ArticlePDF Available

Stabilization of Hypoxia Inducible Factor by DMOG Inhibits Development of Chronic Hypoxia-Induced Right Ventricular Remodeling

Authors:
  • Shanghai Children’s Medical Center

Abstract and Figures

Background: One important determinant of longevity in congenital heart disease is right ventricular (RV) function, and this is especially true in cyanotic congenital heart disease. However, there is paucity of data concerning RV remodeling (RVR) in the setting of chronic hypoxia. Dimethyloxalglycine (DMOG) is a competitive inhibitor of hypoxia-inducible factor (HIF)-hydroxylated prolyl hydroxylase and has been shown to play an important role against ischemia-reperfusion myocardial injury. Methods: We tested the hypothesis that DMOG prevents the development RVR following chronic hypoxia exposure. Rats were injected with saline or DMOG and exposed to room air or continued hypoxia for 4 wk. In addition, we explored the response of myocardial erythropoietin and its receptor to hypoxic exposure. Results: Treatment with DMOG attenuated myocardial fibrosis, apoptosis, and oxidative stress, leading to enhanced RV contractile function. As an end point of HIF-dependent cardioprotection, a novel pathway in which nuclear factor kappa B links HIF-1 transcription was defined. Conclusions: This study support a role for HIF-1 stabilizers in the treatment of RVR and bring into question the commonly held concept that RVR follows a linear relationship with increased RV afterload.
Content may be subject to copyright.
ORIGINAL ARTICLE
Stabilization of Hypoxia-inducible Factor by DMOG
Inhibits Development of Chronic Hypoxia–Induced
Right Ventricular Remodeling
Sen Zhang, PhD, Kai Ma, PhD, Yiwei Liu, PhD, Xiangbin Pan, MD,
Qiuming Chen, PhD, Lei Qi, PhD, and Shoujun Li, MD
Background: One important determinant of longevity in congen-
ital heart disease is right ventricular (RV) function, and this is
especially true in cyanotic congenital heart disease. However, there is
a paucity of data concerning right ventricular remodeling (RVR) in the
setting of chronic hypoxia. Dimethyloxalylglycine (DMOG) is
a competitive inhibitor of hypoxia-inducible factor (HIF)-hydroxylated
prolyl hydroxylase and has been shown to play an important role
against ischemiareperfusion myocardial injury.
Methods: We tested the hypothesis that DMOG prevents the
development RVR after chronic hypoxia exposure. Rats were
injected with saline or DMOG and exposed to room air or continued
hypoxia for 4 weeks. In addition, we explored the response of
myocardial erythropoietin and its receptor to hypoxic exposure.
Results: Treatment with DMOG attenuated myocardial brosis,
apoptosis, and oxidative stress, which lead to enhanced RV
contractile function. As an endpoint of HIF-dependent cardiopro-
tection, a novel pathway in which nuclear factor kappa B links HIF-1
transcription was dened.
Conclusions: This study supports a role for HIF-1 stabilizers in the
treatment of RVR and brings into question the commonly held concept
that RVR follows a linear relationship with increased RV afterload.
Key Words: DMOG, HIF-1a, chronic hypoxia, right ventricular,
hypertrophy, remodeling
(J Cardiovasc Pharmacol Ô2016;67:6875)
INTRODUCTION
Chronic hypoxia is a governing factor for the develop-
ment of pulmonary arterial hypertension (PAH), and right
ventricular hypertrophy (RVH) occurs in the setting of primary
PAH. Comparatively few studies on hypoxia-induced right
ventricular (RV) dysfunction have been reported. The RV has
lower pressure working conditions and more complex
geometry different than the left ventricle (LV). Clinically,
RV function is one of the most important determinants of
longevity, especially in patients with cyanotic congenital
heart disease (CCHD). Approximately 45% of patients with
PAH die of RV dysfunction.
1,2
Moreover, chronic hypoxia
induced right ventricular remodeling (RVR) correlates with
a worse aftermath.
3
However, exposure of experimental ani-
mals to chronic hypoxia can protect against RVR, although
the mechanisms are poorly characterized.
4
As such, improved
understanding of the molecular pathways that modify RVR
may provide important clues toward novel therapies for the
treatment of PAH and RVR.
Hypoxia-inducible factor 1 (HIF-1) mediates various
types of pathogenesis of PAH, including RVH. The
mechanisms by which HIF-1 is triggered in hypoxia are
relatively well understood.
5,6
HIF-1 protein is regulated
mainly through oxygen-dependent proteolysis of the asub-
unit. Under normoxic conditions, the specic proline
residue of HIF-1a, P564, is hydroxylated by the oxygen-
sensing enzyme HIF-1 prolyl hydroxylase. The von
HippelLindau protein then binds to hydroxylated proline
residues, which become targets for ubiquitin-mediated deg-
radation. Under hypoxia, inhibited hydroxylation prohibits
von HippelLindau protein binding. HIF-1alevels are sub-
sequently increased by this stabilization. HIF-1 translocates
from the cytoplasm to the nucleus, promoting transcription
of a set of more than 100 genes whose protein products
mediate adaptive responses to hypoxia/ischemia.
7
In
addition, immunomodulatory inammatory peptides such
as tumor necrosis factor-aare involved in the HIF-1
pathway.
8
Thus, application of a novel HIF-1astabilizer dimethy-
loxalylglycine (DMOG) immediately after onset of chronic
hypoxia could be a promising clinical strategy to reduce
RVR. DMOG is a cell-permeable competitive inhibitor of
HIF-hydroxylated prolyl hydroxylase.
9,10
This study was de-
signed to analyze whether the HIF-1astabilizer DMOG alle-
viates RVR due to chronic hypoxia. Because data are lacking
about the role for nuclear factor kappa B (NF
k
B) in the acti-
vation of the HIF pathway during chronic hypoxiainduced
myocardial response, we also identied a novel pathway in
which NF
k
B links HIF-1 transcription in a mechanism
induced by hypoxia.
Received for publication May 23, 2015; accepted August 17, 2015.
From the Center of Pediatric Cardiac Surgery, Fuwai Hospital, National Center
for Cardiovascular Diseases, Chinese Academy of Medical Sciences, Pe-
king Union Medical College, Beijing, China.
The authors report no conicts of interest.
Supplemental digital content is available for this article. Direct URL citations
appear in the printed text and are provided in the HTML and PDF
versions of this article on the journals Web site (www.jcvp.org).
Reprints: Shoujun Li, MD, Center of Pediatric Cardiac Surgery, Fuwai
Hospital, No. 167 Beilishi Road, Xicheng District, Beijing 100037, China
(e-mail: drlishoujunfw@yahoo.com).
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
68 |www.jcvp.org J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
MATERIALS AND METHODS
All protocols were approved by the Fuwai Hospital
Animal Care and Use Committee. Four-week-old adult male
Sprague Dawley rats (Vital River Laboratory) were placed in
a chamber maintained at 10% O
2
for 4 weeks (hypoxia), as
previously described.
11
The chamber was constantly ushed
with room air to maintain low (,0.5%) CO
2
concentrations.
A real-time control system (ProOx model 110; BioSpherix,
Redeld, NY) monitored O
2
levels and injected 100% N
2
as
needed to maintain 10% 60.5% O
2
. Cages were cleaned and
food and water replenished twice per week. Hypoxic rats
were weighed and injected daily with DMOG (100 mg/kg
intraperitoneally) diluted in 5 times the volume of sterile
saline, or injected with an equal volume of sterile saline as
a control. Normoxic animals were kept in normal air (21%
O
2
). All animals were allowed free access to food and water.
RV Pressure, Hypertrophy, and Hematocrit
At the end of the experiment, all the rats were weighed
and anesthetized with 10% chloral hydrate (0.3 mL/100 g,
intraperitoneally). The RV inner diameter and tricuspid
annular plane systolic excursion were measured by echocar-
diography (VisualSonics, Toronto, Canada). RV pressure
changes were measured in closed-chest rats with a technique
routinely used in our laboratory.
