Enhancer Analysis Unveils Genetic Interactions between TLX and SOX2 in Neural Stem Cells and In Vivo Reprogramming

Abstract

The orphan nuclear receptor TLX is a master regulator of postnatal neural stem cell (NSC) self-renewal and neurogenesis; however, it remains unclear how TLX expression is precisely regulated in these tissue-specific stem cells. Here, we show that a highly conserved cis-element within the Tlx locus functions to drive gene expression in NSCs. We demonstrate that the transcription factors SOX2 and MYT1 specifically interact with this genomic element to directly regulate Tlx enhancer activity in vivo. Knockdown experiments further reveal that SOX2 dominantly controls endogenous expression of TLX, whereas MYT1 only plays a modulatory role. Importantly, TLX is essential for SOX2-mediated in vivo reprogramming of astrocytes and itself is also sufficient to induce neurogenesis in the adult striatum. Together, these findings unveil functional genetic interactions among transcription factors that are critical to NSCs and in vivo cell reprogramming.

Full text

Stem Cell Reports
Ar ticle
Enhancer Analysis Unveils Genetic Interactions between TLX and SOX2 in
Neural Stem Cells and In Vivo Reprogramming
Mohammed M. Islam,
1,4
Derek K. Smith,
1,2
Wenze Niu,
1,2
Sanhua Fang,
1,5
Nida Iqbal,
1
Guoqiang Sun,
3
Yanhong Shi,
3
and Chun-Li Zhang
1,2,
*
1
Department of Molecular Biology
2
Hamon Center for Regenerative Science and Medicine
University of Texas Southwestern Medical Center, 6000 Harry Hines Boulevard, Dallas, TX 75390, USA
3
Department of Neurosciences, Cancer Center, Beckman Research Institute of City of Hope, 1500 E. Duarte Road, Duarte, CA 91010, USA
4
Present address: College of Clinical Pharmacy, King Faisal University, Al-Ahsa 31982, Saudi Arabia
5
Present address: Core Facilities of Zhejiang University Institute of Neuroscience, 866 Yuhangtang Road, Hangzhou 310058, China
*Correspondence: chun-li.zhang@utsouthwestern.edu
http://dx.doi.org/10.1016/j.stemcr.2015.09.015
This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).
SUMMARY
The orphan nuclear receptor TLX is a master regulator of postnatal neural stem cell (NSC) self-renewal and neurogenesis; however, it
remains unclear how TLX expression is precisely regulated in these tissue-specific stem cells. Here, we show that a highly conserved
cis-element within the Tlx locus functions to drive gene expression in NSCs. We demonstrate that the transcription factors SOX2 and
MYT1 specifically interact with this genomic element to directly regulate Tlx enhancer activity in vivo. Knockdown experiments further
reveal that SOX2 dominantly controls endogenous expression of TLX, whereas MYT1 only plays a modulatory role. Importantly, TLX is
essential for SOX2-mediated in vivo reprogramming of astrocytes and itself is also sufficient to induce neurogenesis in the adult striatum.
Together, these findings unveil functional genetic interactions among transcription factors that are critical to NSCs and in vivo cell
reprogramming.
INTRODUCTION
Neural stem cells (NSCs) are self-renewing, multipotent
progenitors with critical roles in the development of a func-
tional nervous system and neuron differentiation (Alvarez-
Buylla and Temple, 1998; McKay, 1997; Weiss and van der
Kooy, 1998). Mounting evidence indicates that adult NSCs,
which normally reside in the subgranular zone (SGZ) of the
dentate gyrus (DG) and the subventricular zone (SVZ) of
the lateral ventricle (LV), are essential for maintaining adult
brain homeostasis (Gage, 2000; McKay, 1997; Rao, 1999).
NSCs in these niches are critical to brain plasticity, but
the molecular mechanisms governing these processes
have yet to be elucidated.
The orphan nuclear receptor subfamily 2 group E
member 1 (NR2E1), commonly known as TLX, has been
identified as a fundamental regulator of adult NSCs and
neurogenesis (Liu et al., 2008; Niu et al., 2011; Shi et al.,
2004; Wang et al., 2013; Zhang et al., 2008). While TLX
expression is observed in the forebrain and retina during
early development, it becomes confined to NSCs of the
DG and SVZ where neurogenesis continues into adulthood
(Hollemann et al., 1998; Kitambi and Hauptmann, 2007;
Monaghan et al., 1995). Even though no obvious defects
are found in the brains of Tlx null mice during early devel-
opment, mature mice exhibit limbic defects, retinopathies,
reduced copulation, and progressively violent behavior
(Islam and Zhang, 2015; Monaghan et al., 1997; Yu et al.,
2000). The primary function of this key transcriptional
regulator is to prevent the precocious differentiation of
NSCs in the developing and adult brain (Li et al., 2008;
Niu et al., 2011; Roy et al., 2004; Shi et al., 2004). TLX con-
trols the expression of a broad network of genes to main-
tain NSC pools in an undifferentiated, self-renewing state
(Niu et al., 2011; Shi et al., 2004, 2008; Zhang et al.,
2008). TLX functions through the transcriptional suppres-
sion of target genes in association with other transcrip-
tional corepressors like lysine-specific histone demethylase
1 (LSD1) (Sun et al., 2007, 2010, 2011; Yokoyama et al.,
2008). Histone deacetylases (HDACs) are also recruited by
TLX to target genes, which restrain transcription and, in
turn, regulate NSC proliferation (Sun et al., 2007). While
the essential roles of TLX in NSC self-renewal and differen-
tiation have been well established, relatively little is known
about the molecular mechanisms that govern the spatio-
temporal expression of this critical factor in the developing
and adult brain (Li et al., 2008; Roy et al., 2004; Shi et al.,
2004, 2008).
To identify novel regulatory elements that will provide
insight into this mechanism, we probed highly conserved
sequences of the Tlx locus using in vitro screening and
in vivo transgenic assays. Here, we have identified a single
short DNA element bound by the transcription factors, sex
determining region-box 2 (SOX2) and myelin transcription
factor 1/neural zinc finger 2 (MYT1), which directly regu-
late Tlx expression in postnatal NSCs. We further unveiled
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 805

