Content uploaded by Krzysztof Lukaszuk
Author content
All content in this area was uploaded by Krzysztof Lukaszuk on Dec 11, 2015
Content may be subject to copyright.
R E S E A R C H Open Access
Comparison of whole genome amplification and
nested-PCR methods for preimplantation genetic
diagnosis for BRCA1 gene mutation on
unfertilized oocytes–a pilot study
Danuta Michalska
1,2†
, Kinga Jaguszewska
1†
, Joanna Liss
1
, Kamila Kitowska
1
, Agata Mirecka
1
and Krzysztof Łukaszuk
1,3,4*
Abstract
Background: Preimplantation genetic diagnosis (PGD) remains nowadays a valid alternative for couples at high-risk
of having a child with a genetic disease and for women older than 37–40 years with the high risk of chromosomal
aneuploidies in the embryos. However the use of PGD for high penetrance recessive, dominant and X-liked
disorders occurring in early life is documented, debate exists regarding its appropriateness in lower penetrance and
late-onset cancer susceptibility syndromes. The data regarding the efficacy of different molecular techniques used
in PGD are still lacking. We therefore sought to assess the different molecular techniques used in PGD for detecting
three most frequent BRCA1 gene mutations: 5382insC, 185delAG and C61G.
Methods: Anonymous donors of the oocytes and control healthy blood samples were extracted and analyzed in
the Fertility and Reproductive Center Invicta in Gdansk. Preimplantation genetic diagnosis for the most frequent
mutations: 185delAG, 5382insC, C61G in BRCA 1 gene was carried out on single, unfertilized oocytes, in metaphase
of second meiotic division, not qualified to IVF. Positive mutation controls were represented by cell lines from the
Coriell Institute for Medical Research: GM14090 (185delAG), GM14097 (C61G), GM13715 (5382insC).
Results: Repeatability of the results acquired from the WGA analysis for the mutation 5382insC was 38%. The
repeatability of the nested-PCR analysis in the second roundoftheamplificationwaslabileforthemutation
5382insC and 185delAG and was ranged from 47% to 57%. However, the repeatabilityforthemutationC61G
was 100%.
Conclusions: Our results suggest that the nested-PCR technique remains more sensitive and specific method as
compared to WGA. WGA performed on the single cells did not reflect expected results. The repeatability of the
WGA methodology remains questionable, and any analysis attempt does not guarantee reliable results.
Further evaluation is strongly needed to propose the most accurate molecular technique used in PGD for
detecting three most frequent BRCA1 gene mutations: 5382insC, 185delAG and C61G.
* Correspondence: krzysztof.lukaszuk@invicta.pl
†
Equal contributors
1
INVICTA Fertility and Reproductive Center, Rajska 10, Gdansk 80-850, Poland
3
Department of Obstetrics, Gynecology and Endocrinology, University of
Varmia and Masuria, Olsztyn, Poland
Full list of author information is available at the end of the article
© 2013 Michalska et al.; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative
Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and
reproduction in any medium, provided the original work is properly cited.
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10
http://www.hccpjournal.com/content/11/1/10
Introduction
Preimplantation genetic diagnosis (PGD) remains nowadays
a valid alternative for couples at high-risk of having a child
with monogenetic diseases, i.e. cystic fibrosis, β-talasemia,
Huntington’s disease, myotonic dystrophy and for women
with the high risk of chromosomal aneuploidies in the em-
bryos [1,2].
Large body of literature documented the use of PGD
for high penetrance recessive, dominant and X-liked dis-
orders occurring in early life. It was used as well in case
of high penetrance cancer syndromes that appear later
[3,4].
Hereditary breast and ovarian cancer (HBOC) reveals as
a monogenic predisposition of offspring features autosomal
dominant inheritance due to constitutional mutations in
the BRCA1 gene [5]. Many BRCA1 gene mutations charac-
terized familial occurrence and the presence of specific
mutations are much more frequent in certain isolated
populations and ethnic groups compared to the general
population [6]. Rubin et al. reported that carriers of muta-
tions in the BRCA1 gene appear to have a significantly
more favorable clinical course [7]. In opposite, Johannsson
et al. suggested that the survival for carriers of BRCA1
mutation is similar or worse compared to the patients
with breast and ovarian cancer in general [8]. Later reports
documented that women with BRCA gene mutations have
65–85% risk of breast cancer exposure [9]. The carriers of
the BRCA1 and BRCA2 mutation have a risk of the ovar-
ian cancer ranged 18% to 56% and 14% to 27%, respect-
ively [10].
