Antioxidant and hepatoprotective effects of food seasoning curry leaves Murraya koenigii (L.) Spreng. (Rutaceae)

Abstract

Murraya koenigii (L.) Spreng. (Rutaceae), a common spice, has been traditionally used to reduce inflammation and hepatitis. The present study aimed to reveal the antioxidant and anti-inflammatory activity as well as the regulation of cytochrome P450 levels elicited by aqueous extracts of M. koenigii leaves in response to paracetamol-induced liver toxicity in BALB/c mice. Liver toxicity was induced by an overdose of paracetamol followed by treatment with a M. koenigii leaf aqueous extract. The levels of serum liver markers, liver antioxidants, inflammatory markers and liver cytochrome P450 2E1 were quantified after 14 days of treatment. Histopathological analysis of the liver was also carried out. In vitro antioxidant levels and phenolic acid characterization were also performed. The extracts (50 and 200 mg kg-1 body weight) effectively restored the serum liver profiles (alanine transaminase, aspartate transaminase and alkaline phosphatase), liver antioxidant levels (superoxide dismutase, glutathione and ferric reducing ability of plasma) and inflammatory markers (tumor necrosis factor alpha, inducible nitric oxide synthase, nuclear factor kappa-light-chain-enhancer of activated B cells and nitric oxide) to healthy levels in a dosage dependent manner. The level of liver cytochrome P450 2E1 was also lowered in the extract treated groups. Histopathological assessment showed that treatment with 200 mg kg-1 of the M. koenigii aqueous extract was able to reduce liver necrosis in mice fed paracetamol. Gallic acid concentration was the highest among all the phenolic acids detected in the extract. These results suggested that the M. koenigii aqueous extract, which possessed antioxidant and anti-inflammatory effects, can be used as a potential treatment for liver diseases caused by oxidative stress.

Full text

Antioxidant and hepatoprotective effects of the
food seasoning curry leaves Murraya koenigii (L.)
Spreng. (Rutaceae)
Wan Yong Ho,
a
Boon Kee Beh,
b
Kian Lam Lim,
c
Nurul Elyani Mohamad,
d
Hamidah Mohd Yusof,
e
Huynh Ky,
d
Sheau Wei Tan,
e
Anisah Jamaluddin,
f
Kamariah Long,
f
Chung Lu Lim,
g
Noorjahan Banu Alitheen
d
and Swee Keong Yeap
*
e
Murraya koenigii (L.) Spreng. (Rutaceae), a common spice, has been traditionally used to reduce
inflammation and hepatitis. The present study aimed to reveal the antioxidant and anti-inflammatory
activity as well as the regulation of cytochrome P450 levels elicited by aqueous extracts of M. koenigii
leaves in response to paracetamol-induced liver toxicity in BALB/c mice. Liver toxicity was induced by an
overdose of paracetamol followed by treatment with a M. koenigii leaf aqueous extract. The levels of
serum liver markers, liver antioxidants, inflammatory markers and liver cytochrome P450 2E1 were
quantified after 14 days of treatment. Histopathological analysis of the liver was also carried out. In vitro
antioxidant levels and phenolic acid characterization were also performed. The extracts (50 and 200 mg
kg
1
body weight) effectively restored the serum liver profiles (alanine transaminase, aspartate
transaminase and alkaline phosphatase), liver antioxidant levels (superoxide dismutase, glutathione and
ferric reducing ability of plasma) and inflammatory markers (tumor necrosis factor alpha, inducible nitric
oxide synthase, nuclear factor kappa-light-chain-enhancer of activated B cells and nitric oxide) to
healthy levels in a dosage dependent manner. The level of liver cytochrome P450 2E1 was also lowered
in the extract treated groups. Histopathological assessment showed that treatment with 200 mg kg
1
of
the M. koenigii aqueous extract was able to reduce liver necrosis in mice fed paracetamol. Gallic acid
concentration was the highest among all the phenolic acids detected in the extract. These results
suggested that the M. koenigii aqueous extract, which possessed antioxidant and anti-inflammatory
effects, can be used as a potential treatment for liver diseases caused by oxidative stress.
1. Introduction
Plants, including spices, have been employed widely as food
and dietary adjuncts. In addition, many are also used as
medication in traditional therapy. Murraya koenigii (L.) Spreng.,
more commonly known as curry leaf tree, is a tropical plant in
the Rutaceae family that can be found commonly in Asia
including India, Sri Lanka, and Southeast Asia such as Malay-
sia.
1
The leaves of M. koenigii are one of the most largely
consumed avoring ingredients in Indian cuisine. The spice is
also utilized in Ayurveda medicine to treat inammation, cuts,
vomiting and dysentery. Nevertheless, many studies have been
carried out to support these traditional applications and the
collective ndings showed that M. koenigii possessed anti-
inammatory, antioxidative and anti-diabetic effects in vitro
and in vivo.
2
Its leaves were found to be rich in polyphenols that
contributed to its strong antioxidant activity.
3
The liver is the major organ for lipid metabolism, protein
synthesis and detoxication.
4
However, prolonged exposure of
the liver to xenobiotics and drugs including carbon tetrachlo-
ride (CCl4) and acetaminophen (APAP), commonly known as
paracetamol, was found to induce high levels of reactive oxygen
species (ROS) and inammation, which subsequently damaged
the liver.
5
APAP is one of the commonly used over-the-counter
(OTC) analgesic and antipyretic drugs. However, over-
production of N-acetyl-p-benzoquinone imine (NAPQI), a by-
product from the metabolization of APAP, can reduce the level
of glutathione (GSH) and increase the level of cytochrome P450
a
Department of Biomedical Sciences, The University of Nottingham Malaysia Campus,
Jalan Broga, 43500 Semenyih, Selangor, Malaysia
b
Department of Bioprocess Technology, Faculty of Biotechnology and Biomolecular
Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
c
Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT
21144, Jalan Sungai Long, Bandar Sungai Long, 43000 Cheras, Selangor, Malaysia
d
Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400
Serdang, Selangor, Malaysia
e
Institute of Bioscience, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia.
E-mail: skyeap2005@gmail.com; Fax: +60-3-89472153; Tel: +60-3-89472153
f
Department of Bioprocess Biotechnology, Malaysian Agriculture Research
Development Institute, 43400 Serdang, Selangor, Malaysia
g
Forestry and Environment Division, Forest Research Institute Malaysia, 52109
Kepong, Selangor, Malaysia
Cite this: RSC Adv.,2015,5, 100589
Received 17th September 2015
Accepted 13th November 2015
DOI: 10.1039/c5ra19154h
www.rsc.org/advances
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589–100597 | 100589
RSC Advances
PAPER
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
View Journal
| View Issue

