Administration of Lactobacillus helveticus NS8 improves behavioral, cognitive, and biochemical aberrations caused by chronic restraint stress

Abstract

Increasing numbers of studies have suggested that the gut microbiota is involved in the pathophysiology of stress related disorders. Chronic stress can cause behavioral, cognitive, biochemical, and gut microbiota aberrations. Gut bacteria can communicate with the host through the microbiota-gut-brain axis (which mainly includes the immune, neuroendocrine, and neural pathways) to influence brain and behavior. It is hypothesized that administration of probiotics can improve chronic-stress-induced depression. In order to examine this hypothesis, the chronic restraint stress depression model was established in this study. Adult SPF Sprague-Dawley rats were subjected to 21 days of restraint stress followed by behavioral testing (including the sucrose preference test, elevated-plus maze test, open-field test, object recognition test, and object placement test) and biochemical analysis. Supplemental Lactobacillus helveticus NS8 was provided every day during stress until the end of experiment, and SSRI citalopram served as a positive control. Results showed that Lactobacillus helveticus NS8 improved chronic restraint stress induced behavioral (anxiety and depression) and cognitive dysfunction, showing an effect similar to and better than that of citalopram. Lactobacillus helveticus NS8 also resulted in lower plasma corticosterone and adrenocorticotropic hormone levels, higher plasma IL-10 levels, restored hippocampal 5-HT and NE levels, and more hippocampal BDNF mRNA expression than in chronic stress rats. Taken together, these results indicate an anti-depressant effect of Lactobacillus helveticus NS8 in rats subjected to chronic restraint stress depression and that this effect could be due to the microbiota-gut-brain axis. They also suggest the therapeutic potential of Lactobacillus helveticus NS8 in stress-related and possibly other kinds of depression.

Full text

ADMINISTRATION OF LACTOBACILLUS HELVETICUS NS8 IMPROVES
BEHAVIORAL, COGNITIVE, AND BIOCHEMICAL ABERRATIONS
CAUSED BY CHRONIC RESTRAINT STRESS
S. LIANG,
a,b
T. WANG,
a
X. HU,
a
J. LUO,
c
W. LI,
a,b
X. WU,
a,b
Y. DUAN
a
AND F. JIN
a
*
a
Key Laboratory of Mental Health, Institute of Psychology,
Chinese Academy of Sciences, Beijing, China
b
University of Chinese Academy of Sciences, Beijing, China
c
Teacher Education College, Sichuan Normal University, Chengdu,
China
Abstract—Increasing numbers of studies have suggested
that the gut microbiota is involved in the pathophysiology
of stress-related disorders. Chronic stress can cause
behavioral, cognitive, biochemical, and gut microbiota
aberrations. Gut bacteria can communicate with the host
through the microbiota–gut–brain axis (which mainly includes
the immune, neuroendocrine, and neural pathways) to
influence brain and behavior. It is hypothesized that
administration of probiotics can improve chronic-stress-
induced depression. In order to examine this hypothesis,
the chronic restraint stress depression model was established
in this study. Adult specific pathogen free (SPF) Sprague–
Dawley rats were subjected to 21 days of restraint stress
followed by behavioral testing (including the sucrose
preference test (SPT), elevated-plus maze test, open-field
test (OFT), object recognition test (ORT), and object place-
ment test (OPT)) and biochemical analysis. Supplemental
Lactobacillus helveticus NS8 was provided every day during
stress until the end of experiment, and selective serotonin
reuptake inhibitor (SSRI) citalopram (CIT) served as a
positive control. Results showed that L. helveticus NS8
improved chronic restraint stress-induced behavioral
(anxiety and depression) and cognitive dysfunction, showing
an effect similar to and better than that of CIT. L. helveticus
NS8 also resulted in lower plasma corticosterone (CORT)
and adrenocorticotropic hormone (ACTH) levels, higher
plasma interleukin-10 (IL-10) levels, restored hippocampal
serotonin (5-HT) and norepinephrine (NE) levels, and more
hippocampal brain-derived neurotrophic factor (BDNF) mRNA
expression than in chronic stress rats. Taken together, these
results indicate an anti-depressant effect of L. helveticus
NS8 in rats subjected to chronic restraint stress depression
and that this effect could be due to the microbiota–gut–brain
axis. They also suggest the therapeutic potential of
L. helveticus NS8 in stress-related and possibly other kinds
of depression. Ó2015 IBRO. Published by Elsevier Ltd. All
rights reserved.
Key words: Lactobacillus helveticus, chronic restraint stress,
depression, microbiota–gut–brain axis, BDNF, serotonin.
