ArticlePDF Available

Evaluation of the anti-Candida effect of Garlic, Shallot and Onion to inhibit the quorum sensing activity

Authors:

Abstract and Figures

Recently, the incidence of systemic candidiasis which is caused by Candida albicans has been increased. Usually, for treatment of systemic fungal infections, azoles such as fluconazole are used. Despite of this, overuse of drugs has caused an extra increasing of the drugs resistance. One of the best strategies to decrease the resistance phenomenon is finding the new derivatives originated from plants instead of chemical antifungals. In the present study the potential of Garlic, Shallot and Onion for growth inhibition of Candida albicans were evaluated by use of inhibition zone termination (Disk Diffusion Agar test) and relative MIC (Broth Microdilution test). Time kill study was also erformed to indicate the rate of anti-Candida activity of plant-extracts tested in different time intervals. Finally, the expression of selected gene involved in Quorum Sensing such as TUP1 was evaluated by semi-quantitative RT-PCR. The result have shown significant in vitro potential of those plants to inhibit Candida albicans growth, which is need further investigations to find its main mechanisms. In addition, the extracts were not able to demonstrate their ability to significant decrease of the selected gene expression. Therefore, further investigation will be needed to find the probable targets of garlic, onion and shallot on the Quorum Sensing phenomenon of C. albicans.
TUP1 and beta-actin gene expression Candida albicans ATCC 10231 at concentrations of 2 MIC, MIC, ½ MIC onion extract. DISCUSSION Medicinal, insecticidal, anti-bacterial and anti-fungal properties have been attributed to plant extract. In addition, interest in plant extract as an anti-fungal agent has been renewed recently. Plant extract was demonstrated to be fungicidal against pathogenic yeasts, especially C. albicans. Various studies have proved that due to dermatophytes resistance to chemical drugs and their effects, herbal extracts are used instead [14]. In present study, extracts of Shallot, Garlic and Onion were used for their sulfide group effect on cell wall and physiological structure of candida albicans. Recent studies showed that herbs such as Shallot in comparison to fluconazole have fewer side effects on dermatophytes, Candida and nonpathogenic mold, which makes the herbal medicine more remarkable than chemical drugs. Some researchers have evaluated standard anti-fungal drug compounds against antifungal agents of plant origin. Allicin effect alone and in combination with fluconazole was examined against Candida species and also a synergistic effect of them was studied. The results showed that the drug combination work well in anti-fungal properties [11]. On the other hand, some of the important virulence attributes in Candida species are include hyphae production, adhesion, phenotypic switching and formation of some extracellular hydrolytic enzymes such as proteinases. Colonization of Candida on the surface of tissue is a primary step of infection [15]. Moreover, quorum sensing is a natural obstacle to treatment with some antifungal agents which may result in drug resistance. It is demonstrated that the ability to form quorum sensing and degree of pathogenicity could be collaborative.
… 
Content may be subject to copyright.
ABR Vol 7 [1] January 2016 125 | P a g e ©2016 Society of Education, India
Advances in Bioresearch
Adv.Biores.,Vol7(1)January2016:125-132
©2015SocietyofEducation,India
PrintISSN0976-4585;OnlineISSN2277-1573 
Journal’sURL:http://www.soeagra.com/abr.html
CODEN:ABRDC3
ICVValue8.21[2014]
O
OR
RI
IG
GI
IN
NA
AL
L
A
AR
RT
TI
IC
CL
LE
E
Evaluation of the Anti-Candida effect of Garlic, Shallot and Onion
to inhibit the Quorum Sensing Activity
Elahe Hamdi1,2, Alireza Khodavandi3
1DepartmentofMicrobiology,ScienceandResearchBranch,IslamicAzadUniversity,Fars,Iran
2DepartmentofMicrobiology,Shirazbranch,IslamicAzadUniversity,Shiraz,Iran
3DepartmentofMedicalSciences,GachsaranBranch,IslamicAzadUniversity,Gachsaran,Iran
Correspondence:AlirezaKhodavandi;email:Khodavandi@iaug.ac.ir
ABSTRACT
Recently, the incidence of systemic candidiasis which is caused by Candida albicans has been increased. Usually, for
treatment of systemic fungal infections, azoles such as fluconazole are used. Despite of this, overuse of drugs has caused
an extra increasing of the drugs resistance. One of the best strategies to decrease the resistance phenomenon is finding
the new derivatives originated from plants instead of chemical antifungals. In the present study the potential of Garlic,
Shallot and Onion for growth inhibition of Candida albicans were evaluated by use of inhibition zone determination
(Disk Diffusion Agar test) and relative MIC (Broth Microdilution test). Time kill study was also performed to indicate the
rate of anti-Candida activity of plant-extracts tested in different time intervals. Finally, the expression of selected gene
involved in Quorum Sensing such as TUP1 was evaluated by semi-quantitative RT-PCR. The result have shown
significantin vitro potential of those plants to inhibit Candida albicans growth, which is need further investigations to
find its main mechanisms. In addition, the extracts were not able to demonstrate their ability to significant decrease of
the selected gene expression. Therefore, further investigation will be needed to find the probable targets of garlic, onion
and shallot on the Quorum Sensing phenomenon of C. albicans.