12
In brief, a 13-cm, heparin-
primed polyethylene catheter (outer diameter, 0.9 mm) was
introduced into the right external jugular vein and advanced
into the right ventricle and the main pulmonary artery. The
catheter was connected to a PowerLab 16/30 data acquisition
system (AD Instruments, Dunedin, New Zealand) through
a pressure transducer to record right ventricular systolic pres-
sure (RVSP) and pulmonary arterial systolic pressure. For
arterial blood gas analysis, hypoxic rats were rst transferred
into the operation box (10% O
2
) containing the real-time
control system. Blood samples (0.5 mL) were obtained from
the femoral artery and analyzed in a blood gas analyzer
(pHOx Ultra; Nova Biomedical, Waltham, MA). Hearts were
then carefully excised and dissected into the RV and LV +
septum (LV + S) to obtain separate weights for derivation of
RV/LV + S ratios.
Histological Analysis
Hearts were isolated, xed with buffered 3.7% forma-
lin, embedded in parafn, and cut into 3-mm sections. Serial
sections were stained with hematoxylineosin, malondialde-
hyde antibodies, and Masson trichrome. In sections stained
with hematoxylineosin, the cardiomyocyte cross-sectional
area was measured by tracing the outlines of 100200 cardi-
omyocytes with a clear nucleus per heart. The degree of
myocardial brosis was determined using sections stained
with Masson trichrome. Routine light microscopic examina-
tion and an Olympus imaging analyzer system (BX61; Olym-
pus, Tokyo, Japan) were used for histological analyses.
Gene Expression and ELISA Analysis
Protein extraction and Western blot analysis were
performed as previously described.
13
Briey, frozen tissues
were homogenized in extraction buffer, and extracts were
quantied. Protein was separated by 6% sodium dodecyl
sulfate polyacrylamide gel electropheresis, transferred onto
Immobilon-P membranes (Millipore Corp, Bedford, MA),
and incubated with antibodies against HIF-1a(Cell Signal-
ing Technology, Danvers, MA), I
k
Bkinase-a/
b
(IKKa/
b
;
Cell Signaling Technology), and erythropoietin receptor
(EpoR; Abcam Corp, Cambridge, MA). Signals were de-
tected by chemiluminescence with horseradish peroxidase
conjugated secondary antibodies. Total RNA from heart
tissue was isolated according to the manufacturersinstruc-
tions. Briey, 10 mg of total RNA was incubated in
a 25-mL reaction mix containing 16 DNase buffer, 50 U
RNasin, and 1 U DNase for 30 minutes at 378C. Real-time
polymerase chain reaction (RT-PCR) was performed
using the One Step RT-PCR Kit (Takara Bio, Shiga,
Japan) according to the manufacturers instructions. The
following primers (MWG Biotech, Ebersberg, Germany)
were used: collagen I forward TGACCTTGAGGTGGA-
CACTA, reverse CAGTCAGAGTGGCACATCTT; heme
oxygenase-1 (HO-1) forward AGCATGTTCCCAGGATG,
reverse GCTCAATGTTGAGCACA; glucose transporter 1
(Glut-1) forward TTGGCTCCGGTATCGTCAAC; reverse
GCCAGGACCCACTTCAAAGA; B-cell lymphoma 2
(Bcl-2) forward GACACCTGAGCTGACCTTGG, reverse
GAGGAAGTCCAGTGTCCAGC; vascular endothelial
growth factor (VEGF) forward GTACCTCCATGCCAAGT,
reverse ACTCCAGGGCTTCATCGTTA; erythropoietin (Epo)
forward CCACCCTGCTGCTTTTACTC, reverse CTCAGT-
CTGGGACCTTCTGC; EpoR forward ACGAAACAGG-
GGCGCTGGAG, reverse ACACGTCCACTTCATATCGG;
b
-actin forward ATGCTCCCCGGGCTGTAT, reverse
TCACCCACATAGGAGTCCTTCTG.
For enzyme-linked immunosorbent assay (ELISA)
experiments, blood serum was separated by centrifugation at
3000gfor 20 minutes at 48C and then stored at 2808Cuntil
analysis. Interleukin 6 (IL-6) levels were determined by ELISA.
Statistical Methods
Values are shown as mean 6SD. Differences in echo-
cardiographic and hemodynamic parameters, as well as
body/organ weights between the groups, were determined
by 1-way analysis of variance with the post hoc Tukey test.
Statistical analysis was performed using Prism 5 (GraphPad
Software, San Diego, CA). P,0.05 was considered statis-
tically signicant.
RESULTS
Weight Loss Due to Hypoxia Is Attenuated in
DMOG-treated Rats
Normoxic rats increased in body weight over the
4-week experimental period. All rats challenged with hypoxia
in parallel underwent signicant body weight loss, owing to
reductions in food and water intake, of roughly 60 g after 4
weeks (see Figure,Supplemental Digital Content 1,
http://links.lww.com/JCVP/A208). DMOG-treated rats dis-
played a signicant attenuation in this response than did the
hypoxic groups that did not receive DMOG.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |69
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
DMOG Promotes the HIF Signaling Pathway
In Vivo
Initially, we sought to characterize the ability of
DMOG to activate HIF in vivo. Eight hours after exposure
to hypoxia, we detected high levels of intramyocardial
HIF-1a, and the potential for DMOG to induce the HIF
signaling pathway was analyzed. Treatment with DMOG
(100 mg/kg) stabilized HIF-1aprotein abundance in cardiac
tissue, protecting HIF-1aagainst proteolytic degradation
(Fig. 1). Administration of DMOG in rats was well tolerated
with no adverse effects in any groups (dose range, 40100
mg/kg for as long as 4 weeks).
Influence of DMOG on Outcomes in RVR
RV and LV + S weights were determined to evaluate
RV hypertrophy. After 4 weeks of chronic hypoxia, the
RV/LV + S ratio was higher in the hypoxic group than in
hypoxic rats treatment with DMOG (Hyp-DMOG group)
(Fig. 2A). Chronic hypoxia increased RVSP; however, this
change was reversed in the DMOG group (Fig. 2B). RV
contractility estimated by tricuspid annular plane systolic
excursion tended to be impaired in hypoxic rats (Table 1).
To evaluate the ability of DMOG on established RVR,
rats were exposed to 10% O
2
for 4 weeks. Rats received daily
injections of saline or DMOG (100 mg/kg) and were exposed
to hypoxia for an additional 2 weeks. At the end of hypoxic
exposure, RVSP was signicantly reduced in rats treated with
DMOG (Fig. 2D). The RV/LV + S ratio was lower in the
DMOG-treated group (Fig. 2C) than that of those receiving
saline, although the difference did not reach statistical signif-
icance (P= 0.097).
Prolonged exposure to chronic hypoxia results in
polycythemia through HIF-dependent induction of Epo
expression. In normoxic animals, hematocrit values were
below 40% (Table 1). In contrast, all animals exposed to
chronic hypoxia experienced signicantly increased hemato-
crit levels, although values were slightly higher in hypoxic
rats receiving DMOG (Table 1).
The degree of cardiac brosis assessed in trichrome-
stained RV tissue sections was signicantly greater in hypoxic
rats than in controls (Figs. 3AD). Associated with RV brosis,
gene expression of collagen I was increased in hypoxic rats, but
a moderate degree of brosis was determined in the DMOG
group (Fig. 4I). This implies that DMOG has a relevant effect
on collagen metabolism in our study.
FIGURE 1. DMOG increases HIF-aprotein abundance in RV.
Hypoxic (Hyp) rats were treated with DMOG (40 mg/kg and
100 mg/kg). Saline was used as a control. HIF-1aabundance
was quantified by Western blot 8 hours after exposure to
hypoxia (n = 7 for all groups). *P,0.05 compared with the
normoxic (nor) group; #P,0.05 compared with the hyp-
oxic group.
FIGURE 2. Effect of DMOG treatment on RV parameters. A,
Effect of DMOG treatment on RVH. RV/LV + S weight ratio in
rats exposed to normoxia (nor) or hypoxia (Hyp) in the
absence or presence of DMOG. B, Effect of DMOG on RVSP.
