ArticlePDF Available

Expression of Recombinant E1 Glycoprotein of Chikungunya Virus in Baculovirus Expression System

Authors:
JOBIMB, 2015, Vol 3, No 1, 26-29
- 26 -
Expression of Recombinant E1 Glycoprotein of Chikungunya Virus in
Baculovirus Expression System
Magdline Sia Henry Sum
1
*, Anna Andrew
2
, and Milda Aren Maling
1
1
Institute of Health and Community Medicine, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia.
2
Faculty of Medicine and Health Sciences, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia.
*Corresponding author:
Dr. Magdline Sia Henry Sum
Institute of Health and Community Medicine, Universiti Malaysia Sarawak,
94300 Kota Samarahan, Sarawak, Malaysia.
Email: shsmag@unimas.my
Tel: ++6 082-58 1000 ext. 5650
Fax No: +6 082-66 5289
INTRODUCTION
Chikungunya virus (CHIKV) is an arthropod-borne virus of the
Alphavirus genus and the family Togaviridae. It is transmitted
to humans by Aedes mosquitoes and the infection is often
characterized by sudden onset of fever, skin rash and arthralgia
that could persist for several months. In outbreaks that are more
recent however, CHIKV was also associated with severe
neurological disease and even fatalities [1]. Although was first
isolated in Tanzania in 1953 [2], CHIKV infection has only
received considerable attention in recent years with major
outbreaks in the Indian Ocean region, India, Southeast Asia and
especially with the explosive epidemics in Reunion Island from
2005-2006 [3]. The re-emergence of the CHIKV since then had
not only confined to the Asian region but had continued to
spread to the Western world including a first outbreak in Europe
reported in 2007 in Italy [4] and autochthonous transmission
events in France in 2010 [5]. Many factors had influent the
geographical spread of CHIKV, including vector distribution,
human travel, urbanization and climatic changes. The
introduction of the new strain from the epidemic on the Reunion
Islands with the mutation at codon 226 of the envelope protein
E1 from alanine to valine, too had contributed to the
unprecedented worldwide spread of CHIKV [6]. The CHIKV
genome consists of a linear, single-stranded positive sense RNA
of approximately 11.8 kb. The structural genes encode three
structural proteins, E1 and E2 of the envelope and the
nucleocapsid protein [7]. The envelope proteins formed triplets
of heterodimer of E1 and E2 glycoproteins, which cover the
viral surface in the form of membrane-anchored spikes. The
viral spike proteins facilitate attachment to cell surfaces and
viral entry into the cells [8]. E1 contains more conserved cross-
reactive epitopes whereas E2 is the site of neutralizing epitopes
[9].
Currently there is no effective antiviral treatment for
CHIKV infection. Therefore, reliable laboratory confirmation of
CHIKV infection is important for timely vector control.
Laboratory conformation is even more critical in dengue
endemic areas, as the clinical management is different for these
infections even though their manifestations can be similar.
Currently the gold standards of CHIKV diagnosis are virus
culture, and molecular detection using reverse transcriptase
polymerase chain reaction (RT-PCR) [10]. Both methods
require specialised equipment, facilities and skills, which are
limited and can be too costly for developing countries.
Diagnoses are also done by detecting the present of CHIKV
specific antibodies in patients by an enzyme immunoassay or
HISTORY
Received: 10
th
July 2015
Received in revised form: 21st of June 2015
Accepted: 15th of September 2015
ABSTRACT
Chikungunya is an acute febrile illness caused by chikungunya virus (CHIKV). In this study, the
envelope E1 gene of CHIKV was cloned and expressed in a baculovirus system. The
recombinant E1 protein with N-term 6-His residues protein was successfully expressed and
purified as confirmed by SDS-PAGE and western blot analysis. The seroreactivity of the
recombinant protein was evaluated in immunoassay for anti-CHIKV IgM and IgG antibodies.