The debate regarding the use of PGD in lower pene-
trance and late-onset cancer susceptibility syndromes
was accomplished with the final UK Human Fer-
tilization and Embryology Authority (HFEA) approval
forthisdiagnosticmethodtobeavailableforHBOC
[11].
Recently published study reported a potential use of
PGD for BRCA1/2 carriers, particularly in those who
would have to undergo the in-vitro fertilization (IVF) due
to the infertility [12]. However these data should be
interpreted with caution taking into account the age, emo-
tional stress, fertility status and the presence of confirmed
cancer diagnosis [12].
Nowadays, the data regarding the efficacy of different
molecular techniques used in PGD are lacking. Nested
poly-chain reaction technique (Nested-PCR) and whole
genome amplification (WGA) technique remain cur-
rently the frequently used methods for genetic mutations
in PGD. However their accuracy still remains intriguing
due to lacking data regarding the optimal PGD method-
ology for detecting BRCA1 gene mutations.
Herein we sought to assess the different molecular
techniques use in PGD for detecting three most frequent
BRCA1 gene mutations: 5382insC, 185delAG and C61G.
Methods
Setting
Anonymous donors of the oocytes were extracted in the
Fertility and Reproductive Center Invicta in Gdansk. Pre-
implantation genetic diagnosis for the most frequent
BRCA 1 mutations: 185delAG, 5382insC, C61G, was car-
ried out on single, unfertilized oocytes, in metaphase of
second meiotic division, not qualified to IVF.
Control blood samples were obtained from the healthy
subjects, to perform molecular analysis based on standard
procedures carried out in the laboratory of molecular biol-
ogy, Medical Clinics and Laboratories Invicta, Gdansk,
Poland. Positive mutation controls were represented by
cell lines from the Coriell Institute for Medical Research:
GM14090 (185delAG), GM14097 (C61G), GM13715
(5382insC). The study was approved by the local Ethics
Committee in Olsztyn. All patients provided written in-
formed consent before the procedure.
DNA isolation from lymphocytes and cell lines
The isolation of the genetic material from lymphocytes
and cell lines was obtained using a commercial DNA ex-
traction kits (Blood Mini, A&A Biotechnology Comp. and
Genomic Mini, A&A Biotechnology Comp., respectively).
The measurement of the concentrations of DNA was
carried out with a spectrophotometer GeneQuant RNA/
DNA Calculator (model 80-2103-98, Pharmacia Biotech,
USA) and quartz cuvette, previously washed with distilled
water and dried. Each sample was transferred to a cuvette
and placed in a chamber of the spectrophotometer. The
average results were calculated as appropriate.
Cell lysis protocol
The cells were deposited in lysis buffer (SDS and protein-
ase K). Cell lysis was performed by using thermocycler
PTC 225 DNA Engine Tetrad Peltier Thermal Cycler
according to the profile temperature: 60 min in 37°C,
15 min in 99°C.
PCR amplification of specific alleles
After cell lysis protocol, to the isolated DNA the outer
PCR mix was added. The PCR reaction mix comprises
25 μl of the lysis buffer containing the isolated DNA or
negative control, the distilled water. For the mutations
5382insC and C61G the outer PCR reaction contained:
3μlDNA,2μl primers mix, 0,5 μldNTPs,0,2μl polymer-
ase Taq, 2,5 μl PCR buffer, 0,75 μl MgCl
2
and 16,05 μl
H
2
O. For the 185delAG mutation the reaction mix
contained: 3 μlDNA,1μl primers mix, 0,5 μldNTPs,
0,2 μl polymerase Taq, 2,5 μlPCRbuffer,0,75μl MgCl
2
and 17,05 μlH
2
O. All primers sequences were chosen
according to the tested mutation. The sequences of the
primers used in the ASA-PCR reaction are presented in
Table 1. Amplification for the mutation 5382insC was
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 2 of 9
http://www.hccpjournal.com/content/11/1/10
as follows: denaturation step of 95°C for 120 seconds,
followed by 34 cycles of denaturation at 94°C for 60 sec-
onds, annealing at 69°C for 45 seconds, extension at 70°C
for 60 seconds and final extension at 72°C for 300 seconds.
For the mutations 5382insC, C61G amplification was
as follows: denaturation step of 95°C for 120 seconds,
followed by 9 cycles of denaturation at 94°C for 60 sec-
onds, annealing at 57°C for 60 seconds, extension at 72°C
for 60 seconds. This was followed by 24 more cycles of de-
naturation at 94°C for 30 seconds, annealing at 57°C for
60 seconds, extension at 72°C for 60 seconds. Final exten-
sion was performed at 72°C for 300 seconds.
Restriction fragments length polymorphism (RFLP)
RFLP was performed to verify the ASA-PCR method.