C and D, Effect of DMOG treatment on established RVR.
Rats were injected with saline or 100 mg/kg DMOG per day.
Data are represented as mean 6SEM. *P,0.05 compared
with the normoxic group; #P,0.05 compared with the
hypoxic group.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
70 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
Tissue brosis develops as a reparative response to
oxidative damage,
14
and insufcient protection against an
oxidant burden could explain the aggravating degrees of
brosis in our models. Immunostaining with an antibody
directed against malondialdehyde (Figs. 3EH) provided
evidence of more intense oxidative stress in the hypoxic
group than in the normoxic group; while in the DMOG
group, oxidative stress was alleviated. Expression of
HO-1 was signicantly increased in the RV of DMOG-
treated animals, thereby suggesting that DMOG provides
sufcient protection against oxidative stress (Fig. 3J).
Effect of DMOG on HIF-1 Target Genes
We found that levels of mRNA encoding Glut-1 and Bcl-
2, as well as the classic HIF-1 target VEGF, were elevated in
heart tissue from chronically hypoxic rats treated with DMOG
TABLE 1. Morphologic, Echocardiographic, and Blood Data in Normoxic and Hypoxic Rats
RV Weight, mg RVID, mm TAPSE, mm HR, bpm Hematocrit, % Hemoglobin, G/L
Arterial PO
2
,
mm Hg
Normoxia (n = 7) 202 613 2.3 60.2 3.7 60.2 320 618 39 62 132 610 84.6 68.0
Hypoxia (n = 7) 416 670* 4.6 60.9* 2.4 60.4* 298 631 58 66* 192 619* 50.7 69.5*
Hypoxia-Saline (n = 7) 420 669* 4.9 60.7* 2.1 60.5* 286 642 54 65* 178 623* 47.9 66.3*
Hypoxia-DMOG (n = 7) 299 6723.6 60.63.0 60.4314 621 58 67* 196 622* 74.2 610.3
DMOG ameliorated CH-induced RVR in rats.
*P,0.05 compared with the normoxia group.
P,0.05 compared with the hypoxia group.
HR, heart rate; PO
2
, partial pressure of oxygen; RVID, right ventricular inner diameter; TAPSE, tricuspi d annular plane systolic excursion.
FIGURE 3. Masson trichrome staining showing RV
fibrotic areas. A, Minimal fibrosis was detected in
normoxic (nor) rats. Hypoxic (Hyp) rats (B) and
saline-treated hypoxic rats (C) (Hyp-saline) dem-
onstrated extensive fibrosis, whereas DMOG-
treated hypoxic rats (D) (Hyp-DMOG) showed
moderate fibrosis. Collagen I was significantly
decreased in the DMOG group (I). Staining with
malondialdehyde antibodies indicated evidence of
aggravated oxidative stress in the Hyp RV, which
was alleviated in the Hyp-DMOG group (E–H).
The decreased degree of RV oxidative stress may
be related to a decreased antioxidant protection
resulting from expression of HO-1 in Hyp-DMOG
(J). *P,0.05 compared with the normoxic group;
#P,0.05 compared with the hypoxic group.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |71
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
(Figs. 4AC). ELISA analysis demonstrated that serum IL-6
levels were signicantly decreased in DMOG-treated rats com-
pared with those of the hypoxic group (Fig. 4D).
Epo shows the greatest induction in response to
hypoxia.
15
Epo mRNA expression in the heart was at the
limits of detection in our study and could not be reliably
quantied. In contrast, plasma Epo levels were signicantly
increased in hypoxic and DMOG-treated groups (Fig. 4E).
The biological activity of Epo is mediated through binding
to its cognate receptor EpoR. Cardiac EpoR mRNA was de-
tected in all groups by RT-PCR (Fig. 4F). Moreover, to elu-
cidate the protective mechanisms of chronic hypoxiainduced
myocardial hypertrophy, we focused on the response of the
Epo-EpoR system to hypoxic exposure. Compared with the
hypoxic group, the expression of EpoR in hearts from
DMOG-treated rats was enhanced (Fig. 4G).
Myocardial NF
k
B Activation Induced by
DMOG
NF
k
B has been shown to be activated in cardiac
hypertrophy and inhibited by the dominant-negative IKK
b
in the cytoplasm. To investigate whether NF
k
Bplaysan
important role in the adaptive response to hypoxia, Western
blot analysis was performed to determine the levels of
phosphorylated IKKa/
b
in the ventricular myocardium.
After 4 weeks of hypoxia, phospho-IKKa/
b
levels were
signicantly higher than those in normoxic rats, whereas
phospho-IKKa/
b
levels were markedly decreased in the
DMOG group (Fig. 4H). Consistent with previous ndings
in models of left ventricular hypertrophy, NF
k
B partici-
pated in the chronic hypoxiainduced RVH.
DISCUSSION
We demonstrated that administration of DMOG, which
stabilizes HIF-1 transcriptional activity, prevents the
development and slows the progression of chronic hypoxia
induced RVR in a murine model. Our data support a compre-
hensive paradigm for HIF in the myocardial response to
chronic hypoxia, which seems to be a master transcription
factor capable of inducing the expression of genes related
to different adaptive metabolic processes, such as inamma-
tory reactions, glucose metabolism, cell survival, angiogene-
sis, and erythropoiesis (Fig. 5). Thus, the HIF-stabilizer
DMOG might be a promising approach to the prevention
and treatment of chronic hypoxiainduced RVR.
One interesting observation in this study was that
weight loss associated with exposure to chronic hypoxia
was reduced in DMOG-treated rats, which suggests that
DMOG was well tolerated. In our supplementary experi-
ments, administering DMOG to normoxic rats did not
inuence the weight gain phase compared with normal rats.
FIGURE 4. After 4 weeks of hypoxic exposure, gene expression of Glut-1 (A), Bcl-2 (B), and VEGF (C) is significantly increased in
the RV of hypoxic rats receiving DMOG (Hyp-DMOG). Serum IL-6 levels were significantly decreased in the DMOG-treated group
(D). Serum Epo levels were significantly decreased in the DMOG-treated group (E). Cardiac EpoR mRNA was detected by RT-PCR
in all groups (F), and Western blot showed enhanced expression of EpoR on cardiomyocytes in the DMOG-treated group (G).
Hypoxia activated NF
k
B through the IKK complex, DMOG-treated rats demonstrated markedly decreased p-IKKa/
b
protein levels
(H). *P,0.05 compared with the normoxic group; #P,0.05 compared with the hypoxic group.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
72 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
We propose that DMOG signicantly increases hematocrit
and muscle oxygenation that ameliorates skeletal muscle
proteolysis to resist weight loss.
In the prevention protocol, DMOG signicantly nor-
malized RVSP, whereas RVH was reduced but not normal-
ized in our study. The degree of RVH did not follow a close
linear relationship with RVSP or pulmonary arterial systolic
pressure. To address this imbalance, we raise the hypothesis
that hypoxia has a direct effect on the RV, but not on the
pulmonary vasculature (ie, PAH). There is evidence to
suggest that mechanical stress of an elevated pulmonary
artery pressure is not the only reason for PAH-associated RV
failure.
16
Furthermore, application of DMOG through the intra-
peritoneal route resulted in signicant upregulation of HIF-1a
and induction of its well-known target genes VEGF and Epo.
Clinical studies also mentioned this role of HIF-1ain the
pathogenesis of CCHD.
17
It is well known that VEGF is
a stimulator of angiogenesis, which may induce widespread
formation of collateral blood vessels as a compensatory
mechanism to provide adequate oxygen supply for cardio-
myocyte growth.
18
Likewise, the upregulation of Epo expres-
sion plays an equally important role in maintaining oxygen
homeostasis as an adaptive response to chronic hypoxemia.
Increased levels of hemoglobin and hematocrit not only
enable numerous red blood cells through microcirculation,
but are also necessary to enhance oxygen release to cardio-
myocytes. Several studies have indicated that Epo directly
raises blood pressure
19,20
; however, our rats did not seem to
have elevated blood pressure or RVSP despite increased Epo
levels. Hypoxia-independent Epo expression might be regu-
lated by HIF activity to reach oxygen homeostasis, which is
different from previous experiments on hemoconcentration.
