ArticlePDF Available

Antioxidant and hepatoprotective effects of food seasoning curry leaves Murraya koenigii (L.) Spreng. (Rutaceae)

Authors:

Abstract and Figures

Murraya koenigii (L.) Spreng. (Rutaceae), a common spice, has been traditionally used to reduce inflammation and hepatitis. The present study aimed to reveal the antioxidant and anti-inflammatory activity as well as the regulation of cytochrome P450 levels elicited by aqueous extracts of M. koenigii leaves in response to paracetamol-induced liver toxicity in BALB/c mice. Liver toxicity was induced by an overdose of paracetamol followed by treatment with a M. koenigii leaf aqueous extract. The levels of serum liver markers, liver antioxidants, inflammatory markers and liver cytochrome P450 2E1 were quantified after 14 days of treatment. Histopathological analysis of the liver was also carried out. In vitro antioxidant levels and phenolic acid characterization were also performed. The extracts (50 and 200 mg kg-1 body weight) effectively restored the serum liver profiles (alanine transaminase, aspartate transaminase and alkaline phosphatase), liver antioxidant levels (superoxide dismutase, glutathione and ferric reducing ability of plasma) and inflammatory markers (tumor necrosis factor alpha, inducible nitric oxide synthase, nuclear factor kappa-light-chain-enhancer of activated B cells and nitric oxide) to healthy levels in a dosage dependent manner. The level of liver cytochrome P450 2E1 was also lowered in the extract treated groups. Histopathological assessment showed that treatment with 200 mg kg-1 of the M. koenigii aqueous extract was able to reduce liver necrosis in mice fed paracetamol. Gallic acid concentration was the highest among all the phenolic acids detected in the extract. These results suggested that the M. koenigii aqueous extract, which possessed antioxidant and anti-inflammatory effects, can be used as a potential treatment for liver diseases caused by oxidative stress.
Content may be subject to copyright.
Antioxidant and hepatoprotective eects of the
food seasoning curry leaves Murraya koenigii (L.)
Spreng. (Rutaceae)
Wan Yong Ho,
a
Boon Kee Beh,
b
Kian Lam Lim,
c
Nurul Elyani Mohamad,
d
Hamidah Mohd Yusof,
e
Huynh Ky,
d
Sheau Wei Tan,
e
Anisah Jamaluddin,
f
Kamariah Long,
f
Chung Lu Lim,
g
Noorjahan Banu Alitheen
d
and Swee Keong Yeap
*
e
Murraya koenigii (L.) Spreng. (Rutaceae), a common spice, has been traditionally used to reduce
inammation and hepatitis. The present study aimed to reveal the antioxidant and anti-inammatory
activity as well as the regulation of cytochrome P450 levels elicited by aqueous extracts of M. koenigii
leaves in response to paracetamol-induced liver toxicity in BALB/c mice. Liver toxicity was induced by an
overdose of paracetamol followed by treatment with a M. koenigii leaf aqueous extract. The levels of
serum liver markers, liver antioxidants, inammatory markers and liver cytochrome P450 2E1 were
quantied after 14 days of treatment. Histopathological analysis of the liver was also carried out. In vitro
antioxidant levels and phenolic acid characterization were also performed. The extracts (50 and 200 mg
kg
1
body weight) eectively restored the serum liver proles (alanine transaminase, aspartate
transaminase and alkaline phosphatase), liver antioxidant levels (superoxide dismutase, glutathione and
ferric reducing ability of plasma) and inammatory markers (tumor necrosis factor alpha, inducible nitric
oxide synthase, nuclear factor kappa-light-chain-enhancer of activated B cells and nitric oxide) to
healthy levels in a dosage dependent manner. The level of liver cytochrome P450 2E1 was also lowered
in the extract treated groups. Histopathological assessment showed that treatment with 200 mg kg
1
of
the M. koenigii aqueous extract was able to reduce liver necrosis in mice fed paracetamol. Gallic acid
concentration was the highest among all the phenolic acids detected in the extract. These results
suggested that the M. koenigii aqueous extract, which possessed antioxidant and anti-inammatory
eects, can be used as a potential treatment for liver diseases caused by oxidative stress.
1. Introduction
Plants, including spices, have been employed widely as food
and dietary adjuncts. In addition, many are also used as
medication in traditional therapy. Murraya koenigii (L.) Spreng.,
more commonly known as curry leaf tree, is a tropical plant in
the Rutaceae family that can be found commonly in Asia
including India, Sri Lanka, and Southeast Asia such as Malay-
sia.
1
The leaves of M. koenigii are one of the most largely
consumed avoring ingredients in Indian cuisine. The spice is
also utilized in Ayurveda medicine to treat inammation, cuts,
vomiting and dysentery. Nevertheless, many studies have been
carried out to support these traditional applications and the
collective ndings showed that M. koenigii possessed anti-
inammatory, antioxidative and anti-diabetic eects in vitro
and in vivo.
2
Its leaves were found to be rich in polyphenols that
contributed to its strong antioxidant activity.
3
The liver is the major organ for lipid metabolism, protein
synthesis and detoxication.
4
However, prolonged exposure of
the liver to xenobiotics and drugs including carbon tetrachlo-
ride (CCl4) and acetaminophen (APAP), commonly known as
paracetamol, was found to induce high levels of reactive oxygen
species (ROS) and inammation, which subsequently damaged
the liver.
5
APAP is one of the commonly used over-the-counter
(OTC) analgesic and antipyretic drugs. However, over-
production of N-acetyl-p-benzoquinone imine (NAPQI), a by-
product from the metabolization of APAP, can reduce the level
of glutathione (GSH) and increase the level of cytochrome P450
a
Department of Biomedical Sciences, The University of Nottingham Malaysia Campus,
Jalan Broga, 43500 Semenyih, Selangor, Malaysia
b
Department of Bioprocess Technology, Faculty of Biotechnology and Biomolecular
Sciences, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia
c
Faculty of Medicine and Health Sciences, Universiti Tunku Abdul Rahman, Lot PT
21144, Jalan Sungai Long, Bandar Sungai Long, 43000 Cheras, Selangor, Malaysia
d
Faculty of Biotechnology and Biomolecular Sciences, Universiti Putra Malaysia, 43400
Serdang, Selangor, Malaysia
e
Institute of Bioscience, Universiti Putra Malaysia, 43400 Serdang, Selangor, Malaysia.
E-mail: skyeap2005@gmail.com; Fax: +60-3-89472153; Tel: +60-3-89472153
f
Department of Bioprocess Biotechnology, Malaysian Agriculture Research
Development Institute, 43400 Serdang, Selangor, Malaysia
g
Forestry and Environment Division, Forest Research Institute Malaysia, 52109
Kepong, Selangor, Malaysia
Cite this: RSC Adv.,2015,5, 100589
Received 17th September 2015
Accepted 13th November 2015
DOI: 10.1039/c5ra19154h
www.rsc.org/advances
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589100597 | 100589
RSC Advances
PAPER
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
View Journal
| View Issue
which results in a signicant increase of ROS in the liver. Thus,
mice given an overdose of APAP have been widely used in an in
vivo model for hepatoprotective studies of natural products.
6
Enhancement of antioxidant levels especially the GSH level was
found to potentially help the liver recover from damage induced
by an overdose of APAP in rats.
7
Many food and spices, such as
pomegranate
8
and nutmeg,
9
were reported as potential antiox-
idant and hepatoprotective agents. Antioxidants in food have
been proposed as ingredients that strengthen the bodys anti-
oxidative status and subsequently help to alleviate degenerative
diseases linked to oxidative stress.
10
In relation to this, M. koe-
nigii was reported to possess antioxidant and hepatoprotective
eects in vitro and in vivo.
1,5
These eects were also correlated to
the high concentration of polyphenols in the leaf extract of M.
koenigii.
3,5
However, the major soluble phenolic acid content
and the role of the M. koenigii leaf extract in alleviating
inammation and antioxidant levels in APAP-induced liver
damage remains elusive. Our study therefore aimed to evaluate
the eects of the M. koenigii leaf extract on antioxidant,
inammatory and cytochrome P450 levels in mice treated with
an overdose of APAP. In addition, the total phenolic content,
1,1-diphenyl-2-picrylhydrazine (DPPH) scavenging activity,
ferric reduction ability of plasma (FRAP) activity and the soluble
phenolic acid content of the extract were also determined in this
study.
2. Materials and methods
2.1. Plant material
M. koenigii leaves were obtained from a curry leaf plantation in
Selangor, Malaysia in the months of April to June 2010. The
plant was identied and deposited with the voucher number
FRI 65673 by Science Ocer Lim Chung Lu from the Forestry
Division, Forest Research Institute Malaysia (FRIM) (Kepong,
Malaysia). The leaves were air-dried, nely powdered using
a grinder (HFM2413, Taiwan), heated with deionized water (1 g
in 80 mL of water at 60
C for 2 hours) and ltered through
Whatman lter paper no. 1 (Millipore, Malaysia) and spray
dried at an inlet temperature of 150
C and outlet temperature
of 100
C (Buchi B-290, Switzerland). The native extract yield
was 30% w/w with a moisture content <5%. The spray-dried M.
koenigii aqueous extract was stored at 4
C for the following in
vivo and in vitro analyses.