RFLP was carried out for the mutations of C61G. The iso-
lated DNA was fragmented by a restriction enzyme Ava II
(EcoR471). Total volume of the PCR reaction mixture was
25 μl and contained: 1,5 μl PCR buffer, 8 μl amplified
DNA and 1,5 μl of restriction enzyme. Each PCR reaction
contained negative control, the distilled water. Digestion
of the restriction enzyme was incubated in 37°C for
12 hours with using Hybrigene incubator (Techne Comp).
The sequences of the primers used in the RFLP reaction
are presented in Table 2.
Whole genome amplification (WGA)
We amplified the entire genome from a cell up to micro-
gram level to further analysis. The commercially available
Whole Genome Amplification kit (Roche, Switzerland)
was used for this study. 1 μl of genomic DNA were mixed
with 9 μl sample buffer and then heat denatured at 95°C
for three minutes and cooled to 4°C. Next, 9 μl of reaction
buffer were mixed with 1 μl enzyme mixture and added to
the denatured genomic DNA. The reaction was subse-
quently incubated at 30°C for 90 minutes, then heat
inactivated at 65°C for 10 minutes and cooled on ice. The
PCR reaction contained 12,5 μlofthelysisbuffer
containing the isolated DNA or negative control, the dis-
tilled water. Amplification conditions were set for the
5382insC mutation. For the other mutations we did not
achieve the expected results.
For the mutation 5382insC the PCR mix reaction
contained: 2 μlDNA,1μl primers mix, 0,25 μldNTPs,
0,1 μl polymerase Taq, 1,25 μlPCRbuffer,0,375μl MgCl
2
and 8,025 μlH
2
O. All primers sequences were chosen
according to the tested mutation. The sequences of the
primers used in the ASA-PCR reaction are presented in
Table 1. Amplification for the mutation 5382insC was
as follows: denaturation step of 96°C for 120 seconds,
followed by 10 cycles of denaturation at 96°C for 45 sec-
onds, annealing at 66°C for 45 seconds, extension at 72°C
for 45 seconds. This was followed by 20 more cycles of de-
naturation at 94°C for 45 seconds, annealing at 66°C for
45 seconds, extension at 72°C for 45 seconds. Final exten-
sion was performed at 72°C for 300 seconds.
Nested-PCR amplification
Primers sequences used in the nested-PCR reaction
were designed based on the published sequences of
the BRCA1 gene in a ESEMBL (http://www.ensembl.
org; BRCA1: ENST00000337272) and using the Primer3
program for primer design.
Nested PCR reaction is based on the amplification of
an extended sequence in the first stage and the amplifi-
cation of an internal sequence from the product of the
first in second stage. This technique increases specificity
and sensitivity of the PCR reaction by controlling reac-
tion conditions for each amplification to favor gener-
ation of the desired product.
Nested-PCR reaction for blood samples
Multiplex-PCR reaction was carried out for the muta-
tions of BRCA 1 gene: 5382insC, 185delAG and C61G.
Table 2 The sequences of the primers used in the RFLP
reaction
Mutation Sequence of the primers mp Product
length
C61G F: 5’CTC TTA AGG GCA GTT GTG AG 3’59,1°C 158 pz
R: 5’ATG GTT TTA TAG GAA CGC TAT G 3’58,6°C 118 pz
Table 3 The sequences of the primers used in the nested-
PCR reaction
Mutation Sequence of the primers mp Product
length
5382insC F: 5’AGTGATCTGCCTGCCTCAGT 3’64,1°C 315 pz
R: 5’CCATCTCTGCAAAGGGGAGT 3’65,4°C
185delAG F: 5’TTGGAGAAAGCTAAGGCTACCA 3’65,4°C 685 pz
R: 5’CCCAGTGCAGAACCAATCA 3’64,9°C
C61G F: 5’TTGCTTATGCAGCATCCAAA 3’64,2°C 633 pz
R: 5’GCACTCCAGCCTCAGTGAC 3’63,9°C
Table 1 The sequences of the primers used in the ASA-
PCR reaction
Mutation Sequence of the primers mp Product
length
5382insC
N: 5’AGAGAATCCCAGGACA 3’68,2°C
168 pzM: 5’AGAGAACTCCCAGGAC 3’81,8°C
R: 5’ATATGACGTGTCTGCTCCAC 3’64,1°C
185delAG
N: 5’GCTGACTTACCAGATGGGACTCTC 3’66,1°C
335 pz
M: 5’CCCAAATTAATACACTCTTGTCGT
GACTTACCAGATGGGACAGTA 3’78,4°C
R: 5’GGT TGG CAG CAA TAT GTG AA 3’63,4°C
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 3 of 9
http://www.hccpjournal.com/content/11/1/10
DNA was obtained from unrelated individuals of Polish
population and isolated from peripheral blood lympho-
cytes. Total volume of the PCR reaction mixture was
25 μl and contained: 0,5 μl of the isolated DNA, 3 μl
primers mix, 0,5 μl dNTPs, 0,2 μl polymerase Taq, 2,5 μl
PCR buffer, 0,75 μl MgCl
2
and 17,55 μlH
2
O. Each PCR
reaction contained negative control, the distilled water.