The recombinant antigen showed 69% sensitivity and 100% specificity for anti-CHIKV IgG by
dot blot assay. Detection of anti-CHIKV IgM by dot assay showed 79% sensitivity and 100%
specificity. No cross reactivity of the antigen was observed with anti-dengue virus serum
samples. The results strongly support that the recombinant E1 protein has potential to be used as
diagnostic antigen. The used of the antigen in a dot blot assay gives an advantage for laboratory
detection without the need of any specialised equipment.
KEYWORDS
Chikungunya virus
E1 glycoprotein
baculovirus system
anti-CHIKV IgM
immunoassay
JOURNAL OF BIOCHEMISTRY, MICROBIOLOGY
AND BIOTECHNOLOGY
Website: http://journal.hibiscuspublisher.com/index.php/JOBIMB/index
JOBIMB, 2015, Vol 3, No 1, 26-29
- 27 -
immunofluorescence assay and conventionally followed by
confirmation by plaque reduction neutralization test [11].
However reported ELISAs use whole virus antigen in crude
form as a diagnostic reagent for CHIKV diagnosis [12]. This
imposed a problem since high risks factors are associated with
the preparation of the antigen therefore require high biosafety
level containment, which is not widely available especially in
laboratories of developing countries. An alternative way is to
use recombinant antigens to avoid any complications arises
from using whole virus antigen. In this study, our objective is to
produce recombinant antigen of CHIKV to be use as diagnostic
reagent and to develop a simple and robust, and equipment free
assay for detection of CHIKV specific antibodies. For this
purpose, the E1 gene of CHIKV was cloned and the protein was
expressed in the baculovirus expression system. The sero-
reactivity of the recombinant protein was evaluated as
diagnostic reagent for CHIKV infection in a simple and rapid
immuno-dot blot assay.
MATERIALS AND METHODS
Virus isolation, RNA extraction and RT-PCR
The clone was generated from a local CHIKV isolate named
B5. The virus was originally isolated in our laboratory from a
local outbreak of CHIKV in Sarawak in 2009 (unpublished
data). The virus was subsequently propagated in Vero cells,
which was maintained in Dulbecco’s Modified Eagle’s
Medium, DMEM , supplemented with 5% Fetal Calf Serum
(FCS), 100 U/ml Penicillin G and 100 µg/ml Streptomycin
Sulfate. Vero cells were maintained in a humidified incubator at
37
o
C supplemented with 5% CO
2
. The cells were infected upon
reaching 85% confluency and were harvested after 4 days.
Viral RNA was extracted using High Pure Viral Nucleic
Acid Kit (Roche) according to the manufacturer’s manual. The
RNA was subjected to reverse transcription PCR (RT-PCR).
The CHIKV E1 gene was amplified using the following primers
encoding the BssHII and HindIII restriction sites and 6 histidine
residues at the downstream primer: [(upstream primer) 5’-
GAGAGCGCGCATGGCCACATACCAAGAGGCTGCGAT
A3’;(downstream..primer)..5’GAGAAAGCTTTTAATGATG
ATGATGATGATGCGCCGTAGCGGAGATGTCCTGG-3’].
For this purpose 6 µ l of the extracted RNA was mixed with 1 µ l
(20 pmol/ µ l) of downstream primer for 10 minutes at 70
o
C and
immediately chilled on ice. A master mix containing 0.5 µ l of
10 mM dNTPS, 2.0 µl of 5X RT buffer and 0.5 µl (100U) M-
MLV RT (Fermentas) was added to the mixture followed by
incubation at 37
o
C for 1 hour and 70
o
C for 10 minutes. The
cDNA was then amplified in a 50 µ l PCR reaction [ 2 µl of
cDNA, 1.5 µ l of upstream primer (20 pmol/ µl), 1.5 µl of
downstream primer (20 pmol/ µl), 5.0 µl of 10X Taq buffer, 3
µl of 25 mM MgCl, 1.5 µl of 10 mM dNTPs, 1.0 µ l of Taq
DNA polymerase, 34.5 µ l sterile UHQ water ] at 94
o
C for 5
minutes followed by 35 cycles at 94
o
C for 20 seconds, 50
o
C for
30 seconds and 72
o
C for 2 minutes, with a final extension at
72
o
C for 5 minutes. The PCR products were analysed on a 1.0%
agarose gel electrophoresis.