HO-1 may also result in preserved VEGF protein
expression by preventing oxidative damage to the VEGF
promoter.
21
In cardiomyocytes, stress-induced cardioregula-
tory protein HO-1 is induced by hypoxia and has been shown
to contain an HIF-binding site. Like oxidation reaction, ascen-
dant glycolytic metabolism is one of the most well-
characterized cellular responses to lower oxygen. Glut-1
allows for enhanced glucose uptake and maintains ATP pro-
duction in hypoxic conditions as recently demonstrated.
22,23
We document that these changes occur in chronic hypoxia (ie,
induction of HO-1 and Glut-1) and may reect a broad shift
of cardiomyocytes to a cardioprotective phenotype.
A gene assay study indicated that the NF
k
B site
at 2197/2188 bp was responsible for transcriptional activa-
tion of HIF-1.
24
Interestingly, we observed hypoxia-sensitive
FIGURE 5. Summary of possible mechanisms for the protective roles of DMOG in hypoxia-induced RVH. The HIF signaling
pathway mediates inflammatory reactions, cell survival, angiogenesis, and Epo-EpoR activation, resulting in preservation of RV
contractile function. The HIF signaling pathway may also play a role in NF
k
B activity in response to chronic hypoxia.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |73
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
IKK
b
in our study, and, for the rst time, demonstrated that
the HIF-1 stabilizer acts as a regulatory factor for NF
k
Bin
response to hypoxia. We speculate that chronic hypoxia
induced RVH may be associated with increased NF
k
B activ-
ity by enhanced levels of oxidation reaction in hypoxic con-
ditions, which is involved in the pathogenesis of many
cardiovascular disorders including inammatory reactions,
pulmonary hypertension, and hypertrophy.
25
In summary,
our ndings propose a new insight for NF
k
B as a regulatory
factor of HIF-1 in response to chronic hypoxia. NF
k
Bis
reduced through a pathway that may involve inhibition of
IKK
b
leading to phosphorylation-dependent degradation of
I
k
Baand liberation of NF
k
B. These ndings suggest the
need for new therapeutic strategies for chronic hypoxia
induced RVH.
To our knowledge, there are no data supporting the
involvement of the Epo-EpoR system in chronic hypoxia
induced hypertrophied hearts. In this study, we demonstrate
that EpoRs are expressed in the hypoxic heart, and EpoR
protein expression is signicantly increased in DMOG-
treated rats. The endogenous Epo-EpoR system was recently
reported to contribute to a critical role in proliferation and
apoptosis.
26
In rats, DMOG administration after 4 weeks of
hypoxia upregulated VEGF and Bcl-2 in the myocardium and
improved cardiac function. From this nding, we are able to
infer that the Epo-EpoR system in cardiomyocytes plays a pro-
tective role, at least in part, against myocardial hypoxia insult
by preventing apoptosis and proliferation. Research by Satoh
et al suggests that the Epo-EpoR system can mobilize endo-
thelial progenitor cells to recruit microvessels,
27
which may
provide the mechanism for preventing chronic hypoxia
induced RVH observed in our study. However, it is unclear
whether such benecial effects are simply because of the
improvement of oxygen transport or because of the direct
effects of Epo-EpoR on the heart.
28,29
Several limitations of this study should be mentioned.
First, chronic hypoxia causes signicant septal deviation and
an enlarged RV; however, we did not detect signicant
changes in morphology or markers of pathology in the LV.
Thus, more detailed histopathology and complementary
functional assessments would be ideal for assessing the
inuence of hypoxia on the LV. Second, extreme elevation
of hematocrit and hemoglobin levels is often associated with
hypertension and thromboembolism
30
; however, hematocrit
levels reached 0.60.9 in DMOG-treated normoxic rats with-
out alteration of RVSP, blood pressure, and cardiac output in
our preliminary experiments. The adaptive mechanisms to
a high hematocrit may involve regulating blood viscosity by
increasing erythrocyte exibility.
31
However, use of DMOG
in patients with PAH and RVH remains controversial given
that it increases erythropoiesis and possibly aggravates vas-
cular resistance in PAH.
32
Continuous treatment with the HIF-stabilizer DMOG
prevents deleterious RVR in chronic hypoxia. These ndings
provide advantageous insights for the development of efca-
cious therapies for RVH by stabilizing HIF-1independent
pathways, which might represent a promising avenue with
higher efcacy for patients with CCHD. DMOG does have
neuroprotective potency, making it an attractive candidate to
treat CCHD associated with central nervous system dis-
eases.
10,33
Our study suggests that a more selective HIF-1
stabilizer that does not affect hemodynamic properties could
be benecial in the treatment of RVH.
ACKNOWLEDGMENTS
The authors thank Hao Zhang for excellent technical
assistance.
REFERENCES
1. Hernandez-Diaz S, Van Marter LJ, Werler MM, et al. Risk factors for
persistent pulmonary hypertension of the newborn. Pediatrics. 2007;120:
e272e282.
2. Tonelli AR, Arelli V, Minai OA, et al. Causes and circumstances of death
in pulmonary arterial hypertension. Am J Respir Crit Care Med. 2013;
188:365369.
3. Tverskaya MS, Sukhoparova VV, Karpova VV, et al. Pathomorphology
of the heart conduction system: Comparative study during increase in left
or right ventricular afterload. Bull Exp Biol Med. 2011;151:634637.
4. Minet E, Michel G, Mottet D, et al. Transduction pathways involved in
hypoxia-inducible factor-1 phosphorylation and activation. Free Radic
Biol Med. 2001;31:847855.
5. Kaelin WG Jr, Ratcliffe PJ. Oxygen sensing by metazoans: the central
role of the hif hydroxylase pathway. Mol Cell. 2008;30:393402.
6. Jaakkola P, Mole DR, Tian YM, et al. Targeting of hif-alpha to the von
hippel-lindau ubiquitylation complex by o2-regulated prolyl hydroxyl-
ation. Science. 2001;292:468472.
7. Eckle T, Kohler D, Lehmann R, El Kasmi K, Eltzschig HK. Hypoxia-
inducible factor-1 is central to cardioprotection: a new paradigm for
ischemic preconditioning. Circulation. 2008;118:166175.
8. Tang M, Tian Y, Li D, et al. Tnf-alpha mediated increase of hif-1alpha
inhibits vasp expression, which reduces alveolar-capillary barrier func-
tion during acute lung injury (ali). PLoS One. 2014;9:e102967.
9. Bao W, Qin P, Needle S, et al. Chronic inhibition of hypoxia-inducible
factor prolyl 4-hydroxylase improves ventricular performance, remodel-
ing, and vascularity after myocardial infarction in the rat. J Cardiovasc
Pharmacol. 2010;56:147155.
10. Siddiq A, Ayoub IA, Chavez JC, et al. Hypoxia-inducible factor prolyl
4-hydroxylase inhibition. A target for neuroprotection in the central ner-
vous system. J Biol Chem. 2005;280:4173241743.
11. Corno AF, Milano G, Samaja M, et al. Chronic hypoxia: a model for cyanotic
congenital heart defects. J Thorac Cardiovasc Surg. 2002;124:105112.
12. Meng L, Liu X, Zheng Z, et al. Original rat model of high kinetic
unilateral pulmonary hypertension surgically induced by combined sur-
gery. J Thorac Cardiovasc Surg. 2013;146:12201226.e1221.
13. Paffett ML, Lucas SN, Campen MJ. Resveratrol reverses monocrotaline-
induced pulmonary vascular and cardiac dysfunction: a potential role for
atrogin-1 in smooth muscle. Vascul Pharmacol. 2012;56:6473.
14. Kisseleva T, Brenner DA. Mechanisms of brogenesis. Exp Biol Med.
2008;233:109122.