INTRODUCTION
Stress is unavoidable. Chronic uncontrollable stress is
especially detrimental. Stressful life events can impair
digestion, immune responses, endocrine function, brain
function, behavior, and cognition. It is possible that they
may also induce a variety of diseases such as functional
gastrointestinal disorders and mental disorders, including
major depression, anxiety, post-traumatic stress disorder,
and drug addiction (Kessler, 1997; Wichers and Maes,
2002; Hammen, 2005; Alexander et al., 2007; Cleck and
Blendy, 2008; Lupien et al., 2009; Marin et al., 2011;
Moloney et al., 2014). And the chronic stress model is very
common in animal studies (maternal separation, chronic
unpredictable mild stress, chronic restraint stress, etc.) to
mimic the etiology and pathophysiology of human depres-
sive disorder (Glavin et al., 1994; McArthur and Borsini,
2006; Abelaira et al., 2013). However, less is known about
the effects of stress on intestinal microbiota. Chronic stress
(including chronic restraint stress, maternal separation,
social disruption, dietary and environmental stress) can dis-
rupt the microbiota integrity, reduce the microbiota diversity
and richness (Tannock and Savage, 1974; Bailey and
Coe, 1999; O’Mahony et al., 2009; Bailey et al., 2010,
2011). Different bacteria respond differently under stress.
Levels of beneficial bacteria, such as genus Lactobacillus
(LB), have been found to decrease quickly after stress, the
populations of neutral and harmful bacteria like Citrobacter
rodentium and genus Clostridium increased significantly
(Tannock and Savage, 1974; Holdeman et al., 1976
March; Bailey and Coe, 1999; Bailey et al., 2010;
Bangsgaard Bendtsen et al., 2012; Park et al., 2013;
Bailey, 2014; Galley et al., 2014).
Until recently, scientists have started to realize the
great importance of gut microbiota, as evidenced by the
booming study of the human microbiome (the human
http://dx.doi.org/10.1016/j.neuroscience.2015.09.033
0306-4522/Ó2015 IBRO. Published by Elsevier Ltd. All rights reserved.
*Corresponding author.
Abbreviations: 5-HT, serotonin; ACTH, adrenocorticotropic hormone;
BDNF, brain-derived neurotrophic factor; CIT, citalopram; CON, control
group; CORT, corticosterone group; CRS, chronic restraint stress
group; DA, dopamine; ELISA, enzyme-linked immunosorbent assay;
EPM, elevated plus-maze; HPA, hypothalamic–pituitary–adrenal;
IDO, indoleamine-2,3-dioxygenase; IL-10, interleukin-10; INF-c,
interferon-gama; LB, lactobacillus; NE, norepinephrine; OFT, open-
field test; OPT, object placement test; ORT, object recognition test;
PFC, prefrontal cortex; qPCR, quantitative real-time polymerase chain
reaction; SPF, specific pathogen free; SPT, sucrose preference test;
SSRI, selective serotonin reuptake inhibitor; TDO, tryptophan-2,3-
dioxygenase; TNF-a, tumor necrosis factor-alpha.
Neuroscience 310 (2015) 561–577
561

second genome-metagenome) (Human Microbiome
Project, 2012a,b; Nicholson et al., 2012; Yatsunenko
et al., 2012). The human intestinal tract is a set of
microbe-friendly organs where approximately 10
14
of var-
ious microbes live. Collectively, they have more than 200
times as many genes as humans. They are indispensable
to health and disease (Lyte, 2010; Burcelin et al., 2013).
Without gut microbiota, the host would present dysfunc-
tion of the digestive system, immune system, neuroen-
docrine system, nervous system, behavior, and
cognition (Diamond et al., 2011; Al-Asmakh et al., 2012;
Manco, 2012; Clarke et al., 2013; Davari et al., 2013; Di
Mauro et al., 2013; Crumeyrolle-Arias et al., 2014;
Desbonnet et al., 2014). In other words, gut microbiota
are essential to system development and the maturation
of function (Clemente et al., 2012; Morgan et al., 2013).
The normal balance of gut microbiota is also of great
importance to the health of the host (Eloe-Fadrosh and
Rasko, 2013). Many diseases, including cardiovascular,
metabolic, autoimmune, neurodevelopment, and even
psychiatric disorders, have been shown to be correlated
with gut microbiota dysbiosis (Wang et al., 2011;
Bekkering et al., 2013; Moloney et al., 2014; Wang and
Kasper, 2014; Borre et al., 2014b).
Most researchers regard microbiota–gut–brain axis as
the bidirectional communication pathway between brain
and gut bacteria (Cryan and O’Mahony, 2011; Grenham
et al., 2011; Borre et al., 2014a). The main pathways of
microbiota–gut–brain axis are nerve routes (including
vagus nerve, neurotransmitters, and neurogenesis),
endocrine routes, and immune routes (Desbonnet et al.,
2008b; Ochoa-Reparaz et al., 2010a; Bravo et al., 2011;
Sudo, 2014; Ogbonnaya et al., 2015). Interestingly, these
routes are also involved in the pathophysiology of major
depression. The brain neurogenesis (especially in the hip-
pocampus) and the brain-derived neurotrophic factor
(BDNF) levels are reduced in depression patients
(Marije aan het Rot et al., 2009). The monoamine neuro-
transmitters deficiency is an important cause of depres-
sion and a most common antidepressant treatment
target (Hamon and Blier, 2013). The hypothalamic–pitui
tary–adrenal (HPA) system is disturbed and stress hor-
mones are hyper-secreted in patients with severe depres-
sion (Barden, 2004). Inflammation is another character of
depression, the proinflammatory cytokines levels (includ-
ing IL-6, tumor necrosis factor-alpha (TNF-a) and IFN-c)
are usually enhanced while the anti-inflammatory cytoki-
nes (like interleukin-10 (IL-10)) are usually reduced
(Schiepers et al., 2005; Rook and Lowry, 2008). Through
the microbiota–gut–brain axis, the brain can influence gut
bacteria by modulating gut physiological status, and the
composition and variation of intestinal microbiota can
change the central nervous system and behavior (Rhee
et al., 2009; Foster, 2013; Montiel-Castro et al., 2013).