Cloning of CHIKV E1 gene
The Bac-to-Bac Baculovirus Expression System (Invitrogen)
was used to generate the recombinant clone of the E1 gene. The
amplified PCR product was purified from agarose gel using
QIAquick gel extraction kit (Qiagen) according to the
manufacturer’s manual. The amplified CHIKV E1 gene was
digested with restriction enzymes prior to ligation into the
pFastBac Dual baculovirus vector (Invitrogen) at the BssHII
and HindIII sites. The ligated product was transformed into
Mach1
TM
-T1
R
E.coli competent cells, provided in the system.
Clones were screened by colony PCR using the following
primers:..[(upstream..primer)..5’TAACCATCTCGCAAATAA
ATAAGT..3’;(downstream..primer)..5’ATAAGCTGCAATAA
ACAAGT-3’] to select the recombinant plasmid in the correct
orientation. The plasmid DNA of the selected clones was
purified using PureLink Quick Miniprep Kit (Invitrogen). The
recombinant DNA was further verified by sequencing using
BigDye (Applied Biosystem) in conjunction with an automated
DNA sequencer (ABI PRISM 377).The purified donor plasmid
was then transformed into competent cells DH10Bac
TM
,
provided in the system to generate recombinant bacmid. The
recombinant bacmid was purified using Pure Link
TM
HiPure
Plasmid DNA purification kit (Invitrogen, Carlsbad, CA). The
quality and quantity of the purified bacmid DNA was measured
by Nanodrop 1000 spectrometer before it was used to generate
recombinant baculovirus.
Generation of recombinant baculovirus
Sf9 cells were transfected with the recombinant bacmid of
CHIKV E1 gene to generate recombinant baculovirus. The
liposome-mediated gene transfection was carried out using
Cellfectin II (Invitrogen). The infected cells were kept at 27
o
C,
harvested at 3 days post- infection, and subjected to one round
of amplification in Sf9 cells. After day 3 of the amplification the
cells were harvested and clarified by centrifugation at 500 x g
for 5 minutes. The clarified supernatant was tittered to achieve
the best MOI for the expression analysis of CHIKV E1
recombinant protein.
Expression and purification of recombinant CHIKV E1
protein
Sf9 cells were infected with the recombinant baculovirus at the
MOI of 10 and incubated at 27
o
C. The cells were harvested 3
days post-infection. The cells harvest was clarified by
centrifugation and the expression of secreted recombinant
protein was analysed by SDS-PAGE and western blot. The
recombinant protein was expressed as fusion to 6-Histidine
residues at the N-terminal which allows purification using
column for Ni2
+
affinity chromatography. The purified
recombinant protein was analysed by SDS-PAGE and western
blot analysis. The purified recombinant protein was heated in
reducing protein sample buffer and separated on 12% SDS-
PAGE with a constant voltage of 120 V with 1X running buffer
(25mM Tris, 192mM Glycine, 0.1% SDS pH8.3). The gels were
either stained with coomassie brilliant blue (CBB) or electro-
transferred onto a nitrocellulose membrane at constant mA 200
for 1 hour. At the end of the run, the membranes were blocked
with either 1X PBS containing 5% skimmed milk or 1% Bovine
serum albumin in 1X PBS for further incubation with serum or
Nickel HRP respectively.
Serum samples, plaque reduction neutralization test-50
(PRNT
50
)
The panel used in this study consists of 65 sera (42 positive and
20 negative/3 dengue positive sera) send to our laboratory for
confirmation of CHIKV. The serum was tested by RT-PCR and
PRNT
50
. PRNT
50
was done on all 65 sera selected for this study.