15. Chavez JC, Baranova O, Lin J, et al. The transcriptional activator hypoxia
inducible factor 2 (hif-2/epas-1) regulates the oxygen-dependent expression
of erythropoietin in cortical astrocytes. J Neurosci. 2006;26:94719481.
16. Gudausky TM, Beekman RH III. Current options, and long-term results
for interventional treatment of pulmonary valvar stenosis. Cardiol Young.
2006;16:418427.
17. Lemus-Varela ML, Flores-Soto ME, Cervantes-Munguia R, et al.
Expression of hif-1 alpha, vegf and epo in peripheral blood from patients
with two cardiac abnormalities associated with hypoxia. Clin Biochem.
2010;43:234239.
18. Starnes SL, Duncan BW, Kneebone JM, et al. Vascular endothelial
growth factor and basic broblast growth factor in children with cyanotic
congenital heart disease. J Thorac Cardiovasc Surg. 2000;119:534539.
19. Vaziri ND. Cardiovascular effects of erythropoietin and anemia correc-
tion. Curr Opin Nephrol Hypertens. 2001;10:633637.
20. Kaupke CJ, Kim S, Vaziri ND. Effect of erythrocyte mass on arterial
blood pressure in dialysis patients receiving maintenance erythropoietin
therapy. J Am Soc Nephrol. 1994;4:18741878.
Zhang et al J Cardiovasc PharmacoläVolume 67, Number 1, January 2016
74 |www.jcvp.org Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved.
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
21. Grishko V, Solomon M, Breit JF, et al. Hypoxia promotes oxidative base
modications in the pulmonary artery endothelial cell vegf gene. FASEB
J. 2001;15:12671269.
22. Liao R, Jain M, Cui L, et al. Cardiac-specic overexpression of glut1
prevents the development of heart failure attributable to pressure over-
load in mice. Circulation. 2002;106:21252131.
23. Lando D, Peet DJ, Gorman JJ, et al. Fih-1 is an asparaginyl hydroxylase
enzyme that regulates the transcriptional activity of hypoxia-inducible
factor. Genes Dev. 2002;16:14661471.
24. Bonello S, Zahringer C, BelAiba RS, et al. Reactive oxygen species
activate the hif-1alpha promoter via a functional nfkappab site. Arterios-
cler Thromb Vasc Biol. 2007;27:755761.
25. Fu D, Dai A, Hu R, et al. Expression and role of factor inhibiting
hypoxia-inducible factor-1 in pulmonary arteries of rat with
hypoxia-induced hypertension. Acta Biochim Biophys Sin. 2008;
40:883892.
26. Parsa CJ, Matsumoto A, Kim J, et al. A novel protective effect of eryth-
ropoietin in the infarcted heart. J Clin Invest. 2003;112:9991007.
27. Satoh K, Kagaya Y, Nakano M, et al. Important role of endogenous
erythropoietin system in recruitment of endothelial progenitor cells in
hypoxia-induced pulmonary hypertension in mice. Circulation. 2006;
113:14421450.
28. Silverberg DS, Wexler D, Sheps D, et al. The effect of correction of mild
anemia in severe, resistant congestive heart failure using subcutaneous
erythropoietin and intravenous iron: a randomized controlled study. JAm
Coll Cardiol. 2001;37:17751780.
29. Mancini DM, Kunavarapu C. Effect of erythropoietin on exercise capac-
ity in anemic patients with advanced heart failure. Kidney Int Suppl.
2003;87:S48S52.
30. Bertinieri G, Parati G, Ulian L, et al. Hemodilution reduces clinic and
ambulatory blood pressure in polycythemic patients. Hypertension. 1998;
31:848853.
31. Vogel J, Kiessling I, Heinicke K, et al. Transgenic mice overexpressing
erythropoietin adapt to excessive erythrocytosis by regulating blood vis-
cosity. Blood. 2003;102:22782284.
32. Varet B, Casadevall N, Lacombe C, et al. Erythropoietin: Physiology and
clinical experience. Semin Hematol. 1990;27:2531.
33. Bernaudin M, Bellail A, Marti HH, et al. Neurons and astrocytes express
epo mrna: oxygen-sensing mechanisms that involve the redox-state of the
brain. Glia. 2000;30:271278.
J Cardiovasc PharmacoläVolume 67, Number 1, January 2016 Stabilization of Hypoxia-inducible Factor
Copyright © 2015 Wolters Kluwer Health, Inc. All rights reserved. www.jcvp.org |75
Copyright © 201 Wolters Kluwer Health, Inc. Unauthorized reproduction of this article is prohibited.
5
... Different metabolic drugs exist to target different metabolic pathways. A metabolic pathway can be targeted at different levels, for example an essential co-factor can be scavenged or an inhibitory analog of an essential substrate with higher affinity can be provided (Park et al., 2008;Zhdanov et al., 2015;Zhang et al., 2016). Furthermore, a transcription factor can be inhibited directly by keeping it in its inactive form (Gu et al., 2016). ...
Article
Full-text available
In regenerative medicine and tissue engineering, many materials are developed to mimic the extracellular matrix (ECM). However, these ECM-mimicking materials do not yet completely recapitulate the diversity and complexity of biological tissue-specific ECM. In this review, an alternative strategy is proposed to generate ECM, namely synthesizing a material that functions as a drug delivery system, releasing molecules that target cellular metabolic pathways and thereby stimulate the local cells to create their own ECM. This is based on the fact that ECM synthesis, modification, composition, signaling, stiffness, and degradation are modulated by cellular metabolism. Metabolism can be targeted at different levels, ranging from modulating the availability of substrates or co-factors to regulating the activity of essential transcription factors. Depending on the drug of interest, its characteristics, mechanism of action, cellular target, and application, a different drug delivery system should be designed. Metabolic drugs modulating the ECM require cellular uptake for their function, therefore reversible linkers are recommended. Preferably the metabolic modulators are only released when needed, which will be upon a specific metabolic state, a change in ECM stiffness, or ECM remodeling. Therefore, reversible linkers that respond to an environmental stimulus could be incorporated. All in all, a novel strategy is suggested to develop a tissue-specific ECM by generating a synthetic material that releases metabolic molecules modulating the ECM. Various ways to modulate the ECM properties via the metabolism are reviewed and guidelines for the development of these materials are provided.
... Our results on effects of HIF-1α on yak PASMCs proliferation are consistent with angiogenesis profile of HIF-1α and also in line with other reports showing similar effects in mice, rats and human [39,[41][42][43]. However, a few studies have reported that induction of HIF-1α through PHDs inhibitor (nonselective dioxygenase inhibitor DMOG) could limit proliferation of vascular smooth muscle cells (in humans) and right ventricular remodeling (in rats) induced by hypoxia [44,45], despite the fact that inhibition of pulmonary vascular remodeling and PH in chronic hypoxia by HIF-1α dysfunction is a well-established observation [9,14]. ...
Article
Hypoxia-inducible factor-1α (HIF-1α) and heme oxygenase-1 (HO-1) are important transcription regulators in hypoxic cells and for maintaining cellular homeostasis, but it is unclear whether they participate in hypoxia-induced excessive proliferation of yak pulmonary artery smooth muscle cells (PASMCs). In this study, we identified distribution of HIF-1α and HO-1 in yak lungs. Immunohistochemistry and immunofluorescence results revealed that both HIF-1α and HO-1 were mainly concentrated in the medial layer of small pulmonary arteries. Furthermore, under induced-hypoxic conditions, we investigated HIF-1α and HO-1 protein expression and studied their potential involvement in yak PASMCs proliferation and apoptosis. Western blot results also showed that both factors significantly increased in age-dependent manner and upregulated in hypoxic PASMCs (which exhibited obvious proliferation and anti-apoptosis phenomena). HIF-1α up-regulation by DMOG increased the proliferation and anti-apoptosis of PASMCs, while HIF-1α down-regulation by LW6 decreased proliferation and promoted apoptosis. More so, treatment with ZnPP under hypoxic conditions down-regulated HO-1 expression, stimulated proliferation, and resisted apoptosis in yak PASMCs. Taken together, our study demonstrated that both HIF-1α and HO-1 participated in PASMCs proliferation and apoptosis, suggesting that HO-1 is important for inhibition of yak PASMCs proliferation while HIF-1α promoted hypoxia-induced yak PASMCs proliferation.