Pathogenic bacteria like C. rodentium and Campylobacter
jejuni infection increased anxiety-like behavior and
caused memory dysfunction (Lyte et al., 2006; Goehler
et al., 2008; Gareau et al., 2011). Probiotics like some
LB species and some Bifidobacterium species administra-
tion caused improvement in the host (Desbonnet et al.,
2008b, 2010; Bercik et al., 2010, 2011; Bravo
et al., 2011; Arseneault-Breard et al., 2012; Davari
et al., 2013; Savignac et al., 2014, 2015). Probiotics are
defined as ‘‘live microorganisms which when adminis-
tered in adequate amounts confer a health benefit on
the host” (FAO and WHO, 2001).
LB species are one of the most important types of
probiotics (Ljungh and Wadstro
¨m, 2006). In the same time,
genus LB is widely distributed on inner and outer surfaces
of the human body and throughout the entire digestive tract
(Human Microbiome Project, 2012b; Russo et al., 2014). It
is an essential member of gut microbiota and plays great
role in host health (Evaldson et al., 1982; Ljungh and
Wadstro
¨m, 2006; Clemente et al., 2012; Vyas and
Ranganathan, 2012; Human Microbiome Project, 2012b;
Eloe-Fadrosh and Rasko, 2013). For this reason, scientists
have paid a considerable amount of attention to the thera-
peutic effect that probiotics have on many kinds of diseases,
such as irritable bowel syndrome, inflammatory bowel dis-
eases, diabetes, chronic fatigue syndrome, hepatic
encephalopathy, and autism (O’Mahony et al., 2005;
Malaguarnera et al., 2007; Barouei et al., 2009; Kaur
et al., 2009; Rao et al., 2009; Ho
¨rmannsperger and Haller,
2010; Critchfield et al., 2011; Davari et al., 2013; Quigley
and Shanahan, 2014). During these studies, a few studies
have shown that ingestion of some LB strains could not only
rescue disorders but also attenuate emotional behavior and
impairment of cognition (Sullivan et al., 2009; Bravo et al.,
2011; Arseneault-Breard et al., 2012; Davari et al., 2013).
NS8 is a subspecies of Lactobacillus helveticus strain iso-
lated and identified by our own laboratory. It has been pro-
ven to attenuate anxiety and to improve cognition in
hyperammonemia rats (Luo et al., 2014), making similar
behavioral and cognition improving effects like other L. hel-
veticus strains (Messaoudi et al., 2011; Ohland et al., 2013;
Ohsawa et al., 2015).
Considering the modulation effects of some probiotics in
mood and cognition (Cryan and Dinan, 2012; Collins and
Bercik, 2013; Ohland et al., 2013; Tillisch et al., 2013;
Distrutti et al., 2014; Rook et al., 2014; Borre et al.,
2014a), it was here hypothesized that ingestion of some
LB species could decrease anxiety-like and depressive-
like behavior and promote cognition in depression. In order
to assess these effects, the effects of L. helveticus NS8
administration during stress were analyzed in rats with
citalopram (CIT) as a positive control. Anxiety-like behavior
was detected by open-field testing and an elevated plus
maze (EPM). Depressive-like behavior and cognitive func-
tion were assessed by modified sucrose preference test
(SPT), object recognition test (ORT), and object placement
test (OPT). To determine how L. helveticus NS8 influences
mood and cognition, plasma stress hormones, plasma
cytokines, and brain monoamine neurotransmitters were
also measured using enzyme-linked immunosorbent assay
(ELISA) kits. Brain BDNF mRNA expression was measured
using real-time PCR.
EXPERIMENTAL PROCEDURES
Animals
Adult male specific-pathogen-free (SPF) Sprague–
Dawley rats (weighing 220–240 g) were purchased from
Vital River Laboratories. Rats were individually housed
562 S. Liang et al. /Neuroscience 310 (2015) 561–577

during the experiment under standard laboratory
conditions (12/12 h light/dark cycle, lights on at 07:00 h;
22–24 °C, 40–60% humidity). After two weeks of
accommodation, rats were randomly divided into four
groups: control group (CON, n= 8), chronic restraint
stress group (CRS, n= 8), Lactobacillus group (LAC,
n= 8, given supplemental L. helveticus NS8), and
citalopram group (CIT, n= 8, given CIT hydrobromide).