which results in a signicant increase of ROS in the liver. Thus,
mice given an overdose of APAP have been widely used in an in
vivo model for hepatoprotective studies of natural products.
6
Enhancement of antioxidant levels especially the GSH level was
found to potentially help the liver recover from damage induced
by an overdose of APAP in rats.
7
Many food and spices, such as
pomegranate
8
and nutmeg,
9
were reported as potential antiox-
idant and hepatoprotective agents. Antioxidants in food have
been proposed as ingredients that strengthen the body’s anti-
oxidative status and subsequently help to alleviate degenerative
diseases linked to oxidative stress.
10
In relation to this, M. koe-
nigii was reported to possess antioxidant and hepatoprotective
effects in vitro and in vivo.
1,5
These effects were also correlated to
the high concentration of polyphenols in the leaf extract of M.
koenigii.
3,5
However, the major soluble phenolic acid content
and the role of the M. koenigii leaf extract in alleviating
inammation and antioxidant levels in APAP-induced liver
damage remains elusive. Our study therefore aimed to evaluate
the effects of the M. koenigii leaf extract on antioxidant,
inammatory and cytochrome P450 levels in mice treated with
an overdose of APAP. In addition, the total phenolic content,
1,1-diphenyl-2-picrylhydrazine (DPPH) scavenging activity,
ferric reduction ability of plasma (FRAP) activity and the soluble
phenolic acid content of the extract were also determined in this
study.
2. Materials and methods
2.1. Plant material
M. koenigii leaves were obtained from a curry leaf plantation in
Selangor, Malaysia in the months of April to June 2010. The
plant was identied and deposited with the voucher number
FRI 65673 by Science Officer Lim Chung Lu from the Forestry
Division, Forest Research Institute Malaysia (FRIM) (Kepong,
Malaysia). The leaves were air-dried, nely powdered using
a grinder (HFM2413, Taiwan), heated with deionized water (1 g
in 80 mL of water at 60

C for 2 hours) and ltered through
Whatman lter paper no. 1 (Millipore, Malaysia) and spray
dried at an inlet temperature of 150

C and outlet temperature
of 100

C (Buchi B-290, Switzerland). The native extract yield
was 30% w/w with a moisture content <5%. The spray-dried M.
koenigii aqueous extract was stored at 4

C for the following in
vivo and in vitro analyses.
2.2. In vivo hepatoprotective evaluation
APAP-induced hepatotoxicity in a mouse model was used to
evaluate the hepatoprotective effect of the spray-dried M. koe-
nigii aqueous extract. BALB/c mice (aged 5 weeks old, with an
average body weight of 20 g) were purchased from the Animal
House of Institute of Bioscience, Universiti Putra Malaysia. The
procedures for this study were carried out according to the
guidelines approved by the Animal Care and Use Committee,
Faculty of Veterinary Medicine, Universiti Putra Malaysia (ref:
UPM/FPV/PS/3.2.1.551/AUP-R168). Mice were acclimatized in
plastic cages with 70% humidity and a temperature of 22  3

C
for 7 days prior to the experiment and divided into 7 groups.
Group 1: mice were induced with 250 mg kg
1
APAP for 7
days followed by distilled water for another 14 days (untreated).
Group 2: mice were given distilled water for 7 days followed
by 50 mg kg
1
of the M. koenigii aqueous extract treatment for
another 14 days;
Group 3: mice were given distilled water for 7 days followed
by 200 mg kg
1
of the M. koenigii aqueous extract treatment for
another 14 days;
Group 4: mice were given distilled water only throughout the
duration of the study (normal control);
Group 5: mice were induced with 250 mg kg
1
APAP for 7
days followed by a 50 mg kg
1
silybin treatment for another 14
days (positive control);
Group 6: mice were induced with 250 mg kg
1
APAP for 7
days followed by 50 mg kg
1
of the M. koenigii aqueous extract
treatment for another 14 days;
Group 7: mice were induced with 250 mg kg
1
APAP for 7
days followed by 200 mg kg
1
of the M. koenigii aqueous extract
treatment for another 14 days;
Aer 14 days of treatment, the mice were sacriced, the
serum was collected and the liver was harvested prior to per-
forming the following assays.
2.2.1. Serum liver biomarkers and tumor necrosis factor
alpha (TNF- a) quantication. Blood was centrifuged and the
separated serum was used for several liver marker enzyme
assays: alanine aminotransferase (ALT), alkaline phosphatase
(ALP), and aspartate aminotransferase (AST). Assays were per-
formed according to the manufacturer’s protocols (Roche
Diagnostics GmbH, USA). TNF-a was quantied using a mouse
TNF-a ELISA MAX (Biolegend, USA) according to the manufac-
turer’s instructions.
2.2.2. Liver homogenate preparation and antioxidant
quantication. Liver was weighted and meshed using a 70 mm
strainer (SPL, Korea) in cold phosphate buffer saline (PBS). The
supernatant was separated from the pellet aer centrifugation
(8000 rpm, 15 minutes) and kept at 20