2.2. In vivo hepatoprotective evaluation
APAP-induced hepatotoxicity in a mouse model was used to
evaluate the hepatoprotective eect of the spray-dried M. koe-
nigii aqueous extract. BALB/c mice (aged 5 weeks old, with an
average body weight of 20 g) were purchased from the Animal
House of Institute of Bioscience, Universiti Putra Malaysia. The
procedures for this study were carried out according to the
guidelines approved by the Animal Care and Use Committee,
Faculty of Veterinary Medicine, Universiti Putra Malaysia (ref:
UPM/FPV/PS/3.2.1.551/AUP-R168). Mice were acclimatized in
plastic cages with 70% humidity and a temperature of 22 3
C
for 7 days prior to the experiment and divided into 7 groups.
Group 1: mice were induced with 250 mg kg
1
APAP for 7
days followed by distilled water for another 14 days (untreated).
Group 2: mice were given distilled water for 7 days followed
by 50 mg kg
1
of the M. koenigii aqueous extract treatment for
another 14 days;
Group 3: mice were given distilled water for 7 days followed
by 200 mg kg
1
of the M. koenigii aqueous extract treatment for
another 14 days;
Group 4: mice were given distilled water only throughout the
duration of the study (normal control);
Group 5: mice were induced with 250 mg kg
1
APAP for 7
days followed by a 50 mg kg
1
silybin treatment for another 14
days (positive control);
Group 6: mice were induced with 250 mg kg
1
APAP for 7
days followed by 50 mg kg
1
of the M. koenigii aqueous extract
treatment for another 14 days;
Group 7: mice were induced with 250 mg kg
1
APAP for 7
days followed by 200 mg kg
1
of the M. koenigii aqueous extract
treatment for another 14 days;
Aer 14 days of treatment, the mice were sacriced, the
serum was collected and the liver was harvested prior to per-
forming the following assays.
2.2.1. Serum liver biomarkers and tumor necrosis factor
alpha (TNF- a) quantication. Blood was centrifuged and the
separated serum was used for several liver marker enzyme
assays: alanine aminotransferase (ALT), alkaline phosphatase
(ALP), and aspartate aminotransferase (AST). Assays were per-
formed according to the manufacturers protocols (Roche
Diagnostics GmbH, USA). TNF-a was quantied using a mouse
TNF-a ELISA MAX (Biolegend, USA) according to the manufac-
turers instructions.
2.2.2. Liver homogenate preparation and antioxidant
quantication. Liver was weighted and meshed using a 70 mm
strainer (SPL, Korea) in cold phosphate buer saline (PBS). The
supernatant was separated from the pellet aer centrifugation
(8000 rpm, 15 minutes) and kept at 20
C. Nitric oxide (NO),
reduced glutathione and reactive oxygen species (ROS) levels
were determined using the Griess assay kit (Invitrogen, USA),
glutathione assay kit (Sigma, USA) and OxiSelect ROS assay kit
(Cell Biolabs, USA), respectively. In addition, superoxide dis-
mutase (SOD), malondialdehyde (MDA) and ferric reduction
ability of plasma (FRAP) assays were performed according to the
literature.
11
2.2.3. Histology. An assay was performed according to
Mohd Yusof et. al.
11
Briey, liver tissues were xed in 10%
neutral buer formalin before paran embedding and stained
with hematoxylin and eosin (H&E). The morphology of the liver
samples were then observed using a Nikon Eclipse 90i micro-
scope (New York, USA).
2.2.4. Quantitative real time reverse transcriptase PCR
assay (qRT-PCR) of liver inducible nitric oxide synthase (iNOS)
and nuclear factor kappa-light-chain-enhancer of activated B
cell (NF-kB) gene expression. RNA was extracted from the liver
of all groups using an RNeasy mini plus kit (Qiagen, Germany)
and the extracted RNA was converted to cDNA using an iScript
cDNA synthesis kit (Bio-Rad, USA). Expression of iNOS (iNOS
forward primer: GCACCGAGATTGGAGTTC; iNOS reverse
100590 | RSC Adv.,2015,5, 100589100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
primer: GAGCACAGCCACATTGAT) and NF-kB (NF-kB forward
primer: CATTCTGACCTTGCCTATCT; NF-kB reverse primer:
CTGCTGTTCTGTCCATTCT) were evaluated using quantitative
real time PCR (qRT-PCR) using a SYBR select master mix (Life
Tech, USA) and an iQ5-Real Time PCR machine (Bio-Rad, USA).
b-Actin (b-actin forward primer: TTCCAGCCTTCCTTCTTG; b-
actin reverse primer: GGAGCCAGAGCAGTAATC) was used as the
housekeeping control. Primer eciency was determined by the
standard curve of serially diluted cDNA samples isolated from
the untreated control group. The PCR conditions were: 1 cycle of
50
C/2 minutes for UDG activation, 1 cycle of 95
C/2 minutes
for DNA polymerase activation, 40 cycles of 95
C/2 seconds for
denaturation, and 52
C for 30 seconds for annealing and
extension. All samples were assayed in triplicate and the no-
template controls were prepared for the specic assay. The
relative expression of both genes in relation to housekeeping
was calculated by the DDCq method.
12
The fold change between
the treated and untreated control was presented in this study.
2.2.5. Western blot analysis of liver cytochrome P450. The
liver from all groups was homogenized and the protein was
quantied using the Bradford assay. 100 mg of the extracted
protein were loaded onto a gel, subjected to SDS/PAGE (5%
stacking gel and 10% running gel), and then electroblotted onto
nitrocellulose membranes (Hybond-ECL, Amersham) using
a semidry electroblotter (Transblot SD Semi-Dry Transfer Cell,
BioRad). The membranes were blocked in a Tris-buered saline
(TBS)-Tween buer, pH 7.5 (20 mM Tris/500 mM NaCl/0.05%
Tween-20) containing 5% skimmed milk powder for 1 hour
before exposure to an anti-beta actin antibody and anti-
cytochrome P450 2E1 (Abcam, USA), at a dilution of 1/5000 in
the TBS-Tween buer, pH 7 for 1 hour. Membranes were then
washed and incubated with Goat anti-Rabbit IgG H&L conju-
gated to alkaline phosphatase, diluted 1/5000 in the same
buer, for 1 hour. Aer a series of washes in the TBS-Tween
buer, protein bands were visualized by chemiluminescence
with a CDP-STAR® reagent (NEB, UK) and visualized under
a BioSpectrum system (UVP, US). The size of the protein bands
were determined using electrophoresis colour markers. The
protein level was normalized against b-actin to control for
variance in the sample loading and transfer.
2.3. In vitro antioxidant assays
2.3.1. Total phenolic quantication. The total phenolic
content was measured using the FolinCiocalteu method
according to Ho et. al.
13
with slight modication. Briey, 1 mL of
the sample, blank and gallic acid standard was placed in a test
tube. Then, 5 mL of the FolinCiocalteu reagent was added and
the mixture was vortexed and allowed to react for 5 minutes
before adding 4 mL of 7.5% sodium carbonate. The mixture was
then le at room temperature for 2 hours before being
measured at 765 nm using a spectrophotometer (Beckman
Coulter, USA). The results were expressed as gallic acid equiv-
alents (GAE), using gallic acid as a standard.
2.3.2. 1,1-Diphenyl-2-picrylhydrazine (DPPH) radical scav-
enging test. The radical scavenging activity was measured using
a modied DPPH method as described previously.
14
A serial
dilution was done for the sample and the standard. Trolox was
used as a standard in this assay. Briey, 50 mL of the sample was
added to 250 mL of DPPH (0.04 mg mL
1
) in a 96 well-plate. The
mixture was allowed to react for 30 minutes in the dark. The
absorbance was measured using an ELISA plate reader (BioTek
Instrument, USA) at 515 nm.
2.3.3. Ferric reducing antioxidant power (FRAP) test. The
FRAP assay was performed as previously described with slight
modication.
14
The FRAP reagent was prepared by mixing 300
mM acetate buer, 10 mM TPTZ (in 40 mM HCl) and 20 mM of
FeCl
3
$6H
2
O in a 10 : 1 : 1 ratio. The reagent was prewarmed at
37
C before use. Briey, 50 mL of the sample was loaded into
a 96-well plate before adding 250 mL of the prewarmed FRAP
reagent. The plate was incubated for 10 minutes in the dark at
room temperature before an absorbance reading at 593 nm was
taken. Results were calculated according to the calibration
curve, using FeSO
4
$7H
2
O (1001000 mM) as a standard.
2.3.4. Quantication of soluble phenolic acids. Soluble
phenolic acids in the M. koenigii aqueous extract were quanti-
ed using reverse-phase high performance liquid chromatog-
raphy.
15
Concentrations of gallic acid, protocatechuic acid, 4-
hydroxybenzoic acid, vanillic acid and syringic acid were
determined via calibration with standards (external standard
quantitation). The spray-dried aqueous extract of M. koenigii
was solubilised in 2.5% methanol and ltered through a 0.2 mm
membrane before injecting into a Chromolith Performance RP-
18e (100 mm 4.6 mm i.d.) column. Analysis was performed
using a Waters Alliance 2695 Separation Module (Waters, Mil-
ford, MA) at 30
C. The isocratic ow rate was set at 0.7 mL
min
1
with 0.1% formic acid and methanol as the mobile
phase.