In the CRS experiment (Fig. 1), rats (24/32) were
restrained in polypropylene cylinders (6 cm inner
diameter, with air vents at the nasal end of the cylinder
and length adjusted for each rat) 6 h/d for three weeks.
Body weight was measured every two days during the
stress paradigm. The entire experimental protocol was
approved by the Institutional Animal Care and Use
Committee of the Institute of Psychology of the Chinese
Academy of Sciences.
NS Lactobacillus and CIT administration
The L. helveticus NS8 strain was isolated from natural
fermented dairy from Mongolia grasslands in the
present laboratory. It was inoculated into MRS media
and incubated three times at 37 °C for 18 h each. Then
the L. helveticus NS8 strain was extracted by
centrifugation at 3000 rpm for 5 min and washed twice
with PBS buffer. The strain was resuspended in drinking
water at a concentration of 10
9
CFU/ml. The drinking
water was changed every day.
Using the serotonin (5-HT) reuptake inhibitor CIT as
positive control was very common in depression-related
researches (Desbonnet et al., 2010; Malkesman et al.,
2012). In the present study, the method of drug adminis-
tration was similar to Desbonnet 2010 (Desbonnet et al.,
2010). CIT hydrobromide (manufactured by H. Lundbeck
A/S. Copenhagen-DK and repackaged by Xian-Janssen
Pharmaceutical Ltd., Xi’an, Shaanxi Province, China)
was administered at a dose of 30 mg/kg body weight in
the drinking water of each rat. Water intake was moni-
tored 1 week prior to drug dosing and throughout the
experiment. Every two days, the quantity of CIT dissolved
in the drinking water was adjusted according to fluid
intake and body weight in order to maintain a 30 mg/kg
dosage throughout the experimental period.
Both LB and CIT were administrated until the
termination of the experiment.
Behavioral testing
SPT. The day after the stress period, all subjects
underwent behavioral testing. A modified version of
SPT, as described by Huynh et al. was used on day 21
after the end of restraint stress (Huynh et al., 2011).
The baseline SP contained a 5-day protocol. On the first
2 days, rats were given two bottles of tap water in the
home cage. On the third and fourth days, one of the
bottles of water was replaced by 1% sucrose solution.
On the fifth day, rats were deprived of food and water
for 6 h and then allowed one bottle of tap water and one
bottle of 1% sucrose solution to drink freely. The con-
sumption of tap water and 1% sucrose solution was
recorded over the following 1 h. The positions of these
bottles were counterbalanced across rats and switched
during the test. The second SPT replicated the fifth day
protocol. Sucrose preference was tested for 1 h after the
end of restraint stress. Sucrose preference is expressed
as the relative amount of 1% sucrose consumption over
the total water consumption (the sum of 1% sucrose con-
sumption and tap water consumption).
EPM. On day 22, anxiety-related behavior was
assessed using EPM. The plus maze consists of two
opposite open arms (50 * 10 cm) and two opposite
closed arms (50 * 10 * 40 cm) connected by a 10-cm
square center, elevated 70 cm above the floor and
located in an appropriate observation room. The test
was performed under dim light conditions. Rats were
placed in the central area with their heads toward the
open arms. Rats were allowed to move freely for 5 min.
Their behavior was recorded by a CCD camera on an
IBM computer with ANYMAZE software. The number of
entries to open and closed arms and the time spent in
each arm were recorded automatically. After each rat
was tested, the EPM was cleaned with a 10% ethanol
solution in order to avoid interference in subsequent
tests from the animal’s odors or residues.
Open-field test (OFT). On day 23, rats were
introduced to an open-field apparatus (50 * 50 * 50 cm)
to measure anxiety-like behavior. Their behavior was
monitored for 5 min using a CCD camera. The images
were captured on an IBM computer with Image
ANYMAZE software. The distance traveled and the time
spent in central area (12.5 * 12.5 cm) were both
calculated automatically. The apparatus was cleaned
after each trial as in the EPM.
ORT and OPT. Memory was assessed using an ORT
on day 24 and OPT on day 25. All trials were conducted in
the open field apparatus. And the specific procedures
referred published researches (Beck and Luine, 2002;
Bowman et al., 2006). Each trial contained a sample trial
(T1) and a recognition trial (T2). The T1 was the same
across all tests but T2 differed between ORT and OPT.
Fig. 1. Brief schema for chronic restraint stress treatment and Lactobacillus and citalopram intervention. SPT: sucrose preference test; OFT:
open-field test; EPM: elevated plus-maze test; ORT: object recognition test; OPT: object placement test.