C. Nitric oxide (NO),
reduced glutathione and reactive oxygen species (ROS) levels
were determined using the Griess assay kit (Invitrogen, USA),
glutathione assay kit (Sigma, USA) and OxiSelect ROS assay kit
(Cell Biolabs, USA), respectively. In addition, superoxide dis-
mutase (SOD), malondialdehyde (MDA) and ferric reduction
ability of plasma (FRAP) assays were performed according to the
literature.
11
2.2.3. Histology. An assay was performed according to
Mohd Yusof et. al.
11
Briey, liver tissues were xed in 10%
neutral buffer formalin before paraffin embedding and stained
with hematoxylin and eosin (H&E). The morphology of the liver
samples were then observed using a Nikon Eclipse 90i micro-
scope (New York, USA).
2.2.4. Quantitative real time reverse transcriptase PCR
assay (qRT-PCR) of liver inducible nitric oxide synthase (iNOS)
and nuclear factor kappa-light-chain-enhancer of activated B
cell (NF-kB) gene expression. RNA was extracted from the liver
of all groups using an RNeasy mini plus kit (Qiagen, Germany)
and the extracted RNA was converted to cDNA using an iScript
cDNA synthesis kit (Bio-Rad, USA). Expression of iNOS (iNOS
forward primer: GCACCGAGATTGGAGTTC; iNOS reverse
100590 | RSC Adv.,2015,5, 100589–100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

primer: GAGCACAGCCACATTGAT) and NF-kB (NF-kB forward
primer: CATTCTGACCTTGCCTATCT; NF-kB reverse primer:
CTGCTGTTCTGTCCATTCT) were evaluated using quantitative
real time PCR (qRT-PCR) using a SYBR select master mix (Life
Tech, USA) and an iQ5-Real Time PCR machine (Bio-Rad, USA).
b-Actin (b-actin forward primer: TTCCAGCCTTCCTTCTTG; b-
actin reverse primer: GGAGCCAGAGCAGTAATC) was used as the
housekeeping control. Primer efficiency was determined by the
standard curve of serially diluted cDNA samples isolated from
the untreated control group. The PCR conditions were: 1 cycle of
50

C/2 minutes for UDG activation, 1 cycle of 95

C/2 minutes
for DNA polymerase activation, 40 cycles of 95

C/2 seconds for
denaturation, and 52

C for 30 seconds for annealing and
extension. All samples were assayed in triplicate and the no-
template controls were prepared for the specic assay. The
relative expression of both genes in relation to housekeeping
was calculated by the DDCq method.
12
The fold change between
the treated and untreated control was presented in this study.
2.2.5. Western blot analysis of liver cytochrome P450. The
liver from all groups was homogenized and the protein was
quantied using the Bradford assay. 100 mg of the extracted
protein were loaded onto a gel, subjected to SDS/PAGE (5%
stacking gel and 10% running gel), and then electroblotted onto
nitrocellulose membranes (Hybond-ECL, Amersham) using
a semidry electroblotter (Transblot SD Semi-Dry Transfer Cell,
BioRad). The membranes were blocked in a Tris-buffered saline
(TBS)-Tween buffer, pH 7.5 (20 mM Tris/500 mM NaCl/0.05%
Tween-20) containing 5% skimmed milk powder for 1 hour
before exposure to an anti-beta actin antibody and anti-
cytochrome P450 2E1 (Abcam, USA), at a dilution of 1/5000 in
the TBS-Tween buffer, pH 7 for 1 hour. Membranes were then
washed and incubated with Goat anti-Rabbit IgG H&L conju-
gated to alkaline phosphatase, diluted 1/5000 in the same
buffer, for 1 hour. Aer a series of washes in the TBS-Tween
buffer, protein bands were visualized by chemiluminescence
with a CDP-STAR® reagent (NEB, UK) and visualized under
a BioSpectrum system (UVP, US). The size of the protein bands
were determined using electrophoresis colour markers. The
protein level was normalized against b-actin to control for
variance in the sample loading and transfer.
2.3. In vitro antioxidant assays
2.3.1. Total phenolic quantication. The total phenolic
content was measured using the Folin–Ciocalteu method
according to Ho et. al.
13
with slight modication. Briey, 1 mL of
the sample, blank and gallic acid standard was placed in a test
tube. Then, 5 mL of the Folin–Ciocalteu reagent was added and
the mixture was vortexed and allowed to react for 5 minutes
before adding 4 mL of 7.5% sodium carbonate. The mixture was
then le at room temperature for 2 hours before being
measured at 765 nm using a spectrophotometer (Beckman
Coulter, USA). The results were expressed as gallic acid equiv-
alents (GAE), using gallic acid as a standard.
2.3.2. 1,1-Diphenyl-2-picrylhydrazine (DPPH) radical scav-
enging test. The radical scavenging activity was measured using
a modied DPPH method as described previously.
14
A serial
dilution was done for the sample and the standard. Trolox was
used as a standard in this assay. Briey, 50 mL of the sample was
added to 250 mL of DPPH (0.04 mg mL
1
) in a 96 well-plate. The
mixture was allowed to react for 30 minutes in the dark. The
absorbance was measured using an ELISA plate reader (BioTek
Instrument, USA) at 515 nm.
2.3.3. Ferric reducing antioxidant power (FRAP) test. The
FRAP assay was performed as previously described with slight
modication.
14
The FRAP reagent was prepared by mixing 300
mM acetate buffer, 10 mM TPTZ (in 40 mM HCl) and 20 mM of
FeCl
3
$6H
2
O in a 10 : 1 : 1 ratio. The reagent was prewarmed at
37