... Since the first reported target gene of HIF-1α (erythropoietin), hundreds of downstream targets have been identified, demonstrating the complexity and importance of the HIF-1α signaling pathway (15). In MIRI, HIF-1α can regulate and participate in a number of signaling pathways that protect the heart (47). MIRI initially leads to hypoxia, resulting in AKT phosphorylation and activation of HIF-1α and numerous protective genes (48). ...
Article
Full-text available
Myocardial ischemia‑reperfusion injury (MIRI) is a severe injury to the ischemic myocardium following the recovery of blood flow. Currently, there is no effective treatment for MIRI in clinical practice. Over the past two decades, biological studies of hypoxia and hypoxia‑inducible factor‑1α (HIF‑1α) have notably improved understanding of oxygen homeostasis. HIF‑1α is an oxygen‑sensitive transcription factor that mediates adaptive metabolic responses to hypoxia and serves a pivotal role in MIRI. In particular, previous studies have demonstrated that HIF‑1α improves mitochondrial function, decreases cellular oxidative stress, activates cardioprotective signaling pathways and downstream protective genes and interacts with non‑coding RNAs. The present review summarizes the roles and associated mechanisms of action of HIF‑1α in MIRI. In addition, HIF‑1α‑associated MIRI intervention, including natural compounds, exosomes, ischemic preconditioning and ischemic post‑processing are presented. The present review provides evidence for the roles of HIF‑1α activation in MIRI and supports its use as a therapeutic target.
... In physiological conditions, HIF-1α expression is significantly higher in the right than in the left ventricle (114). RV HIF-1α expression is increased in a number of animal models of PH, including MCT rats (115), hypoxia-exposed (HOX) rats (116), pulmonary artery-banded (PAB) rats (117), SuHx rats (117), and pulmonary embolism (PE) rats (118). Rats with PE display increased RV HIF-1α expression, and its level is positively correlated with RV hypertrophy and PAP (118). ...
Article
Full-text available
J Clin Invest. 2020. https://doi.org/10.1172/JCI137558. In-Press Preview Pulmonary hypertension (PH) is characterized by pulmonary artery remodeling that can subsequently culminate in right heart failure and premature death. Emerging evidence suggests that Hypoxia Inducible Factor (HIF) signaling plays a fundamental and pivotal role in the pathogenesis of PH. This review summarizes the regulation of HIF isoforms and their impact in various PH subtypes, as well as the elaborate conditional and cell specific knockout mouse studies that brought the role of this pathway to light. We also discuss the current preclinical status of pan-and isoform-selective HIF inhibitors, and propose new research areas that may facilitate HIF isoform-specific inhibition as a novel therapeutic strategy for PH and right heart failure.
... In physiological conditions, HIF-1α expression is significantly higher in the right than in the left ventricle (114). RV HIF-1α expression is increased in a number of animal models of PH, including MCT rats (115), hypoxia-exposed (HOX) rats (116), pulmonary artery-banded (PAB) rats (117), SuHx rats (117), and pulmonary embolism (PE) rats (118). Rats with PE display increased RV HIF-1α expression, and its level is positively correlated with RV hypertrophy and PAP (118). ...
Article
Pulmonary hypertension (PH) is characterized by pulmonary artery remodeling that can subsequently culminate in right heart failure and premature death. Emerging evidence suggests that Hypoxia Inducible Factor (HIF) signaling plays a fundamental and pivotal role in the pathogenesis of PH. This review summarizes the regulation of HIF isoforms and their impact in various PH subtypes, as well as the elaborate conditional and cell specific knockout mouse studies that brought the role of this pathway to light. We also discuss the current preclinical status of pan- and isoform-selective HIF inhibitors, and propose new research areas that may facilitate HIF isoform-specific inhibition as a novel therapeutic strategy for PH and right heart failure.
... These enzymes are inactivated under low oxygen levels, explaining why HIF-1α is induced by hypoxia. Some small molecules such as dimethyloxalylglycine (DMOG) can stabilize HIF levels under normoxic conditions by inhibiting prolyl hydroxylase ( Zhang et al. 2016). Three distinct HIF-α subunits have been identified (HIF-1α, HIF-2α and HIF-3α) that have a tissue-specific pattern of expression (Al Okail 2010). ...
Article
Full-text available
Background Endothelial injury is an early and enduring feature of cardiovascular disease. Inflammation and hypoxia may be responsible for this, and are often associated with the up-regulation of several transcriptional factors that include Hypoxia Inducible Factor-1 (HIF-1). Although it has been reported that HIF-1α is detectable in plasma, it is known to be unstable. Our aim was to optimize an assay for HIF-1α to be applied to in vitro and in vivo applications, and to use this assay to assess the release kinetics of HIF-1α following endothelial injury. Methods An ELISA for the measurement of HIF-1α in cell-culture medium and plasma was optimized, and the assay was used to determine the best conditions for sample collection and storage. The results of the ELISA were validated using Western blotting and immunohistochemistry (IHC). In vitro, a standardized injury was produced in a monolayer of rat aortic endothelial cells (RAECs) and intracellular HIF-1α was measured at intervals over 24 h. In vivo, a rat angioplasty model was used. The right carotid artery was injured using a 2F Fogarty balloon catheter. HIF-1α was measured in the plasma and in the arterial tissue (0, 1, 2, 3 and 5 days post injury). Results The HIF-1α ELISA had a limit of detection of 2.7 pg/mL and was linear up to 1000 pg/ mL. Between and within-assay, the coefficient of variation values were less than 15%. HIF-1α was unstable in cell lysates and plasma, and it was necessary to add a protease inhibitor immediately after collection, and to store samples at -80 °C prior to analysis. The dynamics of HIF-1α release were different for the in vitro and in vivo models. In vitro, HIF-1α reached maximum concentrations approximately 2 h post injury, whereas peak values in plasma and tissues occurred approximately 2 days post injury, in the balloon injury model. Conclusion HIF-1α can be measured in plasma, but this requires careful sample collection and storage. The carotid artery balloon injury model is associated with the transient release of HIF-1α into the circulation that probably reflects the hypoxia induced in the artery wall. Electronic supplementary material The online version of this article (10.1186/s10020-018-0026-5) contains supplementary material, which is available to authorized users.
Article
In repaired tetralogy of Fallot (rTOF), pulmonary insufficiency results in varying degrees of right ventricle (RV) dilation. A subset of patients is diagnosed at initial cardiac magnetic resonance imaging (CMR) with a massively dilated RV, far beyond pulmonary valve replacement (PVR) criteria, which is unlikely to return to normal size after PVR. This study aimed to identify risk factors for massive RV dilation at initial CMR. This nested case-control study included all patients at our institution with rTOF and massive RV dilation (indexed RV end-diastolic volume [RVEDVi] ≥200 ml/m2) on initial CMR. Patients were matched by age at first CMR, gender, and type of repair with rTOF controls with RVEDVi<200 ml/m2. In 39 cases (median RVEDVi 227 ml/m2, interquartile range [IQR] 213 to 250) and 73 controls (median RVEDVi 155 ml/m2, IQR 130 to 169), repair at >6 months of age, longer QRS duration, and non-Caucasian race were significantly associated with massive RV dilation on univariate analysis. In multivariate analysis, repair at >6 months of age (adjusted odds ratio [AOR] 2.90, 95% confidence interval [CI] 1.12 to 7.55, p = 0.03), longer QRS duration (AOR = 1.03, 95% CI 1.01 to 1.05, p = 0.005), and non-Caucasian race (AOR = 7.84, 95% CI 1.76 to 34.8, p = 0.01) remained independently associated with massive RV dilation. Era of repair, history of systemic to pulmonary shunt palliation, genetic anomaly, and additional cardiac lesions did not differ between groups. In conclusion, these risk factors identify a subset of patients who may benefit from earlier CMR evaluation to avoid massive irreversible RV dilation.