2.4. Statistical analysis
All data were statistically analysed by one-way analysis of vari-
ance (ANOVA) using SPSS 15 soware. Duncans multiple range
tests were used for post-hoc analysis and p < 0.05 compared to
the untreated control was regarded as signicant.
3. Results
3.1. Eects of the M. koenigii aqueous extract on body
weight, serum liver biochemical proles, and TNF-a levels in
APAP treated mice
Neither the sole treatment of APAP and M. koenigii on non-
induced mice nor their post-treatment on APAP-induced mice
resulted in signicant changes in the body weight of the mice
(Table 1). Blood glucose levels of the APAP-treated mice showed
about a 1.5 fold increase as compared to normal control levels.
Both 50 and 200 mg kg
1
of M. koenigii treated non-induced or
APAP-induced mice were able to decrease serum glucose lower
than that of the normal group mice. These mice also showed
signicantly higher serum levels of ALT, ALP, AST and TNF-a in
comparison to the normal control. M. koenigii and silybin
signicantly (p < 0.05) reduced the elevated levels of AST, ALT,
ALP and TNF-a in the APAP-induced mice. Reduction of ALP
and TNF-a by a higher concentration of M. koenigii (200 mg kg
1
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589100597 | 100591
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
bw) was comparable to the eect of the positive control.
Restoration to near normal levels was only observed for serum
ALT in silybin treated mice.
3.2. Eects of the M. koenigii aqueous extract on liver
antioxidant, oxidative stress and nitric oxide levels in APAP
treated mice
The antioxidant capacity of the extract was evaluated via a few
parameters, namely concentration of the liver antioxidant
peptide GSH, antioxidant enzyme SOD, reduction of oxidative
stress (MDA and ROS) and nitric oxide (NO) levels. In addition,
the total antioxidant activity of the extract was also evaluated
based on its ability to reduce the Fe
III
TPTZ complex to Fe
II
TPTZ as indicated by the FRAP assay (Table 2). When compared
to normal control, mice treated with 50 mg kg
1
of M. koenigii
exhibited a slight increase in the total antioxidant activity with
no signicant dierence in other parameters. On the other
hand, a higher concentration (200 mg kg
1
) of the extract not
only enhanced the total antioxidant activity but also signi-
cantly increased GSH and SOD levels. Signicant reduction of
the NO level was observed in the 200 mg kg
1
group while there
were insignicant changes in oxidative stress levels (MDA and
ROS) in both M. koenigii-treated groups.
In contrast, APAP exposure signicantly elevated (p < 0.05)
oxidative stress (MDA, ROS, and NO) and impaired (p < 0.05)
antioxidant activities (SOD, GSH, FRAP) in the mice. Aer
treatment with M. koenigii, the total antioxidant activity and
GSH and SOD levels were enhanced in the livers of APAP-
induced mice. This eect was also associated with the reduc-
tion of oxidative stress (ROS), lipid peroxidation (MDA) and NO
levels. Notably, 200 mg kg
1
of the extract resulted in a greater
inhibition of oxidative stress and inammation than the silybin
group and was the only group that showed restoration of total
antioxidant, SOD, GSH, MDA and NO levels to near normal.
3.3. Eects of the M. koenigii aqueous extract on liver
histopathology in APAP treated mice
Histological sections (H&E staining) of normal control mice
liver showed an intact centrilobular vein, healthy hepatocytes
and a thin sinusoidal space (Fig. 1A). In contrast, mice exposed
to APAP showed a non-uniform morphology of the hepatocytes,
an enlargement of the sinusoidal space and necrosis (Fig. 1B).
Aer treatment with 200 mg kg
1
of the M. koenigii aqueous
extract (Fig. 1E), the liver tissue exhibited signs of recovery
whereby intact hepatocytes were observed, with an integral
centrilobular vein and marginal sinusoidal space similar to the
normal control tissue (Fig. 1A) and silybin (Fig. 1C) treated
mice. In addition, the group treated with 50 mg kg
1
of aqueous
M. koenigii also showed a marginal recovery although some
necrosis and a mild enlargement of the sinusoidal space could
still be observed in the liver histological specimen (Fig. 1D).
Table 1 Eect of M. koenigii, silybin and APAP on the serum biochemical proles of experimental mice
a
Body weight (g) Glucose (mmol L
1
) ALT (U/L) ALP (U/L) AST (U/L) TNF-a (pg mL
1
protein)
Normal control 22.41 0.42
a
4.73 1.14
i
42.32 1.05
y
64.56 1.12
n
143.76 2.82
b
32.51 28.13
f
M. koenigii (50 mg kg
1
) 22.03 0.52
a
4.02 1.56
i
41.58 2.15
y
64.13 1.52
n
141.46 3.41
b
35.55 21.99
f
M. koenigii (200 mg kg
1
) 22.18 0.86
a
3.86 0.89
i,ii
41.32 1.77
y
61.39 1.19
n
139.25 4.56
b
30.18 15.77
f
APAP 21.93 0.57
a
7.30 1.75
iii
118.19 2.75
x
83.83 3.61
m
443.36 9.99
a
585.96 15.88
e
APAP + silybin (50 mg kg
1
) 21.99 0.67
a
4.63 1.11
i
46.23 2.92
y
70.33 1.49
205.00 4.20
g
220.14 14.45
g
APAP + M. koenigii (50 mg kg
1
) 21.18 1.66
a
4.18 1.24
i
107.78 2.46
z
75.42 2.31
p
253.86 5.61
d
364.31 23.42
h
APAP + M. koenigii (200 mg kg
1
) 22.53 1.58
a
4.00 1.40
i
67.79 4.13
zz
71.00 1.60
224.00 3.35
3
233.14 20.75
g
a
Dierent letters indicate a signicant dierence compared with the APAP untreated group, p < 0.05.
Table 2 Eect of M. koenigii, silybin and APAP on the liver antioxidant and NO levels of experimental mice
a
Group
GSH (nM GSH
per mg
protein)
SOD (U/mg per
protein)
FRAP (mM Fe(II)
per mg protein)
MDA (nM
MDA per
mg protein)
ROS (DCF
uorescence
intensity per mg
of protein)
NO (mM per mg
protein)
Normal control 6.42 0.12
a
172.48 5.06
i
30.55 1.83
0.61 0.18
m
431.93 37.35
a
15.27 1.99
e
M. koenigii (50 mg kg
1
) 6.88 0.46
a
179.54 4.61
i
33.89 1.76
p,q
0.60 0.25
m
400.15 41.52
a
14.48 1.44
e
M. koenigii (200 mg kg
1
) 9.15 0.68
b
201.31 6.88
ii
39.14 1.93
r
0.55 0.18
m
389.76 29.64
a
11.85 1.96
f
APAP 1.88 0.03
c
40.89 1.92
iii
17.22 1.30
s
1.24 0.19
n
2876.71 247.01
b
33.16 1.05
g
APAP + silybin
(50 mg kg
1
)
4.33 0.06
d
85.43 5.54
iv
21.98 2.21
t
0.76 0.21
m
1935.88 166.29
g
22.24 1.38
h
APAP + M. koenigii
(50 mg kg
1
)
2.91 0.18
e
72.73 2.36
v
19.62 2.86
s,t
0.76 0.14
m
2315.14 211.12
d
30.78 1.31
g
APAP + M. koenigii
(200 mg kg
1
)
6.89 0.32
a
174.16 1.66
i
28.04 1.76
0.66 0.18
m
1148.35 182.06
3
13.37 2.13
e
a
Dierent letters indicate a signicant dierence compared with the APAP untreated group, p < 0.05.
100592
| RSC Adv.,2015,5,100589100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
3.4. Eects of the M. koenigii aqueous extract on liver iNOS,
NF-kB and cytochrome P450 levels in APAP treated mice
Quantitative real time reverse transcriptase PCR and Western
blotting were used to evaluate the expression levels of inam-
matory markers (iNOS and NF-kB) (Fig. 2) and cytochrome P450
(Fig. 3) in livers collected from the mice. Expression levels of
iNOS and NF-kB were down-regulated in all groups except in the
untreated mice (APAP-induced). The group treated with 200 mg
kg
1
of the M. koenigii aqueous extract also showed the highest
reduction of NF-kB levels among all the treated groups (Fig. 2).
On the other hand, both the groups treated with 50 and 200 mg
kg
1
of the M. koenigii aqueous extract also possessed similar
signicant (p < 0.05) reductions of cytochrome P450 expression
as the positive control silybin treated group when compared to
the untreated group by Western blot analysis (Fig. 3).
3.5. In vitro antioxidant capacity and soluble phenolic acid
proling of the M. koenigii aqueous extract
The in vitro antioxidant capacity and soluble phenolic acid
prole of the M. koenigii aqueous extract are summarized in
Table 3. The M. koenigii aqueous extract contained 304.10 mg
ascorbic acid equivalents per mg sample and 193.97 mg gallic
acid equivalents per mg sample as determined respectively by
FRAP and total phenolic content assays. 300 mgmL
1
of the M.
koenigii aqueous extract showed 26% inhibition to DPPH
scavenging activity. Among the quantied soluble phenolic
acids, gallic acid was most prevalent in the extract (674 mg
mL
1
), followed by vanillic acid, p-coumaric acid, syringic acid
and protocatechuic acid. The concentration of 4-hydroxy-
benzoic acid was the lowest (90 mgmL
1
) of them all.
