Available via license: CC BY 4.0
Content may be subject to copyright.
M ET HODOLOGY AR TICL E Open Access
Copper-free click chemistry for attachment
of biomolecules in magnetic tweezers
Jorine M. Eeftens, Jaco van der Torre, Daniel R. Burnham and Cees Dekker
*
Abstract
Background: Single-molecule techniques have proven to be an excellent approach for quantitatively studying
DNA-protein interactions at the single-molecule level. In magnetic tweezers, a force is applied to a biopolymer that
is anchored between a glass surface and a magnetic bead. Whereas the relevant force regime for many biological
processes is above 20pN, problems arise at these higher forces, since the molecule of interest can detach from the
attachment points at the surface or the bead. Whereas many recipes for attachment of biopolymers have been
developed, most methods do not suffice, as the molecules break at high force, or the attachment chemistry leads
to nonspecific cross reactions with proteins.
Results: Here, we demonstrate a novel attachment method using copper-free click chemistry, where a DBCO-tagged
DNA molecule is bound to an azide-functionalized surface. We use this new technique to covalently attach DNA to a
flow cell surface. We show that this technique results in covalently linked tethers that are torsionally constrained and
withstand very high forces (>100pN) in magnetic tweezers.
Conclusions: This novel anchoring strategy using copper-free click chemistry allows to specifically and covalently link
biomolecules, and conduct high-force single-molecule experiments. Excitingly, this advance opens up the possibility
for single-molecule experiments on DNA-protein complexes and molecules that are taken directly from cell lysate.
Keywords: Magnetic tweezers, Copper-free click chemistry, SPAAC reactions, Surface chemistry, DNA immobilization
Background
Single-mole cule methods have become increasingly
popular to study biomolecules [1]. With techniques such
as atomic force spectroscopy, or optical or magnetic
tweezers, one is able to study the mechanical properties
of single DNA molecules, single proteins, or individual
DNA-protein complexes. The effect of applied force on
biomolecules is a particularly relevant topic, as mechan-
ical forces play a crucial role in many cellular processes
[2–4]. The relevant forces range from a few pN, like the
force produced by an RNA polymerase during transcrip-
tion (14pN) [5], to tens of pN, as in, for instance, viral
packaging motors that use forces of 40pN to compact
genomes [6]. Even higher forces are needed in the
process of chromosome segregation in eukaryotic cells,
where microtubules pull on sister chr omatids to segre-
gate them to opposite sides of the spindle pole [7–10].
Many studies using magnetic tweezers have been
published that probe the behavior of DNA-protein com-
plexes under applied force and torque [11–16]. For
studying biomolecules across the full relevant force
range, it is necessary to also measure at higher forces
(>20pN). In this regime, however, many traditional an-
choring methods fail, thus limiting such single-molecule
experiments.
For efficient tethering of biomolecules, it is essential
to use orthogonal anchoring chemistries on both ends of
the molecule, i.e. at the surface and at the bead. To
achieve this, a DNA molecule is constructed that has
different reactive groups incorporated, on both ends. To
complete the anchoring, the bead and surface are func-
tionalized with the corresponding reacting group. A
commonly used techniqu e is the binding of biotin to
streptavidin. The bond between these functional groups
has been shown to resist forces of 150pN [17, 18]. This
is a high rupture force compared to a second commonly
used method; the binding of a digoxygenin (dig) function-
alized nucleotide and a surface coated with antibodies
against digoxygenin (anti-dig) (Fig. 1a). This forms a stable
* Correspondence: c.dekker@tudelft.nl
Department of Bionanoscience, Delft University of Technology, Kavli Institute
of Nanoscience Delft, Delft, The Netherlands
© 2015 Eeftens et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Eeftens et al. BMC Biophysics (2015) 8:9
DOI 10.1186/s13628-015-0023-9
non-covalent bond, but a limitation of this binding tech-
nique is its low stability under an applied force [19]. De-
pending on the force-loading rate applied to such a
molecule, the dig/anti-dig bond breaks at around 20pN.
Other, much stronger, anchoring methods have been
developed [20–24] by functionalizing DNA with amine
(Fig. 1b) or thiol groups (Fig. 1c) that are covalently
linked to the surface or bead. Although these bonds in-
deed resist high forces, these techniques have an import-
ant limitation in that significant nonspecific binding
occurs when studying systems that are more complicated
than bare DNA. For example, when studying proteins, na-
tive lysines (amine) or cysteines (thiol) in the protein can
bind nonspecifically (blue arrows in Fig. 1b, c). For con-
trolled single-molecule measurements, it is however im-
portant that the force is being applied at a consistent and
known location [25].