that TLX mediates SOX2-dependent in vivo reprogram-
ming of astrocytes in the adult mouse brain.
RESULTS
Identification of NSC-Specific Enhancers within the
Tlx Locus
A cross-species comparison of genomic DNA sequences
revealed multiple highly conserved regions within the
Tlx locus (Figure 1A). To examine whether any of these
conserved elements promote Tlx expression, we screened
seven conserved DNA regions in cultured adult NSCs by
linking the indicated genomic sequences to a b-galactosi-
dase (b-gal) reporter. This systematic in vitro analysis
revealed that five of these seven conserved regions were
sufficient to drive b-gal reporter expression in NSCs, but
not in other non-NSC lines, such as NIH 3T3, COS7, or
HELA (Figure S1; data not shown). Next, a conventional
in vivo transgenic analysis showed that only two of these
regions, region 4 and region 5, were sufficient to drive re-
porter expression in the embryonic day (E) 12.5–13.5 fore-
brain in a pattern that resembles endogenous Tlx (Figures
1A and 1B) (Zhang et al., 2006). The first putative enhancer
region (Enh1) we identified was a 3.3-kb fragment located
8 kb upstream of the Tlx transcription start site within re-
gion 4 (Figure 1A). The second putative enhancer region
(Enh2) was a 4.2-kb fragment located within the first Tlx
intron, a subsection of region 5 (Figure 1A). Both of these
putative enhancers were capable of driving reporter expres-
sion in the developing forebrain and retina (Figure 1B).
When analyzed at postnatal day (P) 28, signal intensity
for the b-gal reporter remained robust for Enh1 but
tapered for Enh2. Further, Enh2-driven b-gal expression
was dramatically reduced in adult neurogenic regions
as compared to the Enh1-driven reporter (Figures 1C and
Tlx
1 2 3 4 5 6 7
X U X X N X N X N N U X N X
A
B
DC
F
E
Enh1.1 Enh1
β-galβ-gal/NES/DAPI NES
β-galβ-gal/NES/DAPI NES
Enhancer 2 (Enh2)
Enhancer 2 (Enh2)
Enhancer 1 (Enh1)
Enhancer 1 (Enh1)
Frog
Fugu
Zebrafish
Opposum
Dog
Chimpanzee
Human
Rat
82P5.21E82P5.21E
LacZ/total: 0/6 3/3 4/6 0/2 0/4
Genomic
conservation
Figure 1. Cis-Regulatory Elements within
the Tlx Locus
(A) Conservatory genomic elements and
their role in controlling gene expression
in neural stem cells (NSCs). The indicated
elements were examined for driving gene
expression in either cultured cells (X, not
expressed; U, ubiquitous; N, NSCs) or trans-
genic mice (LacZ/total, LacZ
+
embryos over
the total number of transgenic embryos).
(B) Brain-restricted reporter expression
controlled by the identified two enhancers.
Embryonic day (E) 12.5–13.5 embryos were
stained for b-galactosidase activity.
(C) Enh1 is active in both embryonic
and postnatal stages. NSCs are marked with
NES staining, while enhancer activity is
indicated by staining for b-galactosidase
(b-gal). E12.5, embryonic day 12.5; P28,
postnatal day 28. The scale bar represents
50 mm.
(D) Enhancer activity of Enh2 is develop-
mentally regulated. The scale bar represents
50 mm.
(E) Genomic conservation of the indicated
enhancer region.
(F) The highly conserved genomic sequence
drives reporter expression (blue signal) in
the developing CNS.
See also Figure S1.
806 Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors

1D). Therefore, we opted to narrow the focus of our inves-
tigations to the enhancer activity of Enh1.
A second screen of smaller Enh1-derived DNA fragments
uncovered a 582-nt region (Enh1.1) sufficient to drive
reporter expression in cultured adult NSCs and trans-
genic E13.5 embryos (Figures 1E and 1F). Interestingly,
Enh1.1-driven reporter expression is robustly detected
throughout the developing CNS, indicating that neigh-
boring elements of the full-length Enh1 region act to
restrict Tlx expression to the forebrain and retina during
early development.
Enh1.1.3 Enhancer Is Active in TLX
+
NSCs
To define the minimal functional region of Enh1 sufficient
to drive Tlx expression, Enh1.1 was subdivided into six
roughly 120-bp overlapping fragments and then cloned
into a GFP reporter vector (Figure 2A; Table S1). Each clone
was co-electroporated with a control plasmid expressing
tdTomato under the constitutively active CAG promoter
into the forebrains of P0 mice (Figure 2B). GFP reporter
expression was evaluated 5 days later (Figure 2C). Strong re-
porter expression was observed for the Enh1.1 subregion
Enh1.1.3, while Enh1.1.6 induced moderate reporter signal
(Figure 2C). Interestingly, the Enh1.1.3 element falls within
a highly conserved region of the Tlx locus (Figure 2A).
To validate Enh1.1.3 as a bona fide Tlx enhancer, we
analyzed the spatial expression pattern of this DNA element
in the SVZ using a GFP reporter. An Enh1.1.3-GFP construct
was electroporated into the LV of the P0 mouse forebrain,
and reporter expression was evaluated 5 days later. Greater
than 91% of Enh1.1.3-GFP
+
cells co-labeled with TLX, while
only 63% of control CAG-GFP transduced cells were TLX
+
,
indicating robust transcriptional activity of this enhancer
in postnatal NSCs (Figure 2D).
Enh1.1.3 Activity Requires SOX2 Binding
We next aimed to identify potential trans-acting factor
binding sites within the Enh1.1.3 enhancer. We used
MatInspector to computationally identify 24 transcription
factor binding sites, then narrowed our focus to four of
these factors based on known molecular functions and
spatiotemporal expression patterns (Cartharius et al.,
2005). We used site-directed mutagenesis to delete one or
more binding sites for each of these transcription factors
and generated five Enh1.1.3 mutant GFP reporter con-
structs, SOX2-BS1, SOX2-BS2, SOX2-BS1+BS2, MYT1, and
AB
C
D
Figure 2. Core Sequences Controlling
Gene Expression in TLX
+
Cells
(A) Relative sequence locations within the
indicated Tlx enhancer.
(B) Analyzing enhancer activity through
in vivo electroporation of P0 mouse brains.
(C) Representative fluorescence images
showing transcriptional activity of the
indicated genomic sequences. tdTomato
under the constitutively active CAG pro-
moter was used as an internal control for
electroporation. The ratios of GFP
+
cells over
tdTomato
+
cells are indicated in the paren-
theses (n = 3 mice; mean ±SEM). LV, lateral
ventricle. The scale bar represents 50 mm.
(D) Immunohistochemistry showing en-
hancer activity in TLX
+
NSCs. Higher
magnification views of the arrow-indicated
cells are also shown. The scale bar repre-
sents 50 mm.
See also Table S1.
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 807

NFkB(Figure 3A). Forebrain tissue electroporated with the
NFkB-binding site-deleted construct showed no significant
change in GFP reporter expression, whereas a moderate
reduction of reporter activity was observed for constructs
with mutations of SOX2-BS1 and SOX2-BS2, respectively
(Figure 3B). Interestingly, the combined deletion of both
SOX2-binding sites (SOX2-BS1+BS2) greatly diminishes
GFP expression, indicating these sites are redundant but
required for Enh1.1.3 cis-regulatory activity (Figure 3B).
Unexpectedly, the deletion of these SOX2-binding sites
from the full-length Enh1.1 Tlx regulatory element does
not significantly alter enhancer activity (data not shown),
suggesting additional redundancy among the five putative
SOX2-binding sites within this larger enhancer region.
SOX2 and MYT1 Bind to Enh1.1.3
Similar to the deletion of SOX2-binding sites in Enh1.1.3,
the deletion of a single MYT1-binding site moderately
A
B
CD
Figure 3. Transcription Factors Regu-
lating Tlx Enhancer Activity
(A) A diagram showing locations of the
consensus transcription factor binding
sequences (BS).
(B) Diminished enhancer activity with mu-
tations in the SOX2- or MYT1-binding se-
quences. Constitutively expressed tdTomato
was used as an internal control for electro-
poration. The ratios of GFP
+
cells over
tdTomato
+
cells are indicated in the paren-
theses (n = 3 mice; mean ±SEM). The scale
bar represents 50 mm.
(C) MYT1 directly binds to the identified
enhancer. Antibody-induced supershift in
electrophoresis mobility shift assays (EMSA)
is shown in the boxed region. Normal IgG
was used as controls for EMSA and chromatin
immunoprecipitation (ChIP) assays (mean ±
SEM; n = 3 independent experiments for
control IgG and MYT1 antibody).
(D) SOX2 directly binds to the identified
enhancer. The boxed region shows anti-
body-induced supershift of the probe.
Normal IgG was used as controls for EMSA
and ChIP (mean ±SEM; n = 3 independent
experiments for control IgG and SOX2
antibody).
See also Table S2.
808 Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors

diminishes enhancer activity (Figure 3B). To confirm the
sequence-specific binding of MYT1 to this predicted
binding site, we performed an electrophoretic mobility
shift assay (EMSA) (Figure 3C). A double-stranded
DNA probe containing the MYT1-binding site within
Enh1.1.3 showed a distinct shift when incubated with
NSC nuclear extracts, indicating a sequence-specific
DNA-protein interaction (indicated by arrows in Fig-
ure 3C). Further, the addition of a MYT1-specific
antibody induced a supershift not observed in the
mock immunoglobulin G (IgG)-antibody-treated control
(boxed region in Figure 3C). As expected, mutation of
the MYT1-binding site in this probe resulted in the
loss of specific protein binding (Figure 3C). These
in vitro data strongly support MYT1 interaction with
the Enh1.1.3 Tlx enhancer.
To confirm SOX2 sequence-specific binding to the
Enh1.1.3 enhancer element, we similarly performed
EMSA with DNA probes specific to the Enh1.1.3 SOX2-
binding region. These complementary probes exhibited
a specific shift when incubated with NSC nuclear extracts
and were distinctly supershifted when incubated with
SOX2-specific antibody (boxed region in Figure 3D).
Moreover, mutation of the predicted SOX2-binding sites
abolished this specific probe-SOX2 interaction (indicated
by an arrow in Figure 3D). These results confirm the
in vitro binding of SOX2 within the Tlx cis-element
Enh1.1.3.
To validate the in vivo binding of these factors
to Enh1.1.3, we performed chromatin immunoprecipi-
tation (ChIP) assays using early postnatal mouse fore-
brains and antibodies specific to SOX2 or MYT1. qPCR
analysis for the EMSA-identified MYT1-binding site
showed a greater than 3-fold enrichment in MYT1
ChIP DNA over a mock IgG control (Figure 3C; ChIP).
Similarly, SOX2 binding was confirmed with greater
than 12-fold ChIP enrichment over IgG (Figure 3D;
ChIP).
MYT1 Modulates Tlx Enhancer Activity
To determine the role for MYT1 binding within the
Enh1.1.3 Tlx enhancer element, we analyzed the effects
of short hairpin RNA (shRNA)-mediated Myt1 knock-
down on E1.1.3 enhancer activity in vivo. A shRNA
screen in HEK293 cells identified a highly efficient
Myt1-targeting shRNA (Myt1-shRNA1; Figure 4A). Due to
the lack of a suitable antibody for specific MYT1 immu-
nohistochemical staining in the mouse forebrain, we
co-electroporated Enh1.1-LacZ and Enh1.1.3-LacZ with
Myt1-shRNA1 to determine whether MYT1 knockdown
would significantly reduce reporter expression relative
to a scrambled shRNA control. As shown in Figure 4B,
MYT1 knockdown dramatically reduced the Enh1.1.3-
driven b-gal expression but exhibited minimal effect on
Enh1.1-driven reporter expression (Figure 4B). A moder-
ate reduction in the number of TLX
+
cells was also
A
C
B
D
Figure 4. MYT1 Regulates Tlx Enhancer
Activity
(A) A western blot analysis showing shRNA-
mediated downregulation of MYT1. b-actin
was used as a loading control.
(B) Knocking down endogenous MYT1 re-
duces transcriptional activity of the core
enhancer (Enh1.1.3). shRNA-expressing
cells are marked by GFP. The scale bar rep-
resents 100 mm.
(C) Immunohistochemistry showing TLX
expression in cells with the indicated
shRNA. The scale bar represents 100 mm.
(D) Downregulation of MYT1 modestly re-
duces the number of TLX-expressing cells
(mean ±SEM; n = 3 mice for each shRNA;
*p < 0.05 by Student’s t test).
See also Table S3.
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 809

observed after Myt1 knockdown (Figures 4Cand4D).
Together, these results indicate that MYT1 controls the
activity of a defined Tlx enhancer, but its activity is not
a major driving force for the overall expression of endog-
enous Tlx.
SOX2 Controls Tlx Enhancer Activity and Endogenous
Expression
To determine the role of SOX2 in the regulation of
this enhancer, Enh1.1-GFP and Enh1.1.3-GFP were co-
electroporated with two shRNAs targeting Sox2 mRNA
into the P0 mouse forebrain and analyzed 5 days later
(Figure 5A). A scrambled shRNA sequence and the co-
electroporated CAG-tdTomato were used as controls.
Sox2-shRNA1 and Sox2-shRNA2 significantly reduced
both Enh1.1-andEnh1.1.3-driven GFP expression (Fig-
ures 5A–5C). Downregulation of endogenous SOX2
expression by the two Sox2 shRNAs was confirmed by
immunohistochemical analysis of transfected cells that
were labeled by a co-electroporated GFP reporter (Figures
A
CBDE
F
Figure 5. SOX2 Controls Tlx Enhancer
Activity and Endogenous Expression
(A) Immunohistochemistry showing en-
hancer activity in cells with the indicated
shRNA. The co-electroporated tdTomato was
used as an internal control. The scale bar
represents 50 mm.
(B) Downregulation of SOX2 greatly reduces
Enh1.1 activity (mean ±SEM; n = 3 mice for
each shRNA; *p < 0.001 by Student’s t test).
(C) Downregulation of SOX2 greatly reduces
Enh1.1.3 activity (mean ±SEM; n = 3 mice
for each shRNA; *p < 0.001 by Student’s
t test).
(D) Quantification of SOX2 knockdown effi-
ciency. shRNA-expressing cells are indi-
cated by the co-electroporated GFP marker
(mean ±SEM; n = 3 mice for each shRNA;
*p < 0.01 by Student’s t test).
(E) Downregulation of SOX2 dramatically
reduces TLX expression (mean ±SEM; n = 3
mice for each shRNA; *p < 0.01 by Student’s
t test).
(F) Immunohistochemistry showing expres-
sion of the indicated markers. The scale bar
represents 50 mm.
See also Table S3.
810 Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors

5D and 5F). Importantly, the expression of endogenous
TLX is also dramatically reduced due to the downregula-
tion of SOX2 in these cells (Figures 5Eand4F). This sug-
gests a dominant role for SOX2 in the control of TLX
expression.
TLX Is Required for SOX2-Mediated In Vivo
Reprogramming
We and others recently showed that SOX2 can in vivo
reprogram reactive glia into neural progenitors and neu-
rons in the adult mouse brain and spinal cord (Heinrich
et al., 2014; Niu et al., 2013, 2015; Su et al., 2014). As a
direct downstream target of SOX2, we asked whether
TLX plays a role during this in vivo reprogramming pro-
cess. We conditionally deleted the Tlx gene in astrocytes
of mutant mice harboring floxed Tlx alleles (Tlx
flox/flox
)
and a Cre-transgene controlled by the human GFAP
promoter (pGFAP-Cre). SOX2-expressing lentivirus was
injected into the striatum of adult control (Tlx
flox/flox
)
or Tlx-deleted (pGFAP-Cre;Tlx
flox/flox
) mice. DCX
+
neuro-
blasts were quantified surrounding the virus-injected
striatal regions at 5 weeks post virus injection (wpi).
In contrast to control mice, the deletion of Tlx in astro-
cytes significantly decreased the detection of SOX2-
induced DCX
+
cells in the adult striatum (Figures 6A
and 6B).
Because of its essential role in maintaining adult neuro-
genesis (Liu et al., 2008; Niu et al., 2011; Shi et al., 2004;
Zhang et al., 2008), we also examined whether TLX
itself is sufficient to induce DCX
+
cells. Adult wild-type
mice were stereotactically injected with lentivirus ex-
pressing transcription factors or a control GFP under
the GFAP promoter. Immunohistochemistry was per-
formed at 5 wpi. Very interestingly, DCX
+
neuroblasts
were specifically observed in striatal regions with ectopic
TLX but not ASCL1 or GFP (Figures 6C and 6D). Never-
theless, the total number of DCX
+
cells induced by TLX
was significantly fewer than SOX2 alone, and their
morphology was also very primitive, suggesting that
additional factor(s) are required for robust in vivo
reprogramming. Of note, the inclusion of TLX failed to
enhance SOX2-induced adult neurogenesis (Figure 6C),
which is consistent with our finding that TLX functions
downstream of SOX2.
ABC
D
Figure 6. SOX2 Requires TLX to Induce
Neurogenesis in the Adult Striatum
(A) TLX is required for SOX2-mediated
in vivo reprogramming. Tlx was condition-
ally deleted in astrocytes of pGFAP-Cre;
Tlx
flox/flox
mice. DCX
+
cells were quantified by
immunohistochemistry (IHC) at 5 weeks
post SOX2 virus injection in the adult
striatum (mean ±SEM; n = 6 and 4 mice for
Cre

and Cre
+
groups, respectively; *p <
0.001 by Student’s t test).
(B) Representative confocal images showing
SOX2-induced DCX
+
cells in the striatum of
mice with the indicated genetic back-
ground. Hst, Hoechst 33342 dye. The scale
bar represents 50 mm.
(C) Quantification of transcription factor-
induced neuroblasts in the adult striatum.
DCX
+
cells were determined by IHC at
5 weeks post virus injection in the adult
mouse striatum (mean ±SEM; n = 5 mice for
Ascl1, n = 5 mice for Tlx, n = 4 mice for Sox2,
and n = 4 mice for Tlx+Sox2; ND, not
detected; *p < 0.01 by Student’s t test).
(D) Immunofluorescence showing TLX-
induced DCX
+
neuroblasts in the adult mouse
striatum. GFP alone was used as a control.
An enlarged view of a DCX
+
cell in the boxed
region is also shown. LV, lateral ventricle.
The scale bar represents 1 mm (lower
magnification views) and 50 mm (higher
magnification views).
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 811

DISCUSSION
Although discovered more than two decades ago, the tran-
scriptional regulation of Tlx in NSCs remains unclear (Yu
et al., 1994). Numerous microRNAs such as let-7b and
miR-137 have been identified as potential regulators of
NSC proliferation, and a subset of these, miR-9 and let-
7d, have been directly implicated in the regulation of
TLX expression (Sun et al., 2011; Zhao et al., 2009, 2010).
Similarly, interleukin-1 beta (IL-1b) has been shown to
repress Tlx expression in neural precursor cells, differenti-
ating newborn neurons, mature neurons, and astrocytes
(Green and Nolan, 2012; Koo and Duman, 2008). However,
the spatiotemporal mechanism that underlies Tlx tran-
scription is undefined. In this study, we systematically
examined the promoter and enhancer activity regulating
Tlx expression in vivo and established genetic interactions
between Tlx and two critical transcription factors, SOX2
and MYT1.
Comparative genomic analyses have proven to be a use-
ful tool for identifying highly conserved regulatory ele-
ments that direct gene expression in a cell- or tissue-specific
manner. Here, we identified two active regions, Enh1 and
Enh2, upstream of the Tlx transcription start site that are
sufficient to drive the expression of a reporter gene at
E13.5. Importantly, these two enhancers were not previ-
ously identified as SOX2-binding regions in cell culture
(Shimozaki et al., 2012), which indicates the mechanisms
regulating physiological Tlx expression might be signifi-
cantly different from in vitro models. The systematic anal-
ysis of a transcriptional enhancer we termed Enh1 led to the
identification of Enh1.1, a 582-bp cis-regulatory region
active in the developing forebrain, retina, and other
regions of the CNS. We subdivided the sequence of this pu-
tative enhancer to identify the highly conserved 120-bp
cis-element Enh1.1.3. This element is preferentially active
in TLX
+
cells in the SVZ of LV and is sufficient to drive
reporter gene expression. In contrast to NSCs, other
populations of cells in the SVZ did not exhibit Enh1.1.3
activity, which highlights the transcriptional specificity
of this element. In addition, a second subregion of Enh1,
Enh1.1.6, moderately activated reporter expression, poten-
tially indicating that multiple redundant transcription
factor binding sites exist within the Tlx enhancer.
Four potential transcription factor bindingsites were iden-
tified and investigated by site-directedmutagenesis based on
their known functions and expression patterns (Avilion
et al., 2003; Bellefroid et al., 1996; Graham et al.,2003; Pevny
and Nicolis, 2010; Shi et al., 2008; Shimozaki et al., 2012).
The individual deletion of SOX2-binding sites only moder-
ately affected Enh1.1.3 activity; however, the deletion of
both sites severely abolished reporter expression. This func-
tional redundancy might explain why the deletion of these
two binding sites did not affect the activity of Enh1.1, which
contains at least five SOX2-binding motifs. The deletion of a
ChIP-validated MYT1-binding site repressed Enh1.1.3 activ-
ity, indicating the mechanism underlying Tlx expression is
complex and involves multiple factors. These observations
were validated by EMSA binding assays and in vivo ChIP as-
says. Further, Sox2 knockdown dramatically reduced Enh1.1
and Enh1.1.3 activity and significantly reduced TLX expres-
sion in vivo. Myt1 knockdown affected only Enh1.1.3 activ-
ity and moderately repressed in vivo TLX expression. This
suggests a specific MYT1-Enh1.1.3 interaction that fine-
tunes the expression of Tlx in NSCs. As a recently identified
subunit of the lysine-specific demethylase 1 complex, a
corepressor of Tlx, MYT1 might exert unique control over
the onset of neurogenesis and neural differentiation in
adult NSCs (Armstrong et al., 1995, 1997; Kim et al., 1997;
Matsushita et al., 2014).
Collectively, these data demonstrate that SOX2 and
MYT1 regulate the spatiotemporal expression of Tlx in
NSCs during postnatal development. The ectopic expres-
sion of SOX2, a transcription factor with well-defined roles
in stem cell pluripotency and transcriptional regulation
(Avilion et al., 2003; Catena et al., 2004; Graham et al.,
2003; Lorthongpanich et al., 2008; Masui et al., 2007; Pevny
and Nicolis, 2010; Rossant, 2004; Sarkar and Hochedlinger,
2013; Shimozaki et al., 2012; Suh et al., 2007), was recently
shown to reprogram reactive glia into neural progenitors
and neurons in the adult mouse brain and spinal cord
(Niu et al., 2013, 2015; Su et al., 2014). Our current data
further demonstrate that SOX2-regulated Tlx expression is
required for this in vivo reprogramming process. These find-
ings provide new insights into molecular mechanisms that
govern NSC behavior and fate reprogramming.
EXPERIMENTAL PROCEDURES
Animals
Wild-type C57BL/6 and ICR mice were obtained from The Jackson
Laboratory and Harlan Laboratory, respectively. The generation of
Tlx
flox/flox
mice was previously described (Zhang et al., 2008). The
transgenic pGFAP-Cre mice were created by the laboratory of Albee
Messing (Zhuo et al., 2001) and purchased from The Jackson
laboratory (stock number 004600). All mice were housed under
a 12-hr light-dark cycle with ad libitum access to food and water
in a controlled animal facility. All experimental protocols were
approved by the Institutional Animal Care and Use Committee
at The University of Texas Southwestern Medical Center.
Bioinformatics
The UCSC genome browser was used to retrieve sequences and an-
notations for the mouse Tlx gene and its cross-species homologs.
Transcription factor binding sites in E1.1.3 were identified using
the MatInspector application within the Genomatix Suite.
812 Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors

DNA Constructs and Site-Directed Mutagenesis
Assays for the activity of candidate Tlx cis-elements were per-
formed using a human b-globin promoter plasmid carrying either
aLacZ or GFP reporter. Evolutionarily conserved noncoding and
coding subregions of the Tlx locus were PCR amplified and cloned
to generate DNA constructs. Two constructs, CAG-GFP and CAG-
tdTomato, were used as transfection controls. A plasmid carrying
the full-length mouse Myt1 cDNA was obtained from Addgene
(plasmid 22713) and subcloned into a pCMX vector to generate
aMyt1 construct with an amino terminus HA-tag for overexpres-
sion in knockdown studies. A PCR-based site-directed mutagenesis
method was used to generate mutant enhancer constructs. Briefly,
mutations were introduced by PCR using a set of primers with
either a deletion or point mutation in the targeted binding site
and then validated by DNA sequencing.
In Vivo DNA Electroporation
Mouse P0 forebrain DNA electroporation was performed essentially
as previously described (Boutin et al., 2008). Briefly, a 2-ml mixture
of plasmid DNA and fast green FCF dye (4 mg/ml and 2 mg/ml final
concentrations, respectively) was directly injected into the LVs of
the P0 mouse forebrain using a glass micropipette. Five electric
pulses (88 V, 50-ms duration, 950-ms intervals) were applied
through the head with a CUY21 electroporator (Nepagene).
Immunohistochemistry
Mice were sacrificed, perfused with PBS, and then perfused by
ice-cold 4% paraformaldehyde (PFA) in PBS. Brains were dissected
and postfixed overnight with 4% PFA at 4C followed by cryopro-
tection in a 30% sucrose solution overnight. Frozen brains were
sectioned at 40 mm with a sliding microtome (Leica Microsys-
tems). Free-floating sections were washed three times with PBS
and blocked for 1 hr at room temperature (3% BSA and 0.2%
Triton X-100 in PBS). The sections were immunostained over-
night at 4C with anti-SOX2 antibody (SC17320, goat, 1:500,
Santa Cruz) diluted in blocking solution. After three rinses with
wash buffer (0.2% Triton X-100 in PBS), the sections were
incubated with Alexa-Fluor-594-conjugated secondary antibody
(Jackson ImmunoResearch) in blocking solution for 2 hr at
room temperature. Nuclei were stained with Hoechst 33342
(1 mg/ml, Sigma). Images were obtained on a Zeiss LSM510
confocal microscope. A Cell Counter software plugin for ImageJ
was used to count cells. A representative image is shown from at
least three similar images.
EMSA
Complementary single-stranded oligonucleotides were designed
to mimic the Enh1.1.3 DNA sequence including consensus
SOX2- and MYT1-binding sites (Sigma Aldrich). Complimentary
oligonucleotides were annealed and labeled with
32
P-dCTP
(2 310
5
counts per minute). Nuclear extract (5 mg) isolated from
E14 mouse forebrain was incubated with
32
P-dCTP-labeled probes
in binding buffer (10 mM HEPES [pH 7.8], 50 mM KCl, 1 mM
EDTA, 10% glycerol, 1 mM DTT, and 50 mg/ml poly(dI:dC)) for
20 min at room temperature. Antibody-mediated supershift assays
were incubated with 1 mg anti-MYT1 antibody (AB30997, rabbit,
Abcam) or 1 mg anti-SOX2 antibody (AB5603, rabbit, Millipore)
for an additional 15 min. The DNA-protein complexes were sepa-
rated on 5% non-denaturing polyacrylamide gels and detected
by autoradiography.
Western Blot Analysis
Harvested cells were treated with lysis buffer (50 mM Tris-HCl
[pH 7.5], 150 mM NaCl, 1 mM EDTA, 0.5% sodium deoxycholate,
1% NP-40, and protease inhibitors [Roche]) for 30 min at 4C.
Protein samples were separated on 10% SDS-polyacrylamide gels,
transferred to polyvinylidene difluoride membranes (Millipore),
and blotted with corresponding primary and secondary antibodies
for chemiluminescence detection (Amersham). The following pri-
mary antibodies were used: monoclonal anti-b-actin, clone ac-74
(A5316-100mL, mouse, 1:8,000, Sigma-Aldrich), and HA epitope
(MMS-101P, mouse, 1:1,000, Covance).
ChIP and Quantitative Real-Time PCR
Approximately 0.1 g of P5 mouse forebrain was excised from sur-
rounding neural tissue and crosslinked with 1% methanol-free
formaldehyde for 10 min at room temperature. The reaction was
quenched with glycine (0.125 M final concentration) and the tis-
sue washed twice with ice-cold PBS. Tissue was suspended in
5 ml lysis buffer (100 mM HEPES [pH 8.0], 85 mM KCl, 1% IGEPAL
CA-630, and EDTA-free complete protease inhibitor [Roche]) for
20 min on ice then homogenized by douncing. Nuclei were pel-
leted, resuspended in 275 ml shearing buffer (50 mM HEPES
[pH 8.0], 10 mM EDTA [pH 8.0], 1% SDS, EDTA-free complete pro-
tease inhibitor), and chromatin sheared for 45 min at 4C using
a Bioruptor (Diagenode) until DNA fragments were 200–600 bp.
Sheared chromatin (50 mg) was diluted 10-fold in immunoprecipi-
tation buffer (50 mM HEPES (pH 8.0], 20 mM NaCl, 1 mM EDTA
[pH 8.0], 0.1% Triton X-100, EDTA-free complete protease inhibi-
tor) and immunoprecipitated with anti-SOX2 (AB5603, rabbit,
5mg, Millipore), anti-MYT1 (HPA006303, rabbit, 5 mg, Sigma), or
anti-IgG (PP64, rabbit, 5 mg, Millipore) at 4C for 14 hr. Protein G
magnetic Dynabeads (100 ml, Life Technologies) were used to
isolate immunoprecipitated chromatin at 4C for 2 hr. The immu-
noprecipitated fraction was washed twice with immunoprecipita-
tion buffer, twice with wash buffer (100 mM Tris-HCl [pH 9.0],
500 mM LiCl, 1% IGEPAL CA-630, 1% deoxycholic acid, and
EDTA-free complete protease inhibitor) and one time with high
salt wash buffer (wash buffer containing 150 mM NaCl). Chro-
matin was eluted in 100 ml elution buffer (1% SDS, 50 mM sodium
bicarbonate) at 25C for 30 min with shaking. Eluted chromatin
was treated with 1 ml RNase A (10 mg/ml) and 2 ml Proteinase K
(40 mg/ml) at 37C for 1 hr, and then then crosslinking was reversed
with NaCl (333 mM final concentration) at 67C for 14 hr. Immu-
noprecipitated DNA was purified using the QIAquick PCR Purifica-
tion Kit (QIAGEN) according to the manufacturer’s specifications.
Quantitative real-time PCR was performed to determine the fold-
enrichment of SOX2 and MYT1 immunoprecitated DNA relative
to background in IgG-treated samples (primer sequences listed in
Table S2).
shRNA-Mediated SOX2 and MYT1 Knockdown
Mouse P0 forebrains were transfected with Sox2- and Myt1-spe-
cific shRNAs or scrambled control (OriGene). All shRNAs were
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 813

