Content uploaded by Yiwei Liu
Author content
All content in this area was uploaded by Yiwei Liu on Apr 25, 2019
Content may be subject to copyright.
ORIGINAL ARTICLE
Stabilization of Hypoxia-inducible Factor by DMOG
Inhibits Development of Chronic Hypoxia–Induced
Right Ventricular Remodeling
Sen Zhang, PhD, Kai Ma, PhD, Yiwei Liu, PhD, Xiangbin Pan, MD,
Qiuming Chen, PhD, Lei Qi, PhD, and Shoujun Li, MD
Background: One important determinant of longevity in congen-
ital heart disease is right ventricular (RV) function, and this is
especially true in cyanotic congenital heart disease. However, there is
a paucity of data concerning right ventricular remodeling (RVR) in the
setting of chronic hypoxia. Dimethyloxalylglycine (DMOG) is
a competitive inhibitor of hypoxia-inducible factor (HIF)-hydroxylated
prolyl hydroxylase and has been shown to play an important role
against ischemia–reperfusion myocardial injury.
Methods: We tested the hypothesis that DMOG prevents the
development RVR after chronic hypoxia exposure. Rats were
injected with saline or DMOG and exposed to room air or continued
hypoxia for 4 weeks. In addition, we explored the response of
myocardial erythropoietin and its receptor to hypoxic exposure.
Results: Treatment with DMOG attenuated myocardial fibrosis,
apoptosis, and oxidative stress, which lead to enhanced RV
contractile function. As an endpoint of HIF-dependent cardiopro-
tection, a novel pathway in which nuclear factor kappa B links HIF-1
transcription was defined.
Conclusions: This study supports a role for HIF-1 stabilizers in the
treatment of RVR and brings into question the commonly held concept
that RVR follows a linear relationship with increased RV afterload.
Key Words: DMOG, HIF-1a, chronic hypoxia, right ventricular,
hypertrophy, remodeling
(J Cardiovasc Pharmacol Ô2016;67:68–75)
INTRODUCTION
Chronic hypoxia is a governing factor for the develop-
ment of pulmonary arterial hypertension (PAH), and right
ventricular hypertrophy (RVH) occurs in the setting of primary
PAH. Comparatively few studies on hypoxia-induced right
ventricular (RV) dysfunction have been reported. The RV has
lower pressure working conditions and more complex
geometry different than the left ventricle (LV). Clinically,
RV function is one of the most important determinants of
longevity, especially in patients with cyanotic congenital
heart disease (CCHD). Approximately 45% of patients with
PAH die of RV dysfunction.
1,2
Moreover, chronic hypoxia–
induced right ventricular remodeling (RVR) correlates with
a worse aftermath.
3
However, exposure of experimental ani-
mals to chronic hypoxia can protect against RVR, although
the mechanisms are poorly characterized.
4
As such, improved
understanding of the molecular pathways that modify RVR
may provide important clues toward novel therapies for the
treatment of PAH and RVR.
Hypoxia-inducible factor 1 (HIF-1) mediates various
types of pathogenesis of PAH, including RVH. The
mechanisms by which HIF-1 is triggered in hypoxia are
relatively well understood.
5,6
HIF-1 protein is regulated
mainly through oxygen-dependent proteolysis of the asub-
unit. Under normoxic conditions, the specific proline
residue of HIF-1a, P564, is hydroxylated by the oxygen-
sensing enzyme HIF-1 prolyl hydroxylase. The von
Hippel–Lindau protein then binds to hydroxylated proline
residues, which become targets for ubiquitin-mediated deg-
radation. Under hypoxia, inhibited hydroxylation prohibits
von Hippel–Lindau protein binding. HIF-1alevels are sub-
sequently increased by this stabilization. HIF-1 translocates
from the cytoplasm to the nucleus, promoting transcription
of a set of more than 100 genes whose protein products
mediate adaptive responses to hypoxia/ischemia.
7
In
addition, immunomodulatory inflammatory peptides such
as tumor necrosis factor-aare involved in the HIF-1
pathway.
8
Thus, application of a novel HIF-1astabilizer dimethy-
loxalylglycine (DMOG) immediately after onset of chronic
hypoxia could be a promising clinical strategy to reduce
RVR. DMOG is a cell-permeable competitive inhibitor of
HIF-hydroxylated prolyl hydroxylase.