A new and exciting challenge is to study DNA-protein
complexes that are extracted from cell lysate. For con-
trolled single-molecule experiments, it is essential to an-
chor these complexes in a stable, strong, and specific
way. As the anchoring methods developed so far are un-
suitable, studying DNA-protein complexes or complexes
from cell lysate remains challenging [26].
Here, we present a novel method for covalent attach-
ment of a DNA tether to a surface, based on copper-free
click chemistry. Click reactions are defined as those that
are sele ctive, with favorable reaction kinetics, a high
yield, and good physiological stability. Early click chem-
istry reactions required copper as a catalyst [27]. Copper
is cytotoxic and thus limits application of click reactions
in cells. More recently, copper-free methods became
available, for instance the Strain Promoted Azide-Alkyne
Click (SPAAC) reaction, of which the reaction between
dibenzocyclooctyl (DBCO) and azide is an example [28].
These click reactions are bio-orthogonal, i.e. they can
occur within organisms without interfering with native
biochemical processes.
As mentioned above, a spe cific and high-force-
compatible anchoring technique is essential for studying
DNA-protein complexes in magnetic tweezers. The reac-
tions have to be specific, biocompatible, and able to
withstand experimental conditions such as an applied
high force. We develop a novel technique for covalent
attachment that meets these criteria using copper-free
click chemistry, based on the reaction of DBCO with
azide (Scheme 1). By functionalizing DNA with DBCO
on one end (R1), we can covalently link it to an azide-
functionalized surface (R2). As we will show below, this
protocol results in a high-yield of DNA tethers, that are
torsionally constrained and able to withstand very high
forces (>100pN). This method is thus found to be suit-
able for specifically anchoring DNA-protein complexes
and measuring in the relevant force regime.
Methods
Magnetic tweezers
We used multiplexed magnetic tweezers [29], as illus-
trated in Fig. 2a. Two 5 mm cube magnets (Supermag-
nete, N50) are mounted in vertical orientation [30], with
a very small (0.3 mm) gap in between them. A red LED
provides illum ination through the magnet holder onto
the flow cell. We use a 50x objective (Nikon) with an
achromatic doublet tube lens (200 mm) to provide 50x
magnification and image the focal plane onto a CCD
camera (Dalsa Falcon 4 M60). Beads are tracked in real
time with custom software (Labview, National Instru-
ments) and images are also saved for later analysis [31].
Reference beads are used to correct for drift. The ap-
plied force is determined from the Brownian motion of
Fig. 1 Common DNA tethering techniques. a Binding of a digoxygenin-functionalized DNA-protein complex to an anti-digoxygenin-coated surface.
This reaction is specific, but unstable when high forces are applied. b Binding of an amine-functionalized DNA-protein complex to a carboxyl-coated
surface. Both the functionalized DNA (black arrow) and native lysine gro ups in the protein (bl ue arrow) bind the surface. c. Binding of a
thiol-functionalized DNA-protein complex to a maleimide-coated surface. Both the functionalized DNA (black arrow) and native cysteine
groups in the protein (blue arrow) bind t he sur face
Eeftens et al. BMC Biophysics (2015) 8:9 Page 2 of 7
the magnetic bead [32, 33]. For force-extension curves,
we perform dynamic force microscopy where the force
is increased over time with a constant loading rate of 1
pN/second.
DNA constructs
A 20678 bp pSupercos1 plasmid was made by removal
of the MluI fragment from pSupercos1 (Stratagene) and
insertion of two lambda fragments. This Plasmid DNA
was isolated with midiprep (Qiagen), restricted with
XhoI and NotI.HF (New England Biolabs), and purified
(Wizard® SV Gel and PCR Clean-Up System, Promega),
resulting in a 20 kb fragment.
DB CO and biotin labeled handles were prepared by
PCR on a pbluescriptIISK+ template (Stratagene) with a
taq polymerase (GoTaq, Promega) and the addition of
Biotin-16-dUTP (Roche), or 5-DBCO-dUTP (Jena-
bioscience) to the nucleotide mixture respectively. The
forward primer was: GACCGAGATAGGGTTGAGTG,
and reverse primer: CAGGGTCGGAACAGGAGAGC.