4. Discussion
ALT is a cytosolic enzyme in hepatocytes, AST is a mitochondrial
enzyme in liver parenchymal cells while ALP is an enzyme in the
cells lining the biliary duct of the liver.
16
Leakage of these
enzymes in the blood could be promoted by the loss of hepa-
tocyte membrane integrity, mitochondria damage in the liver
tissue or large bile duct obstruction.
16
Thus, an increase in
enzyme levels can be conveniently used for measuring the
extent of hepatic injury.
13
Previous studies showed that hydro-
ethanaolic and methaolic extracts of M. koenigii leaves were
capable of reducing the levels of these 3 liver enzymes in rats
treated with CCl4.
5,17,18
A separate study on extracts of M. koe-
nigii dried bark, extracted using dierent solvents including
acetone, benzene, petroleum ether, chloroform, acetone and
methanol, showed the signicant ability of these extracts to
reduce elevated ALP levels in CCl4-induced rats.
19
Pre-treatment
with the aqueous leaf extract of M. koenigii has also been shown
to protect rats against liver damage induced by lead but its eect
on the liver enzymes was not evaluated in the study.
20
On the
other hand, Sathaye et. al.
21
reported that the ALP level was
reduced in ethanol-induced mice that were co-treated with an
aqueous leaf extract of M. koenigii. Cumulatively, these results
suggested that M. koenigii is a potent hepatoprotective agent
and it would be imperative to examine its e ects on liver marker
enzymes to assess the degree of recovery or protection against
induced damage in liver cells.
APAP is the most widely used analgesic/antipyretic drug.
However, an overdose of APAP has always been associated with
acute hepatotoxicity. Thus, the drug is commonly used in
studies for xenobiotic-induced hepatotoxicity
22
and it is oen
Fig. 1 Representative histopathology of the liver of (A) normal healthy mice, (B) APAP treated only, (C) APAP + silybin treated mice, (D) APAP + 50
mg kg
1
M. koenigii, and (E) APAP + 200 mg kg
1
M. koenigii treated mice. (H&E staining, magnication 100.) CV: centrilobular vein; SS:
sinusoidal space; N: necrosis.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589100597 | 100593
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
associated with increased liver enzyme levels (ALT, AST and
ALP), lipid peroxidation, cytochrome P450 2E1, and necrosis of
hepatocytes.
23,24
As observed in this study, mice which received
APAP exhibited signicantly higher levels of ALT, ALP and AST
compared to the normal control (Table 1), signifying liver
damage. These ndings are also supported by H&E histopath-
ological examination, which shows abnormalities including
necrosis and enlargement of the sinusoidal space in the mouse
livers (Fig. 1B). In contrast, both concentrations of the M. koe-
nigii extract signicantly reduced the serum levels of all 3 liver
enzymes as compared to the levels in APAP-treated mice,
demonstrating the protective properties against liver damage in
a dosage dependent manner. A higher concentration of the
extract exhibited greater reductions and more comparable
eects to silybin. However, both concentrations did not recover
the liver enzyme levels to near normal while silybin was able to
restore the ALT level only to near normal. Histopathological
examination of the liver tissues was also consistent with the
observation whereby higher concentrations of M. koenigii and
silybin resulted in more prominent signs of recovery than lower
concentrations of M. koenigii (Fig. 1).
With preliminary evidence of recovery from APAP-induced
damage, we were interested to know if the eect of M. koenigii
is associated with the anti-inammatory and anti-oxidant
pathways that could alleviate liver damage. Necrosis caused by
APAP would oen lead to recruitment of macrophages and the
release of pro-inammatory factors such as cytokines and che-
mokines.
25
This explains why liver inammation is commonly
observed in xenobiotic-induced hepatotoxicity. Among the
regulators of inammation, the NF-kB signalling pathway plays
the most important role in the regulation of liver disease
progression.
26
Activation of NF-kB during acute inammation
caused by APAP-induced stress can eventually lead to brosis,
cirrhosis and even increase the risk of progression to hepato-
cellular carcinoma.
26
TNF-a, a proinammatory cytokine, was
found to be highly upregulated aer treatment with APAP (Table
1). Apart from inducing neutrophil and macrophage accumu-
lation and activation, high levels of TNF-a will also activate NF-
kB and the subsequent production of iNOS in the liver.
26,27
In
this study, the activation of proinammatory markers including
iNOS, NF-kB, (Fig. 2) and NO (Table 2) was observed aer
exposure to an overdose of APAP (Table 1). Aer being treated
with M. koenigii, the levels of TNF-a and NO in the liver reduced
in a dosage dependent manner. The mRNA expression of iNOS
and NF-kB was also down regulated in response to this. M.
koenigii has been shown to potently scavenge nitric oxide in vitro
in a previous study.
28
In this study, both silybin and M. koenigii
signicantly reduced NO levels in the APAP-treated mice, and
200 mg kg
1
of M. koenigii was able to restore the NO level to
near normal. Thus, along with the reduced mRNA expression of
iNOS and NF-kB, it is suggested that M. koenigii possesses an
anti-inammatory eect over APAP-induced liver inammation.
Besides TNF-a, the activation of the NF-kB proinammatory
signalling pathway could also be attributed to oxidative stress
and lipid peroxidation. Consistent with other ndings, APAP
induced hyperglycemia (Table 1),
29
oxidative stress (ROS),
Fig. 2 Quantitative real time reverse transcriptase PCR evaluation of the expression of liver iNOS and NFkB in normal healthy, M. koenigii
aqueous extract (50 and 200 mg kg
1
) treated healthy, APAP treated only, APAP + silybin treated and APAP + M. koenigii aqueous extract (50 and
200 mg kg
1
) treated mice. The statistical dierences among all groups were assessed by one-way ANOVA followed by Duncans post-hoc.
Means labelled with dierent letters are signicantly dierent, p < 0.05.
100594
| RSC Adv.,2015,5, 100589100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
Fig. 3 Western blot analysis of the levels of liver P450 protein of (a) APAP treated only, APAP + silybin treated and APAP + M. koenigii aqueous
extract (50 and 200 mg kg
1
) treated mice and (b) normal and M. koenigii aqueous extract (50 and 200 mg kg
1
) treated healthy mice. The
statistical dierences among all groups were assessed by one-way ANOVA followed by Duncans post-hoc. Means labelled with dierent letters
are signicantly dierent, p < 0.05.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589100597 | 100595
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
increased lipid peroxidation (MDA) while suppressing antioxi-
dant levels (SOD, GSH and FRAP) in the liver (Table 2).
27
APAP is
catalysed into its metabolite, N-acetyl-p-benzoquinone imine
(NAPQI), which can be detoxied at a nontoxic dose. When
overdosed however, NAPQI leads to the depletion of GSH,
exposing hepatocytes to the destructive eects of reactive
oxygen species (ROS) and oxidative stress, which initiate
necrosis.
27
Besides GSH depletion, NAPQI was also reported to
signicantly deplete glycogen thus inducing hyperglycemia in
mice.
29
Both concentrations of M. koenigii were able to maintain
the glucose level of non-induced and APAP-induced mice lower
than that of normal mice, which may be contributable to its
hypoglyemic action as previously reported by Khan et al., indi-
cating that M. koenigii exhibited signicant hypoglycemic action
via an increase of hepatic glycogen and glycogenesis.
30
ROS was
increased by more than 6 fold by APAP while both concentra-
tions of M. koenigii did not result in any signicant change in
the non APAP-treated mice. As indicated by both the non-
induced and APAP-induced mice, 50 mg kg
1
of the M. koeni-
gii extract possessed great hypoglycemic action to completely
reverse the serum glucose level lower than that of the normal
control, but the antioxidant eect of this treatment was not able
to completely reverse the liver damage caused by APAP treat-
ment. A signicant reduction of ROS was observed in the group
treated with 200 mg kg
1
of the M. koenigii extract as it exerted
a greater antioxidant eect than treatment with 50 mg kg
1
of
the extract or even silybin.
Strong antioxidants were shown to prevent APAP-induced
cytochrome P450 2E1 expression in liver cells
31
and could
subsequently protect or recover the liver from APAP-induced
hepatocellular damage. In the attempt to study the eect of
M. koenigii in mediating APAP catalysis, we found that both
concentrations of the extract down regulated the increased
expression of P450 2E1 by APAP induction. Various extracts of
the plant, including water, ethyl alcohol : water (1 : 1), meth-
anol, ethanol, hexane, chloroform, acetone, ethyl acetate,
benzene, petroleum ether, and methylene chloride had been
previously tested for their antioxidant activities.
3,3236
Among
them, the methanol extract of M. koenigii leaves was shown to
possess greater antioxidant activity than the methanol extract of
a few green leafy vegetables such as Amaranthus sp., Centella
asiatica, and Trigonella foenum-graecum
32
while its ethanolic leaf
extract was reported to exhibit good antioxidant activity
comparable to that of ascorbic acid.
33
On the other hand, the
antioxidant activity of the M. koenigii aqueous leaf extracts was
claimed to confer signicant protection against cadmium-
induced oxidative stress in rat cardiac tissue.
34
A separate
study reported that 300 mgmL
1
of the extract scavenged 41%
of DPPH radical activity
3
while our study showed 26% DPPH
scavenging activity with a lower concentration (100 mgmL
1
)of
the same extract. In addition, our study also evaluated antioxi-
dant activity using the FRAP assay, which was reported to be
more reliable in measuring antioxidant activity and correlates
well with the total phenolic content.