9,10
This study was de-
signed to analyze whether the HIF-1astabilizer DMOG alle-
viates RVR due to chronic hypoxia. Because data are lacking
about the role for nuclear factor kappa B (NF
k
B) in the acti-
vation of the HIF pathway during chronic hypoxia–induced
myocardial response, we also identified a novel pathway in
which NF
k
B links HIF-1 transcription in a mechanism
induced by hypoxia.
Received for publication May 23, 2015; accepted August 17, 2015.
From the Center of Pediatric Cardiac Surgery, Fuwai Hospital, National Center
for Cardiovascular Diseases, Chinese Academy of Medical Sciences, Pe-
king Union Medical College, Beijing, China.
The authors report no conflicts of interest.
Supplemental digital content is available for this article. Direct URL citations
appear in the printed text and are provided in the HTML and PDF
versions of this article on the journal’s Web site (www.jcvp.org).
Reprints: Shoujun Li, MD, Center of Pediatric Cardiac Surgery, Fuwai
Hospital, No. 167 Beilishi Road, Xicheng District, Beijing 100037, China
(e-mail: drlishoujunfw@yahoo.com).
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
68 |www.jcvp.org J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
MATERIALS AND METHODS
All protocols were approved by the Fuwai Hospital
Animal Care and Use Committee. Four-week-old adult male
Sprague Dawley rats (Vital River Laboratory) were placed in
a chamber maintained at 10% O
2
for 4 weeks (hypoxia), as
previously described.
11
The chamber was constantly flushed
with room air to maintain low (,0.5%) CO
2
concentrations.
A real-time control system (ProOx model 110; BioSpherix,
Redfield, NY) monitored O
2
levels and injected 100% N
2
as
needed to maintain 10% 60.5% O
2
. Cages were cleaned and
food and water replenished twice per week. Hypoxic rats
were weighed and injected daily with DMOG (100 mg/kg
intraperitoneally) diluted in 5 times the volume of sterile
saline, or injected with an equal volume of sterile saline as
a control. Normoxic animals were kept in normal air (21%
O
2
). All animals were allowed free access to food and water.
RV Pressure, Hypertrophy, and Hematocrit
At the end of the experiment, all the rats were weighed
and anesthetized with 10% chloral hydrate (0.3 mL/100 g,
intraperitoneally). The RV inner diameter and tricuspid
annular plane systolic excursion were measured by echocar-
diography (VisualSonics, Toronto, Canada). RV pressure
changes were measured in closed-chest rats with a technique
routinely used in our laboratory.
12
In brief, a 13-cm, heparin-
primed polyethylene catheter (outer diameter, 0.9 mm) was
introduced into the right external jugular vein and advanced
into the right ventricle and the main pulmonary artery. The
catheter was connected to a PowerLab 16/30 data acquisition
system (AD Instruments, Dunedin, New Zealand) through
a pressure transducer to record right ventricular systolic pres-
sure (RVSP) and pulmonary arterial systolic pressure. For
arterial blood gas analysis, hypoxic rats were first transferred
into the operation box (10% O
2
) containing the real-time
control system. Blood samples (0.5 mL) were obtained from
the femoral artery and analyzed in a blood gas analyzer
(pHOx Ultra; Nova Biomedical, Waltham, MA). Hearts were
then carefully excised and dissected into the RV and LV +
septum (LV + S) to obtain separate weights for derivation of
RV/LV + S ratios.
Histological Analysis
Hearts were isolated, fixed with buffered 3.7% forma-
lin, embedded in paraffin, and cut into 3-mm sections. Serial
sections were stained with hematoxylin–eosin, malondialde-
hyde antibodies, and Masson trichrome. In sections stained
with hematoxylin–eosin, the cardiomyocyte cross-sectional
area was measured by tracing the outlines of 100–200 cardi-
omyocytes with a clear nucleus per heart. The degree of
myocardial fibrosis was determined using sections stained
with Masson trichrome. Routine light microscopic examina-
tion and an Olympus imaging analyzer system (BX61; Olym-
pus, Tokyo, Japan) were used for histological analyses.
Gene Expression and ELISA Analysis
Protein extraction and Western blot analysis were
performed as previously described.