C before use. Briey, 50 mL of the sample was loaded into
a 96-well plate before adding 250 mL of the prewarmed FRAP
reagent. The plate was incubated for 10 minutes in the dark at
room temperature before an absorbance reading at 593 nm was
taken. Results were calculated according to the calibration
curve, using FeSO
4
$7H
2
O (100–1000 mM) as a standard.
2.3.4. Quantication of soluble phenolic acids. Soluble
phenolic acids in the M. koenigii aqueous extract were quanti-
ed using reverse-phase high performance liquid chromatog-
raphy.
15
Concentrations of gallic acid, protocatechuic acid, 4-
hydroxybenzoic acid, vanillic acid and syringic acid were
determined via calibration with standards (external standard
quantitation). The spray-dried aqueous extract of M. koenigii
was solubilised in 2.5% methanol and ltered through a 0.2 mm
membrane before injecting into a Chromolith Performance RP-
18e (100 mm  4.6 mm i.d.) column. Analysis was performed
using a Waters Alliance 2695 Separation Module (Waters, Mil-
ford, MA) at 30

C. The isocratic ow rate was set at 0.7 mL
min
1
with 0.1% formic acid and methanol as the mobile
phase.
2.4. Statistical analysis
All data were statistically analysed by one-way analysis of vari-
ance (ANOVA) using SPSS 15 soware. Duncan’s multiple range
tests were used for post-hoc analysis and p < 0.05 compared to
the untreated control was regarded as signicant.
3. Results
3.1. Effects of the M. koenigii aqueous extract on body
weight, serum liver biochemical proles, and TNF-a levels in
APAP treated mice
Neither the sole treatment of APAP and M. koenigii on non-
induced mice nor their post-treatment on APAP-induced mice
resulted in signicant changes in the body weight of the mice
(Table 1). Blood glucose levels of the APAP-treated mice showed
about a 1.5 fold increase as compared to normal control levels.
Both 50 and 200 mg kg
1
of M. koenigii treated non-induced or
APAP-induced mice were able to decrease serum glucose lower
than that of the normal group mice. These mice also showed
signicantly higher serum levels of ALT, ALP, AST and TNF-a in
comparison to the normal control. M. koenigii and silybin
signicantly (p < 0.05) reduced the elevated levels of AST, ALT,
ALP and TNF-a in the APAP-induced mice. Reduction of ALP
and TNF-a by a higher concentration of M. koenigii (200 mg kg
1
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589–100597 | 100591
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

bw) was comparable to the effect of the positive control.
Restoration to near normal levels was only observed for serum
ALT in silybin treated mice.
3.2. Effects of the M. koenigii aqueous extract on liver
antioxidant, oxidative stress and nitric oxide levels in APAP
treated mice
The antioxidant capacity of the extract was evaluated via a few
parameters, namely concentration of the liver antioxidant
peptide GSH, antioxidant enzyme SOD, reduction of oxidative
stress (MDA and ROS) and nitric oxide (NO) levels. In addition,
the total antioxidant activity of the extract was also evaluated
based on its ability to reduce the Fe
III
–TPTZ complex to Fe
II
–
TPTZ as indicated by the FRAP assay (Table 2). When compared
to normal control, mice treated with 50 mg kg
1
of M. koenigii
exhibited a slight increase in the total antioxidant activity with
no signicant difference in other parameters. On the other
hand, a higher concentration (200 mg kg
1
) of the extract not
only enhanced the total antioxidant activity but also signi-
cantly increased GSH and SOD levels. Signicant reduction of
the NO level was observed in the 200 mg kg
1
group while there
were insignicant changes in oxidative stress levels (MDA and
ROS) in both M. koenigii-treated groups.
In contrast, APAP exposure signicantly elevated (p < 0.05)
oxidative stress (MDA, ROS, and NO) and impaired (p < 0.05)
antioxidant activities (SOD, GSH, FRAP) in the mice. Aer
treatment with M. koenigii, the total antioxidant activity and
GSH and SOD levels were enhanced in the livers of APAP-
induced mice. This effect was also associated with the reduc-
tion of oxidative stress (ROS), lipid peroxidation (MDA) and NO
levels. Notably, 200 mg kg
1
of the extract resulted in a greater
inhibition of oxidative stress and inammation than the silybin
group and was the only group that showed restoration of total
antioxidant, SOD, GSH, MDA and NO levels to near normal.
3.3. Effects of the M. koenigii aqueous extract on liver
histopathology in APAP treated mice
Histological sections (H&E staining) of normal control mice
liver showed an intact centrilobular vein, healthy hepatocytes
and a thin sinusoidal space (Fig. 1A). In contrast, mice exposed
to APAP showed a non-uniform morphology of the hepatocytes,
an enlargement of the sinusoidal space and necrosis (Fig. 1B).
Aer treatment with 200 mg kg
1
of the M. koenigii aqueous
extract (Fig. 1E), the liver tissue exhibited signs of recovery
whereby intact hepatocytes were observed, with an integral
centrilobular vein and marginal sinusoidal space similar to the
normal control tissue (Fig. 1A) and silybin (Fig. 1C) treated
mice. In addition, the group treated with 50 mg kg
1
of aqueous
M. koenigii also showed a marginal recovery although some
necrosis and a mild enlargement of the sinusoidal space could
still be observed in the liver histological specimen (Fig. 1D).
Table 1 Effect of M. koenigii, silybin and APAP on the serum biochemical profiles of experimental mice
a
Body weight (g) Glucose (mmol L
1
) ALT (U/L) ALP (U/L) AST (U/L) TNF-a (pg mL
1
protein)
Normal control 22.41  0.42
a
4.73  1.14
i
42.32  1.05
y
64.56  1.12
n
143.76  2.82
b
32.51  28.13
f
M. koenigii (50 mg kg
1
) 22.03  0.52
a
4.02  1.56
i
41.58  2.15
y
64.13  1.52
n
141.46  3.41
b
35.55  21.99
f
M. koenigii (200 mg kg
1
) 22.18  0.86
a
3.86  0.89
i,ii
41.32  1.77
y
61.39  1.19
n
139.25  4.56
b
30.18  15.77
f
APAP 21.93  0.57
a
7.30  1.75
iii
118.19  2.75
x
83.83  3.61
m
443.36  9.99
a
585.96  15.88
e
APAP + silybin (50 mg kg
1
) 21.99  0.67
a
4.63  1.11
i
46.23  2.92
y
70.33  1.49