14
As seen in Table 3, the
total antioxidant activity of the M. koenigii aqueous leaf extract
was 304 mM Fe(
II)/mg extract and the total phenolic content was
194 mg GAE/mg extract. Further analysis by HPLC identied the
presence of a few common phenolic acid derivatives in the
extract, with gallic acid (674 mgmL
1
extract) being the most
abundant compound. As shown previously, phenolic acids,
sesquiterpenes, rutinosides
32
and alkaloids
33
from M. koenigii
had been reported to exert moderate hepatoprotective eects in
vitro
28
and anti-inammatory eects in vivo.
37
Among them,
gallic acid had been reported to possess hepatoprotective eects
against APAP-induced liver damage due to its antioxidant
activity. The treatment was capable of restoring the depleted
SOD and GSH levels and controlled inammation induced by
APAP in mice.
37
The hepatoprotective eect of gallic acid was
proposed to be correlated to its inhibitory eect on cytochrome
P450 2E1 activity.
38
For instance, gallic acid isolated from
Orostachys japonicus was found to interfere with the increased
hepatic activities of two cytochrome P450-dependent mono-
oxygenases, namely aminopyrine N-demethylase (AMND) and
aniline hydroxylase in mouse models.
39
As this enzyme plays an
important role in catalysing APAP to NAPQI, we propose that M.
koenigii is capable of protecting the liver from damage by
inhibiting APAP catalysis to its toxic metabolite NAPQI, and this
could be attributed to the presence of gallic acid in the leaf
extract.
Table 3 Total phenolic content, soluble phenolic acids content, DPPH and FRAP of the M. koenigii aqueous extract
a
Murraya koenigii
aqueous extract
Total phenolic content (mg GAE per mg M. koenigii extract) 193.97 12.53
Phenolic acid derivatives (HPLC)
Gallic acid (mgmL
1
) 674.20 5.81
Protocatechuic acid (mgmL
1
) 133.21 3.84
4-Hydroxybenzoic Acid (mgmL
1
) 90.05 2.33
Vanillic acid (mgmL
1
) 250.64 7.28
Syringic acid (mgmL
1
) 219.06 5.88
p-Coumaric acid (mgmL
1
) 247.60 3.61
DPPH (percentage of inhibition at 300 mgmL
1
) 26.13 1.66
FRAP (mM Fe(II) per mg M. koenigii extract) 304.10 3.88
a
GAE: gallic acid equivalent.
100596
| RSC Adv.,2015,5, 100589100597 This journal is © The Royal Society of Chemistry 2015
RSC Advances Paper
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
5. Conclusion
In the present study, a M. koenigii aqueous extract demonstrated
liver protective activities against the damage induced by APAP.
In vitro antioxidant tests and HPLC proling revealed the
presence of various soluble phenolic acids, especially gallic
acid, which may contribute to the hepatoprotective, anti-
oxidative and anti-inammatory eects of the M. koenigii
aqueous leaf extract. As such, further studies are essential for
elucidating the role of the individual phytochemicals in elicit-
ing the anti-inammatory and hepatoprotective eects of the M.
koenigii leaves. This study could also serve as a lead to identify
the standard target for regulating the M. koenigii aqueous
extract as a functional food supplement for liver protection.
Acknowledgements
This project was funded by Research University Grants (RUGS)
91194, Universiti Putra Malaysia. We would like to thank
Professor Tan Soon Guan for proof reading this manuscript.
References
1 S. Sathaye, Y. Bagul, S. Gupta, H. Kaur and R. Redkar, Exp.
Toxicol. Pathol., 2011, 63, 587591.
2 Q. Ma, J. Tian, J. Yang, A. Wang, T. Ji, Y. Wang and Y. Su,
Fitoterapia, 2013, 87,16.
3 M. B. Ningappa, R. Dinesha and L. Srinivas, Food Chem.,
2008, 106, 720728.
4 S. Fu, L. Yang, P. Li, O. Hofmann, L. Dicker, W. Hide, X. Lin,
S. M. Watkins, A. R. Ivanov and G. S. Hotamisligil, Nature,
2011, 473, 528531.
5 S. N. Desai, D. K. Patel, R. V. Devkar, P. V. Patel and
A. V. Ramachandran, Food Chem. Toxicol., 2012, 50, 310314.
6 S. Bhanwra, J. Singh and P. Khosla, Indian J. Physiol.
Pharmacol., 2000, 44,6468.
7 R. Simeonova, V. Vitcheva, M. Kondeva-Burdina, I. Krasteva,
V. Manov and M. Mitcheva, BioMed Res. Int., 2013, 757126,
DOI: 10.1155/2013/757126.
8 I. S. Ashoush, O. I. El-Batawy and G. A. El-Shourbagy, Ann.
Agric. Sci., 2013, 58,2732.
9 T. Morita, K. Jinno, H. Kawagishi, Y. Arimoto, H. Suganuma,
T. Inakuma and K. Sugiyama, J. Agric. Food Chem., 2003, 51,
15601565.
10 V. Mani, K. Ramasamy, A. Ahmad, S. N. Wahab, S. M. Jaafar,
T. L. Kek, M. Z. Salleh and A. B. A. Majeed, Phytother. Res.,
2013, 27,4653.
11 H. Mohd Yusof, N. M. Ali, S. K. Yeap, W. Y. Ho, B. K. Beh,
S. P. Koh, K. Long, S. Abdul Aziz and N. B. Alitheen, J.
Evidence-Based Complementary Altern. Med., 2013, 274274,
DOI: 10.1155/2013/274274.
12 M. W. Pfa, Nucleic Acids Res., 2001, 29, e45.
13 W. Y. Ho, S. K. Yeap, C. L. Ho, R. Abdul Rahim and
N. B. Alitheen, J. Evidence-Based Complementary Altern.
Med., 2012, 417953, DOI: 10.1155/2012/417953.
14 K. Thaipong, U. Boonprakob, K. Crosby, L. Cisneros-Zevallos
and D. Hawkins Byrne, J. Food Compos. Anal., 2006,
19, 669
675.
15 V. Nagavani and T. Raghava Rao, Adv. Biol. Res., 2010, 4, 159
168.
16 S. Rao, J. W. Einstein and K. Das, Int. Lett. Nat. Sci., 2014, 3,
3043.
17 R. Gupta and D. Singh, Pharmacologyonline, 2007, 1, 232
242.
18 B. N. Parimi, R. Mopuri and B. Meriga, J. Coastal Life Med.,
2014, 2, 313318.
19 M. Pande, S. Gupta and A. Pathak, J. Herb. Med. Toxicol.,
2009, 3,6971.
20 D. Ghosh, S. B. Firdaus, E. Mitra, M. Dey, A. Chattopadhyay,
S. K. Pattari, S. Dutta, K. Jana and D. Bandyopadhyay, Int. J.
Pharm. Pharm. Sci., 2013, 5, 285295.
21 S. Sathaye, P. D. Amin, V. B. Mehta and V. B. Zala, Int. J.
Pharma Bio Sci., 2012, 3, 430438.
22 K. C. D. Anantha, R. C. Siva and R. A. Manohar, J. Ayurveda
Integr. Med., 2012, 3, 198203.
23 J. Das, J. Ghosh, P. Manna and P. C. Sil, Free Radical Res.,
2010, 44, 340355.
24 J. Hwang, Y.-H. Chang, J. H. Park, S. Y. Kim, H. Chung,
E. Shim and H. J. Hwang, Lipids Health Dis., 2011, 10, 184.
25 H. Jaeschke, C. D. Williams, A. Ramachandran and
M. L. Bajt, Liver Int., 2012, 32,820.
26 B. Sun and M. Karin, Oncogene, 2008, 27, 62286244.
27 W.-T. Chen, C.-L. Yang and M.-C. Yin, Biomedicine, 2014, 4,5.
28 M. S. Baliga, G. C. Jagetia, S. K. Rao and K. Babu, Nahrung,
2003, 47, 261264.
29 J. A. Hinson, J. B. Mays and A. M. Cameron, Biochem.
Pharmacol., 1983, 32, 19791988.
30 B. A. Khan, A. Abraham and S. Leelamma, Indian J. Biochem.
Biophys., 1995, 32, 106108.
31 S. C. Jeong, S. M. Kim, Y. T. Jeong and C. H. Song, Chin. Med.,
2013, 8,7.
32 S. Gupta and J. Prakash, Plant Foods Hum. Nutr., 2009, 64,
3945.
33 I. W. Kusuma, H. Kuspradini, E. T. Arung, F. Aryani,
Y.-H. Min, J.-S. Kim and Y.-U. Kim, J. Acupunct. Meridian
Stud., 2011, 4,7579.
34 E. Mitra, A. K. Ghosh, D. Ghosh, D. Mukherjee,
A. Chattopadhyay, S. Dutta, S. K. Pattari and
D. Bandyopadhyay, Food Chem. Toxicol., 2012, 50, 1340
1353.
35 Y. Tachibana, H. Kikuzaki, N. H. Lajis and N. Nakatani, J.
Agric. Food Chem., 2001, 49, 55895594.
36 M. Zahin, F. Aqil, F. M. Husain and I. Ahmad, BioMed Res.
Int., 2013, 2013, 263509.