S. Liang et al. /Neuroscience 310 (2015) 561–577 563

The interval between T1 and T2 was 3 h in both tests. In
T1, two identical objects were placed at one end of the
open field and amount of time spent exploring the two
objects was recorded for 3 min. In T2 of ORT, one of
the objects was replaced with a different object and the
time spent exploring the old one (familiar object) and the
new (novel) object was recorded for 3 min. The relative
amount of time spent exploring the novel object over the
total exploration time during T2 served as an index of
object recognition. During T2 of OPT, one of these two
objects was placed in a new location. Then the time spent
exploring both objects, either in the new location or in the
old location, was recorded for 3 min. The relative amount
of time spent exploring the novel location over the total
exploration time during T2 served as an index of place-
ment recognition. Exploration was defined as when the
rat sniffed at, whisked at, or looked at the object from
no more than 2 cm away. The objects used for trials were
toy blocks of different shapes. The novel object was coun-
terbalanced across treatment. The field and all objects
were thoroughly cleaned with a 10% ethanol solution both
between T1 and T2 for individual animals and between
separate trials for each animal.
Animal termination and tissue dissection
On day 26, rats were quickly killed by decapitation, and
trunk blood samples were collected into pre-trilled
EDTA-coated tubes. Tubes were then centrifuged at
3000gat 4 °C for 10 min. The plasma was aspirated
and stored at 80 °C until further analysis. Whole brains
were rapidly removed and placed on ice-cold plates.
Then the prefrontal cortex (PFC) and hippocampus,
were quickly dissected, frozen in liquid nitrogen and
stored in 80 °C for further analysis.
Enzyme-linked immunosorbent assay (ELISA)
analysis
Plasma cytokines and stress hormones were common
biological indexes in chronic restraint stress model
(Naert et al., 2011; Voorhees et al., 2013). In the present
experiment, levels of plasma cytokines (including IL-10,
interferon-gama (INF-c), TNF-a) and stress hormones
corticosterone (CORT) and adrenocorticotropic hormone
(ACTH) were all measured using ELISA kits (Cusabio
Biotech Co., Ltd., Wuhan, China), according to the manu-
facturer’s instructions.
The PFC and hippocampus were two crucial parts for
cognition and mood regulation (Marije aan het Rot et al.,
2009; Duman and Duman, 2015). And the monoamine
transmitters’ content and BDNF mRNA expression in
these regions were often detected in animal behavior
studies (Desbonnet et al., 2010; Naert et al., 2011;
O’Mahony et al., 2011; Chiba et al., 2012). In the present
experiment, the right PFC and right hippocampus sam-
ples were homogenized in phosphate-buffered saline
(0.1 mol L
1
) on ice. The homogenate was centrifuged
(3500 rpm for 10, at 4 °C). The supernatants were aspi-
rated and stored at 80 °C until further analysis. Monoa-
mine neurotransmitters including 5-HT, norepinephrine
(NE), and dopamine (DA) in the supernatants were also
detected using ELISA kits (Cusabio Biotech Co., Ltd.,
Wuhan, China), according to the manufacturer’s
instructions.
Quantitative real-time polymerase chain reaction
(qPCR)
The total RNA in the left PFC and left hippocampus was
isolated using TRNzol reagent according to the
manufacturer’s instructions (Tiangen Biotech Co. Ltd.,
Beijing, China). Then the RNA samples were converted
to double-stranded cDNA using a TIANScript Reverse
Transcription Kit (Tiangen Biotech Co. Ltd., Beijing,
China). The cDNA samples collected were used in
subsequently qPCR for measurement of mRNA
expressions of GADPH (housekeeping gene, forward
5
0
–3
0
: ATGACTCTACCCACGGCAAG; reverse 5
0
–3
0
:
TACTCAGCACCAGCATCACC), and (BDNF, forward
5
0
–3
0
: AAGCCGAACTTCTCACATGATGA; reverse 5
0
–3
0
:
TGCAACCGAAGTATGAAATAACCATAG). The qPCR
reaction was performed in an Applied Biosystems7300
system using SYBRÒPremix Ex Taq
TM
(Takara Bio,
Japan). Using the 7300 SDS software, the relative
quantification of each sample was analyzed and each
mean 2
4CT
was calculated later. The BDNF mRNA
expression is presented as percentage related to
GADPH.
Statistical analysis
All data were presented as mean ± SEM. The body
weight data were analyzed by a repeated measures
analysis of variance (ANOVA). Other data were
analyzed by a one-way ANOVA. And the gene
expression data were logarithmic transformed before
ANOVA because of the heterogeneity of variance.
Tukey HSD testing was used for the post hoc test. A
correlation analysis was performed between behavioral
results and biological outcomes using Pearson’s
correlation coefficient (r
p
). Differences were considered
statistically significant when P< 0.05.
RESULTS
Body weight
The body weight was measured every two days from day
0 to day 21. Repeated measures ANOVA found a
significant effect of time (F(11,328) = 400.237, P<
0.001), time * treatment (F(33,308) = 15.975, P< 0.001),
and group (F(3,28) = 3.769, P= 0.02). Then one-way
ANOVA and post hoc test found chronic restraint stress
retarded the body weight growing from day 8 compared
to CON, while LB and CIT treatment could not promote
body weight gain, see Table 1.