13
Briefly, frozen tissues
were homogenized in extraction buffer, and extracts were
quantified. Protein was separated by 6% sodium dodecyl
sulfate polyacrylamide gel electropheresis, transferred onto
Immobilon-P membranes (Millipore Corp, Bedford, MA),
and incubated with antibodies against HIF-1a(Cell Signal-
ing Technology, Danvers, MA), I
k
Bkinase-a/
b
(IKKa/
b
;
Cell Signaling Technology), and erythropoietin receptor
(EpoR; Abcam Corp, Cambridge, MA). Signals were de-
tected by chemiluminescence with horseradish peroxidase–
conjugated secondary antibodies. Total RNA from heart
tissue was isolated according to the manufacturer’sinstruc-
tions. Briefly, 10 mg of total RNA was incubated in
a 25-mL reaction mix containing 16 DNase buffer, 50 U
RNasin, and 1 U DNase for 30 minutes at 378C. Real-time
polymerase chain reaction (RT-PCR) was performed
using the One Step RT-PCR Kit (Takara Bio, Shiga,
Japan) according to the manufacturer’s instructions. The
following primers (MWG Biotech, Ebersberg, Germany)
were used: collagen I forward TGACCTTGAGGTGGA-
CACTA, reverse CAGTCAGAGTGGCACATCTT; heme
oxygenase-1 (HO-1) forward AGCATGTTCCCAGGATG,
reverse GCTCAATGTTGAGCACA; glucose transporter 1
(Glut-1) forward TTGGCTCCGGTATCGTCAAC; reverse
GCCAGGACCCACTTCAAAGA; B-cell lymphoma 2
(Bcl-2) forward GACACCTGAGCTGACCTTGG, reverse
GAGGAAGTCCAGTGTCCAGC; vascular endothelial
growth factor (VEGF) forward GTACCTCCATGCCAAGT,
reverse ACTCCAGGGCTTCATCGTTA; erythropoietin (Epo)
forward CCACCCTGCTGCTTTTACTC, reverse CTCAGT-
CTGGGACCTTCTGC; EpoR forward ACGAAACAGG-
GGCGCTGGAG, reverse ACACGTCCACTTCATATCGG;
b
-actin forward ATGCTCCCCGGGCTGTAT, reverse
TCACCCACATAGGAGTCCTTCTG.
For enzyme-linked immunosorbent assay (ELISA)
experiments, blood serum was separated by centrifugation at
3000gfor 20 minutes at 48C and then stored at 2808Cuntil
analysis. Interleukin 6 (IL-6) levels were determined by ELISA.
Statistical Methods
Values are shown as mean 6SD. Differences in echo-
cardiographic and hemodynamic parameters, as well as
body/organ weights between the groups, were determined
by 1-way analysis of variance with the post hoc Tukey test.
Statistical analysis was performed using Prism 5 (GraphPad
Software, San Diego, CA). P,0.05 was considered statis-
tically significant.
RESULTS
Weight Loss Due to Hypoxia Is Attenuated in
DMOG-treated Rats
Normoxic rats increased in body weight over the
4-week experimental period. All rats challenged with hypoxia
in parallel underwent significant body weight loss, owing to
reductions in food and water intake, of roughly 60 g after 4
weeks (see Figure,Supplemental Digital Content 1,
http://links.lww.com/JCVP/A208). DMOG-treated rats dis-
played a significant attenuation in this response than did the
hypoxic groups that did not receive DMOG.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |69
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
DMOG Promotes the HIF Signaling Pathway
In Vivo
Initially, we sought to characterize the ability of
DMOG to activate HIF in vivo. Eight hours after exposure
to hypoxia, we detected high levels of intramyocardial
HIF-1a, and the potential for DMOG to induce the HIF
signaling pathway was analyzed. Treatment with DMOG
(100 mg/kg) stabilized HIF-1aprotein abundance in cardiac
tissue, protecting HIF-1aagainst proteolytic degradation
(Fig. 1). Administration of DMOG in rats was well tolerated
with no adverse effects in any groups (dose range, 40–100
mg/kg for as long as 4 weeks).
Influence of DMOG on Outcomes in RVR
RV and LV + S weights were determined to evaluate
RV hypertrophy. After 4 weeks of chronic hypoxia, the
RV/LV + S ratio was higher in the hypoxic group than in
hypoxic rats treatment with DMOG (Hyp-DMOG group)
(Fig. 2A). Chronic hypoxia increased RVSP; however, this
change was reversed in the DMOG group (Fig. 2B). RV
contractility estimated by tricuspid annular plane systolic
excursion tended to be impaired in hypoxic rats (Table 1).