The biotin-handle was digested with XhoI resulting in
554 bp and 684 bp fragme nts. The DBCO-handle was
digested with NotI.HF resulting in 624 bp and 614 bp
fragments. The handles were purified (Wizard® SV Gel
and PCR Clean-Up System, Promega), combined with
the restricted plasmid DNA and ligated with T4 DNA
ligase (Promega) overnight at 16 °C. The tweezer-
construct wa s then purified again (Wizard® SV Gel and
PCR Clean-Up System, Promega).
Surface functionalization and flow cell assembly
For making amine-coated flow cells, coverslips (Menzel
Glaser, 24x60mm, thickness #1) were cleaned in an O
2
plasma cleaner for 30 s, which ensures activation of the
silanol groups. Coverslips were then treated with 2 %
APTES in acetone for 10 min, rinsed with MilliQ and
air-dried. Before flow cell assembly, polystyrene beads
(Polysciences Europe GmbH) were pipetted onto the
coverslip and spread with the side of a pipette tip. These
non-motile surface-bound beads serve as reference
Fig. 2 Magnetic tweezers set-up for measuring on a tethered DNA molecule. a Schematic of the set-up. A LED illuminates the flow cell through a
lens and the magnet holder. Imaging is done with a 50x Nikon objective onto a CCD camera. Magnets manipulate a magnetic bead attached to
the DNA. b A flow cell is constructed with 24x60mm coverslips. The bottom coverslip is amine-coated and has reference beads bound to it. The
top coverslip has sandblasted holes to allow fluid flow. Parafilm is used to seal the coverslips and to create a ˜50 μl flow cell volume. c Schematic of a
tethered DNA molecule. A DNA molecule is linked to a streptavidin-coated magnetic bead with biotin, and to azide groups on the surface with DBCO
at the other end
Scheme 1 Cycloaddition between dibenzocyclooctyl and azide
Eeftens et al. BMC Biophysics (2015) 8:9 Page 3 of 7
beads for drift correction. The amine-coated coverslips
were then aligned with a pre-cut parafilm gasket and an-
other cover slip (Fig. 2b). The assembled flow cell was
put on a hot plate at 90 °C until the parafilm was suffi-
ciently melted to prevent fluid leakage. The applied heat
also firmly binds the polystyrene reference beads to the
surface.
DNA Anchoring
To anchor the DBCO-functionalized DNA to the amine-
coated flow cell, we used bifunctionalized PEG
4
-linkers
with an N-hydroxysuccimide (NHS) ester on one end and
an azide group on the other (CLK-AZ103, Jenabioscience
GmbH, Germany). We mixed azide-functionalized PEG-
linkers with CH
3
-terminated PEG-linkers of the same
length (MS(PEG)4, Life technologies) in PBS buffer to
passivate the surface and prevent aspecific binding. Both
PEG-linkers were dissolved in DMSO before further
diluting in PBS. To prevent hydrolysis of the NHS ester,
the PEG mixture in PBS was prepared shortly before fill-
ing the flow cell via capillary action through pipetting the
fluid into one flow cell hole of the amine-coated flow cell.
The MS-PEG-linker concentration was held constant at
50 mM, while the Azide-PEG concentration was varied
(0-50 mM). PEG-linkers incubated in the amine-coated
flow cell for 1 h at room temperature, to allow the NHS-
ester group to attach to the amine groups in the flow cells
(Fig. 3). Next, the flow cell was flushed with washing buf-
fer (20 mM Tris, 5 mM EDTA, pH7.4), to stop the reac-
tion and remove excess PEG. Streptavidin-coated beads
(M270 Streptavidin coated, Life Technologies) were incu-
bated with the biotin-functionalized DNA for 20 min.
After incubation, the beads were washed 3 times with
washing buffer with 0.05 % Tween. An overabundance of
DNA-bound beads was then dissolved in 50 μl washing
buffer with 0.05 % Tween and flushed into the flow cell.