37 M. K. Rasool, E. P. Sabina, S. R. Ramya, P. Preety, S. Patel,
N. Mandal, P. P. Mishra and J. Samuel, J. Pharm.
Pharmacol., 2010, 62, 638643.
38 K.-T. Ha, S.-J. Yoon, D.-Y. Choi, D.-W. Kim, J.-K. Kim and
C.-H. Kim, J. Ethnopharmacol., 2005, 96, 529535.
39 J. C. Park, W. D. Han, J. R. Park, S. H. Choi and J. W. Choi, J.
Ethnopharmacol., 2005, 102, 313318.
This journal is © The Royal Society of Chemistry 2015 RSC Adv.,2015,5, 100589100597 | 100597
Paper RSC Advances
Published on 16 November 2015. Downloaded by RSC Internal on 04/12/2015 11:01:59.
View Article Online
... It has been reported that the leaves also contain cyclomahanimbin, tetrahydromahanmbine, Murrayastine and murrayalin. Variety of phytochemicals found in M. koenigii (curry leaves) have been reported its antidiabetic, stimulant, antidysentery, 2 antioxidant, 3,4 lipid-lowering, 5 anti-nociceptive, antiaging, anticancer, 6 hepatoprotective, 7,8 cardio protective, antifungal, antibacterial properties. 8 It could also be useful in treating various gastrointestinal disorders, to improve craving and metabolism. ...
... Variety of phytochemicals found in M. koenigii (curry leaves) have been reported its antidiabetic, stimulant, antidysentery, 2 antioxidant, 3,4 lipid-lowering, 5 anti-nociceptive, antiaging, anticancer, 6 hepatoprotective, 7,8 cardio protective, antifungal, antibacterial properties. 8 It could also be useful in treating various gastrointestinal disorders, to improve craving and metabolism. Despite of having potential antidiabetic activities, formulations with M. koenigii are inadequately absorbed through biological membranes potentially causing low bioavailability. ...
... M. koenigii is recognised by its bioactive ingredients, having significant potential for its use in pharmaceutical preparations. [1][2][3][4][5][6][7][8]43 Antisolvent precipitation technique was used for the preparation of phytosomes. [12][13][14][15] For optimisation of phytosomes, 3 2 factorial design was chosen. ...
Article
Full-text available
Background: Phytosome is a novel technique introduced by Indena that combines standardised herbal extract and phospholipid in preferably equal ratio to provide better absorption enhancing bioavailability. Purpose: The objective of proposed study is to prepare, optimise and characterize phytosomes of Murraya koenigii (Linn.) Spreng extract to improve its antidiabetic properties. Materials and Methods: Antisolvent precipitation technique was used to prepare phytosomes. Design expert software was used to evaluate the impact of soya lecithin and cholesterol concentration on various dependent variables such as particle size, span value and entrapment efficiency. Streptozotocin-nicotinamide induced diabetes model was used to evaluate in vivo antidiabetic activity in rats for extract as well as prepared phytosomes. Results: The phytosomes were successfully designed and optimised for particle size, entrapment efficiency, span value, and zeta potential of 236 nm, 75.1%, 0.395 and-16.85 mV respectively. Streptozotocin-nicotinamide induced diabetes model was used to study antidiabetic potential of plant extracts and its optimized phytosomal formulations in male Wistar rats. Optimized phytosomal formulation showed significant reduction in serum glucose concentration at lower dose, suggesting enhancement in its therapeutic efficacy. Conclusion: We were successful in formulation, optimization and characterization of phytosomes for Murraya koenigii extract. The tested phytosomes showed better antidiabetic and hypolipidemic activities as compared to crude extract in male Wistar rats.
... Total phenolic content assay Total phenolic contents in the CFS of selected cultures were determined by the Folin-Ciocalteu method as described by Ho et al. (2015). The results were expressed in milligrams equivalent to gallic acid. ...
... Total flavonoid content assay Total flavonoid content was determined by aluminum chloride colorimetric method as described by Ho et al. (2015). The results were expressed in milligrams equivalent to catechin. ...
Article
Full-text available
Consumer’s vigilance towards health-promoting foods beyond only taste and nutrition has increased the recognition for probiotic products. In the present study, various parameters have been studied to define the probiotic properties of cultures isolated from different fermented products. Around 118 samples were selectively screened for antimicrobial compound (AMC) producing isolates by overlay-plate assay using Micrococcus luteus ATCC9341. Among 134 zone producing isolates, 48 cultures showing Gram positive, catalase negative, non-spore forming and non-motile rods and cocci were selected. Subsequently, 18 strains were chosen based on non-hemolytic, absence of biogenic amine production, gelatinase and lecithinase negative trait for safer isolates. These were identified by biochemical assays and then subjected to RAPD-PCR. The selected cultures DB-1aa, DB-b2-15b, Cu2-PM7, Cu3-PM8 and IB-pM15 were identified by 16S rDNA sequencing as Enterococcus durans, Enterococcus faecium, Lactobacillus plantarum, two Lactobacillus fermentum respectively. Several in-vitro experiments were carried out including acid and bile tolerance, survival under simulated gastrointestinal condition, adhesion assay to evaluate the probiotic potential of the isolates. In addition, the isolates were studied for competent properties such as antibacterial, antioxidant activity, and enzyme production for their functional application. The results of the study prove the efficiency of selected isolates as potential probiotic cultures and hence can be recommended for application in any functional food formulations.
... Total phenolic contents of isolated Lactobacillus spp. from kefir samples were determined by the Folin-Ciocalteu assay and the results were expressed in milligrams of gallic acid [62]. Briefly, supernatant of the isolated Lactobacillus spp. ...
... Total flavonoid content of supernatant of isolated Lactobacillus spp. from kefir samples was determined by the aluminum chloride colorimetric method [62]. In brief, 0.15 mL supernatant of isolated Lactobacillus spp. ...
Article
Full-text available
Kefir is a homemade, natural fermented product comprised of a probiotic bacteria and yeast complex. Kefir consumption has been associated with many advantageous properties to general health, including as an antioxidative, anti-obesity, anti-inflammatory, anti-microbial, and anti-tumor moiety. This beverage is commonly found and consumed by people in the United States of America, China, France, Brazil, and Japan. Recently, the consumption of kefir has been popularized in other countries including Malaysia. The microflora in kefir from different countries differs due to variations in culture conditions and the starter media. Thus, this study was aimed at isolating and characterizing the lactic acid bacteria that are predominant in Malaysian kefir grains via macroscopic examination and 16S ribosomal RNA gene sequencing. The results revealed that the Malaysian kefir grains are dominated by three different strains of Lactobacillus strains, which are Lactobacillus harbinensis, Lactobacillusparacasei, and Lactobacillus plantarum. The probiotic properties of these strains, such as acid and bile salt tolerances, adherence ability to the intestinal mucosa, antibiotic resistance, and hemolytic test, were subsequently conducted and extensively studied. The isolated Lactobacillus spp. from kefir H maintained its survival rate within 3 h of incubation at pH 3 and pH 4 at 98.0 ± 3.3% and 96.1 ± 1.7% of bacteria growth and exhibited the highest survival at bile salt condition at 0.3% and 0.5%. The same isolate also showed high adherence ability to intestinal cells at 96.3 ± 0.01%, has antibiotic resistance towards ampicillin, penicillin, and tetracycline, and showed no hemolytic activity. In addition, the results of antioxidant activity tests demonstrated that isolated Lactobacillus spp. from kefir G possessed high antioxidant activities for total phenolic content (TPC), total flavonoid content (TFC), ferric reducing ability of plasma (FRAP), and 1,1-diphenyl-2-picryl-hydrazine (DPPH) assay compared to other isolates. From these data, all Lactobacillus spp. isolated from Malaysian kefir serve as promising candidates for probiotics foods and beverage since they exhibit potential probiotic properties and antioxidant activities.
... Total phenolic quantification Total phenolic content in the cell-free supernatant of bacterial cultures was measured using the colorimetric method of Folin-Ciocalteu according to Ho et al. (2015) with a slight modification. About 0.5 ml of the sample was mixed with 4.5 ml of Folin-Ciocalteu reagent. ...
Article
Full-text available
Aims: The objective of this study is to identify and investigate the antifungal and antioxidant potential of lactic acid bacteria (LAB) isolated from traditional fermented products. Methods and results: In this work, a collection of LAB was isolated from traditional fermented products collected in four Tunisian regions. After first screening using the overlay method, seven bacterial strains were retained due to their high antifungal effect. Four strains of Limosilactobacillus fermentum were identified, one strain of Lacticaseibacillus paracasei, one strain of Lacticaseibacillus rhamnosus and one strain of Enterococcus faecium. The antifungal as well as the antioxidant potential of these bacteria were then evaluated. Bacterial strains were effective against six fungal strains with a minimum inhibitory concentrations ranging from 25 to 100 mg/mL and a minimum fungicidal concentrations ranging from 50 to 200 mg/mL. Cell free supernatants of LAB were analyzed by HPLC-DAD and LC-MS-qTOF-MS analysis. Results showed significant production of organic acids as well as several phenolic compounds. Correlation analysis confirmed that PLA and 1,2-Dihydroxybenzene were positively correlated with antifungal potential. The results of the antioxidant activity highlighted an ABTS radical cation scavenging activity ranging from 49% to 57% and a DPPH trapping percentage ranging from 80% to 97%. Conclusions: Therefore, due to these characteristics, identified lactic acid bacteria strains have shown their effectiveness to perform as antifungal and antioxidant agents. Significance and impact of the study: Since microbial contamination is at the root of extensive losses in the food sector, the identified strains or their metabolites can potentially be used as additives to limit microorganism spoilage in food products and increase their shelf life.