To evaluate the ability of DMOG on established RVR,
rats were exposed to 10% O
2
for 4 weeks. Rats received daily
injections of saline or DMOG (100 mg/kg) and were exposed
to hypoxia for an additional 2 weeks. At the end of hypoxic
exposure, RVSP was significantly reduced in rats treated with
DMOG (Fig. 2D). The RV/LV + S ratio was lower in the
DMOG-treated group (Fig. 2C) than that of those receiving
saline, although the difference did not reach statistical signif-
icance (P= 0.097).
Prolonged exposure to chronic hypoxia results in
polycythemia through HIF-dependent induction of Epo
expression. In normoxic animals, hematocrit values were
below 40% (Table 1). In contrast, all animals exposed to
chronic hypoxia experienced significantly increased hemato-
crit levels, although values were slightly higher in hypoxic
rats receiving DMOG (Table 1).
The degree of cardiac fibrosis assessed in trichrome-
stained RV tissue sections was significantly greater in hypoxic
rats than in controls (Figs. 3A–D). Associated with RV fibrosis,
gene expression of collagen I was increased in hypoxic rats, but
a moderate degree of fibrosis was determined in the DMOG
group (Fig. 4I). This implies that DMOG has a relevant effect
on collagen metabolism in our study.
FIGURE 1. DMOG increases HIF-aprotein abundance in RV.
Hypoxic (Hyp) rats were treated with DMOG (40 mg/kg and
100 mg/kg). Saline was used as a control. HIF-1aabundance
was quantified by Western blot 8 hours after exposure to
hypoxia (n = 7 for all groups). *P,0.05 compared with the
normoxic (nor) group; #P,0.05 compared with the hyp-
oxic group.
FIGURE 2. Effect of DMOG treatment on RV parameters. A,
Effect of DMOG treatment on RVH. RV/LV + S weight ratio in
rats exposed to normoxia (nor) or hypoxia (Hyp) in the
absence or presence of DMOG. B, Effect of DMOG on RVSP.
C and D, Effect of DMOG treatment on established RVR.
Rats were injected with saline or 100 mg/kg DMOG per day.
Data are represented as mean 6SEM. *P,0.05 compared
with the normoxic group; #P,0.05 compared with the
hypoxic group.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
70 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
Tissue fibrosis develops as a reparative response to
oxidative damage,
14
and insufficient protection against an
oxidant burden could explain the aggravating degrees of
fibrosis in our models. Immunostaining with an antibody
directed against malondialdehyde (Figs. 3E–H) provided
evidence of more intense oxidative stress in the hypoxic
group than in the normoxic group; while in the DMOG
group, oxidative stress was alleviated. Expression of
HO-1 was significantly increased in the RV of DMOG-
treated animals, thereby suggesting that DMOG provides
sufficient protection against oxidative stress (Fig. 3J).
Effect of DMOG on HIF-1 Target Genes
We found that levels of mRNA encoding Glut-1 and Bcl-
2, as well as the classic HIF-1 target VEGF, were elevated in
heart tissue from chronically hypoxic rats treated with DMOG
TABLE 1. Morphologic, Echocardiographic, and Blood Data in Normoxic and Hypoxic Rats
RV Weight, mg RVID, mm TAPSE, mm HR, bpm Hematocrit, % Hemoglobin, G/L
Arterial PO
2
,
mm Hg
Normoxia (n = 7) 202 613 2.3 60.2 3.7 60.2 320 618 39 62 132 610 84.6 68.0
Hypoxia (n = 7) 416 670* 4.6 60.9* 2.4 60.4* 298 631 58 66* 192 619* 50.7 69.5*
Hypoxia-Saline (n = 7) 420 669* 4.9 60.7* 2.1 60.5* 286 642 54 65* 178 623* 47.9 66.3*
Hypoxia-DMOG (n = 7) 299 672†3.6 60.6†3.0 60.4†314 621 58 67* 196 622* 74.2 610.3†
DMOG ameliorated CH-induced RVR in rats.
*P,0.05 compared with the normoxia group.
†P,0.05 compared with the hypoxia group.
HR, heart rate; PO
2
, partial pressure of oxygen; RVID, right ventricular inner diameter; TAPSE, tricuspi d annular plane systolic excursion.
FIGURE 3. Masson trichrome staining showing RV
fibrotic areas. A, Minimal fibrosis was detected in
normoxic (nor) rats. Hypoxic (Hyp) rats (B) and
saline-treated hypoxic rats (C) (Hyp-saline) dem-
onstrated extensive fibrosis, whereas DMOG-
treated hypoxic rats (D) (Hyp-DMOG) showed
moderate fibrosis. Collagen I was significantly
decreased in the DMOG group (I). Staining with
malondialdehyde antibodies indicated evidence of
aggravated oxidative stress in the Hyp RV, which
was alleviated in the Hyp-DMOG group (E–H).