Key words: MIC, Time kill, Candida albicans, Shallot, Garlic, Onion.
Received10/09/2015Accepted21/12/2015©2016SocietyofEducation,India
How to cite this article:
ElaheH,AlirezaK.EvaluationoftheAnti-CandidaeffectofGarlic,ShallotandOnion toinhibittheQuorumSensing
Activity.Adv.Biores.,Vol7[1]January2016:125-132. DOI:10.15515/abr.0976-4585.7.1.125132
INTRODUCTION
Thedimorphicyeast,Candida albicans,isacommensalorganismwhichiscommonlyfoundinoralcavity,
gastrointestinaltract,female’sgenitaltractandoccasionallyonthesurfaceofskinandmucousmembrane
[1].Candida albicanscan be isolated from approximately70%ofthehealthypopulation. It is the fourth
leadingcauseof nosocomialbloodstreaminfections,withmortalityrateof 37–44% inseverelyimmune-
compromisedpatients.Candidaspp.isthemostcommoncauseofopportunisticmycosesanditsinfection
generally referred to as candidiasis, which can be further classified into superficial candidiasis,
mucocutaneous candidiasis and systemic or invasive candidiasis [2]. Superficial candidiasis is relatively
commonascomparedwithsystemiccandidiasisduetoitsseriousinfectionthatcanbefatal.Superficial
infections of C. albicans could worsen into invasive form and disseminate elsewhere in the body [3].
Virulentfactorsthatcontributetocandidiasisaremainlyundefinedandunderinvestigation.Thevirulent
factors include secreted protease, phospholipase and the ability to change morphology from budding
yeastcellsintohyphal,filamentousorevenmycelialcellsform,adheretothehostcellsandsubsequently
penetratehosttissuesremainsanimportantvirulentdeterminantforinvasiveinfection. Morphogenesis
in C. albicans has been extensively investigated in vitro [4]. Although, a number of transcriptional
regulators have been characterized as main factor in regulating th e yeast-to-hyphal shift, many of the
targetgenesinvolvedinmorphogenesishavenotbeenidentified.Recently,quorumsensing(QS)hasbeen
described as a phenomenon con tributing to morphogenic control in C. albicans. One of the conditions
whichdefinetheyeast-to-hyphalshiftinvitroisdependenceoncelldensitytodeterminemorphogenesis;
thishasbeen called "inoculumeffect"inwhichthis term has beenassociatedwithregulationby QS.The
A
Ad
dv
va
an
nc
ce
es
s
i
in
n
B
Bi
io
or
re
es
se
ea
ar
rc
ch
h
ABR Vol 7 [1] January 2016 126 | P a g e ©2016 Society of Education, India
"inoculumeffect"isseenwhenyeastcellsaredilutedtoconcentrationslessthan106cellsml-1)inculture
medium to germinate into the hyphal form under certain conditions [5]. However, cells which are
inoculatedathigherconcentrations(>106cellsml-1),predominantlyremaininayeaststate.Candidiasisis
normally treatedwith antimycotics, which arethecommonused antifungal drugs inhospitals.Fornon-
severe clinical condition, the used antifungal drugs are including topical clotrimazole, topical nystatin,
fluconazole and topical ketonazole, while for severe infection, amphotericin B, caspofungin or
variconazole may be used. Moreover, these antifungal drugs often have side effects, and more efforts
warrantedtofindnewertreatmentregimensforsaferandmoreeffective treatment.Also,Azolesdisrupt
ergosterol biosynthesis in fungi resulting in the formation of cell membrane with altered structure and
function[6].
Ithasbeen demonstrated that theantimicrobial activity ofplantsarerelatedto both theallylandsulfur
groupsinthiosulfinates,peptides,alkaloidandetc.Withanemphasisonaboveinformation,plantextracts
andtheircompoundscanbeusedasapotentialcheap,affordableantifungalagentwithfewersideeffects
[7,8,9].So,theaimofthisstudyistoevaluateantifungalactivityofGarlic,ShallotandOnionongrowthof
Candida albicansisolates,witheffectongenesinvolvedinquorumsensing.
Material and Methods
10clinicalisolatesofCandida albicans wereobtained from microbiologicallaboratoriesofMadaranand
Labafinezhad Hospital. All samples were isolated from patient’s with syst emic candidiasis. For control
strains,C. albicansATCC10231wasemployed.Eachsamplewasmaintainedassterile20%(v/v)glycerol
stocksand subculturedonSabourauddextroseagar at35–37Cfor24-48htoensureviabilityandpurity
priortotesting.