The sequences of the primers used in the nested-PCR
reaction are presented in Table 3. First stage of amplifi-
cation for the mutations 5382insC, 185delAG and C61G
was as follows: denaturation step of 95°C for 120 sec-
onds, followed by 34 cycles of denaturation at 94°C for
60 seconds, annealing at 62°C for 60 seconds, extension
at 72°C for 60 seconds and final extension at 72°C for
300 seconds. In second stage of amplification the PCR
reaction mixture for the mutation 5382insC contained:
0,5 μl of the isolated DNA, 2 μl primers mix, 0,5 μl
dNTPs, 0,2 μl polymerase Taq, 2,5 μl PCR buffer, 1,12 μl
MgCl
2
and 18,18 μlH
2
O. The annealing temperature
was raised from 69°C to 71°C. The PCR reaction mixture
for the mutation 185delAG contained: 0,5 μl of the iso-
lated DNA, 1 μl primers mix, 0,5 μl dNTPs, 0,2 μl poly-
merase Taq, 2,5 μl PCR buffer, 0,75 μl MgCl
2
and
19,55 μlH
2
O. The annealing temperature was raised
from 57°C to 65°C. Each PCR reaction contained nega-
tive control, the distilled water.
Nested-PCR reaction for oocytes
DNA was isolated from single oocytes. Multiplex-PCR
was performed for each mutations of BRCA1 gene:
5382insC, 185delAG and C61G. The PCR reaction was
performed in a total volume of 25 μl with negative con-
trol–the distilled water. The sequences of the primers used
in the nested-PCR reaction are presented in Table 3. The
composition of the PCR reaction mixture was the same as
in the second stage of amplification for blood samples.
The amount of isolated DNA was increased to 6 μlinthe
second stage of amplification. The PCR reaction was
performed in a total volume of 25 μl and for mutation of
5382insC contained: 6 μlofDNA,2μl primers mix, 0,5 μl
dNTPs, 0,2 μl polymerase Taq, 2,5 μl PCR buffer, 0,75 μl
MgCl
2
and 13,05 μlH
2
O. For the mutations of 185delAG
and C61G PCR reaction contained: 6 μlofDNA,1μl
primers mix, 0,5 μldNTPs,0,2μlpolymeraseTaq,2,5μl
PCR buffer, 0,75 μl MgCl
2
and 14,05 μlH
2
O. In the third
stage of amplification were performed ASA-PCR and
RFLP analyses. PCR products were separated on a 2% de-
naturing polyacrylamide gel mounted on a Sigma-Aldrich
DNA Sequencer and Power-Pac 300 (Bio-Rad) with auto-
mated fluorescent scanning detection and analyzed using
Quantity One Analysis Software (Bio-Rad).
Results
Repeatability of the results acquired from the WGA ana-
lysis for the mutation 5382insC was 38% (Table 4). The
WGA analysis for the mutation 5382insC of BRCA 1 gene
is presented on Figures 1 and 2. WGA performed on the
single cells did not reflect expected results. The repeatabil-
ity of this method remains still questionable particularly
for the material investigated in the present study. The re-
peatability of the nested-PCR analysis in the second round
Table 4 WGA of oocytes-recurrence of the results for
oocytes obtained from the same amplification conditions
for each mutation
Mutation
Amount of amplified
gene fragments
in one sample
Number of
samples [n] Average Recurrence
5382insC 3/3 2 0,38 38%
0/5
Figure 1 WGA analysis-ASA-PCR technique. Analyses of the mutation of 5382insC; 1 N, 2 N, 3 N, 4 N–normal allele; 1 M, 2 M, 3 M,
4M–mutation allele; K+N, K+M–positive control (N–normal alelle, M–mutation allele); K-N, K-M–negative control; size marker–pUC19.
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 4 of 9
http://www.hccpjournal.com/content/11/1/10
of the amplification was labile for the mutation 5382insC
and 185delAG and was ranged from 47% to 57% (Table 5).
However, the repeatability for the mutation C61G was
100% (Table 5). Sample results of the nested-PCR analysis
for each mutation of BRCA 1 gene are presented on
Figures 3, 4, 5 and 6.