205.00  4.20
g
220.14  14.45
g
APAP + M. koenigii (50 mg kg
1
) 21.18  1.66
a
4.18  1.24
i
107.78  2.46
z
75.42  2.31
p
253.86  5.61
d
364.31  23.42
h
APAP + M. koenigii (200 mg kg
1
) 22.53  1.58
a
4.00  1.40
i
67.79  4.13
zz
71.00  1.60

224.00  3.35
3
233.14  20.75
g
a
Different letters indicate a signicant difference compared with the APAP untreated group, p < 0.05.
Table 2 Effect of M. koenigii, silybin and APAP on the liver antioxidant and NO levels of experimental mice
a
Group
GSH (nM GSH
per mg
protein)
SOD (U/mg per
protein)
FRAP (mM Fe(II)
per mg protein)
MDA (nM
MDA per
mg protein)
ROS (DCF
uorescence
intensity per mg
of protein)
NO (mM per mg
protein)
Normal control 6.42  0.12
a
172.48  5.06
i
30.55  1.83

0.61  0.18
m
431.93  37.35
a
15.27  1.99
e
M. koenigii (50 mg kg
1
) 6.88  0.46
a
179.54  4.61
i
33.89  1.76
p,q
0.60  0.25
m
400.15  41.52
a
14.48  1.44
e
M. koenigii (200 mg kg
1
) 9.15  0.68
b
201.31  6.88
ii
39.14  1.93
r
0.55  0.18
m
389.76  29.64
a
11.85  1.96
f
APAP 1.88  0.03
c
40.89  1.92
iii
17.22  1.30
s
1.24  0.19
n
2876.71  247.01
b
33.16  1.05
g
APAP + silybin
(50 mg kg
1
)
4.33  0.06
d
85.43  5.54
iv
21.98  2.21
t
0.76  0.21
m
1935.88  166.29
g
22.24  1.38
h
APAP + M. koenigii
(50 mg kg
1
)
2.91  0.18
e
72.73  2.36
v
19.62  2.86
s,t
0.76  0.14
m
2315.14  211.12
d
30.78  1.31
g
APAP + M. koenigii
(200 mg kg
1
)
6.89  0.32
a
174.16  1.66
i
28.04  1.76

0.66  0.18
m
1148.35  182.06
3
13.37  2.13
e
a
Different letters indicate a signicant difference compared with the APAP untreated group, p < 0.05.
100592
| RSC Adv.,2015,5,100589–100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

3.4. Effects of the M. koenigii aqueous extract on liver iNOS,
NF-kB and cytochrome P450 levels in APAP treated mice
Quantitative real time reverse transcriptase PCR and Western
blotting were used to evaluate the expression levels of inam-
matory markers (iNOS and NF-kB) (Fig. 2) and cytochrome P450
(Fig. 3) in livers collected from the mice. Expression levels of
iNOS and NF-kB were down-regulated in all groups except in the
untreated mice (APAP-induced). The group treated with 200 mg
kg
1
of the M. koenigii aqueous extract also showed the highest
reduction of NF-kB levels among all the treated groups (Fig. 2).
On the other hand, both the groups treated with 50 and 200 mg
kg
1
of the M. koenigii aqueous extract also possessed similar
signicant (p < 0.05) reductions of cytochrome P450 expression
as the positive control silybin treated group when compared to
the untreated group by Western blot analysis (Fig. 3).
3.5. In vitro antioxidant capacity and soluble phenolic acid
proling of the M. koenigii aqueous extract
The in vitro antioxidant capacity and soluble phenolic acid
prole of the M. koenigii aqueous extract are summarized in
Table 3. The M. koenigii aqueous extract contained 304.10 mg
ascorbic acid equivalents per mg sample and 193.97 mg gallic
acid equivalents per mg sample as determined respectively by
FRAP and total phenolic content assays. 300 mgmL
1
of the M.
koenigii aqueous extract showed 26% inhibition to DPPH
scavenging activity. Among the quantied soluble phenolic
acids, gallic acid was most prevalent in the extract (674 mg
mL
1
), followed by vanillic acid, p-coumaric acid, syringic acid
and protocatechuic acid. The concentration of 4-hydroxy-
benzoic acid was the lowest (90 mgmL
1
) of them all.
4. Discussion
ALT is a cytosolic enzyme in hepatocytes, AST is a mitochondrial
enzyme in liver parenchymal cells while ALP is an enzyme in the
cells lining the biliary duct of the liver.
16
Leakage of these
enzymes in the blood could be promoted by the loss of hepa-
tocyte membrane integrity, mitochondria damage in the liver
tissue or large bile duct obstruction.
16
Thus, an increase in
enzyme levels can be conveniently used for measuring the
extent of hepatic injury.
13
Previous studies showed that hydro-
ethanaolic and methaolic extracts of M. koenigii leaves were
capable of reducing the levels of these 3 liver enzymes in rats
treated with CCl4.
5,17,18
A separate study on extracts of M. koe-
nigii dried bark, extracted using different solvents including
acetone, benzene, petroleum ether, chloroform, acetone and
methanol, showed the signicant ability of these extracts to
reduce elevated ALP levels in CCl4-induced rats.
19
Pre-treatment
with the aqueous leaf extract of M. koenigii has also been shown
to protect rats against liver damage induced by lead but its effect
on the liver enzymes was not evaluated in the study.
20
On the
other hand, Sathaye et. al.
21
reported that the ALP level was
reduced in ethanol-induced mice that were co-treated with an
aqueous leaf extract of M. koenigii. Cumulatively, these results
suggested that M. koenigii is a potent hepatoprotective agent
and it would be imperative to examine its e ffects on liver marker
enzymes to assess the degree of recovery or protection against
induced damage in liver cells.
APAP is the most widely used analgesic/antipyretic drug.
However, an overdose of APAP has always been associated with
acute hepatotoxicity. Thus, the drug is commonly used in
studies for xenobiotic-induced hepatotoxicity
22
and it is oen
Fig. 1 Representative histopathology of the liver of (A) normal healthy mice, (B) APAP treated only, (C) APAP + silybin treated mice, (D) APAP + 50
mg kg
1
M. koenigii, and (E) APAP + 200 mg kg
1
M. koenigii treated mice. (H&E staining, magnification 100.) CV: centrilobular vein; SS:
sinusoidal space; N: necrosis.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589–100597 | 100593
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