Vero cells were suspended at a density of 3 x 10
5
cells / ml and
0.5 ml was dispensed in each well of 24-well plates. Cells were
left to adhere overnight in a moist chamber in a 37
o
C incubator
supplemented with 5% CO
2
. Dilution of 1: 10 of all the test
samples were prepared and were subjected to heat inactivation
at 56
o
C for 30 minutes. An equal amount of the heat inactivated
samples were mixed with virus stock diluted to 350 pfu / ml and
were incubated at 37
o
C for 60 minutes. 200 µl of each of the
mixtures were added into the wells and incubated for 2 hours at
JOBIMB, 2015, Vol 3, No 1, 26-29
- 28 -
37
o
C before adding 0.8 ml semisolid overlay containing 1%
carboxy methylcellulose in growth medium supplemented with
3% fetal bovine serum. Cells monolayers were stained once the
plaques were visible by microscopy with naphthalene black for
20 minutes before rinsing off with water. Appropriate controls
were added in duplicate in each plate and the 50% plaque
reduction dilution was determined.
Immuno-dot blot assay
2 microgram of the purified protein was dotted on nitrocellulose
membrane. The membrane was blocked with 1 X PBS-SM for
30 minutes and rinsed off with RO water afterwards. The
membrane was left to dry at room temperature before used. In
the assay, serum was diluted at 1:200 for an overnight reaction.
Membrane was subjected to 3 round of washing with 1 X PBS
at 10 minutes interval. Afterwards the membrane was incubated
for 1 hour with human anti-IgM or IgG used at 1:2000 dilution.
Colour was developed using 4-CIN/H
2
0
2
substrate.
RESULTS
Cloning of complete CHIKV E1 gene
In this work, the complete E1 gene of CHIKV was amplified
using the primers listed in the methodology section with an
expected size of 1445 bp (Figure 1). The amplicon was verified
by sequencing prior to cloning into the BssHII and HindIII sites
of the pFASTBac Dual vector. Once a positive clone was
selected from the cloning host, the plasmid was purified and
further transformed into the selected competent cells to produce
recombinant bacmid DNA.
Figure 1. PCR-amplification of CHIKV E1 gene. CHIKV E1 gene was
amplified and electrophoresed in a 1.0% TBE agarose gel. M: Lambda
DNA/HindIII+EcoRI Marker, Lane 1; PCR product of CHIKV E1
protein gene (1445 bp), Lane 2; negative control.
Expression of recombinant CHIKV-E1 protein
The recombinant bacmid was transfected into insect cells, Sf9 to
express the E1 protein. The main advantage of the insect
expression system is its post-translational modifications and its
ability to expressed soluble protein in its active conformation.
In order to validate the expression of the E1 envelope protein of
CHIKV, the purified protein was analysed by SDS-PAGE and
western blot. The expressed protein was detectable on CBB
stained gel with an expected molecular weight of 52 kDa
(Figure 2). The expression of the recombinant fusion protein
was confirmed with the detection of the polyhistidine tag and
was shown to be reactive against positive CHIKV serum and no
reaction was detected with negative CHIKV serum (Figure 2).
The results clearly demonstrate the successful expression and
purification of the recombinant CHIKV E1 protein.
Figure 2. Analysis of expression of CHIKV E1 envelope protein in Sf9
cells. Lane 1; recombinant CHIKV E1 protein on CBB stained gel.
Western blot analysis with lane 2; nickel-HRP, lane 3; CHIKV positive
serum, lane 4; CHIKV negative serum.
Immuno-dot blot assay
The recombinant protein was tested in a dot blot assay against
pairs of known positive and negative CHIKV sera, and known
dengue positive sera. These sera were verified by RT-PCR and
PRNT50 prior to the dot blot assay. The result shows that the
recombinant E1 protein was able to detect the positive and
negative sera correctly and no cross-reactivity was seen with the
dengue positive sera (Figure 3).
Figure 3. Dot Blot assay for the detection of IgM antibody to CHIKV.
Results with (a,b) CHIKV positive sera; (c,d) with CHIKV negative
sera; (e,f) with pooled dengue positive sera (5-6).