Discussion
The present study reports a comparison of two PGD tech-
niques: WGA and nested-PCR. Our results suggest that
the nested-PCR technique is more sensitive and specific
method as compared to WGA potentially due to the two-
phase amplification which simplifies the final analysis. The
usage of the WGA method therefore remains question-
able, and any analysis attempt does not guarantee reliable
results.
Among female population, 5000 breast cancer deaths
is recorded in Poland annually [13]. Morbidity rate rises
with the age and is the highest at 40 years of age. The
genetic basis of cancer significantly worses patients clin-
ical status.
Breast cancer susceptibility gene 1 (BRCA1) was the first
gene assigned responsible for developing hereditary breast
and ovarian cancer which manifests as a HBOC syndrome
(Hereditary Breast and Ovarian Cancer Syndrome).
HBOCs reveals as a monogenic predisposition of pedigree
features autosomal dominant inheritance due to constitu-
tional mutations in the BRCA1 gene. According to the
dominant model of inheritance of just one allele mutation
that predisposes to disease BRCA1 mutated gene is passed
to offspring by both men and women. The BRCA1 gene
has almost 2000 described sequences changes, including
mutations leading to changes in the reading frame by dele-
tion or insertion, missense mutations, inframe deletions,
nonsense and various types of sequence variants and poly-
morphisms (Breast Cancer Information Core). Most of
them lead to the premature termination of translation and
a shortened protein formation (approximately 87% of all
terminal mutations in BRCA1). It has been suggested that
the clinical effect depends on the position along the gene
mutation. The central region of the BRCA1 gene is associ-
ated with an increased risk of breast cancer compared to
other regions of the gene. Furthermore, the mutations are
located closer to the 5 ′end of the BRCA1 gene are at
higher risk for ovarian cancer than those to the 3′end
[14,15].
However a number of studies were performed among
Polish population, data regarding the methodology of gene
mutations detection are lacking [16-21]. The preimplanta-
tion diagnosis technique has not been published so far.
Therefore, this paper presents a methodology for detection
of three mutations of BRCA 1 gene: 5382insC, 185delAG
and C61G, using unfertilized oocytes from anonymous
women. Here we should depict the fact, that the mutations
Figure 2 WGA analysis-ASA-PCR technique. Analyses of the mutation of 5382insC; 1 N, 2 N, 3 N, 4 N–normal allele; 1 M, 2 M, 3 M,
4M–mutation allele; K+N, K+M–positive control (N–normal alelle, M–mutation allele); K-N, K-M–negative control; size marker–pUC19.
Table 5 Nested-PCR amplification of oocytes–second
stage of amplification-recurrence of the results for
oocytes obtained from the same amplification conditions
for each mutation
Mutation
Amount of amplified
gene fragments
in one sample
Number of
samples [n] Average Recurrence
5382insC
4/5
3 0,47 47%2/5
1/5
185delAG
2/5
3 0,67 67%3/5
5/5
C61G 5/5 22100%
10/10 1
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 5 of 9
http://www.hccpjournal.com/content/11/1/10
in the BRCA1 gene do not constitute a pathogenic factor,
but potentially predispose to breast cancer.
Preimplantation genetic diagnosis (PGD) is nowadays
a valid alternative for parents with a genetic disease and
high-risk child transmission of gene defects. This re-
mains also an alternative for women older than 37–
40 years with the high risk of chromosomal aneuploidies
in the embryos [1,2]. The usage PGD for lower pene-
trance and late-onset cancer susceptibility syndromes is
still debated and remains a frequently asked and as yet
incompletely answered question.
In the current study we performed two most common
PGD techniques of molecular biology-WGA and nested
multiplex PCR. It was demonstrated that none of these
diagnosis methods of mutations in the BRCA1 gene
were satisfactory due to its low effectiveness.
The main disadvantages of WGA technique is non-
specific products formation. In the multiplex nested-
PCR technique the most challenging is appropriate
primers design for the multiplex reaction. Although this
method is more specific with respect to the studied gene
segment. Moreover, the use of several pairs of primers
allows receiving a proper short DNA fragment.
However, the multiplication of genetic material during
subsequent rounds of amplification can also lead to the
formation of nonspecific products. Proper analysis depends
on the appropriate diagnostic technique. Therefore we
obtained positive results for diagnostic analysis of the
C61G mutation using RFLP technique. Recurrence of
nested-PCR method for single oocyte in the second round
of amplification was 100%. ASA-PCR technique has
proven to be sub-optimal diagnostic method. After using
Figure 3 Nested-PCR amplification of oocytes, IInd amplification–analysis of the mutations of 5382insC; 1, 2, 3, 4, 5–amplificated
fragment of the gene; DM–amplificated fragment of the gene on blood sample probe; K+ –positive control; K- –negative control;
size marker–pUC19.