SPT
The SPT was conducted on day 21 after the end of
restraint stress. ANOVA indicated significant differences
between four groups with respect to sucrose
consumption (F(3,28) = 9.68, P< 0.001) (Fig. 2). Post
hoc analyses revealed that the CRS group consumed
564 S. Liang et al. /Neuroscience 310 (2015) 561–577

less sucrose solution than the control group (P=0.001),
LAC group (P= 0.001) and CIT group (P= 0.001).
EPM
Chronic restraint stress influenced anxiety behavior in
EPM on day22 (Fig. 3), for time spent in open arms
F(3,28) = 5.789, P= 0.003, for open arm entries F(3,28) =
3.920, P= 0.019 and for closed arm entries F(3,28) =
7.276, P= 0.001. The CRS group rats entered the open
arms fewer times (P= 0.019) than control rats did. Rats
given L. helveticus NS8 stayed longer in open arms
than CRS rats (P= 0.017). And rats administrated with
CIT entries more times in closed arms than other groups.
OFT
In the OFT on day 23, chronic restraint stress also
affected rats
,
performance in center area (time in center
area F(3,28) = 3.089, P= 0.043; distance traveled in
the center area F(3,28) = 7.82, P= 0.001). As shown
in Fig. 4D, C, the CRS group stayed less time in the
center area (P= 0.03) and traveled less distance in
center area (P= 0.001) than the control group.
Ingestion of L. helveticus NS8 was associated with
more distance traveled in the center area (P= 0.002)
than in the CRS group. Administration of CIT did not
show any influence on behavior in the OFT.
ORT and OPT
Fig. 5A, B shows performance of rats in ORT. In ORT on
day 24, the four groups presented different exploration
patterns (F(3,27) = 4.802, P= 0.008). Chronic restraint
stress decreased the percentage of time exploring new
object compared to the control (P= 0.039). L. helveticus
NS8 was associated with more object exploration than in
the CRS groups (P= 0.025). CIT treatment showed no
effect in ORT.
Fig. 5C, D shows the performance of rats in OPTs on
day 25. There were significant differences between the
four groups in placement recognition (F(3,27) = 6.191,
P= 0.002). Post hoc tests showed that the CRS group
spent less time exploring the object in novel location
than control rats (P= 0.024), while LB and CIT groups
both showed more novel location exploration time than
the CRS group (P= 0.002 and P= 0.048, respectively).
Plasma CORT and ACTH levels
To elucidate the molecular basis of these behavioral
changes, we first measured the stress hormones in
plasma (Fig. 6). The four groups showed significant
differences in both CORT (F(3,28) = 18.905, P< 0.001)
and ACTH (F(3,28) = 9.559, P< 0.001) levels. The CRS
rats showed higher CORT (P= 0.011) and ACTH
(P= 0.02) levels than control rats. Administration of L.
helveticus NS8 was associated with lower CORT levels
and ACTH levels than in the CRS group (P<0.001 and
P= 0.019, respectively). Administration of CIT showed no
effect on either CORT or ACTH levels.
Plasma cytokines
The plasma pro-inflammatory cytokines IFN-cand TNF-a
and anti-inflammatory cytokine IL-10 were also detected
to evaluate the inflammatory situation (Fig. 7). A one-
way ANOVA displayed significant differences across
Table 1. Chronic restraint stress retarded the body weight growth
Day CON CRS CRS/LAC CRS/CIT
0 339.38 ± 6.28 344.25 ± 10.05 342.5 ± 6.83 340.88 ± 6.10
2 349 ± 7.64 338.25 ± 10.57 335.13 ± 6.65 327.75 ± 6.92
4 357.63 ± 7.18 340.13 ± 10.92 337.88 ± 6.45 331.13 ± 7.04
6 368 ± 7.61 343.13 ± 11.41 339.88 ± 5.49 335.25 ± 6.62
8 375.88 ± 7.65 344.38 ± 10.72*342.88 ± 5.69 337.88 ± 6.31
10 387.88 ± 7.91 351.13 ± 11.71
*
349 ± 6.34 346.88 ± 6.74
12 393 ± 8.31 354.88 ± 12.08
*
354.5 ± 6.76 352.38 ± 6.62
14 397.13 ± 8.73 357.63 ± 11.58
*
356.88 ± 7.26 359.13 ± 6.74
16 405.88 ± 9.21 364.63 ± 11.98
*
362 ± 7.28 364.63 ± 6.92
18 413.63 ± 9.27 365.25 ± 11.8
**
366.13 ± 7.4 367.25 ± 6.43
20 417.5 ± 8.79 366.25 ± 11.78
**
368.63 ± 6.77 372.63 ± 7.49
25 431.13 ± 10.57 389.88 ± 13.73
*
394.88 ± 8.90 390.88 ± 7.32
The body weight changes of four groups during the experiment are shown in the above table. All values are expressed as mean ± SEM. Groups:
N= 8/group.
*
P< 0.05,
**
P< 0.01 compared to the control.
Fig. 2. Lactobacillus helveticus NS8 supplementation increased
sucrose preferences in SPT as citalopram intervention did. Depres-
sion-related sucrose preferences were presented in the above figure.