subcloned into the Superscript-GFP vector (shRNA sequences listed
in Table S3).
Virus Generation and Stereotactic Injections
The lentiviral vectors GFAP-GFP,GFAP-Sox2,GFAP-GFP-T2A-Tlx,
and GFAP-Ascl1 were generated as previously described (Niu
et al., 2013). Under the guidance of a stereotactic apparatus
(Stoelting), a total volume of 2 ml purified virus, each with a titer
of 0.5–1 310
9
colony-forming units per 1 ml, was injected
into the striatum of adult mice. The injection coordinates
follow: +1.0 mm (anterior-posterior), ±2 mm (medial-lateral),
and 3.0 mm (dorsal-ventral from the skull).
Statistical Analysis
Data are presented as mean ±SEM. Statistical analysis was per-
formed by a two-tailed unpaired Student’s t test. Any p value <
0.05 was considered significant.
SUPPLEMENTAL INFORMATION
Supplemental Information includes one figure and three tables
and can be found with this article online at http://dx.doi.org/10.
1016/j.stemcr.2015.09.015.
AUTHOR CONTRIBUTIONS
M.M.I. and C.-L.Z. conceived and designed the experiments.
M.M.I., D.K.S., W.N., S.F., and N.I. performed the experiments.
G.S. and Y.S. provided critical reagents and comments. M.M.I.,
D.K.S., and C.-L.Z. prepared the manuscript.
ACKNOWLEDGMENTS
We thank Hiro Tanda for assistance with preliminary experiments
and data collection, as well as other members of the C.-L.Z. labora-
tory for discussions and technical support. We are grateful to Jane
E. Johnson (The University of Texas Southwestern Medical Center)
and Li Cai (Rutgers University) for generously providing b-GP-LacZ
and b-GP-GFP plasmids, respectively. C-L.Z. is a W.W. Caruth, Jr.
Scholar in Biomedical Research. This work was supported by the
Welch Foundation Award (I-1724), the Ellison Medical Foundation
Award (AG-NS-0753-11), Texas Institute for Brain Injury and
Repair, the Decherd Foundation, and NIH grants (R01NS070981,
R01NS088095, R21NS093502, and DP2OD006484 to C.-L.Z.).
Received: May 28, 2015
Revised: September 16, 2015
Accepted: September 17, 2015
Published: October 22, 2015
REFERENCES
Alvarez-Buylla, A., and Temple, S. (1998). Stem cells in the devel-
oping and adult nervous system. J. Neurobiol. 36, 105–110.
Armstrong, R.C., Kim, J.G., and Hudson, L.D. (1995). Expression of
myelin transcription factor I (MyTI), a ‘‘zinc-finger’’ DNA-binding
protein, in developing oligodendrocytes. Glia 14, 303–321.
Armstrong, R.C., Migneault, A., Shegog, M.L., Kim, J.G., Hudson,
L.D., and Hessler, R.B. (1997). High-grade human brain tumors
exhibit increased expression of myelin transcription factor 1
(MYT1), a zinc finger DNA-binding protein. J. Neuropathol. Exp.
Neurol. 56, 772–781.
Avilion, A.A., Nicolis, S.K., Pevny, L.H., Perez, L., Vivian, N., and
Lovell-Badge, R. (2003). Multipotent cell lineages in early mouse
development depend on SOX2 function. Genes Dev. 17, 126–140.
Bellefroid, E.J., Bourguignon, C., Hollemann, T., Ma, Q., Anderson,
D.J., Kintner, C., and Pieler, T. (1996). X-MyT1, a Xenopus C2HC-
type zinc finger protein with a regulatory function in neuronal
differentiation. Cell 87, 1191–1202.
Boutin, C., Diestel, S., Desoeuvre, A., Tiveron, M.C., and Cremer,
H. (2008). Efficient in vivo electroporation of the postnatal rodent
forebrain. PLoS ONE 3, e1883.
Cartharius, K., Frech, K., Grote, K., Klocke, B., Haltmeier, M., Klin-
genhoff, A., Frisch, M., Bayerlein, M., and Werner, T. (2005). Mat-
Inspector and beyond: promoter analysis based on transcription
factor binding sites. Bioinformatics 21, 2933–2942.
Catena, R., Tiveron, C., Ronchi, A., Porta, S., Ferri, A., Tatangelo, L.,
Cavallaro, M., Favaro, R., Ottolenghi, S., Reinbold, R., et al. (2004).
Conserved POU binding DNA sites in the Sox2 upstream enhancer
regulate gene expression in embryonic and neural stem cells.
J. Biol. Chem. 279, 41846–41857.
Gage, F.H. (2000). Mammalian neural stem cells. Science 287,
1433–1438.
Graham, V., Khudyakov, J., Ellis, P., and Pevny, L. (2003). SOX2func-
tions to maintain neural progenitor identity. Neuron 39, 749–765.
Green, H.F., and Nolan, Y.M. (2012). Unlocking mechanisms in
interleukin-1b-induced changes in hippocampal neurogenesis–a
role for GSK-3band TLX. Transl. Psychiatry 2, e194.
Heinrich, C., Bergami, M., Gasco
´n, S., Lepier, A., Vigano
`, F., Dimou,
L., Sutor, B., Berninger, B., and Go
¨tz, M. (2014). Sox2-mediated
conversion of NG2 glia into induced neurons in the injured adult
cerebral cortex. Stem Cell Reports 3, 1000–1014.
Hollemann, T., Bellefroid, E., and Pieler, T. (1998). The Xenopus
homologue of the Drosophila gene tailless has a function in early
eye development. Development 125, 2425–2432.
Islam, M.M., and Zhang, C.L. (2015). TLX: A master regulator
for neural stem cell maintenance and neurogenesis. Biochim.
Biophys. Acta 1849, 210–216.
Kim, J.G., Armstrong, R.C., v Agoston, D., Robinsky, A., Wiese, C.,
Nagle, J., and Hudson, L.D. (1997). Myelin transcription factor 1
(Myt1) of the oligodendrocyte lineage, along with a closely related
CCHC zinc finger, is expressed in developing neurons in the
mammalian central nervous system. J. Neurosci. Res. 50, 272–290.
Kitambi, S.S., and Hauptmann, G. (2007). The zebrafish orphan
nuclear receptor genes nr2e1 and nr2e3 are expressed in devel-
oping eye and forebrain. Gene Expr. Patterns 7, 521–528.
Koo, J.W., and Duman, R.S. (2008). IL-1beta is an essential medi-
ator of the antineurogenic and anhedonic effects of stress. Proc.
Natl. Acad. Sci. USA 105, 751–756.
Li, W., Sun, G., Yang, S., Qu, Q., Nakashima, K., and Shi, Y. (2008).
Nuclear receptor TLX regulates cell cycle progression in neural
stem cells of the developing brain. Mol. Endocrinol. 22, 56–64.
814 Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors

Liu, H.K., Belz, T., Bock, D., Takacs, A., Wu, H., Lichter, P., Chai, M.,
and Schu
¨tz, G. (2008). The nuclear receptor tailless is required for
neurogenesis in the adult subventricular zone. Genes Dev. 22,
2473–2478.
Lorthongpanich, C., Yang, S.H., Piotrowska-Nitsche, K., Parnpai,
R., and Chan, A.W. (2008). Development of single mouse blasto-
meres into blastocysts, outgrowths and the establishment of em-
bryonic stem cells. Reproduction 135, 805–813.
Masui, S., Nakatake, Y., Toyooka, Y., Shimosato, D., Yagi, R.,
Takahashi, K., Okochi, H., Okuda, A., Matoba, R., Sharov, A.A.,
et al. (2007). Pluripotency governed by Sox2 via regulation of
Oct3/4 expression in mouse embryonic stem cells. Nat. Cell Biol.
9, 625–635.
Matsushita, F., Kameyama, T., Kadokawa, Y., and Marunouchi, T.
(2014). Spatiotemporal expression pattern of Myt/NZF family
zinc finger transcription factors during mouse nervous system
development. Dev. Dyn. 243, 588–600.
McKay, R. (1997). Stem cells in the central nervous system. Science
276, 66–71.
Monaghan, A.P., Grau, E., Bock, D., and Schu
¨tz, G. (1995). The
mouse homolog of the orphan nuclear receptor tailless is expressed
in the developing forebrain. Development 121, 839–853.
Monaghan, A.P., Bock, D., Gass, P., Schwa
¨ger, A., Wolfer, D.P., Lipp,
H.P., and Schu
¨tz, G. (1997). Defective limbic system in mice lack-
ing the tailless gene. Nature 390, 515–517.
Niu, W., Zou, Y., Shen, C., and Zhang, C.L. (2011). Activation
of postnatal neural stem cells requires nuclear receptor TLX.
J. Neurosci. 31, 13816–13828.
Niu, W., Zang, T., Zou, Y., Fang, S., Smith, D.K., Bachoo, R., and
Zhang, C.L. (2013). In vivo reprogramming of astrocytes to neuro-
blasts in the adult brain. Nat. Cell Biol. 15, 1164–1175.
Niu, W., Zang, T., Smith, D.K., Vue, T.Y., Zou, Y., Bachoo, R.,
Johnson, J.E., and Zhang, C.-L. (2015). SOX2 reprograms resident
astrocytes into neural progenitors in the adult brain. Stem Cell
Reports 4, 780–794.
Pevny, L.H., and Nicolis, S.K. (2010). Sox2 roles in neural stem
cells. Int. J. Biochem. Cell Biol. 42, 421–424.
Rao, M.S. (1999). Multipotent and restricted precursors in the
central nervous system. Anat. Rec. 257, 137–148.
Rossant, J. (2004). Lineage development and polar asymmetries
in the peri-implantation mouse blastocyst. Semin. Cell Dev. Biol.
15, 573–581.
Roy, K., Kuznicki, K., Wu, Q., Sun, Z., Bock, D., Schutz, G., Vranich,
N., and Monaghan, A.P. (2004). The Tlx gene regulates the timing
of neurogenesis in the cortex. J. Neurosci. 24, 8333–8345.
Sarkar, A., and Hochedlinger, K. (2013). The sox family of tran-
scription factors: versatile regulators of stem and progenitor cell
fate. Cell Stem Cell 12, 15–30.
Shi, Y., Chichung Lie, D., Taupin, P., Nakashima, K., Ray, J., Yu, R.T.,
Gage, F.H., and Evans, R.M. (2004). Expression and function of
orphan nuclear receptor TLX in adult neural stem cells. Nature
427, 78–83.
Shi, Y., Sun, G., Zhao, C., and Stewart, R. (2008). Neural stem cell
self-renewal. Crit. Rev. Oncol. Hematol. 65, 43–53.
Shimozaki, K., Zhang, C.L., Suh, H., Denli, A.M., Evans, R.M., and
Gage, F.H. (2012). SRY-box-containing gene 2 regulation of nuclear
receptor tailless (Tlx) transcription in adult neural stem cells.
J. Biol. Chem. 287, 5969–5978.
Su, Z., Niu, W., Liu, M.L., Zou, Y., and Zhang, C.L. (2014). In vivo
conversion of astrocytes to neurons in the injured adult spinal
cord. Nat. Commun. 5, 3338.
Suh, H., Consiglio, A., Ray, J., Sawai, T., D’Amour, K.A., and Gage,
F.H. (2007). In vivo fate analysis reveals the multipotent and self-
renewal capacities of Sox2+ neural stem cells in the adult hippo-
campus. Cell Stem Cell 1, 515–528.
Sun, G., Yu, R.T., Evans, R.M., and Shi, Y. (2007). Orphan nuclear
receptor TLX recruits histone deacetylases to repress transcription
and regulate neural stem cell proliferation. Proc. Natl. Acad. Sci.
USA 104, 15282–15287.
Sun, G., Alzayady, K., Stewart, R., Ye, P., Yang, S., Li, W., and Shi, Y.
(2010). Histone demethylase LSD1 regulates neural stem cell pro-
liferation. Mol. Cell. Biol. 30, 1997–2005.
Sun, G., Ye,P., Murai, K., Lang, M.F., Li, S., Zhang, H., Li, W., Fu, C.,
Yin, J., Wang, A., et al. (2011). miR-137 forms a regulatory loop
with nuclear receptor TLX and LSD1 in neural stem cells. Nat.
Commun. 2, 529.
Wang, Y., Liu, H.K., and Schu
¨tz, G. (2013). Role of the nuclear re-
ceptor Tailless in adult neural stem cells. Mech. Dev. 130, 388–390.
Weiss, S., and van der Kooy, D. (1998). CNS stem cells: where’s the
biology (a.k.a. beef)? J. Neurobiol. 36, 307–314.
Yokoyama, A., Takezawa, S., Schu
¨le, R., Kitagawa, H., and Kato, S.
(2008). Transrepressive function of TLX requires the histone deme-
thylase LSD1. Mol. Cell. Biol. 28, 3995–4003.
Yu, R.T., McKeown, M., Evans, R.M., and Umesono, K. (1994).
Relationship between Drosophila gap gene tailless and a vertebrate
nuclear receptor Tlx. Nature 370, 375–379.
Yu, R.T., Chiang, M.Y., Tanabe, T., Kobayashi, M., Yasuda, K.,
Evans, R.M., and Umesono, K. (2000). The orphan nuclear receptor
Tlx regulates Pax2 and is essential for vision. Proc. Natl. Acad. Sci.
USA 97, 2621–2625.
Zhang, C.L., Zou, Y., Yu, R.T., Gage, F.H., and Evans, R.M. (2006).
Nuclear receptor TLX prevents retinal dystrophy and recruits the
corepressor atrophin1. Genes Dev. 20, 1308–1320.
Zhang, C.L., Zou, Y., He, W., Gage, F.H., and Evans, R.M. (2008). A
role for adult TLX-positive neural stem cells in learning and behav-
iour. Nature 451, 1004–1007.
Zhao, C., Sun, G., Li, S., and Shi, Y. (2009). A feedback regulatory
loop involving microRNA-9 and nuclear receptor TLX in neural
stem cell fate determination. Nat. Struct. Mol. Biol. 16, 365–371.
Zhao, C., Sun, G., Li, S., Lang, M.F., Yang, S., Li, W., and Shi, Y.
(2010). MicroRNA let-7b regulates neural stem cell proliferation
and differentiation by targeting nuclear receptor TLX signaling.
Proc. Natl. Acad. Sci. USA 107, 1876–1881.
Zhuo, L., Theis, M., Alvarez-Maya, I., Brenner, M., Willecke, K., and
Messing, A. (2001). hGFAP-cre transgenic mice for manipulation of
glial and neuronal function in vivo. Genesis 31, 85–94.
Stem Cell Reports jVol. 5 j805–815 jNovember 10, 2015 jª2015 The Authors 815