Figure 4 Nested-PCR amplification of oocytes, IInd amplification–analysis of the mutations of 185delAG; 1, 2, 3, 4, 5–amplificated
fragment of the gene; DM–amplificated fragment of the gene on blood sample probe; K+ –positive control; K- –negative control;
size marker–pUC19.
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 6 of 9
http://www.hccpjournal.com/content/11/1/10
theWGAtechniquerecurrencewas38%.Inthenested-
PCR technique recurrence was 47% for mutation 5382insC
and 67% for 185delAG mutation.
In 2007, Menon and colleagues published the results of
a postal survey of BRCA mutation carriers. Only 51% of
patients responded to the previously send questionnaires.
Of these, 75% were supportive of offering PGD [11]. 15
people from 40 respondents (37.5%) who do not plan to
enlarge the family and 14% of those who want to enlarge
the family would consider the PGD [11]. Another study
performed by Quinn et al. presented that out of 111 pa-
tients with strong aggregation of breast and ovarian can-
cer, 57% found PGD as a one of the diagnostic methods of
BRCA1 mutation in carriers, while the other 33% were
personally interested in using this method [22].
Sagi et al. published a method for PGD, where con-
vinced that the majority of patients participating in the
program were often very pleased with the opportunities
given by PGD [12]. It should be noted that the study
performed on patients with breast and ovarian cancer
HBOCs has a relatively high level of acceptance of PGD
for the BRCA1 gene mutation diagnosis. Interest in PGD
procedure is ranged between 14 and 75%.
Undoubtedly, PGD in mutations of the gene BRCA1 will
be often accepted by patients where in vitro fertilization is
necessary. However, it should be emphasized, that fertile
patients would also consider the possibility of performing
PGD techniques, particularly in case of the strong aggre-
gation of breast cancer within the family with the occur-
rence of cancer at a young age. In addition in families of
patients with co-occurrence of breast and ovarian cancer,
significantly increases the probability of identification of
the mutation in this gene. Certainly, the decision is im-
pacted by the ethical and psychological factors.
Moreover, we should stress the fact that PGD for the
mutation of BRCA1 gene is still controversial and meets
Figure 5 Nested-PCR, IInd amplification–analysis of the mutations of C61G; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10-amplificated fragment of the
gene; DM–amplificated fragment of the gene on blood sample probe; K+ –positive control; K- –negative control; size marker–pUC19.
Figure 6 Nested-PCR–analysis of the mutations of C61G after enzyme restriction Ava II in 37°C temp.; 1, 2, 3, 4, 5, 6, 7, 8, 9, 10-
amplificated fragment of the gene; DM–amplificated fragment of the gene on blood sample probe; K+ –positive control; K- –negative
control; size marker–pUC19.
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 7 of 9
http://www.hccpjournal.com/content/11/1/10
with multiple opponents. However, PGD should be con-
sidered for people who have fertility problems and are
burdened to genetic mutation in the BRCA1 gene. None-
theless, mutations in the BRCA1 gene do not give confi-
dence to transform normal cells into cancer cells, and
other factors are essential to conduct neoplasia. PGD is
therefore addressed to carriers the mutation in the BRCA1
gene wanted to deprive their future children a substantial
risk of breast cancer.
It seems that the lack of knowledge of patients about
the hereditary breast and ovarian cancer, can significantly
reduce the level of trust in relation to preimplantation
diagnosis.
Although PGD for the BRCA1 gene mutation detection
remains still controversial, there is a large group of people
who would decide to perform the PGD. The knowledge of
the potential consequences of the gene mutation posses-
sion will raise the desire to explore opportunities carried
by PGD. The awareness of having the mutated gene and
the ability of transferring gene defect to offspring should
significantly sensitize the patient to the future fate of their
children. Unfortunately, most people still do not have suf-
ficient knowledge of PGD or never heard of this diagnostic
technique, which significantly affects the current opinions.
The accurate methodology of PGD would also strengthen
the efforts to broad the knowledge of the positive sites of
PGD and improve its use in routine clinical practice.
Conclusion
In the study we compared the two PGD techniques: WGA
and nested-PCR. Our results suggest that the nested-PCR
technique is more sensitive and specific method as com-
pared to WGA potentially due to the two-phase amplifica-
tion which simplifies the final analysis. WGA performed
on the single cells did not reflect expected results. The re-
peatability of the WGA methodology remains question-
able, and any analysis attempt does not guarantee reliable
results.