Article
Wound healing responses are physiological reactions to injuries and share common characteristics and phases independently of the injured organ or tissue. A major hallmark of wound healing responses is the formation of extra-cellular matrix (ECM), mainly consisting of collagen fibers, to restore the initial organ architecture and function. Overshooting wound healing responses result in unphysiological accumulation of ECM and collagen deposition, a process called fibrosis. Importantly, hypoxia (oxygen demand exceeds supply) plays a significant role during wound healing responses and fibrotic diseases. Under hypoxic conditions, cells activate a gene program, including the stabilization of hypoxia-inducible factors (HIFs), which induces the expression of HIF target genes counteracting hypoxia. In contrast, in normoxia, so-called HIF-prolyl hydroxylases (PHDs) oxygen-dependently hydroxylate HIF-α, which marks it for proteasomal degradation. Importantly, PHDs can be pharmacologically inhibited (PHI) by so-called PHD inhibitors. There is mounting evidence that the HIF-pathway is continuously up-regulated during the development of tissue fibrosis, and that pharmacological (HIFI) or genetic inhibition of HIF can prevent organ fibrosis. By contrast, initial (short-term) activation of the HIF pathway via PHI during wound healing seems to be beneficial in several models of inflammation or acute organ injury. Thus, timing and duration of PHI and HIFI treatment seem to be crucial. In this review, we will highlight the role of hypoxia-adaptive pathways during wound healing responses and development of fibrotic disease. Moreover, we will discuss whether PHI and HIFI might be a promising treatment option in fibrotic disease, and consider putative pitfalls that might result from this approach.
Article
Spinal cord injury (SCI) is a devastating neurological disorder that usually leads to a loss of motor and sensory function in patients. The expression of hypoxia inducible factor-1α (HIF-1α) is increased, and exerts a protective role after traumatic SCI. However, the endogenous activity of HIF-1α is insufficient for promoting functional recovery. The present study tested the potential effect of the sustained activation of HIF-1α by the prolylhydroxylase (PHD) inhibitor dimethyloxalylglycine (DMOG) on anti-apoptotic process and the regulation of axonal regeneration after SCI. Here, we found that treatment with DMOG significantly increased the expression of HIF-1α and that the stabilization of HIF-1α induced by DMOG not only decreased the expression of apoptotic proteins to promote neural survival, but also enhanced axonal regeneration by regulating microtubule stabilization in vivo and in vitro. In addition, we found that DMOG promoted neural survival and axonal regeneration by activating autophagy, which is induced by the HIF-1α/BNIP3 signaling pathway, and that the inhibition of HIF-1α or autophagy abrogated the protective effect of DMOG, as expected. Taken together, our results demonstrate that treatment with DMOG improves functional recovery after SCI and that DMOG may serve as a potential candidate for treating SCI.
Article
Background: Diastolic dysfunction is emerging as a leading cause of heart failure in aging population. Induction of hypoxia tolerance and reprogrammed cell metabolism have emerged as novel therapeutic strategies for the treatment of cardiovascular diseases. Methods and results: In the present study, we showed that deletion of sirtuin 3 (SIRT3) resulted in a diastolic dysfunction together with a significant increase in the expression of prolyl hydroxylases (PHD) 1 and 2. We further investigated the involvement of PHD in the development of diastolic dysfunction by treating the 12-14 months old mice with a PHD inhibitor, dimethyloxalylglycine (DMOG) for 2 weeks. DMOG treatment increased the expression of hypoxia-inducible factor (HIF)-1α in the endothelium of coronary arteries. This was accompanied by a significant improvement of coronary flow reserve and diastolic function. Inhibition of PHD altered endothelial metabolism by increasing glycolysis and reducing oxygen consumption. Most importantly, treatment with DMOG completely reversed the pre-existing diastolic dysfunction in the endothelial-specific SIRT3 deficient mice. Conclusions: Our findings demonstrate that inhibition of PHD and reprogrammed cell metabolism can reverse the pre-existed diastolic dysfunction in SIRT3 deficient mice. Our study provides a potential therapeutic strategy of induction of hypoxia tolerance for patients with diastolic dysfunction associated with coronary microvascular dysfunction, especially in the aging population with reduced SIRT3.
Article
Full-text available
Acute lung injury (ALI) is an inflammatory disorder associated with reduced alveolar-capillary barrier function and increased pulmonary vascular permeability. Vasodilator-stimulated phosphoprotein (VASP) is widely associated with all types of modulations of cytoskeleton rearrangement-dependent cellular morphology and function, such as adhesion, shrinkage, and permeability. The present studies were conducted to investigate the effects and mechanisms by which tumor necrosis factor-alpha (TNF-α) increases the tight junction permeability in lung tissue associated with acute lung inflammation. After incubating A549 cells for 24 hours with different concentrations (0-100 ng/mL) of TNF-α, 0.1 to 8 ng/mL TNF-α exhibited no significant effect on cell viability compared with the 0 ng/mL TNF-α group (control group). However, 10 ng/mL and 100 ng/mL TNF-α dramatically inhibited the viability of A549 cells compared with the control group (*p
Article
Full-text available
Rationale: The causes and circumstances surrounding death are understudied in patients with pulmonary arterial hypertension (PAH). Objectives: We sought to determine the specific reasons and characteristics surrounding the death of patients with PAH. Methods: All deaths of patients with pulmonary hypertension (PH) followed in the Cleveland Clinic Pulmonary Vascular Program were prospectively reviewed by the PH team. A total of 84 patients with PAH (age 58 ± 14 yr; 73% females) who died between June 2008 and May 2012 were included. Measurements and main results: PH was determined to be the direct cause of death (right heart failure or sudden death) in 37 (44%) patients; PH contributed to but did not directly cause death in 37 (44%) patients; and the death was not related to PH in the remaining cases (n = 7; 8.3%). In three (3.6%) patients the final cause of death could not be adequately assessed. Most patients died in a healthcare environment and most received PH-specific therapies. In our cohort, 50% of all patients with PAH and 75.7% of those who died of right heart failure received parenteral prostanoid therapy. Less than half of patients had advanced healthcare directives. Conclusions: Most patients with PAH in our cohort died of their disease; however, right ventricular failure or sudden death was the sole cause of death in less than half of patients.
Article
Hypoxia, a stimulus for angiogenesis and vascular remodeling, has been proposed to use reactive oxygen species as second messengers in signal transduction. This contention remains controversial, in part because of vagaries associated with fluorescence-based methods of free-radical detection. We took a different approach. Rat main pulmonary artery endothelial cells (PAECs) were cultured in hypoxia for up to 48 h, and, with dichlorofluorescein fluorescence to detect free-radical production, we used quantitative Southern blot and ligation-mediated PCR analyses to search for oxidative modifications in the mitochondrial genome and in the nuclear vascular endothelial cell growth factor (VEGF) gene. In accord with previous studies in other cell types, we found that acute hypoxic exposure promoted time-dependent dichlorofluorescein fluorescence in PAECs. Quantitative Southern blot analysis showed that although hypoxia failed to alter mitochondrial DNA integrity, prominent oxidative lesions occurred in a 5.0-kb sequence of the VEGF promoter. Using ligation-mediated PCR to map the modifications at single nucleotide resolution, we found clusters of oxidized bases in a VEGF promoter sequence that included the AP-1 and HIF-1 response elements. These actions of hypoxia differed from exogenous xanthine oxidase, which obliterated the mitochondrial genome but failed to erode integrity of the VEGF promoter. Our observations indicate that hypoxia promotes an oxidant stress in main PAECs as detected by oxidative base modifications in the nuclear VEGF gene. The presence of hypoxia-induced, oxidative base modifications in functionally significant sequences within the VEGF promoter suggests new concepts for mechanisms by which reactive oxygen species participate in hypoxic signal transduction.