The decreased degree of RV oxidative stress may
be related to a decreased antioxidant protection
resulting from expression of HO-1 in Hyp-DMOG
(J). *P,0.05 compared with the normoxic group;
#P,0.05 compared with the hypoxic group.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |71
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
(Figs. 4A–C). ELISA analysis demonstrated that serum IL-6
levels were significantly decreased in DMOG-treated rats com-
pared with those of the hypoxic group (Fig. 4D).
Epo shows the greatest induction in response to
hypoxia.
15
Epo mRNA expression in the heart was at the
limits of detection in our study and could not be reliably
quantified. In contrast, plasma Epo levels were significantly
increased in hypoxic and DMOG-treated groups (Fig. 4E).
The biological activity of Epo is mediated through binding
to its cognate receptor EpoR. Cardiac EpoR mRNA was de-
tected in all groups by RT-PCR (Fig. 4F). Moreover, to elu-
cidate the protective mechanisms of chronic hypoxia–induced
myocardial hypertrophy, we focused on the response of the
Epo-EpoR system to hypoxic exposure. Compared with the
hypoxic group, the expression of EpoR in hearts from
DMOG-treated rats was enhanced (Fig. 4G).
Myocardial NF
k
B Activation Induced by
DMOG
NF
k
B has been shown to be activated in cardiac
hypertrophy and inhibited by the dominant-negative IKK
b
in the cytoplasm. To investigate whether NF
k
Bplaysan
important role in the adaptive response to hypoxia, Western
blot analysis was performed to determine the levels of
phosphorylated IKKa/
b
in the ventricular myocardium.
After 4 weeks of hypoxia, phospho-IKKa/
b
levels were
significantly higher than those in normoxic rats, whereas
phospho-IKKa/
b
levels were markedly decreased in the
DMOG group (Fig. 4H). Consistent with previous findings
in models of left ventricular hypertrophy, NF
k
B partici-
pated in the chronic hypoxia–induced RVH.
DISCUSSION
We demonstrated that administration of DMOG, which
stabilizes HIF-1 transcriptional activity, prevents the
development and slows the progression of chronic hypoxia–
induced RVR in a murine model. Our data support a compre-
hensive paradigm for HIF in the myocardial response to
chronic hypoxia, which seems to be a master transcription
factor capable of inducing the expression of genes related
to different adaptive metabolic processes, such as inflamma-
tory reactions, glucose metabolism, cell survival, angiogene-
sis, and erythropoiesis (Fig. 5). Thus, the HIF-stabilizer
DMOG might be a promising approach to the prevention
and treatment of chronic hypoxia–induced RVR.
One interesting observation in this study was that
weight loss associated with exposure to chronic hypoxia
was reduced in DMOG-treated rats, which suggests that
DMOG was well tolerated. In our supplementary experi-
ments, administering DMOG to normoxic rats did not
influence the weight gain phase compared with normal rats.
FIGURE 4. After 4 weeks of hypoxic exposure, gene expression of Glut-1 (A), Bcl-2 (B), and VEGF (C) is significantly increased in
the RV of hypoxic rats receiving DMOG (Hyp-DMOG). Serum IL-6 levels were significantly decreased in the DMOG-treated group
(D). Serum Epo levels were significantly decreased in the DMOG-treated group (E). Cardiac EpoR mRNA was detected by RT-PCR
in all groups (F), and Western blot showed enhanced expression of EpoR on cardiomyocytes in the DMOG-treated group (G).
Hypoxia activated NF
k
B through the IKK complex, DMOG-treated rats demonstrated markedly decreased p-IKKa/
b
protein levels
(H). *P,0.05 compared with the normoxic group; #P,0.05 compared with the hypoxic group.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
72 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
We propose that DMOG significantly increases hematocrit
and muscle oxygenation that ameliorates skeletal muscle
proteolysis to resist weight loss.
In the prevention protocol, DMOG significantly nor-
malized RVSP, whereas RVH was reduced but not normal-
ized in our study. The degree of RVH did not follow a close
linear relationship with RVSP or pulmonary arterial systolic
pressure. To address this imbalance, we raise the hypothesis
that hypoxia has a direct effect on the RV, but not on the
pulmonary vasculature (ie, PAH). There is evidence to
suggest that mechanical stress of an elevated pulmonary
artery pressure is not the only reason for PAH-associated RV
failure.