To further investigate the potential of the CHIKV E1 as
alternative antigen, a panel of 65 sera was tested in the CHIKV
E1 dot blot assay. All these sera were tested for the presence of
neutralizing antibody by PRNT
50
prior to the CHIKV E1 dot
blot assay. The agreement between the two assays were
compared to measure the sensitivity and specificity of the
CHIKV E1 assay (Table 1). Based on the standard PRNT
50
assay, out of the 65 sera tested 42 had neutralizing antibody to
CHIKV and 23 sera were negative for CHIKV which include 3
that were known to be dengue positive. All the 23 negative sera
tested by PRNT
50
were also tested negative by both the CHIKV
E1 IgG and IgM assay. However, not all the 42 positive sera
tested by PRNT
50
were tested positive by the CHIKV E1 assay
with 69% and 79% for the IgG assay and IgM assay
respectively.
Table 1. Agreement of the CHIKV E1 dot blot assay to neutralization
assay (PRNT
50
).
neutralization
assay
Total Sensitivit
y (%)
Specificity
(%)
positive negative
CHIKV E1
IgG dot
blot assay
positive 29 0 29 69% 100%
negative
13 23 36
CHIKV E1
IgM dot
blot assay
positive 33 0 33 79% 100%
negative
9 23 32
JOBIMB, 2015, Vol 3, No 1, 26-29
- 29 -
DISCUSSION
In this study, the complete CHIKV E1 gene of 1445 bp was
successfully cloned into a baculovirus vector and the fusion
protein of CHIKV E1 and polyhistidine tag of 52 kDa was
expressed in Sf9, insect cells. Here we report that the expressed
protein that accumulated in the cell culture supernatant was
purified, and the protein was recognized by anti-sera to CHIKV.
Furthermore, no cross-reactivity was shown against dengue
positive sera. This is critical especially in regions where both
dengue and chikungunya are endemics, it is important to be able
to diagnostically differentiate the two diseases. This is because
the two illnesses can be mistakenly diagnose due to the
similarity in their clinical symptoms [13]. The ability to
distinguish the two infections is important to launch different
control strategies. This report also described the use of the
CHIKV E1 recombinant protein as antigen in an immuno-dot
blot assay. The results of the immuno-dot blot assay showed
high specificity (100%) and sensitivity (70%) of the CHIKV E1
assay. Although the assay is not as sensitive, this is in line with
other study on ELISA and immunodetection assays that report
poor sensitivity and specificity, which is mostly due to the cross
reactivity of CHIKV with other related viruses [14]. In
conclusion, we have cloned, expressed, purified and evaluate
the potential of recombinant CHIKV E1 as antigen in
serological assay. Given the simplicity of the assay and the high
specificity and the relatively high sensitivity, the CHIKV E1
immuno-dot blot assay could be useful to be developed as
diagnostics method for CHIKV detection.
ACKNOWLEDGEMENT
This work was funded by short term grant,
RAGS/d(2)/918/2012(19) and supported by Universiti Malaysia
Sarawak.
List of abbreviations
bp base pair
CHIKV chikungunya virus
CBB coomassie brilliant blue
ELISA enzyme-linked immunosorbent assay
HRP horseradish peroxidase
IgM Immunoglobulin M
IgG Immunoglobulin G
kDa kilo Dalton
MOI multiplicity of infection
PBS phosphate buffer saline
PBS-SM phosphate buffer saline-skimmed milk
PRNT plaque reduction neutralizing test
SDS-PAGE sodium dodecyl sulphate polyacrylamide gel
electrophoresis
REFERENCES
[1] Sam IC, Kamarulzaman A, Ong GS, Veriah RS, Ponnampalavanar
S, Chan YF, AbuBakar S. Chikungunya virus-associated death in
Malaysia. Trop Biomed. 2010; 27(2): 343-347
[2] Ross RW. The Newala epidemic. III. The virus: isolation,
pathogenic properties and relationship to the epidemic. J Hyg
(Lond). 1956; 54(2): 177-191.
[3] Renault P, Solet JL, Sissoko D, Balleydier E, Larrieu S, Filleul L,
et al. A major epidemic of Chikungunya virus infection on
Reunion Island, France, 2005-2006. Am J Trop Med Hyg. 2007;
77(4): 727-731.
[4] Lines, J. Chikungunya in Italy. BMJ. 2007; 335(7620): 576.