Fig. 3 Stepwise linkage of DNA to the surface with copper-free click chemistry. Bifunctionalized PEG-linkers are attached to an amine-coated
surface via their NHS group. The NHS ester on the PEG conjugates to the amine on the surface. Non-reactive PEG linkers (terminated with a
CH
3
-group) are used to passivate the surface. Finally, a DBCO group on DNA clicks with the azide and thus forms a covalent bond between the
DNA and the surface
Eeftens et al. BMC Biophysics (2015) 8:9 Page 4 of 7
Beads were incubated for 1 h, to allow the DBCO to click
with the azide (Fig. 3). Finally, the flow cell was washed
with washing buffer until no more unbound beads were
visible.
Control experiment
For control experiments, we used a dig-functionalized
DNA construct. The dig handle was constructed in the
same matter as the DBCO handle described above, but in-
stead dig-11-dUTP was used (Digoxygenin-11-dUTP,
Roche). Coverslips were cleaned in acetone for 30 min in
a sonicator for creating the flow cells. After air-drying,
they were coated with 1 % nitrocellulose (Invitrogen) in
amylacetate (Sigma Aldrich). Application of reference
beads and assembly of flow cells proceeded as described
above. Next, nitrocellulose-coated flow cells were incu-
bated with 100 mM anti-dig antibodies (Fab-fragment,
Roche) for 30 min. After washing as described above, the
surface was passivated with 10 mg/ml BSA (Bioke) for 1 h.
Preparation of beads proceeded as described above. Beads
with digoxygenin-functionalized DNA then incubated in
the flow cell for 10 min. Finally, the flow cell was washed
with washing buffer until no more unbound beads were
visible.
Results and Discussion
We developed a protocol to covalently attach biomole-
cules in a magnetic tweezers flow cell using copper-free
click chemistry. As described in Methods, we coat the
glass surface with azide-functionalized PEG-linkers, and
attach DBCO-tagged DNA through the azide-group,
thereby covalently linking the DNA molecule at one end
to the surfa ce.
The DBCO-functionalized DNA thus covalently at-
taches to the azide-coated flow cell while the biotin
groups at the other end of the DNA attach to the bead.
The amount of these DNA tethers is expected to scale
with the amount of clickable groups on the surface. To
verify the protoco l, we varied the density of the azide
groups on the surface by using different concentrations
of the PEG-linking groups. We determined the tether
density by manually counting the number of successful
DNA tethers in our field of view (0.02 mm
2
), for differ-
ent azide-PEG concentrations. As expected, we found
that the number of tethers increased linearly with in-
creasing azide-PEG concentrations, see Fig. 4. Import-
antly, when no azide-functionalized PEG-linkers were
added, no tethers of the expected length were observed.
This shows that the steps in the protocol are specific
and that, conveniently, the tether density is tunable.
Our DNA tethers anchored with copper-free click
chemistry are able to withstand high forc e. We an-
chored 20 kb DNA molecules using copper-free click
chemistry and tracked the position of the magnetic
beads (corresponding to the end-to-end length of the
DNA) while applying a force ramp of 1pN/sec. A s
showninFig.5,thetethered double-stranded DNA
molecules show the expected behavior, viz., with in-
creasing end-to-end distance we observe a strongly ris-
ing force, a plateau as the DNA overstretches , and a
further rise. As expected, for torsionally unconstrained
molecules , overstretching of the double-stranded DNA
is observed at about 65pN [34]. Torsionally constrained
DNAmolecules(depictedingreyinFig.5a)areex-
pected to show overstretching at a force of about
110pN, a force that, unfortu na tely, is just beyond the
Fig. 4 Tether density as a function of PEG concentration. DNA tether density for different Azide-PEG concentrations. The number of tethers
increases linearly with increasing PEG concentration. Inset shows an example of a reference bead (left) and three beads that signal 20 kb DNA
molecules tethered with click chemistry
Eeftens et al. BMC Biophysics (2015) 8:9 Page 5 of 7
reach of our set-up [35]. We find an avera ge contour
length of 6.75 ± 0.04 μm (as measured from the exten-
sion just before the overstretching plateau), indicating
correct attachment of the DNA molec ules at the func-
tional end groups. Most importantly , the tethers can
withstand a force of >100pN (Fig. 5a). The tethers re-
main stable at this high force for over 12 h, allowing
ample time for measurements. By contrast, DNA mole-
cules attache d with the conventional anti-dig tag break
off well before the overstretching force (cf. the black
lineinFig.5a).Inaddition,asshowninFig.5b,the
click-chemistry-assembled DNA tethers can be torsion -
ally constrained, which allows for DNA supercoiling
studies with magnetic tweezers. For the described con-
ditions , we found half of the tethers to be coilable. Loss
of torsional constrain is likely induced by nicking of the
DNA. The new attachment strategy is thus found to be
suitable for both high force and torque measurements.