Plantsextractpreparation
Thefreshplantswerewashedwithdistilledwater,sliced anddriedin theovenfor atleasttwodaysand
thenpowdered,accordingtoresearcher(10).Atotalweightof1goffreshplantspowderwasaddedin10
mlofdistilledwatertoprepareastocksolutionof100 mgml-1(w⁄v).Theextract wasallowedtostand
for30mininroomtemperatureandthencentrifugedat5000rpmfor10min.Thesupernatantfluidwas
passedthroughasterile0.22μmfilter(Millipore,UK).Therequiredconcentrationwaspreparedbyserial
dilutionofthestocksolutions.
Determination of antimicrobial activity
According to the Clinical and Laboratory Standards Institute (CLSI) for yeast cell with some slight
modification, paper disks of 6 mm in diameter were prepared using Whatman filter paper for disc
diffusionmethod.Thepaperdiskswereautoclavedat121°Cfor20minbeforeuse.Thestocksolutionsof
100 mg/ml of extracts were prepared by dissolving 100 mg of extracti nto1 ml solvent. Serial ten-fold
dilution was carried out to make different concentrations of plant extracts. Amphotericin B (10 μg),
Nistatin(50μg)andketoconazole(15μg)werealsousedasastandardcontrolantifungaldrug.Eventually,
5μlof each concentrationof plant extractswere loadedseparately on paperdisks and were allowed to
dry completely for 30 min. Clinical Candida albicans and ATCC(10231) were grown on separate
Sabouraud’s dextrose agar (SDA) and then passage three times to ensure its viability and activity.
Inoculumwerepreparedbypickingfivecoloniesof≥1mmindiameterfrom24hcultureofCandida using
5ml of PBSbuffer.Following,theinoculumwerecentrifugedand the supernatant was removedandthe
cell pellet was washed with PBS buffer and aga in centrifuged for 5 min. These steps were repeated at
leastthreetimes. The cell densitywasadjustedfrom1 × 106 to5×106cfu/ml usingspectrophotometric
methodat 530 nmtoachievetheturbidityequivalentto0.5 McFarland standards. Workingsuspensions
were prepared by the stock solution with ratio 1:100 with PBS followed by 1:20 dilution with same
solutiontoproduce5×102–2.5×103yeastcells/ml.ThedilutedcultureswerespreadonSDAusinga
sterilecottonswab.Theculture plates were kept at room temperaturefor15mintodry.Subsequently,
theplantextractdiskswereappliedontheagarandkeptagainatroomtemperaturefor15minandthen
incubatedat37°Cfor24h.Atlast,thediameterofzoneofinhibitionwasmeasured.
The plant extracts were examined in terms of antifungal activities through the determination of MIC,
according to CLSI documents with slight modifications. 100 μlof the two fold dilution of the antifungal
agentswhichdissolvedinSabouraud’sdextrosebroth(SDB)(Fluka,Germany),wereinoculatedwith100
μlofinoculumcontainingbetween5×102to2.5×103yeastcfu/mlusing U-bottom96-wellmicroplates
(Brand781660,Wertheim,Germany).Themicroplates,includingplantextractsandcells,wereincubated
at35°Cfor24hMICsweremeasuredat530nmusinganEMaxsmicro-platereader.Time-killmethodsas
detailedabovewereutilizedwiththefollowingmodifications.Theinoculumforeachisolatewerestudied
againstonion,shallot, and garlic1× 106 cell/ml. Antifungalsweretestedat concentrations equalto2×
MIC for each isolate. Test samples were incubated at 35°C with agitatio n. Aliquots were removed from
Hamdi and Khodavandi
ABR Vol 7 [1] January 2016 127 | P a g e ©2016 Society of Education, India
each test solution for colony count determination at 0, 1, 2, 3, 4, 5, 6, 7, 8, 12, and 24 h following
inoculation. The plating procedures described above were followed for high- and medium-inoculum
samples; however, the limit of fungal quantitati on was lowered to approximately 30 CFU/ml for each
isolate in the low-inoculum group. This was accomplished by pla ting 100 μl of the test sample directly
onto an RPMI 1640 agar plate without dilution. Plates were incubated at 35°C for 24-48 h prior to
determinationofcolony counts.Allexperimentswereconductedinduplicate.Simultaneously,alongthis
stage,microscopicinvestigation atthetimeof 0,24and48hourswithextracts effects performedandas
control,alloftheseprocesseshadbeendonewithoutextracts[11].
Preparationofproperconditionforquorumsensingincandida albicansATCC10231:
Yeast cells were washed in phosphat e buffer saline and adjusted to a cell density of 1×106cells/ml in
RPMI-1640.L-glutamine(Sigma),10% fetalbovineserum(FBS)and 100Uml–1penicillin-streptomycin
(bothfromGibco,Invitrogen)wereaddedtothemixture.Thecellswereincubatedat37°Cwith5%CO2.