All values are expressed as mean ± SEM. N= 8/group.
**
P< 0.01.
S. Liang et al. / Neuroscience 310 (2015) 561–577 565

groups in IL-10 content (F(3,28) = 19.263, P< 0.001),
IFN-ccontent (F(3,28) = 11.703, P< 0.001) and TNF-a
content (F(3,28) = 13.152, P< 0.001). As shown in
Fig. 7, chronic restraint stress increased IFN-c
(P= 0.003) levels and TNF-a(P= 0.05) levels,
decreased IL-10 levels (P=0.002) compared to the
control group. Although L. helveticus NS8 supplementation
did not change the IFN-cand TNF-alevels, it was
associated with higher IL-10 levels (P< 0.001) than in
the CRS group. Although CIT intervention did not
influence IL-10 levels it did reduce IFN-c(P= 0.004)
and TNF-a(P< 0.001) levels.
Fig. 3. Lactobacillus helveticus NS8 supplementation increased time spent in open arms in EPM while citalopram intervention did not. The anxiety-
related behaviors in the elevated plus maze are shown in the above figure. Panel A, panel C and panel E show the time spent in open arms, closed
arms and center areas individually. Panel B and panel D show the entries in open arms and closed arms respectively. All values are expressed as
mean ± SEM. N= 8/group.
*
P< 0.05,
**
P< 0.01.
566 S. Liang et al. / Neuroscience 310 (2015) 561–577

BDNF
The BDNF mRNA expression in the PFC and
hippocampus were measured to explain cognition-
related changes (Fig. 8). A one-way ANOVA after
logarithmic transformation (Log 10) showed the mRNA
expression to have significant differences in the
hippocampus (F(3,8) = 16.582, P= 0.001). Post hoc
testing showed that chronic restraint stress rendered
BDNF mRNA expression in the hippocampus
(P= 0.003) lower than in the control group, and L.
helveticus NS8 and CIT was associated with more
BDNF mRNA expression (P= 0.024 and P= 0.001,
respectively) in the hippocampus than in the CRS group.
Brain monoamine neurotransmitters
The anxiety and depression-related neurotransmitters
5-HT, DA, and NE were also detected. As shown in
Fig. 9, chronic restraint stress not only changed NE
levels in the PFC (F(3,28) = 8.951, P< 0.001) and
hippocampus (F(3,28) = 8.074, P< 0.001). It also
influenced hippocampus 5-HT levels (F(3,28) = 6.392,
P= 0.002). The NE levels in the PFC (P= 0.018) and
hippocampus (P= 0.001) and the 5-HT levels in the
hippocampus (P= 0.019) were all lower in the CRS
group than in the control group. While the NE levels in
the hippocampus (P= 0.006) and 5-HT levels in
hippocampus (P= 0.002) were both higher in the LAC
group than in the CRS group. CIT administration
showed significantly higher 5-HT levels in both the PFC
(P= 0.013) and hippocampus (P= 0.01) than in the
CRS group, but it did not affect NE levels.
Correlation
The correlations between behavioral results and
biological outcomes are shown in Fig. 10. The sucrose
preferences in SPT were positively correlated with
hippocampus 5-HT content (r
p
= 0.603, P< 0.001).
The time in open arms in EPM was negatively
correlated with plasma CORT (r
p
=0.448, P= 0.01)
and ACTH (r
p
=0.441, P= 0.019) levels. The
distance traveled in the center in OFT was positively
correlated with hippocampus NE content (r
p
= 0.441,
P= 0.012). The time spent with new objects in ORT
was negatively correlated with plasma CORT
(r
p
=0.499, P= 0.004) and ACTH (r
p
=0.405,
P= 0.024) levels while positively correlated with plasma
IL-10 content (r
p
= 0.467, P= 0.008) and hippocampus
NE content (r
p
= 0.59, P< 0.001).
DISCUSSION
The present study confirmed and expanded upon
previous findings demonstrating behavior and cognition
Fig. 4. Lactobacillus helveticus NS8 supplementation increased distance traveled in center in OFT while citalopram intervention did not. The
anxiety-related behaviors in the open field test are shown in the above figure. Panel A and panel B show the distance traveled in entire area and in
center respectively. Panel C shows the mean speed of rats. Panel D shows the time spent in center area. All values are expressed as
mean ± SEM. N= 8/group.
*
P< 0.05,
**
P< 0.01.
S. Liang et al. / Neuroscience 310 (2015) 561–577 567

changes in adult rats subjected to chronic restraint stress.