associated with increased liver enzyme levels (ALT, AST and
ALP), lipid peroxidation, cytochrome P450 2E1, and necrosis of
hepatocytes.
23,24
As observed in this study, mice which received
APAP exhibited signicantly higher levels of ALT, ALP and AST
compared to the normal control (Table 1), signifying liver
damage. These ndings are also supported by H&E histopath-
ological examination, which shows abnormalities including
necrosis and enlargement of the sinusoidal space in the mouse
livers (Fig. 1B). In contrast, both concentrations of the M. koe-
nigii extract signicantly reduced the serum levels of all 3 liver
enzymes as compared to the levels in APAP-treated mice,
demonstrating the protective properties against liver damage in
a dosage dependent manner. A higher concentration of the
extract exhibited greater reductions and more comparable
effects to silybin. However, both concentrations did not recover
the liver enzyme levels to near normal while silybin was able to
restore the ALT level only to near normal. Histopathological
examination of the liver tissues was also consistent with the
observation whereby higher concentrations of M. koenigii and
silybin resulted in more prominent signs of recovery than lower
concentrations of M. koenigii (Fig. 1).
With preliminary evidence of recovery from APAP-induced
damage, we were interested to know if the effect of M. koenigii
is associated with the anti-inammatory and anti-oxidant
pathways that could alleviate liver damage. Necrosis caused by
APAP would oen lead to recruitment of macrophages and the
release of pro-inammatory factors such as cytokines and che-
mokines.
25
This explains why liver inammation is commonly
observed in xenobiotic-induced hepatotoxicity. Among the
regulators of inammation, the NF-kB signalling pathway plays
the most important role in the regulation of liver disease
progression.
26
Activation of NF-kB during acute in ammation
caused by APAP-induced stress can eventually lead to brosis,
cirrhosis and even increase the risk of progression to hepato-
cellular carcinoma.
26
TNF-a, a proinammatory cytokine, was
found to be highly upregulated aer treatment with APAP (Table
1). Apart from inducing neutrophil and macrophage accumu-
lation and activation, high levels of TNF-a will also activate NF-
kB and the subsequent production of iNOS in the liver.
26,27
In
this study, the activation of proinammatory markers including
iNOS, NF-kB, (Fig. 2) and NO (Table 2) was observed aer
exposure to an overdose of APAP (Table 1). Aer being treated
with M. koenigii, the levels of TNF-a and NO in the liver reduced
in a dosage dependent manner. The mRNA expression of iNOS
and NF-kB was also down regulated in response to this. M.
koenigii has been shown to potently scavenge nitric oxide in vitro
in a previous study.
28
In this study, both silybin and M. koenigii
signicantly reduced NO levels in the APAP-treated mice, and
200 mg kg
1
of M. koenigii was able to restore the NO level to
near normal. Thus, along with the reduced mRNA expression of
iNOS and NF-kB, it is suggested that M. koenigii possesses an
anti-inammatory effect over APAP-induced liver inammation.
Besides TNF-a, the activation of the NF-kB proinammatory
signalling pathway could also be attributed to oxidative stress
and lipid peroxidation. Consistent with other ndings, APAP
induced hyperglycemia (Table 1),
29
oxidative stress (ROS),
Fig. 2 Quantitative real time reverse transcriptase PCR evaluation of the expression of liver iNOS and NFkB in normal healthy, M. koenigii
aqueous extract (50 and 200 mg kg
1
) treated healthy, APAP treated only, APAP + silybin treated and APAP + M. koenigii aqueous extract (50 and
200 mg kg
1
) treated mice. The statistical differences among all groups were assessed by one-way ANOVA followed by Duncan’s post-hoc.
Means labelled with different letters are significantly different, p < 0.05.
100594
| RSC Adv.,2015,5, 100589–100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

Fig. 3 Western blot analysis of the levels of liver P450 protein of (a) APAP treated only, APAP + silybin treated and APAP + M. koenigii aqueous
extract (50 and 200 mg kg
1
) treated mice and (b) normal and M. koenigii aqueous extract (50 and 200 mg kg
1
) treated healthy mice. The
statistical differences among all groups were assessed by one-way ANOVA followed by Duncan’s post-hoc. Means labelled with different letters
are significantly different, p < 0.05.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589–100597 | 100595
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