RNA extraction and cDNA synthesis
A suspension containing different concentratio ns of antifungal agents and 1×106 cells/ml of C. albicans
ATCC10231were prepared. Subsequently, themixturewascentrifugedat3000 rpm for10minand the
supernatantwasremoved.The cells werewashedwithapproximately2mlof PBS,andthencentrifuged
at3000rpmfor10 minandthesupernatantwereremoved.Thewashingprocesswas repeatedatleast
three times. Subsequently, total RN A was extracted using RNeasy mini kit (Qiagen,  Germany) for yeast
and treated with 1U DNase I (Promega, UK). RNA quality was checked by formaldehyde-denaturing
agarose gel electrophoresis at 70 V for 45 min and also the concentration and absorption ratio of RNA
was measured for purity estimation using the Nanodrop ND-1000 spectrophotometer. According to
manufacturer’sprotocol,singlestrandedcDNAwassynthesized(approximately0.5–1μg)fromRNAusing
MoloneyMurineLeukemiaVirus(M-MuLV)reversetranscriptaseandrandomhexameroligonucleotides
(Fermentas,USA).Thereversetranscriptionreactionswereperformedatleastintriplicates.
Semi-quantitative RT-PCR
Candida albicansTUP1 gene was amplified from the synthesized cDNA. In this study, the pri mers used
were established by other investigators (Table 1). Moreover, beta actin was established as a house-
keepinggeneandinternalcontroltonormalizethedissimilarRNAconcentrationsduringRNAextraction.
Furthermore,foreachsampleaninternalnegativecontrol (withoutM-MuLV reverse transcriptase) was
performedtoensurethatthePCRproductswerenotoriginatedfromgenomic DNA. PCR products were
performed by gel electrophoresis and visualized via the AlphaImager HP imaging system. The PCR
productswerequantitated intermsofintensityofbands bycomparingtoknownmolecularweight DNA
markers(Fermentas,USA)usingAlphaImager software.Themathematicalcalculationmethodofrelative
quantificationwasdeterminedasfollows:
Foldchangeintargetgeneexpression=Ratiooftargetgeneexpression(experiment/untreatedcontrol)
Ratioofreferencegeneexpression(experiment/untreatedcontrol)
Table1:OligonucleotideprimersusedforPCR.
ReferenceSizeof
Product
SequenceNameofPrimer
(12)313bp5'AGAAGATTATGACTCAAAGTACCAAC3'
TUP1Sense
5'AATGTATTGTGACTTGTCGATAACC3'
TUP1Antisense
(13)516bp
ACCGAAGCTCCAATGAATCCAAAATCC3'
'
5
Beta-ACTSense
GTTTGGTCAATACCAGCAGCTTCCAAA3'
'
5
Beta-ACTAntisense
RESULT
Disk diffusion assay is a simple and reliable preliminary screening test to investigate the antifungal
activityof extracts. Theplantsinvestigatedin thisstudyhavebeenusedintraditionalmedicinefor their
antimicrobial and detoxification properties.  However the result of preliminary test using the disk
diffusion method demonstrated that shallot, garlic and onioncouldable to show the strong antifungal
propertiesagainstallCandida albicans, butshallotextractantifungaleffectwasstrongerthanonionand
garlicextract. Thediameterofinhibitionzoneforshallot,garlicandonion extractswithconcentrationof
100mg/ml,were25,17and14mmagainstCandida albicans respectively.Alsothediameterofinhibition
zonefortheantifungalchemicalagent AmphotricinB,ketoconazoleand nystatin were16,33and 25mm
againstCandida albicans respectively.EvaluationofplantextractseffectonCandida albicansATCC10231
indicated, as the time past, colonies of the microorganism shows growth reduction in the presence of
Hamdi and Khodavandi
ABR Vol 7 [1] January 2016 128 | P a g e ©2016 Society of Education, India
differentconcentrationofaqueousextractsofshallot,garlicandonions.However,intheabsenceofthese
extractsexcellentgrowthwasobserved.
Fig1.EvaluationofthegrowthofCandida albicansATCC10231intheabsenceandpresenceofaqua
extractsofgarlic,shallotsandonions.
Fig2.ThegrowthoftheyeastCandida albicansATCC10231atdifferenttimeswithoutthepresenceof
plantextracts.Magnification×40,Bar=50μm
Thepicturesfromtheleftrandomlyshowthetimeon0,12and24hours.
Fig3.ThegrowthoftheyeastCandida albicansATCC10231atvarioustimesinthepresenceofaqueous
extractsofshallot.Magnification×40,Bar=50μm
Thepicturesfromtheleftrandomlyshowthetimeon0,12and24hours.
Fig4.ThegrowthoftheyeastCandida albicansATCC10231atvarioustimesinthepresenceofaqueous
extractsofgarlic.Magnification×40,Bar=50μm
0
2
4
6
8
10
12
14
16
-10 0 10 20 30 40 50 60
log ATCC 10231 growth(cfu/mg)
time h
Aqueous extracts of garlic
Aqueous extracts of shallot
Aqueous extracts of onion
without extract
Hamdi and Khodavandi
ABR Vol 7 [1] January 2016
Thepicturesfromtheleftrandomlyshowthetimeon0,12and24
Fig5.Thegrowthoftheyeast
Candida albicans
extractsofonion
Thepicturesfromthel
eftrandomlyshowthetimeon0
According to the M
icroscopic observations, partly inhibition of quorum sensing due to prevent the
formation of hyphae was
observed, since
hyphaedirectconnection.