The accuracy of different PGD methodologies for de-
tecting BRCA1 gene mutations still remains intriguing
due to the lacking data so far. Therefore further evaluation
is strongly needed to propose the most accurate molecular
technique used in PGD for detecting three most frequent
BRCA1 gene mutations: 5382insC, 185delAG and C61G.
Competing interests
The authors report no financial relationships or conflicts of interest regarding
the content herein.
Authors’contributions
KL - study concept and design. DM, JL, KK, AM - carried out the molecular
genetic studies and participated in the sequence alignment. DM, JL, KJ, KL -
interpretation of data. KJ - drafted the manuscript. KL - critical revision of the
manuscript for important intellectual content. KL - study supervision. All
authors read and approved the final manuscript.
Author details
1
INVICTA Fertility and Reproductive Center, Rajska 10, Gdansk 80-850, Poland.
2
Faculty of Biology, University of Gdansk, Gdansk, Poland.
3
Department of
Obstetrics, Gynecology and Endocrinology, University of Varmia and Masuria,
Olsztyn, Poland.
4
Department of Obstetrics and Gynecology Nursing, Medical
University of Gdansk, Gdansk, Poland.
Received: 25 March 2013 Accepted: 11 July 2013
Published: 13 August 2013
References
1. Handyside AH, Kontogianni EH, Hardy K, Winston RM: Pregnancies from
biopsied human preimplantation embryos sexed by Y-specific DNA
amplification. Nature 1990, 344:768–770.
2. Sermon K, Van Steirteghem A, Liebaers I: Preimplantation genetic
diagnosis. Lancet 2004, 363:1633–1641.
3. Sermon K, Moutou C, Harper J, Geraedts J, Scriven P, Wilton L, Magli MC,
Michiels A, Viville S, De Die C: ESHRE PGD consortium data collection IV:
May-December 2001. Hum Reprod 2005, 20:19–34.
4. Harper JC, Boelaert K, Geraedts J, Harton G, Kearns WG, Moutou C,
Muntjewerff N, Repping S, SenGupta S, Scriven PN, Traeger-Synodinos J,
Vesela K, Wilton L, Sermon KD: ESHRE PGD consortium data collection V:
Cycles from January to December 2002 with pregnancy follow-up to
October 2003. Hum Reprod 2006, 21:3–21.
5. Lubinski J, Gorski B, Kurzawski G, Jakubowska A, Cybulski C, Suchy J,
Debniak T, Grabowska E, Lener M, Nej K: Molecular basis of inherited
predispositions for tumors. Acta Biochim Pol 2002, 49:571–581.
6. Struewing JP, Hartge P, Wacholder S, Baker SM, Berlin M, McAdams M,
Timmerman MM, Brody LC, Tucker MA: The risk of cancer associated with
specific mutations of BRCA1 and BRCA2 among Ashkenazi Jews. N Engl J
Med 1997, 336:1401–1408.
7. Rubin SC, Benjamin I, Behbakht K, Takahashi H, Morgan MA, LiVolsi VA,
Berchuck A, Muto MG, Garber JE, Weber BL, Lynch HT, Boyd J: Clinical and
pathological features of ovarian cancer in women with germ-line
mutations of BRCA1.N Engl J Med 1996, 335:1413–1416.
8. Johannsson OT, Ranstam J, Borg A, Olsson H: Survival of BRCA1 breast and
ovarian cancer patients: A population-based study from southern
Sweden. J Clin Oncol 1998, 16:397–404.
9. Antoniou A, Pharoah PD, Narod S, Risch HA, Eyfjord JE, Hopper JL, Loman N,
Olsson H, Johannsson O, Borg A, Pasini B, Radice P, Manoukian S, Eccles DM,
Tang N, Olah E, Anton-Culver H, Warner E, Lubinski J, Gronwald J, Gorski B,
Tulinius H, Thorlacius S, Eerola H, Nevanlinna H, Syrjakoski K, Kallioniemi OP,
Thompson D, Evans C, Peto J, et al: Average risks of breast and ovarian
cancer associated with BRCA1 or BRCA2 mutations detected in case
series unselected for family history: A combined analysis of 22 studies.
Am J Hum Genet 2003, 72:1117–1130.
10. Sogaard M, Kjaer SK, Gayther S: Ovarian cancer and genetic susceptibility
in relation to the BRCA1 and BRCA2 genes. Occurrence, clinical
importance and intervention. Acta Obstet Gynecol Scand 2006, 85:93–105.