increased lipid peroxidation (MDA) while suppressing antioxi-
dant levels (SOD, GSH and FRAP) in the liver (Table 2).
27
APAP is
catalysed into its metabolite, N-acetyl-p-benzoquinone imine
(NAPQI), which can be detoxied at a nontoxic dose. When
overdosed however, NAPQI leads to the depletion of GSH,
exposing hepatocytes to the destructive effects of reactive
oxygen species (ROS) and oxidative stress, which initiate
necrosis.
27
Besides GSH depletion, NAPQI was also reported to
signicantly deplete glycogen thus inducing hyperglycemia in
mice.
29
Both concentrations of M. koenigii were able to maintain
the glucose level of non-induced and APAP-induced mice lower
than that of normal mice, which may be contributable to its
hypoglyemic action as previously reported by Khan et al., indi-
cating that M. koenigii exhibited signicant hypoglycemic action
via an increase of hepatic glycogen and glycogenesis.
30
ROS was
increased by more than 6 fold by APAP while both concentra-
tions of M. koenigii did not result in any signicant change in
the non APAP-treated mice. As indicated by both the non-
induced and APAP-induced mice, 50 mg kg
1
of the M. koeni-
gii extract possessed great hypoglycemic action to completely
reverse the serum glucose level lower than that of the normal
control, but the antioxidant effect of this treatment was not able
to completely reverse the liver damage caused by APAP treat-
ment. A signicant reduction of ROS was observed in the group
treated with 200 mg kg
1
of the M. koenigii extract as it exerted
a greater antioxidant effect than treatment with 50 mg kg
1
of
the extract or even silybin.
Strong antioxidants were shown to prevent APAP-induced
cytochrome P450 2E1 expression in liver cells
31
and could
subsequently protect or recover the liver from APAP-induced
hepatocellular damage. In the attempt to study the effect of
M. koenigii in mediating APAP catalysis, we found that both
concentrations of the extract down regulated the increased
expression of P450 2E1 by APAP induction. Various extracts of
the plant, including water, ethyl alcohol : water (1 : 1), meth-
anol, ethanol, hexane, chloroform, acetone, ethyl acetate,
benzene, petroleum ether, and methylene chloride had been
previously tested for their antioxidant activities.
3,32–36
Among
them, the methanol extract of M. koenigii leaves was shown to
possess greater antioxidant activity than the methanol extract of
a few green leafy vegetables such as Amaranthus sp., Centella
asiatica, and Trigonella foenum-graecum
32
while its ethanolic leaf
extract was reported to exhibit good antioxidant activity
comparable to that of ascorbic acid.
33
On the other hand, the
antioxidant activity of the M. koenigii aqueous leaf extracts was
claimed to confer signicant protection against cadmium-
induced oxidative stress in rat cardiac tissue.
34
A separate
study reported that 300 mgmL
1
of the extract scavenged 41%
of DPPH radical activity
3
while our study showed 26% DPPH
scavenging activity with a lower concentration (100 mgmL
1
)of
the same extract. In addition, our study also evaluated antioxi-
dant activity using the FRAP assay, which was reported to be
more reliable in measuring antioxidant activity and correlates
well with the total phenolic content.
14
As seen in Table 3, the
total antioxidant activity of the M. koenigii aqueous leaf extract
was 304 mM Fe(
II)/mg extract and the total phenolic content was
194 mg GAE/mg extract. Further analysis by HPLC identied the
presence of a few common phenolic acid derivatives in the
extract, with gallic acid (674 mgmL
1
extract) being the most
abundant compound. As shown previously, phenolic acids,
sesquiterpenes, rutinosides
32
and alkaloids
33
from M. koenigii
had been reported to exert moderate hepatoprotective effects in
vitro
28
and anti-inammatory effects in vivo.
37
Among them,
gallic acid had been reported to possess hepatoprotective effects
against APAP-induced liver damage due to its antioxidant
activity. The treatment was capable of restoring the depleted
SOD and GSH levels and controlled inammation induced by
APAP in mice.
37
The hepatoprotective effect of gallic acid was
proposed to be correlated to its inhibitory effect on cytochrome
P450 2E1 activity.
38
For instance, gallic acid isolated from
Orostachys japonicus was found to interfere with the increased
hepatic activities of two cytochrome P450-dependent mono-
oxygenases, namely aminopyrine N-demethylase (AMND) and
aniline hydroxylase in mouse models.
39
As this enzyme plays an
important role in catalysing APAP to NAPQI, we propose that M.
koenigii is capable of protecting the liver from damage by
inhibiting APAP catalysis to its toxic metabolite NAPQI, and this
could be attributed to the presence of gallic acid in the leaf
extract.
Table 3 Total phenolic content, soluble phenolic acids content, DPPH and FRAP of the M. koenigii aqueous extract
a
Murraya koenigii
aqueous extract
Total phenolic content (mg GAE per mg M. koenigii extract) 193.97  12.53
Phenolic acid derivatives (HPLC)
Gallic acid (mgmL
1
) 674.20  5.81
Protocatechuic acid (mgmL
1
) 133.21  3.84
4-Hydroxybenzoic Acid (mgmL
1
) 90.05  2.33
Vanillic acid (mgmL
1
) 250.64  7.28
Syringic acid (mgmL
1
) 219.06  5.88
p-Coumaric acid (mgmL
1
) 247.60  3.61
DPPH (percentage of inhibition at 300 mgmL
1
) 26.13  1.66
FRAP (mM Fe(II) per mg M. koenigii extract) 304.10  3.88
a
GAE: gallic acid equivalent.
100596
| RSC Adv.,2015,5, 100589–100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online