Table2.TheMICandMFCforvariousspeciesof
Aqueousextractsofshallot
Isolates
MIC90
MIC50
11.28
6.27
C.albicansATCC
10231
11.26
6.25
C.albicansCI-1
*
12.24
6.80
C.albicansCI-2
*
12.27
6.82
C.albicansCI-3
*
11.82
6.57
C.albicansCI-4
*
11.80
6.55
C.albicansCI-5
*
11.44
6.36
C.albicansCI-6
*
12.24
6.80
C.albicansCI-7
*
11.55
6.42
C.albicansCI-8
*
12.15
6.75
C.albicansCI-9
*
11.82
6.57
C.albicansCI-10
*
ClinicalIsolates.=*CI;
MICandMFCaremeasuredaccordingtomilligram/milliliter.
RT-PCR products indicated (p
≥ 0.05)
influence of 2MIC, MIC, ½ MIC plant extracts
genes, which is close to the size of the markers, showed slight differences in the gene expression in
control and other samples. The results showed no significant changes (p
tup1geneofCandidaalbicans
ATCC10231inthepresenceofplantextract(Fig6,7,8).
Fig6.TUP1andbeta-
actingeneexpressionin
129 | P a g e ©2016
Society of Education, India
Thepicturesfromtheleftrandomlyshowthetimeon0,12and24
hours.
Candida albicans
ATCC10231atvarioustimesinthepresenceofaqueous
extractsofonion
.Magnification×40,Bar=50μm.
eftrandomlyshowthetimeon0
.12and24hours.
icroscopic observations, partly inhibition of quorum sensing due to prevent the
observed, since
the phenomenon of quorum sensing in
Table2.TheMICandMFCforvariousspeciesof
Candida albicans
inthepresenceofaqueousextractsof
shallot,garlicandonion.
Aqueousextractsofonion
Aqueousextractsofgarlic
Aqueousextractsofshallot
MIC50
MFC
MIC90
MIC50
MFC
MIC90
12.89
25.08
22.57
12.54
12.54
11.28
12.95
25.90
23.31
12.95
12.51
11.26
12.80
25.80
23.22
12.90
13.60
12.24
12.95
25.84
23.25
12.92
13.64
12.27
12.90
25.80
23.22
12.90
13.14
11.82
12.90
25.60
23.04
12.80
13.10
11.80
12.85
25.50
22.95
12.75
12.72
11.44
12.90
25.90
23.31
12.95
13.60
12.24
12.79
25.92
23.32
12.96
12.84
11.55
12.86
25.68
23.11
12.84
13.50
12.15
12.95
25.64
23.07
12.82
13.14
11.82
MICandMFCaremeasuredaccordingtomilligram/milliliter.
≥ 0.05)
TUP1
gene expression without significant changes under the
influence of 2MIC, MIC, ½ MIC plant extracts
 concentrations. The beta-
actin (516bp) and
genes, which is close to the size of the markers, showed slight differences in the gene expression in
control and other samples. The results showed no significant changes (p ≥ 0.05) for expression of
ATCC10231inthepresenceofplantextract(Fig6,7,8).
actingeneexpressionin
Candida albicans
ATCC10231inthepresenceofdifferent
concentrationsofShallotextracs.
Hamdi and Khodavandi
Society of Education, India
ATCC10231atvarioustimesinthepresenceofaqueous
icroscopic observations, partly inhibition of quorum sensing due to prevent the
the phenomenon of quorum sensing in
C. albicans formed
inthepresenceofaqueousextractsof
Aqueousextractsofonion
MFC
MIC90
MIC50
25.78
23.20
25.91
23.32
25.60
23.04
25.90
23.31
25.80
23.22
25.80
23.22
25.70
23.13
25.80
23.22
25.58
23.02
25.72
23.14
25.90
23.31
gene expression without significant changes under the
actin (516bp) and
TUP1(313bp)
genes, which is close to the size of the markers, showed slight differences in the gene expression in
≥ 0.05) for expression of
ATCC10231inthepresenceofplantextract(Fig6,7,8).
ATCC10231inthepresenceofdifferent
ABR Vol 7 [1] January 2016
C+:control posetive; C-:
control negative
ShallotextractsMIC2:
ConcentrationofShallotextracts1/2MIC3:
4:InternalcontrolRT-PCR
Fig7.TUP1andbeta-
actingeneexpressionin
C+:controlposetive;C-
:controlnegative
extractsMIC2:
ConcentrationofGarlicextracts1/2MIC3:
C+:controlposetive;C-
:controlnegative
extractsMIC2:
ConcentrationofOnionextracts1/2MIC3:
Fig8.TUP1 andbeta-
actingeneexpressionin
Fig 9.TUP1andbeta-
actingeneexpressionof
0
0.2
0.4
0.6
0.8
1
1.2
0
normalizedratio(target
gene/refrencegene)
130 | P a g e ©2016
Society of Education, India
control negative
;
Concentration of Shallot extracts2MIC1:
ConcentrationofShallotextracts1/2MIC3:
actingeneexpressionin
Candida albicans
ATCC10231inthepres
concentrationsofGarlicextracts.