In contrast to the binding of DBCO to azide, the bond
between biotin and streptavidin on the other end of the
DNA is not covalent. Yet, as can be observed from Fig. 5,
this bond also withsta nds forces of >100pN, which is
consistent with earlier reports [17, 18]. For a wide range
of applications , the current method, with tethers that
contain a mutually orthogonal DBCO/azide bond on
one end and biotin/streptavidin on the other, will suffice.
Double copper-free click chemistry (with orthogonal
click reactions at both bead and surface) can be consid-
ered in future applications if even much higher forces
are desired.
The copper-free click chemistry attachment strategy
presents many advantages. The reaction between DBCO
and azide is relatively fast, specific, it does not require a
catalyst, and, importantly for some applications, it can
be performed in physiological conditions. Furthermore,
azide and DBCO groups are relatively small and inert to
biological moieties [27] and thus easy to incorporate.
There are already numerous examples of the application
of SPAAC reactions in biological systems and even living
cells [28, 36]. Examples include use of copper-free click
chemistry in non-canonical amino acids [37], imaging in
live cells [38], joining of DNA strands [39], and DNA-
functionalized nanoparticles [40].
Above, we demonstrated the use of a new DNA-
attachment method in magnetic tweezers. We note that
it can easily be applied to other single-molecule methods
as well. For example, in the same manner, polystyrene
beads could be coated with click chemistry functional
groups for use in optical tweezers. By immobilizing the
PEG linkers on the surface, the same copper-free click
chemistry can also be used in atomic force microscopy
[41], flow stretching and DNA combing.
Single-mole cule force spectroscopy opens up the pos-
sibility to apply and measure forces on biomolecules,
and study DNA-protein interactions. These in vitro ex-
periments with bare DNA and purified protein give great
insights into the cell machinery, but purified complexes
are taken out of their cellular context. As our new
method does not cross-react, it is possible to anchor and
measure complexes that are directly extracted from cell
lysate. Measuring on this native state of biomolecules
can be expected to yield new insight into interactions
between biomolecules.
Conclusions
Traditional methods for anchoring biomolecules have
encountered limitations in studying DNA-protein com-
plexes in magnetic tweezers related to low force stability
Fig. 5 Anchored DNA molecules can be torsionally constrained and withstand forces of >100pN. a The DNA molecules anchored with click
chemistry show the expected behavior (a strongly rising force, and for unconstrained molecules, a plateau near 65pN as DNA overstretches and
a further rise) in a slow force ramp of 1pN/sec. Different colors represent different tethers. All tethers that were bonded by click chemistry withstand
forces of over 100pN. By contrast, the DNA anchored with digoxygenin/anti-dig (black) breaks off near 40pN, well before the overstretching point.
b Rotation curves at constant forces of (light to dark) 0.5, 1, 3 and 5pN, indicating that this 20 kb DNA molecule anchored with click chemistry is
torsionally constrained
Eeftens et al. BMC Biophysics (2015) 8:9 Page 6 of 7
and cross reactivity. Here, we developed a method for
covalently anchoring biomolecules with copper-free click
chemistry, using the reaction between DBCO and azide.
This reaction is bio-orthogonal and no catalyst is
needed. Furthermore, it is highly specific and it resists
high force (>100pN). The protocol is reproducible, fast
and uses commercially available reagents. Perhaps most
excitingly, covalently linking molecules with copper-free
click chemistry opens up the possibility to measure on a
wide variety of DNA-protein complexes and complexes
isolated from cell lysate.
Competing insterests
The authors declare that they have no competing interests.
Authors’ contributions
JE, JvdT: conceived and designed the experiments. JE: performed the
experiments, analyzed the data. JE, JvdT, DB: contributed materials/analy sis
tools. JE, JvdT, DB, CD: wrote the paper. All authors read and approved the
final manuscript.
Authors’ information
Not applicable.
Acknowledgements
We thank Jacob Kerssemakers for technical support and Richard Janissen for
discussions. This work was supported by the ERC Advanced Grant
NanoforBio (No. 247072) and by The Netherlands Organization for Scientific
Research (NWO/OCW), as part of the Frontiers of Nanoscience program.