Article
Methods: 56 adult male albino rats were divided into two main groups; the first main group (7 rats) was fed on basal diet and was kept as a negative control group, the second main group (49 rats) were injected with alloxan to induce diabetes and were fed on basal diet. Diabetic rats were divided into seven groups, first group was kept as a positive control group while the other (6) groups divided to groups (1-2) were fed on basal diet + Samwa extract (150-250) ml/kg of rat weight, respectively, and groups (3-4) were fed on basal diet + curry extract (350-450(ml/kg of rat weight) respectively, and groups (5-6) were fed on basal diet + the extracts of Samwa and curry mixture (150-350, 250-450) ml/kg respectively at the end of the experiment (6 weeks). Rats were fasted for 12 hours before slaughter and collected blood samples to obtain Fasting serum glucose, lipid profile and (pancreas - kidneys and liver) functions. Results: The results showed that the best increase in body weight in group 4, and the best results of feed efficiency ratio in group 7, and the mixture of Samwa and curry in group 8 achieved a significant decrease in fasting glucose, about lipemia the best result of cholesterol in groups 7-8 and triglycerides in group 8 and The best results were low-density lipoprotein in group 7, very low-density lipoprotein in group 8, and high-density lipoprotein in group 6, and there was a significant improvement in liver and kidney functions, and the best results were for examination of pancreatic, kidney and liver tissues for group 8. Conclusion: The results showed that the mixture of Samwa and curry extracts achieved better results than the extract of individual leaves. Therefore, we recommend taking the mixture of Samwa and curry leaves to control the high level of glucose and lipid imbalance in diabetic patients.
Article
Objecitvie: To compare the liver protective activity of fresh/dried dandelion extracts against acetaminophen (APAP)-induced hepatotoxicity. Methods: Totally 90 Kunming mice were randomly divided into 10 groups according to body weight (9 mice for each group). The mice in the normal control and model (vehicle control) groups were administered sodium carboxymethyl cellulose (CMC-Na, 0.5%) only. Administration groups were pretreated with high and low-dose dry dandelion extract (1,000 or 500 g fresh herb dried and then decocted into 120 mL solution, DDE-H and DDE-L); low-, medium- and high-dose dandelion juice (250, 500, 1,000 g/120 mL, DJ-L, DJ-M, and DJ-H); fresh dandelions evaporation juice water (120 mL, DEJW); dry dandelion extract dissolved by pure water (1 kg/120 mL, DDED-PW); dry dandelion extract dissolved by DEJW (120 g/120 mL, DDED-DEJW) by oral gavage for 7 days at the dosage of 0.5 mL solution/10 g body weight; after that, except normal control group, all other groups were intraperitonealy injected with 350 mg/kg APAP to induce liver injury. Twenty hours after APAP administration, serum and liver tissue were collected and serum alanine aminotransferase (AST), aspartate transaminase (ALT), alkaline phosphatase (AKP), malondialdehyde (MDA), glutathione (GSH), superoxide dismutase (SOD) activities were quantified by biochemical kits; tumor necrosis factor (TNF-α), interleukin (IL)-2, and IL-1 β contents in liver tissue were determined by enzyme linked immunosorbent assay kits. Histopathological changes in liver tissues were observed by hematoxylin and eosin staining; TUNEL Assay and Hoechst 33258 staining were applied for cell apoptosis evaluation. The expressions of heme oxygenase-1 (HO-1), nuclear factor erythroid-2-related factor 2 (Nrf-2), caspase-9, B-cell leukemia/lymphoma 2 (Bcl-2), Bax and p-JNK were determined by Western blot analysis. Results: Pretreatment with fresh dandelion juice (FDJ, including DJ-L, DJ-M, DJ-H, DEJW and DDED-DEJW) significantly decreased the levels of serum ALT, AST, AKP, TNF-α and IL-1β compared with vehicle control group (P<0.05 or P<0.01). Additionally, compared with the vehicle control group, FDJ decreased the levels of hepatic MDA and restored GSH levels and SOD activity in livers (P<0.05 or P<0.01). FDJ inhibited the overexpression of pro-inflammatory factors including cyclooxygenase-2 and inducible nitric oxide synthase in the liver tissues (P<0.05 or P<0.01). Furthermore, Western blot analysis revealed that FDJ pretreatment inhibited activation of apoptotic signaling pathways via decreasing of Bax, and caspase-9 and JNK protein expression, and inhibited activation of JNK pathway (P<0.05 or P<0.01). Liver histopathological observation provided further evidence that FDJ pretreatment significantly inhibited APAP-induced hepatocyte necrosis, inflammatory cell infiltration and congestion. Conclusions: FDJ pretreatment protects against APAP-induced hepatic injury by activating the Nrf-2/HO-1 pathway and inhibition of the intrinsic apoptosis pathway, and the effect of fresh dandelion extracts was superior to dried dandelion extracts in APAP hepatotoxicity model mice.
Article
This study was performed to study the in vitro and in vivo efficacy of hydroalcoholic extract of curry leaf (CLE) rich in carbazole alkaloids, against LPS‐induced inflammation in Raw 264.7 macrophages and cerulein‐induced acute pancreatitis, respectively. CLE was characterized by Fourier‐transform infrared (FTIR) and liquid chromatography–mass spectrometry. Raw 264.7 cells were stimulated with LPS (2 μg/ml) and treated with CLE. The animals were treated with two doses of CLE (100 and 300 mg/kg). Plasma biochemistry, tissue lipid peroxidation, cytokines, and histological examination were evaluated. CLE was found to decently scavenge the activity of DPPH radical. It dose dependently suppressed nitrite production and oxidative stress in macrophages. CLE alleviated LPS‐induced inflammation in macrophages as evident from the results of various inflammatory cytokines (IL‐1β, IL‐6, and TNF‐α). In vivo, CLE reduced cerulein‐induced pancreatic edema. CLE significantly abrogated the cerulein‐induced lipid peroxidation, nitrite, MPO, and GSH levels. The inflammatory cytokines and p65‐NFκB activity were significantly reduced by CLE. Mechanistically, CLE reduced the expression of NT, MPO, IL‐1β, ICAM‐1, and COX‐2, and increased the expression of Nrf2. It reduced distant organ damage markers as well. We report for the first time that CLE holds substantial potential for the prevention of acute pancreatitis.
Article
Full-text available
The present study deals with the protective nature of methanol extract of Murraya koenigii leaves against hepatosuppression through antioxidant status in experimental rats, which has been evaluated in terms of hepatic marker enzymes - AST, ALT (aspartate and alanine transaminases), ALP (alkaline phosphatase), γ-GTP (gamma glutamyl transpeptidase), LDH (lactate dehydrogenase), SDH (Sorbitol dehydrogenase) and total bilirubin, total protein and albumin in serum alongwith the levels of total cholesterol, triglycerides, LPO (lipid peroxidation), SOD (Superoxide dismutase), GSH (reduced glutathione), CAT (catalase) and Vit. C (ascorbic acid) in the liver. Hepatic alterations were significantly (P≥0.001) induced by CCl4 (0.2 ml/kg body weight/twice a week, intra peritoneal, with olive oil, 1:1) for 21 days. Simultaneously, the rats were given M. koenigii leaves extract, at the doses of 100 and 200 mg/kg body weight/day, orally, which remarkable restored the altered biochemical parameters in a dose dependent manner. However, silymarin showed a significant effect in all the parameters, studied in CCl4-treated rats. In conclusion, the protective nature of M. koenigii leaves extract may be attributed to the combined effect of carbazole alkaloids - Mahanimbine (1), Girinimbine (2), Isomahanimbine (3), murrayazoline (4), Murrayazolidine (5), Mahanine (6) and ascorbic acid, α-tocopherol and mineral (Zn, Cu, Fe) contents. Thus M. koenigii leaves extract showing protection in liver, may prove promising as a rich source of free radical quenchers, which have been mediated through hepatocyte membrane stabilizing activity alongwith the reduction of fat metabolism.
Article
Full-text available
Hepatoprotective and antioxidant activity of Lannea coromandelica bark extract (LCBE) was investigated on thioacetamide induced hepatotoxicity in rats. Hepatotoxicity was induced by thioacetamide (TAA) administration (100 mg/kg. s.c). LCBE at different doses (400 and 200 mg/kg) were administered orally to male wistar rats. Thioacetamide caused elevation of serum concentration of AST, ALT, ALP, serum bilirubin and also reduced serum concentration of total protein, albumin, sodium, potassium in animals as compared to control (p < 0.05) but LCBE treated rats showed maximum reduction of AST [(138±5.1) IU/L], ALT [(71 ±2.7) IU/L], ALP [(140 ±1.9) IU/L] with the high dose (400 mg/kg bw) of combined aqueous and alcoholic bark extract. Whereas, serum bilurubin, cholesterol, sugar and LDH content were varied with the treatments but showed higher with the only ethanolic extract at dose of 400 mg/kg. The IC50 value was observed as (83.28 ±2.12) µg/mL, for DPPH radical scavenging activity. Result concluded that ethanolic extract and combined aqueous and alcoholic bark extract of L. coromandelica showed a potential hepatoprotective and antioxidant activities might be due to the presence of phenolic groups, terpenoids and alkaloids.