11. Menon U, Harper J, Sharma A, Fraser L, Burnell M, ElMasry K, Rodeck C,
Jacobs I: Views of BRCA gene mutation carriers on preimplantation
genetic diagnosis as a reproductive option for hereditary breast and
ovarian cancer. Hum Reprod 2007, 22:1573–1577.
12. Sagi M, Weinberg N, Eilat A, Aizenman E, Werner M, Girsh E, Siminovsky Y,
Abeliovich D, Peretz T, Simon A, Laufer N: Preimplantation genetic
diagnosis for BRCA1/2–a novel clinical experience. Prenat Diagn 2009,
29:508–513.
13. Nowicki A, Olszewska A: Humanska M [self-examination influence on
breast cancer detection. Research conducted in women after breast
amputation]. Ginekol Pol 2007, 78:293–298.
14. Gayther SA, Harrington P, Russell P, Kharkevich G, Garkavtseva RF, Ponder
BA: Frequently occurring germ-line mutations of the BRCA1 gene in
ovarian cancer families from Russia. Am J Hum Genet 1997, 60:1239–1242.
15. Pharoah PD, Ponder BA: The genetics of ovarian cancer. Best Pract Res Clin
Obstet Gynaecol 2002, 16:449–468.
16. Gorski B, Jakubowska A, Huzarski T, Byrski T, Gronwald J, Grzybowska E,
Mackiewicz A, Stawicka M, Bebenek M, Sorokin D, Fiszer-Maliszewska L,
Hauss O, Janiszewska H, Niepsuj S, Gozdz S, Zaremba L, Posmyk M,
Pluzanska M, Kilar E, Czudowska D, Wasko B, Miturski R, Kowalczyk JR,
Urbanski K, Szwiec M, Koc J, Debniak B, Rozmiarek A, Debniak T, Cybulski C,
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 8 of 9
http://www.hccpjournal.com/content/11/1/10
et al: A high proportion of founder BRCA1 mutations in Polish breast
cancer families. Int J Cancer 2004, 110:683–686.
17. Brozek I, Cybulska C, Ratajska M, Piatkowska M, Kluska A, Balabas A, Dabrowska
M, Nowakowska D, Niwinska A, Pamula-Pilat J, Tecza K, Pekala W, Rembowska J,
Nowicka K, Mosor M, Januszkiewicz-Lewandowska D, Rachtan J, Grzybowska E,
Nowak J, Steffen J, Limon J: Prevalence of the most frequent BRCA1
mutations in Polish population. J Appl Genet 2011, 52:325–330.
18. Gorski B, Byrski T, Huzarski T, Jakubowska A, Menkiszak J, Gronwald J,
Pluzanska A, Bebenek M, Fischer-Maliszewska L, Grzybowska E, Narod SA,
Lubinski J: Founder mutations in the BRCA1 gene in Polish families with
breast-ovarian cancer. Am J Hum Genet 2000, 66:1963–1968.
19. Grzybowska E, Sieminska M, Zientek H, Kalinowska E, Michalska J, Utracka-
Hutka B, Rogozinska-Szczepka J, Kazmierczak-Maciejewska M: Germline
mutations in the BRCA1 gene predisposing to breast and ovarian
cancers in Upper Silesia population. Acta Biochim Pol 2002, 49:351–356.
20. Perkowska M, BroZek I, Wysocka B, Haraldsson K, Sandberg T, Johansson U,
Sellberg G, Borg A, Limon J: BRCA1 and BRCA2 mutation analysis in
breast-ovarian cancer families from northeastern Poland. Hum Mutat
2003, 21:553–554.
21. Skasko E, Paszko Z, Niwinska A, Kwiatkowska E, Kruczek A, Pienkowski T: The
presence of hereditary BRCA1 gene mutations in women with familial
breast or ovarian cancer and the frequency of occurrence of these
tumours in their relatives. Eur J Gynaecol Oncol 2004, 25:470–474.
22. Quinn GP, Vadaparampil ST, King LM, Miree CA, Friedman S: Conflict
between values and technology: Perceptions of preimplantation genetic
diagnosis among women at increased risk for hereditary breast and
ovarian cancer. Fam Cancer 2009, 8:441–449.
doi:10.1186/1897-4287-11-10
Cite this article as: Michalska et al.:Comparison of whole genome
amplification and nested-PCR methods for preimplantation genetic
diagnosis for BRCA1 gene mutation on unfertilized oocytes–a pilot
study. Hereditary Cancer in Clinical Practice 2013 11:10.
Submit your next manuscript to BioMed Central
and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at
www.biomedcentral.com/submit
Michalska et al. Hereditary Cancer in Clinical Practice 2013, 11:10 Page 9 of 9
http://www.hccpjournal.com/content/11/1/10