Received: 24 April 2015 Accepted: 16 September 2015
References
1. Neuman KC, Nagy A. Single-molecule force spectroscopy: optical tweezers,
magnetic tweezers and atomic force microscopy. Nat Methods. 2008;5:491–505.
2. Vogel V, Sheetz M. Local force and geometry sensing regulate cell
functions. Nat Rev Mol Cell Biol. 2006;7:265–75.
3. Wang JH-C, Thampatty BP. An introductory review of cell mechanobiology.
Biomech Model Mechanobiol. 2006;5:1–16.
4. Rape AD, Guo W-H, Wang Y-L. The regulation of traction force in relation to
cell shape and focal adhesions. Biomaterials. 2011;32:2043–51.
5. Yin H, Wang MD, Svoboda K, Landick R, Block SM, Gelles J. Transcription
Against an Applied Force. Science. 1995;270(80-):1653–7.
6. Chemla YR, Aathavan K, Michaelis J, Grimes S, Jardine PJ, Anderson DL, et al.
Mechanism of force generation of a viral DNA packaging motor. Cell.
2005;122:683–92.
7. Nicklas RB. The forces that move chromosomes in mitosis. Annu Rev
Biophys Biophys Chem. 1988;17:431–49.
8. Nicklas RB. Measurements of the force produced by the mitotic spindle in
anaphase. J Cell Biol. 1983;97:542–8.
9. Jannink G, Duplantier B, Sikorav JL. Forces on chromosomal DNA during
anaphase. Biophys J. 1996;71:451–65.
10. Brock J, Bloom K. A chromosome breakage assay to monitor mitotic forces
in budding yeast. J Cell Sci. 1994;107:891–902.
11. De Vlaminck I, Vidic I, van Loenhout MTJ, Kanaar R, Lebbink JHG, Dekker C.
Torsional regulation of hRPA-induced unwinding of double-stranded DNA.
Nucleic Acids Res. 2010;38:4133–42.
12. Xiao B, Johnson R, Marko J. Modulation of HU–DNA interactions by salt
concentration and applied force. Nucleic Acids Res 2010;38(18):6176–6185.
13. Revyakin A, Ebright RH, Strick TR. Promoter unwinding and promoter
clearance by RNA polymerase: detection by single-molecule DNA
nanomanipulation. Proc Natl Acad Sci U S A. 2004;101:4776–80.
14. Vlijm R, Smitshuijzen JSJ, Lusser A, Dekker C. NAP1-assisted nucleosome
assembly on DNA measured in real time by single-molecule magnetic
tweezers. PLoS One. 2012;7:e46306.
15. Van Loenhout MTJ, van der Heijden T, Kanaar R, Wyman C, Dekker C. Dynamics
of RecA filaments on single-stranded DNA. Nucleic Acids Res. 2009;37:4089–99.
16. Vlijm R, Lee M, Lipfert J, Lusser A, Dekker C, Dekker NH. Nucleosome
Assembly Dynamics Involve Spontaneous Fluctuations in the Handedness
of Tetrasomes. Cell Rep. 2015;10:216–25.
17. De Odrowaz PM, Czuba P, Targosz M, Burda K, Szymoński M. Dynamic force
measurements of avidin-biotin and streptavdin-biotin interactions using
AFM. Acta Biochim Pol. 2006;53:93–100.
18. Janissen R, Berghuis B a, Dulin D, Wink M, van Laar T, Dekker NH: Invincible
DNA tethers: covalent DNA anchoring for enhanced temporal and force
stability in magnetic tweezers experiments. Nucleic Acids Res 2014:1–10
19. Neuert G, Albrecht C, Pamir E, Gaub HE. Dynamic force spectroscopy of the
digoxigenin-antibody complex. FEBS Lett. 2006;580:505–9.
20. Walsh MK, Wang X, Weimer BC. Optimizing the immobilization of single-
stranded DNA onto glass beads. J Biochem Biophys Methods. 2001;47:221–31.
21. Janissen R, Oberbarnscheidt L, Oesterhelt F. Optimized straight forward
procedure for covalent surface immobilization of different biomolecules for
single molecule applications. Colloids Surf B Biointerfaces. 2009;71:200–7.