Article
Full-text available
The antioxidant activity of pomegranate peel powder (PPP) and whey powder (WP) was evaluated, their hepatoprotective effect of each alone or in combination (PPWP) at equal levels was also evaluated in Wistar rats against carbon tetrachloride (CCL4) induced liver injury. The hepatoprotective activity was assessed using various biochemical parameters and histopathological studies. The results indicated that both PPP and WP exhibited antioxidant activity. Also, rats fed on diets supplemented with 10% PPP, 10% WP or 10% of their mixture (PPWP) for 28 days showed a potential hepatoprotective effects compared to liver injury control group (IC). They succeeded to restore the biochemical parameters and improved the histological alteration of the liver. This improvement was pronounced in the group received PPWP. It could be concluded that whey powder should be incorporated with pomegranate peel powder when used as ingredients in functional foods for people suffering from liver diseases.
Article
Full-text available
Recently, soybean tempeh has received great attention due to many advantages such as higher nutritional value, lower production cost, and shorter fermentation time. In this study, the in vivo hepatoprotective and antioxidant effects of nutrient enriched soybean tempeh (NESTE) were determined. NESTE fermentation process which involved anaerobic incubation was previously proclaimed to increase the content of amino acids and antioxidant properties remarkably. The evaluation of histological sections, serum biochemical markers (aspartate aminotransferase (AST), alanine aminotransferase (ALT), and cholesterol and triglycerides (TG)), liver immune response level (nitric oxide (NO)) and liver antioxidant level (superoxide dismutase (SOD), ferric reducing antioxidant power (FRAP), and malondialdehyde (MDA)) was conducted in order to compare the effects of nonfermented soybean extract (SBE) and fermented soybean extract (NESTE) on alcohol-induced liver damage in mice. Results demonstrated that 1000 mg/kg of NESTE can significantly reduce the levels of AST, ALT, cholesterol, TG, MDA, and NO. On the other hand, it also raised the level of SOD and FRAP. Furthermore, the histological examination on 1000 mg/kg NESTE treatment group showed that this extract was capable of recovering the damaged hepatocytes to their normal structures. Thus, it can be concluded that NESTE produced through fermentation process was able to enhance hepatoprotective and antioxidant effects in vivo.
Article
Full-text available
The hepatoprotective potential of saponarin, isolated from Gypsophila trichotoma, was evaluated in vitro/in vivo using a hepatotoxicity model of paracetamol-induced liver injury. In freshly isolated rat hepatocytes, paracetamol (100 μmol) led to a significant decrease in cell viability, increased LDH leakage, decreased levels of cellular GSH, and elevated MDA quantity. Saponarin (60–0.006 μg/mL) preincubation, however, significantly ameliorated paracetamol-induced hepatotoxicity in a concentration-dependent manner. The beneficial effect of saponarin was also observed in vivo. Rats were challenged with paracetamol alone (600 mg/kg, i.p.) and after 7-day pretreatment with saponarin (80 mg/kg, oral gavage). Paracetamol toxicity was evidenced by increase in MDA quantity and decrease in cell GSH levels and antioxidant defence system. No changes in phase I enzyme activities of AH and EMND and cytochrome P 450 quantity were detected. Saponarin pretreatment resulted in significant increase in cell antioxidant defence system and GSH levels and decrease in lipid peroxidation. The biochemical changes are in good correlation with the histopathological data. Protective activity of saponarin was similar to the activity of positive control silymarin. On the basis of these results, it can be concluded that saponarin exerts antioxidant and hepatoprotective activity against paracetamol liver injury in vitro/in vivo.
Article
Full-text available
It is well known that the intake of antioxidants with increased consumption of fruits and vegetables and medicinal herbs contributes towards reduced risk of certain diseases including cancers. This study aims to evaluate the broad-spectrum antioxidant and antimutagenic activities as well as to elucidate phytochemical profile of an Indian medicinal plant Murraya koenigii (curry) leaves. Leaves of the plant were successively fractionated in various organic solvents. Benzene fraction demonstrated the highest phenolic content followed by petroleum ether. The benzene fraction showed maximum antioxidant activity in all tested assays, namely, phosphomolybdenum, 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical, ferric reducing antioxidant power (FRAP) and cupric reducing antioxidant capacity (CUPRAC) assays. Based on the promising broad-spectrum antioxidant activity, benzene fraction was further evaluated for antimutagenic activity and showed a dose-dependent antimutagenic response in Ames Salmonella mutagenicity assay. It inhibited 72-86% mutagenicity induced by sodium azide, methyl methanesulfonate, benzo(a)pyrene, and 2-aminoflourene at the maximum tested concentration (100 μ g/mL) in Salmonella typhimurium tester strains. At least 21 compounds were detected by GC/MS. The findings clearly demonstrated that phenolic-rich benzene fraction has promising broad-spectrum antioxidant and antimutagenic property and needs further evaluation to exploit its therapeutic potential.
Article
Full-text available
Background Chrysanthemum indicum L. flower (CIF) has been widely used as tea in Korea. This study aims to investigate the hepatoprotective effect of the hot water extract of CIF (HCIF) in in vitro and in vivo systems. Methods Hepatoprotective activities were evaluated at 250 to 1000 μg/mL concentrations by an in vitro assay using normal human hepatocytes (Chang cell) and hepatocellular carcinoma cells (HepG2) against CCl4-induced cytotoxicity. Cytochrome P450 2E1, which is a key indicator of hepatic injury, was detected by western blot analysis using rabbit polyclonal anti-human CYP2E1 antibody. An in vivo hepatoprotective activity assay was performed at 1000 to 4000 μg/mL concentrations on CCl4-induced acute toxicity in rats, and the serum levels of glutamic oxaloacetic transaminase (GOT), glutamic pyruvic transaminase (GPT), alkaline phosphatase (ALP) and lactate dehydrogenase (LDH) were determined by standard enzyme assays. Results The hepatoprotective effects of HCIF significantly reduced the levels of GOT (60.1%, P = 0.000) and GPT (64.5%, P = 0.000) compared with the vehicle control group (CCl4 alone). The survival rates of HepG2 and Chang cells were significantly improved compared with the control group [82.1% (P = 0.034) and 62.3% (P = 0.002), respectively]. HCIF [50 mg/kg body weight (BW)] treatment significantly reduced the serum levels of GOT (49.5%, P = 0.00), GPT (55.5%, P = 0.00), ALP (30.8%, P = 0.000) and LDH (45.6%, P = 0.000) compared with the control group in this in vivo study. The expression level of cytochrome P450 2E1 (CYP2E1) protein was also significantly decreased at the same concentration (50 mg/kg BW; P = 0.018). Conclusion HCIF inhibited bioactivation of CCl4-induced hepatotoxicity and downregulates CYP2E1 expression in vitro and in vivo.
Article
Protective effects of Houttuynia cordata aqueous extract (HCAE) against acetaminophen-induced hepatotoxicity in Balb/cA mice were examined. HCAE, at 1 or 2 g/L, was added into the drinking water for 4 weeks. Acute liver injury was induced by acetaminophen treatment intraperitoneally (350 mg/kg body weight). Acetaminophen treatment significantly depleted hepatic glutathione (GSH) content, increased hepatic malonyldialdehyde (MDA), reactive oxygen species (ROS) and oxidized glutathione (GSSG) levels, and decreased hepatic activity of glutathione peroxidase (GPX), catalase and superoxide dismutase (SOD) (p<0.05). The pre-intake of HCAE alleviated acetaminophen-induced oxidative stress by retaining GSH content, decreasing MDA, ROS and GSSG production, and maintaining activity of GPX, catalase and SOD in liver (p<0.05). The pre-intake of HCAE also significantly lowered acetaminophen-induced increase in cytochrome P450 2E1 activity (p<0.05). Acetaminophen treatment increased hepatic release of interleukin (IL)-6, IL-10, tumor necrosis factor (TNF)-alpha and monocyte chemoattractant protein-1 (p<0.05). HCAE intake significantly diminished acetaminophen-induced elevation of these cytokines (p<0.05). These results support that HCAE could provide hepato-protection.
Article
Women diagnosed with breast cancer experience symptom clusters in addition to existential issues from a life-threatening diagnosis during chemotherapy. A complementary therapy, such as traditional acupuncture (TA) with its whole-person orientation, may help to modify these effects, alongside inducing other patient benefits. Exploring the needs and concerns of women and perceived benefits of TA would add to knowledge about its integrative treatment potential. Methods. A longitudinal qualitative study recruited fourteen women to receive up to ten sessions of TA during chemotherapy. They were interviewed before, during, and after chemotherapy. Two practitioners of TA delivered treatment and were interviewed before and after the study, and kept treatment logs and diaries. Interviews were recorded and transcribed, and the data were analysed using grounded theory. Findings. Both broad and specific benefits were reported by the women; a highly valued outcome was enabling coping through the alleviation of symptoms and increased well-being. Practitioners dealt with the presented symptom clusters facilitating outcome patterns, including and beyond individual symptom changes. Further research on TA as a flexible intervention able to respond to the changing needs and concerns of woman during chemotherapy along with the measure of such outcome patterns is warranted.