16
Furthermore, application of DMOG through the intra-
peritoneal route resulted in significant upregulation of HIF-1a
and induction of its well-known target genes VEGF and Epo.
Clinical studies also mentioned this role of HIF-1ain the
pathogenesis of CCHD.
17
It is well known that VEGF is
a stimulator of angiogenesis, which may induce widespread
formation of collateral blood vessels as a compensatory
mechanism to provide adequate oxygen supply for cardio-
myocyte growth.
18
Likewise, the upregulation of Epo expres-
sion plays an equally important role in maintaining oxygen
homeostasis as an adaptive response to chronic hypoxemia.
Increased levels of hemoglobin and hematocrit not only
enable numerous red blood cells through microcirculation,
but are also necessary to enhance oxygen release to cardio-
myocytes. Several studies have indicated that Epo directly
raises blood pressure
19,20
; however, our rats did not seem to
have elevated blood pressure or RVSP despite increased Epo
levels. Hypoxia-independent Epo expression might be regu-
lated by HIF activity to reach oxygen homeostasis, which is
different from previous experiments on hemoconcentration.
HO-1 may also result in preserved VEGF protein
expression by preventing oxidative damage to the VEGF
promoter.
21
In cardiomyocytes, stress-induced cardioregula-
tory protein HO-1 is induced by hypoxia and has been shown
to contain an HIF-binding site. Like oxidation reaction, ascen-
dant glycolytic metabolism is one of the most well-
characterized cellular responses to lower oxygen. Glut-1
allows for enhanced glucose uptake and maintains ATP pro-
duction in hypoxic conditions as recently demonstrated.
22,23
We document that these changes occur in chronic hypoxia (ie,
induction of HO-1 and Glut-1) and may reflect a broad shift
of cardiomyocytes to a cardioprotective phenotype.
A gene assay study indicated that the NF
k
B site
at 2197/2188 bp was responsible for transcriptional activa-
tion of HIF-1.
24
Interestingly, we observed hypoxia-sensitive
FIGURE 5. Summary of possible mechanisms for the protective roles of DMOG in hypoxia-induced RVH. The HIF signaling
pathway mediates inflammatory reactions, cell survival, angiogenesis, and Epo-EpoR activation, resulting in preservation of RV
contractile function. The HIF signaling pathway may also play a role in NF
k
B activity in response to chronic hypoxia.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |73
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
IKK
b
in our study, and, for the first time, demonstrated that
the HIF-1 stabilizer acts as a regulatory factor for NF
k
Bin
response to hypoxia. We speculate that chronic hypoxia–
induced RVH may be associated with increased NF
k
B activ-
ity by enhanced levels of oxidation reaction in hypoxic con-
ditions, which is involved in the pathogenesis of many
cardiovascular disorders including inflammatory reactions,
pulmonary hypertension, and hypertrophy.
25
In summary,
our findings propose a new insight for NF
k
B as a regulatory
factor of HIF-1 in response to chronic hypoxia. NF
k
Bis
reduced through a pathway that may involve inhibition of
IKK
b
leading to phosphorylation-dependent degradation of
I
k
Baand liberation of NF
k
B. These findings suggest the
need for new therapeutic strategies for chronic hypoxia–
induced RVH.
To our knowledge, there are no data supporting the
involvement of the Epo-EpoR system in chronic hypoxia–
induced hypertrophied hearts. In this study, we demonstrate
that EpoRs are expressed in the hypoxic heart, and EpoR
protein expression is significantly increased in DMOG-
treated rats. The endogenous Epo-EpoR system was recently
reported to contribute to a critical role in proliferation and
apoptosis.
26
In rats, DMOG administration after 4 weeks of
hypoxia upregulated VEGF and Bcl-2 in the myocardium and
improved cardiac function. From this finding, we are able to
infer that the Epo-EpoR system in cardiomyocytes plays a pro-
tective role, at least in part, against myocardial hypoxia insult
by preventing apoptosis and proliferation. Research by Satoh
et al suggests that the Epo-EpoR system can mobilize endo-
thelial progenitor cells to recruit microvessels,
27
which may
provide the mechanism for preventing chronic hypoxia–
induced RVH observed in our study. However, it is unclear
whether such beneficial effects are simply because of the
improvement of oxygen transport or because of the direct
effects of Epo-EpoR on the heart.