5. Conclusion
In the present study, a M. koenigii aqueous extract demonstrated
liver protective activities against the damage induced by APAP.
In vitro antioxidant tests and HPLC proling revealed the
presence of various soluble phenolic acids, especially gallic
acid, which may contribute to the hepatoprotective, anti-
oxidative and anti-inammatory effects of the M. koenigii
aqueous leaf extract. As such, further studies are essential for
elucidating the role of the individual phytochemicals in elicit-
ing the anti-inammatory and hepatoprotective effects of the M.
koenigii leaves. This study could also serve as a lead to identify
the standard target for regulating the M. koenigii aqueous
extract as a functional food supplement for liver protection.
Acknowledgements
This project was funded by Research University Grants (RUGS)
91194, Universiti Putra Malaysia. We would like to thank
Professor Tan Soon Guan for proof reading this manuscript.
References
1 S. Sathaye, Y. Bagul, S. Gupta, H. Kaur and R. Redkar, Exp.
Toxicol. Pathol., 2011, 63, 587–591.
2 Q. Ma, J. Tian, J. Yang, A. Wang, T. Ji, Y. Wang and Y. Su,
Fitoterapia, 2013, 87,1–6.
3 M. B. Ningappa, R. Dinesha and L. Srinivas, Food Chem.,
2008, 106, 720–728.
4 S. Fu, L. Yang, P. Li, O. Hofmann, L. Dicker, W. Hide, X. Lin,
S. M. Watkins, A. R. Ivanov and G. S. Hotamisligil, Nature,
2011, 473, 528–531.
5 S. N. Desai, D. K. Patel, R. V. Devkar, P. V. Patel and
A. V. Ramachandran, Food Chem. Toxicol., 2012, 50, 310–314.
6 S. Bhanwra, J. Singh and P. Khosla, Indian J. Physiol.
Pharmacol., 2000, 44,64–68.
7 R. Simeonova, V. Vitcheva, M. Kondeva-Burdina, I. Krasteva,
V. Manov and M. Mitcheva, BioMed Res. Int., 2013, 757126,
DOI: 10.1155/2013/757126.
8 I. S. Ashoush, O. I. El-Batawy and G. A. El-Shourbagy, Ann.
Agric. Sci., 2013, 58,27–32.
9 T. Morita, K. Jinno, H. Kawagishi, Y. Arimoto, H. Suganuma,
T. Inakuma and K. Sugiyama, J. Agric. Food Chem., 2003, 51,
1560–1565.
10 V. Mani, K. Ramasamy, A. Ahmad, S. N. Wahab, S. M. Jaafar,
T. L. Kek, M. Z. Salleh and A. B. A. Majeed, Phytother. Res.,
2013, 27,46–53.
11 H. Mohd Yusof, N. M. Ali, S. K. Yeap, W. Y. Ho, B. K. Beh,
S. P. Koh, K. Long, S. Abdul Aziz and N. B. Alitheen, J.
Evidence-Based Complementary Altern. Med., 2013, 274274,
DOI: 10.1155/2013/274274.
12 M. W. Pfaffl, Nucleic Acids Res., 2001, 29, e45.
13 W. Y. Ho, S. K. Yeap, C. L. Ho, R. Abdul Rahim and
N. B. Alitheen, J. Evidence-Based Complementary Altern.
Med., 2012, 417953, DOI: 10.1155/2012/417953.
14 K. Thaipong, U. Boonprakob, K. Crosby, L. Cisneros-Zevallos
and D. Hawkins Byrne, J. Food Compos. Anal., 2006,
19, 669–
675.
15 V. Nagavani and T. Raghava Rao, Adv. Biol. Res., 2010, 4, 159–
168.
16 S. Rao, J. W. Einstein and K. Das, Int. Lett. Nat. Sci., 2014, 3,
30–43.
17 R. Gupta and D. Singh, Pharmacologyonline, 2007, 1, 232–
242.
18 B. N. Parimi, R. Mopuri and B. Meriga, J. Coastal Life Med.,
2014, 2, 313–318.
19 M. Pande, S. Gupta and A. Pathak, J. Herb. Med. Toxicol.,
2009, 3,69–71.
20 D. Ghosh, S. B. Firdaus, E. Mitra, M. Dey, A. Chattopadhyay,
S. K. Pattari, S. Dutta, K. Jana and D. Bandyopadhyay, Int. J.
Pharm. Pharm. Sci., 2013, 5, 285–295.
21 S. Sathaye, P. D. Amin, V. B. Mehta and V. B. Zala, Int. J.
Pharma Bio Sci., 2012, 3, 430–438.
22 K. C. D. Anantha, R. C. Siva and R. A. Manohar, J. Ayurveda
Integr. Med., 2012, 3, 198–203.
23 J. Das, J. Ghosh, P. Manna and P. C. Sil, Free Radical Res.,
2010, 44, 340–355.
24 J. Hwang, Y.-H. Chang, J. H. Park, S. Y. Kim, H. Chung,
E. Shim and H. J. Hwang, Lipids Health Dis., 2011, 10, 184.
25 H. Jaeschke, C. D. Williams, A. Ramachandran and
M. L. Bajt, Liver Int., 2012, 32,8–20.
26 B. Sun and M. Karin, Oncogene, 2008, 27, 6228–6244.
27 W.-T. Chen, C.-L. Yang and M.-C. Yin, Biomedicine, 2014, 4,5.
28 M. S. Baliga, G. C. Jagetia, S. K. Rao and K. Babu, Nahrung,
2003, 47, 261–264.
29 J. A. Hinson, J. B. Mays and A. M. Cameron, Biochem.
Pharmacol., 1983, 32, 1979–1988.
30 B. A. Khan, A. Abraham and S. Leelamma, Indian J. Biochem.
Biophys., 1995, 32, 106–108.
31 S. C. Jeong, S. M. Kim, Y. T. Jeong and C. H. Song, Chin. Med.,
2013, 8,7.
32 S. Gupta and J. Prakash, Plant Foods Hum. Nutr., 2009, 64,
39–45.
33 I. W. Kusuma, H. Kuspradini, E. T. Arung, F. Aryani,
Y.-H. Min, J.-S. Kim and Y.-U. Kim, J. Acupunct. Meridian
Stud., 2011, 4,75–79.
34 E. Mitra, A. K. Ghosh, D. Ghosh, D. Mukherjee,
A. Chattopadhyay, S. Dutta, S. K. Pattari and
D. Bandyopadhyay, Food Chem. Toxicol., 2012, 50, 1340–
1353.
35 Y. Tachibana, H. Kikuzaki, N. H. Lajis and N. Nakatani, J.
Agric. Food Chem., 2001, 49, 5589–5594.
36 M. Zahin, F. Aqil, F. M. Husain and I. Ahmad, BioMed Res.
Int., 2013, 2013, 263509.
37 M. K. Rasool, E. P. Sabina, S. R. Ramya, P. Preety, S. Patel,
N. Mandal, P. P. Mishra and J. Samuel, J. Pharm.
Pharmacol., 2010, 62, 638–643.
38 K.-T. Ha, S.-J. Yoon, D.-Y. Choi, D.-W. Kim, J.-K. Kim and
C.-H. Kim, J. Ethnopharmacol., 2005, 96, 529–535.
39 J. C. Park, W. D. Han, J. R. Park, S. H. Choi and J. W. Choi, J.
Ethnopharmacol., 2005, 102, 313–318.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589–100597 | 100597
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online