:controlnegative
;ConcentrationofGarlicextracts2MIC1
:Concentration
ConcentrationofGarlicextracts1/2MIC3:
4:InternalcontrolRT-PCR
:controlnegative
;ConcentrationofOnionextracts2MIC1:
ConcentrationofOnion
ConcentrationofOnionextracts1/2MIC3:
4:InternalcontrolRT-PCR
actingeneexpressionin
Candida albicans
ATCC10231inthep
concentrationsofOnionextracts.
actingeneexpressionof
Candida albicans
ATCC10231atconcentrationsof2MIC,
MIC,½MICshallotextract.
1/2 ×MIC MIC
Shallot extract concentration (mg/ml)
Hamdi and Khodavandi
Society of Education, India
Concentration of Shallot extracts2MIC1:
Concentration of
ATCC10231inthepres
enceofdifferent
:Concentration
ofGarlic
ConcentrationofOnion
ATCC10231inthep
resenceofdifferent
ATCC10231atconcentrationsof2MIC,
2 ×MIC
ABR Vol 7 [1] January 2016 131 | P a g e ©2016 Society of Education, India
Fig 10.TUP1andbeta-actingeneexpressionofCandida albicansATCC10231atconcentrationsof2MIC,
MIC,½MICgarlicextract.
Fig 11.TUP1 and beta- actin gene expression Candida albicans ATCC 10231 at concentrations of 2
MIC, MIC, ½ MIC onion extract.
DISCUSSION
Medicinal,insecticidal,anti-bacterial and anti-fungal propertieshavebeenattributedtoplantextract.In
addition, interest in plant extract as an anti-fu ngal agent has been renewed recently. Plant extract was
demonstrated to be fungicidal against pathogenic yeasts, especially C. albicans. Various studies have
provedthatduetodermatophytesresistancetochemicaldrugsandtheireffects,herbalextractsareused
instead[14].Inpresentstudy,extractsofShallot,GarlicandOnionwereusedfortheirsulfidegroupeffect
on cell wall and physiological structure of candida albicans. Recent studies showed that herbs such as
Shallot in comparison to fluconazole have fewer side effects on dermatophytes, Candida and non-
pathogenic mold, which makes the herbal medicine more remarkable than chemical drugs. Some
researchers have evaluated standard anti-fungal drug compounds against antifungal agents of plant
origin.AllicineffectaloneandincombinationwithfluconazolewasexaminedagainstCandidaspeciesand
alsoasynergisticeffectofthemwasstudied.Theresultsshowedthatthedrugcombinationworkwellin
anti-fungal properties [11]. On the other hand, some of the important virulence attributes in Candida
species are include hyphae production, adhesion, phenotypic switching and formation of some
extracellularhydrolyticenzymessuchasproteinases.ColonizationofCandidaonthesurfaceoftissueisa
primary step of infection [15]. Moreover, quorum sensing is a natural obstacle to treatment with some
antifungalagentswhichmayresultindrugresistance.Itisdemonstratedthattheabilitytoformquorum
sensinganddegreeofpathogenicitycouldbecollaborative.
CONCLUSION
Inpresentstudy,thefungicidalconcentrationoftheaqueousShallotextractagainstC. albicanswashigher
thanGarlicandOnionextracts.Infact,theuseofaqueousextractsofShallot,GarlicandOnion(especially
shallot) at different time intervals represent more reduction than in the control group (no extracts
shallot,garlicandonion)(p≤0.05)onyeastcells,sothatthecellsreachalmosttozeroafter48hoursof
0
0.2
0.4
0.6
0.8
1
1.2
01/2×MIC MIC 2×MIC
normalized ratio(target
gene/refrence gene)
garlicextractconcentration(mg/ml)
0
0.2
0.4
0.6
0.8
1
1.2
01/2
×MIC
MIC
2
×MIC
normalized ratio (target
gene/refrence gene)
onion extract concentration (mg/ml)
Hamdi and Khodavandi
ABR Vol 7 [1] January 2016 132 | P a g e ©2016 Society of Education, India
incubation. According to our results, reduce gene expression by RT-PCR t echnique has been approved.