[5] Gould E, Gallian P, De Lamballerie X, Charrel R. First cases of
autochthonous dengue fever and chikungunya fever in France:
from bad dream to reality! Clin Microbiol Infect. 2010; 12: 1702-
1704.
[6] Tsetkarkin KA, Vanlandingham DL, McGee CE, Higgs S. (2007).
A single mutation in chikungunya virus affects vector specificity
and epidemic potential. PLoS Pathogen. 2007: 3(12): 1895-1906.
[7] Strauss EG, Stec DS, Schmaljohn AL, Strauss JH. Identification
of antigenically important domains in the glycoproteins of Sindbis
virus by analysis of antibody escape variants. J Virol. 1991;
65(9):4654-64.
[8] Voss JE, Vaney MC, Duquerroy S, Vonrhein C, Girard-Blanc C,
Crublet E, et al. Glycoprotein organization of Chikungunya virus
particles revealed by X-ray crystallography. Nature. 2010;
468(7324): 709-12.
[9] Mukhopadhyay S, Zhang W, Gabler S, Chipman PR, Strauss EG,
Strauss JH, et al. Mapping the structure and function of the E1 and
E2 glycoproteins in alphaviruses. Structure. 2006; 14(1): 63-73.
[10] Edwards CJ, Welch SR, Chamberlain J, Hewson R, Tolley H,
Cane PA, et al. Molecular diagnosis and analysis of chikungunya
virus. J Clin Virol. 2007; 39: 271-275.
[11] Karabatsos N. Antigenic relationships of group A arboviruses by
plaque reduction neutralization testing. Am J Trop Med Hyg.
1975; 24: 527-532.
[12] Hundekar SL, Thakare JP, Gokhale MD, Barde PV, Argade SV,
Mourya DT. Development of monoclonal antibody based antigen
capture ELISA to detect chikungunya virus antigen in mosquitoes.
Indian J Med Res. 2002; 115:144-8
[13] Halstead SB. Reappearance of chikungunya, formerly called
dengue, in the Americas. Emerg Infect Dis. 2015; 21(4): 557-561.
[14] Greiser-Wilke IM, Moenning V, Kaaden OR, Shope RE.
Detection of alphaviruses in a genus-specific antigen capture
enzyme immunoassay using monoclonal antibodies. J Clin
Microbiol. 1991; 29: 131-137.
... The domain III region was cloned into a commercially available pET-SUMO vector (Invitrogen) and was expressed as fusion protein with polyhistidine in E. coli cells, BL21-DE3 with isopropyl-B-D thiogalactopyranoside (IPTG) induction. The JEV was purified using a Ni 2+ chelating chromatographic column under denaturing condition and then dialyzed into phosphate buffer saline [20,21]. ...
... A mouse monoclonal antibody (Clone ID: MV12/1/C2-2/1), specific to JEV was originally provided by Venture Technology, Penang, Malaysia [20,21], and treated with ethyl(dimethylaminopropyl) carbodiimide (EDC) and N-hydroxysuccinimide (NHS) for activation. 200 L each of ethyl(dimethylaminopropyl) carbodiimide (EDC, 0.2 M) and N-hydroxysuccinimide (NHS, 0.05 M) were added to 200 L of JEV antibody (10.0 M) to activate its carboxyl groups by allowing them to react for 1 hour at 4 ∘ C. The activated JEV antibody was then added onto the surfaces of CNPs at room temperature and then incubated for 24 hours to immobilize the JEV antibody on CNPs surfaces by allowing the formation of amide bonds between amino groups on CNPs surface and activated carboxyl groups on the JEV antibody. ...
Article
Full-text available
We reported a disposable and sensitive electrochemical biosensor strip based on carbon nanoparticles modified screen-printed carbon electrode (SPCE) for rapid and sensitive detection of Japanese Encephalitis Virus (JEV). Amino group functionalized carbon nanoparticles were prepared from preformed chitosan nanoparticles. Japanese Encephalitis Virus (JEV) antibody was immobilized onto the surfaces of carbon nanoparticles through amide bonds formation between amino groups of carbon nanoparticles and carboxylic groups of JEV antibody. The analytical performance of SPCE electrochemical biosensor strip was characterized using cyclic voltammetry (CV) and electrochemical impedance spectroscopy (EIS). SPCE electrochemical biosensor strip exhibited a linear detection range of 1–20 ngmL ⁻¹ with a low detection limit of 0.36 ngmL ⁻¹ (at S/N = 3) for JEV, detection sensitivity was 0.024 ngmL ⁻¹ for JEV, and analysis results were obtainable within 10 minutes. The potential clinical application of this SPCE electrochemical biosensor strip was demonstrated by the detection of JEV in human serum.