Stem Cell Reports, Volume 5
Supplemental Information
Enhancer Analysis Unveils Genetic Interactions between
TLX and SOX2 in Neural Stem Cells and In Vivo
Reprogramming
Mohammed M. Islam, Derek K. Smith, Wenze Niu, Sanhua Fang, Nida Iqbal, Guoqiang
Sun, Yanhong Shi, and Chun-Li Zhang

Control vector CMV promoter-LacZ Enh1.1-LacZ
NSCs
NIH3T3
COS7
HELA
LacZ
AB
Figure S1. A Cell-Based Assay for Enhancer Activity in Neural Stem Cells, Related to Figure 1.
(A) Genomic fragments with putative enhancers were cloned into a LacZ reporter for cell-based assays.
(B) Enhancer activity was examined in the indicated cell types. An empty vector and a LacZ reporte
r
under the constitutively active CMV promoter were used as negative and positive controls for β-
galactosidase assay, respectively. The identified Enh1.1 Tlx enhancer is active in neural stem cells
(NSCs) but not the other cell types. The scale bar represents 50 μm.

Table S1: Mouse Genomic DNA Sequences for the Putative E1.1 and E1.1-Derivative Tlx
Enhancer Elements, Related to Figure 2.
Element DNA sequence
Enh1.1 5-GGGGAGGGAAAGAAAACCCGGGTGCTGGGCGTCCGCGAAGCGGAG
CCCTGGACCGCCGGCTCGCCGGCCCATTTAACAGATGCGTAAAAGCGC
AGCGCGGACTTGGGCCACTAGCCGCGGGTGAGCGGGAGTCCCGGGTG
GGGCGGCGAGTCCTGGCCTGGGGGGCCCAACCTTCAGACCGGTGGCTT
TTTGCTTCCTTCCCGAAGGTCGCTGCTGACAAATCTATCTATTTGGGGC
AAATTGTCAGTGAGAAACTTCCGCTCGAACTGCGCTGGACAAAACCCG
CTGTTTGAAAAGGGAAAATCCCGCGGCCGGCGCGGCCGAACAATGCC
GCGGGCTGAGCGCCGGGGGCGGCGCGGGCCGCACAAAGGGCGGATTA
ATTGGGGCCGCGGCGGAGCGCAGCGCTCCAGCCCCACTCAGCCCGCGC
CGCGGGGCGCCCCATTGACTGGGCCCCGAGCCCCACTTTTCACAAACT
CCAAACAAAAGTCAATTTCTTTTTTATAAGGCGGGGGAGGGGGAGGCC
GCCGAGACTCTCCACCCGCTTCTCTCCTGTGCTCTTGCTTTGGGGGTGG
GAGGATTCGG-3
Enh1.1.1 5-GGGGAGGGAAAGAAAACCCGGGTGCTGGGCGTCCGCGAAGCGGAG
CCCTGGACCGCCGGCTCGCCGGCCCATTTAACAGATGCGTAAAAGCGC
AGCGCGGACTTGGGCCACTAGCCG-3
Enh1.1.2 5-GACTTGGGCCACTAGCCGCGGGTGAGCGGGAGTCCCGGGTGGGGCG
GCGAGTCCTGGCCTGGGGGGCCCAACCTTCAGACCGGTGGCTTTTTGC
TTCCTTCCCGAAGGTCGCTGCTGACAA-3
Enh1.1.3 5-CCCGAAGGTCGCTGCTGACAAATCTATCTATTTGGGGCAAATTGTCA
GTGAGAAACTTCCGCTCGAACTGCGCTGGACAAAACCCGCTGTTTGAA
AAGGGAAAATCCCGCGGCCGGCG-3
Enh1.1.4 5-GAAAATCCCGCGGCCGGCGCGGCCGAACAATGCCGCGGGCTGAGCG
CCGGGGGCGGCGCGGGCCGCACAAAGGGCGGATTAATTGGGGCCGCG
GCGGAGCGCAGCGCTCCAGCCCCACTCA-3
Enh1.1.5 5-CGCAGCGCTCCAGCCCCACTCAGCCCGCGCCGCGGGGCGCCCCATT
GACTGGGCCCCGAGCCCCACTTTTCACAAACTCCAAACAAAAGTCAAT
TTCTTTTTTATAAGGCGGGGGA-3
Enh1.1.6 5-CCCCACTTTTCACAAACTCCAAACAAAAGTCAATTTCTTTTTTATAA
GGCGGGGGAGGGGGAGGCCGCCGAGACTCTCCACCCGCTTCTCTCCTG
TGCTCTTGCTTTGGGGGTGGGAGGATTCGG-3

Table S2: Quantitative Real-Time PCR Primers Used to Validate ChIP Enrichment, Related to
Figure 3.
Target Primer sequence
Enh1.1.3 (sense) 5-CTTCAGACCGGTGGCTTTTTGC-3
Enh1.1.3 (antisense) 5-CTCAGCCCGCGGCATTGTTC-3
Table S3: shRNA Sequences Targeting Sox2 and Myt1, Related to Figure 4 and Figure 5.
Target shRNA sequence
Sox2-shRNA1 5-AGACGCTCATGAAGAAGGATAAGTACACG-3
Sox2-shRNA2 5-AGCTACGCGCACATGAACGGCTGGAGCAA-3
Sox2-shRNA3 5-CTCTGTGGTCAAGTCCGAGGCCAGCTCCA-3
Myt1-shRNA1 5-GAGAACAAGCTCATTGAGGAGCAGAATGA-3
Myt1-shRNA2 5-CGCCTTTAGCTGGCTTAGGAGTTCGCACA-3
Myt1-shRNA3 5-GTGGAGAAGCGTGAAATCAAGTGTCCGAC-3
Scrambled shRNA 5-GGAAGTAGACACTGTAGAC-3