Molecularstudies showed that impact ofaqueousextractsof shallot; garlic and onion reduce TUP1gene
expressioninCandida albicans.However,incontrasttoprevious,ourfindingsshowednoinhibitioneffect
of these extracts on quorum sensing through changes in TUP1gene expression. It is possible that
expression of other genes involved in this phenomenon is affected by these extracts. Therefore,
consideration of each gene expression involved in this phenomenon in the presence of anti-fungal
extracts is critical. The techniques were used in this study may not accurate enough to Measure
expressionlevel,sothatmoreappropriatetechniquessuchasRealtimeRT-PCRisrequired.
REFERENCES
1. Odds, F.C., Brown, A.J.P. and Grow, N.A.R.(2003).Antifungal agents: mechanisms of action. TRENDS in
Microbiology11(6):272-279.
2. Kinironsom,J.(1983).CandidialinvasionofdentineComplicationhypodontia.Br dent J.13:1-180.
3. Lynch, M.A., Brightman, V.J. and Greenberg, M.S.(2008).Burkets oral medicine, diagnosis and treatment.
Philadelphia.JB Lippincott CompanyP:79-84.
4. Ghannoum, M.A. and Rice, L.B.(1999).Antifungal agents : mode of action, mechanisms of resistance, and
correlationofthesemechanismswithbacterialresistance.Cilinical microbiology reviews12(4):501-517.
5. Williams, P. (2007). Quorum sensing, communication and crosskingdom signaling in the bacterial world.
Microbiology153:3923–3938.
6. Amin,M.,Kapadnis,B.P.(2005).HeatstableantimicrobialactivityofAllium ascalonicumagainst bacteriaand
fungi.Indian journal of experimental biology 43:751-754.
7. Kumar,M.,and Berwal, J.S. (1998). Sensitivity of food pathogenstogarlic(Allium sativum). Journal of Applied
Microbiology84:213-215.
8. Lemar,K.M.,Turner,M.P.andLloyd,D.(2005).Garlic(Allium sativum)asananti-Candidaagent:acomparison
oftheefficacyoffreshgarlicandfreeze-driedextracts.Journal of Applied Microbiology93:398-405.
9. José Abad, M., Ansuategui, M. and Bermejo, P. (2007). Active antifungal substances from natural source.
ARKIVOC7:116-145.
10. Falahati, M., Fateh, R. and Sharifinia, S. (2011). Anti-Candidal effect of shallot against chronic
candidiasis.Iranian journal of pharmacology  therapeutic10:49-51.
11. Khodavandi, A., Alizadeh, F., Aala, F., Sekawi, Z. and Chong, P. P. (2010).In vitro investigation of antifungal
activityofallicinaloneandincombinationwithazolesagainstCandida Species.Mycopathologia169:287-295.
12. Braun,B.R.and Johnson,A.D.(1997). Controlof filamentformationin Candida albicans bythetranscriptional
repressorTUP1.Science 277:105–109.
13. Khodavandi,A.,Alizadeh,F.,Harmal,N.S.,Sidik,S.M.,Othman,F.,Sekawi,Z.andChong,P.P.(2011).Expression
analysisofSIR2 andSAPs1-4geneexpressioninCandida albicanstreatedwithallicin comparedtofluconazole.
Tropical Biomedicine28(3):589-598.
14. Merz, W., Hay, R.(2005). Medical mycology. Topley and Wilsons, Microbiology and Microbial infection 10th
Editions.USA.EdwardArnoldLTDP:802-815.
15. Calderon,R.A.andFonzi,W.A.(2001).VirulencefactorsofCandida albicans.TRENDS in Microbiology9:327-335.
Copyright: © 2016 Society of Education. This is an open access article distributed under the Creative Commons
Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the
original.
Hamdi and Khodavandi
ResearchGate has not been able to resolve any citations for this publication.
Article
Full-text available
The spread of multidrug-resistant strains of fungus and the reduced number of drugs available, makes it necessary to discover new classes of antifungals and compounds that inhibit these resistant mechanisms. This has led to a search for therapeutic alternatives, particularly among medicinal plants and compounds isolated from them used for their empirically antifungal properties. In these natural sources, a series of molecules with antifungal activity against different strains of fungus have been found, which are of great importance to humans and plants. In this article, we review the main sources of molecules with antimycotic activity obtained from the natural environment.
Article
Full-text available
One of the main factors for virulence of fungus such as Candida albicans is the ability to change its morphology from yeast to hyphae. Allicin, one of the volatile sulfur-oil compounds from freshly crushed garlic, has a variety of antifungal activities. In this study, the effect of allicin on growth and hyphae production in C. albicans as compared to fluconazole, an antifungal drug was investigated using survival time in vitro and microscopic image at different time intervals. Additionally, the expression of selected genes involved in hyphae formation and development such as SIR2 and SAP1-4 was evaluated by semi-quantitative RT-PCR and relative real time RT-PCR. Allicin was shown to down-regulate the expression of SIR2 (5.54 fold), similar to fluconazole (3.48 fold) at 2x MIC concentrations. Interestingly, allicin had no effect on SAPs1-4 expression, whereas fluconazole was able to suppress SAP4 expression. Our findings showed that allicin was effective in suppressing hyphae development of C. albicans to an extent that is sometimes equal or more than fluconazole. Moreover, allicin and fluconazole seemed to share a common anti-Candida mechanism through inhibition of SIR2 gene, while fluconazole appeared to also exert its fungistatic effect through another pathway that involved SAP4 suppression.