22. Wildling L, Unterauer B, Zhu R, Rupprecht A, Haselgrübler T, Rankl C, et al.
Linking of sensor molecules with amino groups to amino-functionalized
AFM tips. Bioconjug Chem. 2011;22:1239–48.
23. Riener CK, Kienberger F, Hahn CD, Buchinger GM, Egwim IOC, Haselgrübler
T, et al. Heterobifunctional crosslinkers for tethering single ligand molecules
to scanning probes. Anal Chim Acta. 2003;497:101–
14.
24. Grandbois M. How Strong Is a Covalent Bond? Science. 1999;283(80-):1727–30.
25. BestRB,PaciE,HummerG,DudkoOK.Pullingdirectionasareactioncoordinatefor
the mechanical unfolding of single molecules. J Phys Chem B. 2008;112:5968–76.
26. Dufrêne YF, Evans E, Engel A, Helenius J, Gaub HE, Müller DJ. Five
challenges to bringing single-molecule force spectroscopy into living cells.
Nat Methods. 2011;8:123–7.
27. Sletten EM, Bertozzi CR. Bioorthogonal chemistry: fishing for selectivity in a
sea of functionality. Angew Chem Int Ed Engl. 2009;48:6974–98.
28. Agard NJ, Prescher J a, Bertozzi CR. A strain-promoted [3 + 2] azide-alkyne
cycloaddition for covalent modification of biomolecules in living systems.
J Am Chem Soc. 2004;126:15046–7.
29. De Vlaminck I, Henighan T, van Loenhout MTJ, Burnham DR, Dekker C.
Magnetic forces and DNA mechanics in multiplexed magnetic tweezers.
PLoS One. 2012;7:e41432.
30. Te Velthuis AJW, Kerssemakers JWJ, Lipfert J, Dekker NH. Quantitative
guidelines for force calibration through spectral analysis of magnetic
tweezers data. Biophys J. 2010;99:1292–302.
31. Van Loenhout MTJ, Kerssemakers JWJ, De Vlaminck I, Dekker C. Non-bias-
limited tracking of spherical particles, enabling nanometer resolution at low
magnification. Biophys J. 2012;102:2362–71.
32. Lipfert J, Hao X, Dekker NH. Quantitative modeling and optimization of
magnetic tweezers. Biophys J. 2009;96:5040–9.
33. Wong WP, Halvorsen K. The effect of integration time on fluctuation
measurements: calibrating an optical trap in the presence of motion blur.
Opt Express. 2006;14:12517–31.
34. Smith SB, Cui Y, Bustamante C. Overstretching B-DNA: The Elastic Response
of Individual Double-Stranded and Single-Stranded DNA Molecules. Science.
1996;271(80-):795–9.
35. Léger JF, Romano G, Sarkar A, Robert J, Bourdieu L, Chatenay D, et al.
Structural Transitions of a Twisted and Stretched DNA Molecule. Phys Rev
Lett. 1999;83:1066–9.
36. Jewett JC, Bertozzi CR. Cu-free click cycloaddition reactions in chemical
biology. Chem Soc Rev. 2010;39:1272.
37. Link AJ, Vink MKS, Agard NJ, Prescher JA, Bertozzi CR, Tirrell DA. Discovery of
aminoacyl-tRNA synthetase activity through cell-surface display of
noncanonical amino acids. Proc Natl Acad Sci U S A. 2006;103:10180–5.
38. Baskin JM, Prescher J a, Laughlin ST, Agard NJ, Chang PV, Miller I a, et al.
Copper-free click chemistry for dynamic in vivo imaging. Proc Natl Acad Sci
U S A. 2007;104:16793–7.
39. Qiu J, El-Sagheer AH, Brown T. Solid phase click ligation for the synthesis of
very long oligonucleotides. Chem Commun (Camb). 2013;49:6959–61.
40. Heuer-Jungemann A, Kirkwood R, El-Sagheer AH, Brown T, Kanaras AG.
Copper-free click chemistry as an emerging tool for the programmed ligation
of DNA-functionalised gold nanoparticles. Nanoscale. 2013;5:7209–12.
41. Hinterdorfer P, Gruber HJ, Kienberger F, Kada G, Riener C, Borken C, et al.
Surface attachment of ligands and receptors for molecular recognition force
microscopy. Colloids Surfaces B Biointerfaces. 2002;23:115–23.
Eeftens et al. BMC Biophysics (2015) 8:9 Page 7 of 7