Article
Objectives: The characteristic morphologic lesions observed in the lungs of patients with congenital cardiac anomalies have not been closely modeled in rat shunt-related models, except for the reversible grade 1 changes. The present study reported an original rat model of unilateral pulmonary hypertension surgically induced by combined surgery to reproduce more advanced pulmonary vascular lesions. Methods: The right pulmonary artery was ligated through a right posterolateral thoracotomy, and a cervical shunt was established 1 week later. The immediate and chronic effects on the pulmonary hemodynamics were evaluated through right heart catheterization immediately after and at 8 and 12 weeks postoperatively. The morphologic changes in pulmonary vasculature were analyzed after staining with hematoxylin-eosin and modified Weigert's method. The right ventricular hypertrophy index was calculated and artery blood gas analysis performed. Results: A pulmonary hypertensive status was successfully induced immediately after cervical surgery and progressively aggravated into a borderline state with disease course advancing. Pulmonary vasculopathy demonstrated a transition from reversibility (muscularization, intimal proliferation of grade 1-2) at 8 weeks to irreversibility (intimal fibrosis, entirely luminal occlusion, grade 3) at 12 weeks postoperatively. Conspicuous right ventricular hypertrophy and decreasing partial arterial pressure of oxygen were also observed. Conclusions: The present shunt-related model successfully simulated a hypertensive status in pulmonary circulation and reproduced the characteristic transition of pulmonary vasculopathy from reversibility to irreversibility within a relatively short period. Thus, this model could offer an alternative with low mortality and high reproducibility for investigations on the underling mechanisms of shunt-related pulmonary hypertension.
Article
Erythropoietin (Epo), the major hormone controling the hypoxia-induced increase in the number of erythrocytes, has also a functional role in the brain. However, few data exist as to the cellular source of brain-derived Epo as well as to the molecular mechanisms that control Epo expression in the central nervous system. Using patch-clamp and RT-PCR methods, we provide direct evidence that, besides astrocytes, neurons are a source of Epo in the brain. Both the astrocytic and neuronal expression of Epo mRNA are induced not only by hypoxia, but also by desferrioxamine (DFX) and cobalt chloride (CoCl2), two agents known to mimic the hypoxic induction of Epo in hepatoma cells. This induction is blocked by cycloheximide suggesting that de novo protein synthesis is required. Furthermore, the addition of H2O2 decreases the hypoxia-induced Epo mRNA levels. These data indicate that, following hypoxia, a common oxygen sensing and signaling pathway leads to increased Epo gene expression in both nervous and hepatoma cells; this pathway would be dependent on the redox-state of the brain. Furthermore, we show that the in vivo administration of CoCl2 and DFX to mice induces an increased Epo mRNA level in the neocortex. As Epo protects the brain against ischemia, our in vivo experiments suggest that the use of molecules such as CoCl2 or DFX, that provoke an increased Epo gene expression in the brain, could be useful in the development of potential therapeutic strategies for the treatment of hypoxic or ischemic brain injury. GLIA 30:271–278, 2000. © 2000 Wiley-Liss, Inc.
Article
Pathomorphology of the peripheral compartments of the heart conduction system under conditions of increased left or right ventricular afterload is characterized by interstitial edema, hemorrhages, and reversible and irreversible focal lesions. The percentage of damaged conduction cardiomyocytes increases in the wall of hemodynamically overloaded ventricle and in the ventricular septum. These changes are more pronounced in cases when the afterload increase is complicated by heart failure development. Acute dilatation of the heart and distention of the myocardium are events of great specific significance in the genesis of the conduction system disorders developing under conditions of increased right ventricular afterload in comparison with those developing under conditions of increase left ventricular afterload. These data attest the presence of a pathomorphological base for the appearance of arrhythmias during the acute phase of pressure overload of the heart, especially in cases when it is aggravated by heart failure.
Article
Arterial remodeling contributes to elevated pulmonary artery (PA) pressures and right ventricular hypertrophy seen in pulmonary hypertension (PH). Resveratrol, a sirtuin-1 (SIRT1) pathway activator, can prevent the development of PH in a commonly used animal model, but it is unclear whether it can reverse established PH pathophysiology. Furthermore, atrophic ubiquitin ligases, such as atrogin-1 and MuRF-1, are known to be induced by SIRT1 activators but have not been characterized in hypertrophic vascular disease. Therefore, we hypothesized that monocrotaline (MCT)-induced PH would attenuate atrophy pathways in the PA while, conversely, SIRT1 activation (resveratrol) would reverse indices of PH and restore atrophic gene expression. Thus, we injected Sprague-Dawley rats with MCT (50 mg/kg i.p.) or saline at Day 0, and then treated with oral resveratrol or sildenafil from days 28-42 post-MCT injection. Oral resveratrol attenuated established MCT-induced PH indices, including right ventricular systolic pressure, right ventricular hypertrophy, and medial thickening of intrapulmonary arteries. Resveratrol also normalized PA atrogin-1 mRNA expression, which was significantly reduced by MCT. In cultured human PA smooth muscle cells (hPASMC), resveratrol significantly inhibited PDGF-stimulated proliferation and cellular hypertrophy, which was also associated with improvements in atrogin-1 levels. In addition, SIRT1 inhibition augmented hPASMC proliferation, as assessed by DNA mass, and suppressed atrogin mRNA expression. These findings demonstrate an inverse relationship between indices of PH and PA atrogin expression that is SIRT1 dependent and may reflect a novel role for SIRT1 in PASMCs opposing cellular hypertrophy and proliferation.
Article
Hypoxia inducible factors (HIFs) are transcription factors that are regulated by HIF-prolyl 4-hydroxylases (PHDs) in response to changes in oxygen tension. Once activated, HIFs play an important role in angiogenesis, erythropoiesis, proliferation, cell survival, inflammation, and energy metabolism. We hypothesized that GSK360A, a novel orally active HIF-PHD inhibitor, could facilitate local and systemic HIF-1 alpha signaling and protect the failing heart after myocardial infarction (MI). GSK360A is a potent (nanomolar) inhibitor of HIF-PHDs (PHD1>PHD2 = PHD3) capable of activating the HIF-1 alpha pathway in a variety of cell types including neonatal rat ventricular myocytes and H9C2 cells. Male rats treated orally with GSK360A (30 mg x kg x d) had a sustained elevation in circulating levels of erythropoietin and hemoglobin and increased hemoxygenase-1 expression in the heart and skeletal muscle. In a rat model of established heart failure with systolic dysfunction induced by ligation of left anterior descending coronary artery, chronic treatment with GSK360A for 28 days prevented the progressive reduction in ejection fraction, ventricular dilation, and increased lung weight, which were observed in the vehicle-treated animals, for up to 3 months. In addition, the microvascular density in the periinfarct region was increased (>2-fold) in GSK360A-treated animals. Treatment was well tolerated (survival was 89% in the GSK360A group vs. 82% in the placebo group). Chronic post-myocardial infarction treatment with a selective HIF PHD inhibitor (GSK360A) exerts systemic and local effects by stabilizing HIF-1 alpha signaling and improves long-term ventricular function, remodeling, and vascularity in a model of established ventricular dysfunction. These results suggest that HIF-PHD inhibitors may be suitable for the treatment of post-MI remodeling and heart failure.
Article
HIF-1 alpha (hypoxia-inducible factor-1 alpha) mediates the responses of mammalian cells to hypoxia/ischemia by inducing the expression of adaptive gene products (e.g., vascular endothelial growth factor (VEGF) and erythropoietin (EPO)). Persistent pulmonary hypertension of the newborn (PPHN) and cyanotic congenital heart disease (CCHD) are common neonatal diseases considered as paradigms of hypoxemia. Since the expression HIF-1 alpha, VEGF and EPO in newborns diagnosed with these diseases has yet to be studied, we set out to define the expression of these genes in peripheral blood from newborn infants diagnosed with PPHN and CCHD. The mRNA transcripts encoding HIF-1 alpha, VEGF and EPO were measured by RT-PCR in healthy newborn infants and infants diagnosed with PPHN and CCHD. An important increase in HIF-1 alpha expression was observed in both pathological conditions, accompanied by significant increases in VEGF and EPO expression when compared to healthy infants. HIF-1 alpha mRNA expression increases in newborn infants with PPHN or CCHD, as does the expression of its target genes VEGF and EPO.