Article
Full-text available
After an absence of ≈200 years, chikungunya returned to the American tropics in 2013. The virus is maintained in a complex African zoonotic cycle but escapes into an urban cycle at 40- to 50-year intervals, causing global pandemics. In 1823, classical chikungunya, a viral exanthem in humans, occurred on Zanzibar, and in 1827, it arrived in the Caribbean and spread to North and South America. In Zanzibar, the disease was known as kidenga pepo, Swahili for a sudden cramp-like seizure caused by an evil spirit; in Cuba, it was known as dengue, a Spanish homonym of denga. During the eighteenth century, dengue (present-day chikungunya) was distinguished from breakbone fever (present-day dengue), another febrile exanthem. In the twentieth century, experiments resulted in the recovery and naming of present-day dengue viruses. In 1952, chikungunya virus was recovered during an outbreak in Tanzania, but by then, the virus had lost its original name to present-day dengue viruses.
Article
Chikungunya virus (CHIKV) is an emerging mosquito-borne alphavirus that has caused widespread outbreaks of debilitating human disease in the past five years. CHIKV invasion of susceptible cells is mediated by two viral glycoproteins, E1 and E2, which carry the main antigenic determinants and form an icosahedral shell at the virion surface. Glycoprotein E2, derived from furin cleavage of the p62 precursor into E3 and E2, is responsible for receptor binding, and E1 for membrane fusion. In the context of a concerted multidisciplinary effort to understand the biology of CHIKV, here we report the crystal structures of the precursor p62-E1 heterodimer and of the mature E3-E2-E1 glycoprotein complexes. The resulting atomic models allow the synthesis of a wealth of genetic, biochemical, immunological and electron microscopy data accumulated over the years on alphaviruses in general. This combination yields a detailed picture of the functional architecture of the 25 MDa alphavirus surface glycoprotein shell. Together with the accompanying report on the structure of the Sindbis virus E2-E1 heterodimer at acidic pH (ref. 3), this work also provides new insight into the acid-triggered conformational change on the virus particle and its inbuilt inhibition mechanism in the immature complex.
Article
Chikungunya virus (CHIKV) is a mosquito-borne alphavirus which causes fever, rash, and arthralgia. In the past, life-threatening complications were very rarely reported. However, during the recent worldwide outbreaks, there have been several reports of unusually severe complications and deaths. Malaysia is experiencing a nationwide outbreak of CHIKV, with over 10 000 patients affected since April 2008. We report the first case of culture-confirmed CHIKV-associated death in Malaysia, in a patient with fever, rash, acute exacerbation of pre-existing heart failure, rhabdomyolysis, and multiple organ failure. CHIKV infections may cause atypical, severe or fatal presentations.
Article
Antigenic relationships of 20 group A arboviruses were assessed by the plaque reduction neutralization test, using highly specific hyperimmune mouse ascitic fluids and antisera. The existence of three complexes of group A viruses was verified. With rare exceptions, heterologous neutralization reactions were observed only among viruses in the same complex; however there were at least one or two immune reagents in each complex which were broadly cross-reactive within that complex.