28,29
Several limitations of this study should be mentioned.
First, chronic hypoxia causes significant septal deviation and
an enlarged RV; however, we did not detect significant
changes in morphology or markers of pathology in the LV.
Thus, more detailed histopathology and complementary
functional assessments would be ideal for assessing the
influence of hypoxia on the LV. Second, extreme elevation
of hematocrit and hemoglobin levels is often associated with
hypertension and thromboembolism
30
; however, hematocrit
levels reached 0.6–0.9 in DMOG-treated normoxic rats with-
out alteration of RVSP, blood pressure, and cardiac output in
our preliminary experiments. The adaptive mechanisms to
a high hematocrit may involve regulating blood viscosity by
increasing erythrocyte flexibility.
31
However, use of DMOG
in patients with PAH and RVH remains controversial given
that it increases erythropoiesis and possibly aggravates vas-
cular resistance in PAH.
32
Continuous treatment with the HIF-stabilizer DMOG
prevents deleterious RVR in chronic hypoxia. These findings
provide advantageous insights for the development of effica-
cious therapies for RVH by stabilizing HIF-1–independent
pathways, which might represent a promising avenue with
higher efficacy for patients with CCHD. DMOG does have
neuroprotective potency, making it an attractive candidate to
treat CCHD associated with central nervous system dis-
eases.
10,33
Our study suggests that a more selective HIF-1
stabilizer that does not affect hemodynamic properties could
be beneficial in the treatment of RVH.
ACKNOWLEDGMENTS
The authors thank Hao Zhang for excellent technical
assistance.
REFERENCES
1. Hernandez-Diaz S, Van Marter LJ, Werler MM, et al. Risk factors for
persistent pulmonary hypertension of the newborn. Pediatrics. 2007;120:
e272–e282.
2. Tonelli AR, Arelli V, Minai OA, et al. Causes and circumstances of death
in pulmonary arterial hypertension. Am J Respir Crit Care Med. 2013;
188:365–369.
3. Tverskaya MS, Sukhoparova VV, Karpova VV, et al. Pathomorphology
of the heart conduction system: Comparative study during increase in left
or right ventricular afterload. Bull Exp Biol Med. 2011;151:634–637.
4. Minet E, Michel G, Mottet D, et al. Transduction pathways involved in
hypoxia-inducible factor-1 phosphorylation and activation. Free Radic
Biol Med. 2001;31:847–855.
5. Kaelin WG Jr, Ratcliffe PJ. Oxygen sensing by metazoans: the central
role of the hif hydroxylase pathway. Mol Cell. 2008;30:393–402.
6. Jaakkola P, Mole DR, Tian YM, et al. Targeting of hif-alpha to the von
hippel-lindau ubiquitylation complex by o2-regulated prolyl hydroxyl-
ation. Science. 2001;292:468–472.
7. Eckle T, Kohler D, Lehmann R, El Kasmi K, Eltzschig HK. Hypoxia-
inducible factor-1 is central to cardioprotection: a new paradigm for
ischemic preconditioning. Circulation. 2008;118:166–175.
8. Tang M, Tian Y, Li D, et al. Tnf-alpha mediated increase of hif-1alpha
inhibits vasp expression, which reduces alveolar-capillary barrier func-
tion during acute lung injury (ali). PLoS One. 2014;9:e102967.
9. Bao W, Qin P, Needle S, et al. Chronic inhibition of hypoxia-inducible
factor prolyl 4-hydroxylase improves ventricular performance, remodel-
ing, and vascularity after myocardial infarction in the rat. J Cardiovasc
Pharmacol. 2010;56:147–155.
10. Siddiq A, Ayoub IA, Chavez JC, et al. Hypoxia-inducible factor prolyl
4-hydroxylase inhibition. A target for neuroprotection in the central ner-
vous system. J Biol Chem. 2005;280:41732–41743.
11. Corno AF, Milano G, Samaja M, et al. Chronic hypoxia: a model for cyanotic
congenital heart defects. J Thorac Cardiovasc Surg. 2002;124:105–112.
12. Meng L, Liu X, Zheng Z, et al. Original rat model of high kinetic
unilateral pulmonary hypertension surgically induced by combined sur-
gery. J Thorac Cardiovasc Surg. 2013;146:1220–1226.e1221.
13. Paffett ML, Lucas SN, Campen MJ. Resveratrol reverses monocrotaline-
induced pulmonary vascular and cardiac dysfunction: a potential role for
atrogin-1 in smooth muscle. Vascul Pharmacol. 2012;56:64–73.
