF production and to substantially reduce the amount of the ompF mRNA. This RNA [mRNA-interfering complementary RNA (micRNA)] has a long sequence that is complementary to the 5' end region of the ompF mRNA. We propose that the micRNA inhibits the translation of the ompF mRNA by hybridizing with it. This RNA interaction may cause premature termination of the transcription of the ompF gene or destabilization of the ompF mRNA or both.
We present genetic evidence that insertion sequence IS10, the active element in transposon Tn10, can negatively control expression of its own transposase protein at the translational level. This control process is manifested in trans in a phenomenon called "multicopy inhibition": the presence of a multicopy plasmid containing IS10 inhibits transposition of a single copy chromosomal Tn10 element by reducing its ability to express transposition functions. Fusion analysis suggests that expression is reduced at the translational and not the transcriptional level. Only the outer 180 bp of IS10-Right are required on the plasmid for full inhibition. Plasmid-encoded transposase protein is not involved. The genetic structure of the essential plasmid region and the effects of point and deletion mutations on multicopy inhibition lead us to propose that inhibition of transposase translation occurs by direct pairing between the transposase messenger RNA and a small, complementary, regulatory RNA specified by the IS10-encoded pOUT promoter.
Small bacteriophage Mu transposable elements containing the lac operon structural genes were constructed to facilitate the isolation and use of Mu insertions and lac gene fusions. These mini-Mu elements have selectable genes for either ampicillin or kanamycin resistance and can be used to form both transcriptional and translational lac gene fusions. Some of the mini-Mu-lac elements constructed are deleted for the Mu A and B transposition genes and form stable insertions that cannot undergo transposition unless complemented for these functions. A procedure was developed for selecting mini-Mu insertions specifically into plasmids, including commonly used high-copy-number cloning vectors such as pBR322. Mu insertions in pBR322 were found to be distributed around the plasmid, but insertions in certain regions occurred more frequently than in others.
Expression of luminescence in Escherichia coli was recently achieved by cloning genes from the marine bacterium Vibrio fischeri. One DNA fragment on a hybrid plasmid encoded regulatory functions and enzymatic activities necessary for light production. We report the results of a genetic analysis to identify the luminescence genes (lux) that reside on this recombinant plasmid. lux gene mutations were generated by hydroxylamine treatment, and these mutations were ordered on a linear map by complementation in trans with a series of polar transposon insertions on other plasmids. lux genes were defined by complementation of lux gene defects on pairs of plasmids in trans in E. coli. Hybrid plasmids were also used to direct the synthesis of polypeptides in the E. coli minicell system. Seven lux genes and the corresponding gene products were identified from the complementation analysis and the minicell programing experiments. These genes, in the order of their position on a linear map, and the apparent molecular weights of the gene products are luxR (27,000), luxI (25,000), luxC (53,000), luxD (33,000), luxA (40,000), luxB (38,000), and luxE (42,000). From the luminescence phenotypes of E. coli containing mutant plasmids, functions were assigned to these genes: luxA, luxB, luxC, luxD, and luxE encode enzymes for light production and luxR and luxI encode regulatory functions.
Recombinant E. coli that produce light were found in a clone library of hybrid plasmids containing DNA from the marine bacterium Vibrio fischeri. All luminescent clones had a 16 kb insert that encoded enzymatic activities for the light reaction as well as regulatory functions necessary for expression of the luminescence phenotype (Lux). Mutants generated by transposons Tn5 and mini-Mu were used to define Lux functions and to determine the genetic organization of the lux region. Regulatory and enzymatic functions were assigned to regions of two lux operons. With transcriptional fusions between the lacZ gene or transposon mini-Mu and the target gene, expression of lux operons could be measured in the absence of light production. The direction of transcription of lux operons was deduced from the orientation of mini-Mu insertions in the fusion plasmids. Induction of transcription of one lux operon required a function encoded by that operon (autoregulation). From these and other regulatory relationships, we propose a model for genetic control of light production.
Synthesis of bacterial luciferase in some strains of luminous bacteria requires a threshold concentration of an autoinducer synthesized by the bacteria and excreted into the medium. Autoinducer excreted by Photobacterium fischeri strain MJ-1 was isolated from the cell-free medium by extraction with ethyl acetate, evaporation of solvent, workup with ethanol-water mixtures, and silica gel chromatography, followed by normal-phase and then reverse-phase high-performance liquid chromatography. The final product was greater than 99% pure. The structure of the autoinducer as determined by high-resolution 1H nuclear magnetic resonance spectroscopy, infrared spectroscopy, and high-resolution mass spectrometry was N-(3-oxohexanoly)-3-aminodihydro-2(3H)-furanone [or N-(beta-ketocaproyl)homoserine lactone]. The formation of homoserine by hydrolysis of the autoinducer was consistent with this structure. Synthetic autoinducer, obtained as a racemate, was prepared by coupling homoserine lactone to the ethylene glycol ketal of sodium 3-oxohexanoate, followed by mildly acidic removal of the protecting group; this synthetic material showed the appropriate biological activity.
Genes for the luciferase enzyme of Vibrio harveyi were isolated in Escherichia coli by a general method in which nonluminous, transposon insertion mutants were used. Conditions necessary for light production in E. coli were examined. Stimulation of transcription of the genes for luciferase (lux A and lux B) was required for efficient synethesis of luciferase. To enhance transcription bacteriophage promoter elements were coupled to the cloned lux gene fragments.