Article
To study important epitopes on glycoprotein E2 of Sindbis virus, eight variants selected to be singly or multiply resistant to six neutralizing monoclonal antibodies reactive against E2, as well as four revertants which had regained sensitivity to neutralization, were sequenced throughout the E2 region. To study antigenic determinants in glycoprotein E1, four variants selected for resistance to a neutralizing monoclonal antibody reactive with E1 were sequenced throughout the E2 and E1 regions. All of the salient changes in E2 occurred within a relatively small region between amino acids 181 and 216, a domain that encompasses a glycosylation site at residue 196 and that is rich in charged amino acids. Almost all variants had a change in charge, suggesting that the charged nature of this domain is important for interaction with antibodies. Variants independently isolated for resistance to the same antibody were usually altered in the same amino acid, and reversion to sensitivity occurred at the sites of the original mutations, but did not always restore the parental amino acid. The characteristics of this region suggest that this domain is found on the surface of E2 and constitutes a prominent antigenic domain that interacts directly with neutralizing antibodies. Previous studies have shown that this domain is also important for penetration of cells and for virulence of the virus. Resistance to the single E1-specific neutralizing monoclonal antibody resulted from changes of Gly-132 of E1 to either Arg or Glu. Analogous to the findings with E2, these changes result in a change in charge and are found near a glycosylation site at residue 139. This domain of E1 may therefore be found near the 181 to 216 domain of E2 on the surface of the E1-E2 heterodimer; together, they could form a domain important in virus penetration and neutralization.
Article
A genus-specific antigen capture assay using similar combinations of monoclonal antibodies for capture and detection of 24 alphaviruses belonging to the seven serocomplexes was developed. The sensitivity of the test ranged from 10(3.4) 50% tissue culture infective doses/ml for o'nyong-nyong virus to 10(6.1) 50% tissue culture infective doses/ml for Middelburg virus. The antigen capture test uses a combination of cross-reacting monoclonal antibodies directed against the nucleocapsid protein and envelope glycoprotein E1 of Semliki Forest virus.
Article
Chikungunya (CHIK) virus has caused numerous large outbreaks in India. No active or passive surveillance has been carried out since the last epidemic which occurred in 1971. For active surveillance, it is necessary to have a test, which can detect the virus from a large number of field-collected mosquitoes. The present study describes the standardization of monoclonal antibody (MAb) based antigen capture ELISA to detect chikungunya virus antigen from the mosquitoes. CHIK virus antigen from suspension of experimentally infected mosquitoes and their progeny was captured on mouse polyclonal antibody, while biotinylated CHIK Mab was used as a probing antibody. CHIK virus antigen in the head squashes of virus inoculated mosquitoes was detected using indirect immunofluorescence antibody (IFA) test for confirmation of ELISA results. The ELISA test was sensitive enough to detect antigen even if a small fraction of a single infected mosquito homogenate was incorporated in the test. The IFA test failed to detect CHIK antigen in 10 and 25 microliters of suspension whereas with ELISA it was detected in all the samples. Progeny of Aedes aegypti and Ae. albopictus mosquitoes infected with chikungunya virus did not show the possibility of existence of transovarial transmission. This test is rapid and simple since it can be completed in two days as compared to the conventional mosquito inoculation and IFA techniques, which require at least 10 days. There is an additional advantage with this test that a large number of samples can be processed, and the remaining homogenate of the mosquitoes can be used for screening other viruses. Experimental data raised using this test showed that transovarial transmission of this virus does not occur in these vector species.
Article
This report on a large outbreak of disease, known locally as ‘Chikungunya’, in the Newala district of Tanganyika concerns the circumstances of isolation of strains of virus, some of their properties, and their relation to the epidemic. The work, reported here, started in Newala from 18 February to 10 March, 1953, and continued thereafter in Entebbe.
Article
The 9 A resolution cryo-electron microscopy map of Sindbis virus presented here provides structural information on the polypeptide topology of the E2 protein, on the interactions between the E1 and E2 glycoproteins in the formation of a heterodimer, on the difference in conformation of the two types of trimeric spikes, on the interaction between the transmembrane helices of the E1 and E2 proteins, and on the conformational changes that occur when fusing with a host cell. The positions of various markers on the E2 protein established the approximate topology of the E2 structure. The largest conformational differences between the icosahedral surface spikes at icosahedral 3-fold and quasi-3-fold positions are associated with the monomers closest to the 5-fold axes. The long E2 monomers, containing the cell receptor recognition motif at their extremities, are shown to rotate by about 180 degrees and to move away from the center of the spikes during fusion.