14. Kisseleva T, Brenner DA. Mechanisms of fibrogenesis. Exp Biol Med.
2008;233:109–122.
15. Chavez JC, Baranova O, Lin J, et al. The transcriptional activator hypoxia
inducible factor 2 (hif-2/epas-1) regulates the oxygen-dependent expression
of erythropoietin in cortical astrocytes. J Neurosci. 2006;26:9471–9481.
16. Gudausky TM, Beekman RH III. Current options, and long-term results
for interventional treatment of pulmonary valvar stenosis. Cardiol Young.
2006;16:418–427.
17. Lemus-Varela ML, Flores-Soto ME, Cervantes-Munguia R, et al.
Expression of hif-1 alpha, vegf and epo in peripheral blood from patients
with two cardiac abnormalities associated with hypoxia. Clin Biochem.
2010;43:234–239.
18. Starnes SL, Duncan BW, Kneebone JM, et al. Vascular endothelial
growth factor and basic fibroblast growth factor in children with cyanotic
congenital heart disease. J Thorac Cardiovasc Surg. 2000;119:534–539.
19. Vaziri ND. Cardiovascular effects of erythropoietin and anemia correc-
tion. Curr Opin Nephrol Hypertens. 2001;10:633–637.
20. Kaupke CJ, Kim S, Vaziri ND. Effect of erythrocyte mass on arterial
blood pressure in dialysis patients receiving maintenance erythropoietin
therapy. J Am Soc Nephrol. 1994;4:1874–1878.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
74 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
21. Grishko V, Solomon M, Breit JF, et al. Hypoxia promotes oxidative base
modifications in the pulmonary artery endothelial cell vegf gene. FASEB
J. 2001;15:1267–1269.
22. Liao R, Jain M, Cui L, et al. Cardiac-specific overexpression of glut1
prevents the development of heart failure attributable to pressure over-
load in mice. Circulation. 2002;106:2125–2131.
23. Lando D, Peet DJ, Gorman JJ, et al. Fih-1 is an asparaginyl hydroxylase
enzyme that regulates the transcriptional activity of hypoxia-inducible
factor. Genes Dev. 2002;16:1466–1471.
24. Bonello S, Zahringer C, BelAiba RS, et al. Reactive oxygen species
activate the hif-1alpha promoter via a functional nfkappab site. Arterios-
cler Thromb Vasc Biol. 2007;27:755–761.
25. Fu D, Dai A, Hu R, et al. Expression and role of factor inhibiting
hypoxia-inducible factor-1 in pulmonary arteries of rat with
hypoxia-induced hypertension. Acta Biochim Biophys Sin. 2008;
40:883–892.
26. Parsa CJ, Matsumoto A, Kim J, et al. A novel protective effect of eryth-
ropoietin in the infarcted heart. J Clin Invest. 2003;112:999–1007.
27. Satoh K, Kagaya Y, Nakano M, et al. Important role of endogenous
erythropoietin system in recruitment of endothelial progenitor cells in
hypoxia-induced pulmonary hypertension in mice. Circulation. 2006;
113:1442–1450.
28. Silverberg DS, Wexler D, Sheps D, et al. The effect of correction of mild
anemia in severe, resistant congestive heart failure using subcutaneous
erythropoietin and intravenous iron: a randomized controlled study. JAm
Coll Cardiol. 2001;37:1775–1780.
29. Mancini DM, Kunavarapu C. Effect of erythropoietin on exercise capac-
ity in anemic patients with advanced heart failure. Kidney Int Suppl.
2003;87:S48–S52.
30. Bertinieri G, Parati G, Ulian L, et al. Hemodilution reduces clinic and
ambulatory blood pressure in polycythemic patients. Hypertension. 1998;
31:848–853.
31. Vogel J, Kiessling I, Heinicke K, et al. Transgenic mice overexpressing
erythropoietin adapt to excessive erythrocytosis by regulating blood vis-
cosity. Blood. 2003;102:2278–2284.
32. Varet B, Casadevall N, Lacombe C, et al. Erythropoietin: Physiology and
clinical experience. Semin Hematol. 1990;27:25–31.
33. Bernaudin M, Bellail A, Marti HH, et al. Neurons and astrocytes express
epo mrna: oxygen-sensing mechanisms that involve the redox-state of the
brain. Glia. 2000;30:271–278.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |75
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