Article
Full-text available
Candidiasis is a term describing infections by yeasts from the genus Candida, and the type of infection encompassed by candidiasis ranges from superficial to systemic. Treatment of such infections often requires antifungals such as the azoles, but increased use of these drugs has led to selection of yeasts with increased resistance to these drugs. In this study, we used allicin, an allyl sulfur derivative of garlic, to demonstrate both its intrinsic antifungal activity and its synergy with the azoles, in the treatment of these yeasts in vitro. In this study, the MIC(50) and MIC(90) of allicin alone against six Candida spp. ranged from 0.05 to 25 microg/ml. However, when allicin was used in combination with fluconazole or ketoconazole, the MICs were decreased in some isolates. Our results demonstrated the existing synergistic effect between allicin and azoles in some of the Candida spp. such as C. albicans, C. glabrata and C. tropicalis, but synergy was not demonstrated in the majority of Candida spp. tested. Nonetheless, In vivo testing needs to be performed to support these findings.
Article
Full-text available
The increased use of antibacterial and antifungal agents in recent years has resulted in the development of resistance to these drugs. The significant clinical implication of resistance has led to heightened interest in the study of antimicrobial resistance from different angles. Areas addressed include mechanisms underlying this resistance, improved methods to detect resistance when it occurs, alternate options for the treatment of infections caused by resistant organisms, and strategies to prevent and control the emergence and spread of resistance. In this review, the mode of action of antifungals and their mechanisms of resistance are discussed. Additionally, an attempt is made to discuss the correlation between fungal and bacterial resistance. Antifungals can be grouped into three classes based on their site of action: azoles, which inhibit the synthesis of ergosterol (the main fungal sterol); polyenes, which interact with fungal membrane sterols physicochemically; and 5-fluorocytosine, which inhibits macromolecular synthesis. Many different types of mechanisms contribute to the development of resistance to antifungals. These mechanisms include alteration in drug target, alteration in sterol biosynthesis, reduction in the intercellular concentration of target enzyme, and overexpression of the antifungal drug target. Although the comparison between the mechanisms of resistance to antifungals and antibacterials is necessarily limited by several factors defined in the review, a correlation between the two exists. For example, modification of enzymes which serve as targets for antimicrobial action and the involvement of membrane pumps in the extrusion of drugs are well characterized in both the eukaryotic and prokaryotic cells.
Article
Shallots are an important part of the diet of many populations and there is long-held belief in their health enhancing properties. The aim of this study was to determine anti-candidal activity of shallot against chronic candidiasis agents. Alcoholic and aqueous extracts of shallot (Allium hirtifolium) were tested for in vitro antifungal activities against 33 candida species isolated from patient with chronic candidiasis who were referred to Mirza-Kochak-Khan and Lolagar Hospitals. Minimal inhibitory concentration (MIC) was determined using broth microdilution method. Allium hirtifoliumshowed antifungal activity against all the candida species tested and anti-candidal activity of the alcoholic extract was very better than aqueous extract. The results indicate that crude juice of shallot has anti-candidal activity and might be promising in treatment of candidiasis.
Article
Candida albicans is the most commonly Candida species associated as an opportunistic pathogen. Candidiasis is a infection of the skin, oral cavity and esophagus, gastrointestinal tract, vagina of mammalians. Pathogenesis of Candida infection depends on patient immunological status and several virulence factors. These factors include adherence, morphogenesis, enzymatic activity (secreted aspartyl proteases and phospholipases), 'phenotypic switching' and dynamic composition of cell surface.
Article
The pathogenic yeast Candida albicans regulates its cellular morphology in response to environmental conditions. Ellipsoidal, single cells (blastospores) predominate in rich media, whereas filaments composed of elongated cells that are attached end-to-end form in response to starvation, serum, and other conditions. The TUP1 gene, which encodes a general transcriptional repressor in Saccharomyces cerevisiae, was isolated from C. albicans and disrupted. The resulting tup1 mutant strain of C. albicans grew exclusively as filaments under all conditions tested. TUP1 was epistatic to the transcriptional activator CPH1, previously found to promote filamentous growth. The results suggest a model where TUP1 represses genes responsible for initiating filamentous growth and this repression is lifted under inducing environmental conditions.
Article
The inhibitory activity of garlic (Allium sativum) against Staphylococcus aureus, Salmonella typhi, Escherichia coli and Listeria monocytogenes was measured by the 'turbidity' method. Minimum inhibitory concentration (MIC) of garlic at 80% inhibition level was calculated for these bacteria. All bacterial pathogenic strains tested were inhibited by garlic; E. coli was most sensitive and Listeria monocytogenes was least sensitive. Therefore, garlic has potential for the preservation of processed foods.