After 3–4 weeks of chronic restraint stress (2–6 h/day),
rats showed less body weight gain, more anxiety-like
behavior (less time spent in aversive arms in EPM
and less distance traveled in aversive areas in OFT),
more depressive-like behavior (less sucrose solution
consumption in SPT), and memory impairment (less
novel object exploration time in ORT and less novel
location exploration time in OPT) (Beck and Luine,
2002; Bowman et al., 2003; Ferraz et al., 2011; Huynh
et al., 2011). These behavioral and cognitive aberra-
tions were paralleled by biochemical alterations including
higher levels of stress hormones and pro-inflammatory
cytokines levels in plasma, lower levels of anti-inflammatory
Fig. 5. Lactobacillus helveticus NS8 supplementation made better improvement than citalopram intervention in memory recognition tests. The
behaviors of rats in object recognition test and placement recognition test are shown in the above figure. Panel A and panel B show the total time
spent with the two objects and the relative amount of time exploring new object in ORT. Panel C and panel D show the total time spent in the two
placements and the percentages of time exploring new placement in OPT. All values are expressed as mean ± SEM. N= 7–8/group.
*
P< 0.05,
**
P< 0.01.
Fig. 6. Lactobacillus helveticus NS8 supplementation reduced plasma stress hormones content while citalopram intervention did not. Plasma
CORT (Panel A) and ACTH (panel B) levels are shown in the above graphs. All values are expressed as mean ± SEM. N= 8/group.
*
P< 0.05,
**
P< 0.01,
***
P< 0.001.
568 S. Liang et al. / Neuroscience 310 (2015) 561–577

cytokines in plasma (Ferraz et al., 2011; Voorhees et al.,
2013), less 5-HT and NE content in the brain, and lower
BDNF content (or BDNF mRNA levels) in the hippocam-
pus (O’Mahony et al., 2011; Radahmadi et al., 2015).
Most of the abnormalities resulting from chronic restraint
stress were attenuated by chronic supplementation of
probiotic L. helveticus NS8 or antidepressant CIT. These
results support the current hypothesis that chronic
L. helveticus NS8 supplementation can counteract
chronic stress-induced behavioral, cognitive, and bio-
chemical aberrations as well as many antidepressants.
The physiological and behavioral responses to chronic
restraint stress may be mediated by the brain–gut–micro
biota axis. The endocrine, immune, and nervous
systems and each pathway of the brain–gut–microbiota
axis were activated to deal with chronic stress (Dinan
and Cryan, 2012; Mahar et al., 2014; Moloney et al.,
2014). The long-lasting exaggeration of HPA activity,
the chronic inflammation, the persistent disruption of brain
neurotransmitters, and the decrease in BDNF were all
detrimental to heath, driving the depression pathogenesis
(Schiepers et al., 2005; Belmaker and Agam, 2008; Marin
et al., 2011; Gold, 2014).
Hypothalamic–pituitary–adrenocortical (HPA) activation
is one of the most important parts of stress response
(Swaab et al., 2005). Both human and murine subjects
release more stress hormones after chronic stress.
Long-term increases in stress hormones suggest the fail-
ure of HPA axis negative feedback under the etiology of
depression (Barden, 2004; Swaab et al., 2005; Lupien
et al., 2009). In the present experiment, plasma CORT
and ACTH levels were both correlated with anxiety-like
behavior in EPM. Probiotic supplementation has been
found to regulate the HPA axis function both in early
age and in adulthood (Sudo et al., 2005; Eutamene and
Bueno, 2007; Gareau et al., 2007). The present results
demonstrated the modulatory effects of L. helveticus
NS8 to restore circulating CORT levels like other probi-
otics, such as Bifidobacterium infantis,Lactobacillus
rhamnosus strain R0011 (95%) and L. helveticus strain
R0052 (5%), L. rhamnosus (JB-1), and Lactobacillus
farciminis (Sudo et al., 2005; Gareau et al., 2007; Bravo
et al., 2011; Ait-Belgnaoui et al., 2012). But we also found
the CORT levels of control group were higher compared
to other studies (Naert et al., 2011). This was possibly
because the control rats were also deprived of food and
water during restraint time and food and water deprivation
could increase CORT levels on their own (Tannock and
Savage, 1974).
The immune system is also involved in the stress
response. Sustained stress exposure can induce
maladaptive inflammation (Gold, 2014). The pro-
inflammatory and anti-inflammatory balance is dysregu-
lated, and the entire immune response moves toward
inflammation, as demonstrated by the increase in the
release of pro-inflammatory cytokines and decrease in
the release of anti-inflammatory cytokines (Schiepers
et al., 2005; Rook and Lowry, 2008; Gold, 2014). Levels
Fig. 7. Lactobacillus helveticus NS8 supplementation promoted
plasma IL-10 release while citalopram intervention promoted IFN-c
and TNF-arelease. The plasma cytokines content are shown in
theabove graphs. Plasma IL-10 levels (Panel A), IFN-clevels (Panel
B) and TNF-alevels (Panel C) are shown in the three graphs given
above. All values are expressed as mean ± SEM. N= 8/group.
*
P< 0.05,
**
P< 0.01,
***
P< 0.001.
Fig. 8. Lactobacillus helveticus NS8 supplementation increased
BDNF mRNA expression in hippocampus as citalopram intervention
did. The BDNF mRNA expression in prefrontal cortex and hippocam-
pus are shown in the above graph. All values are expressed as mean
± SEM. N= 3/group.
*
P< 0.05,
**
P< 0.01.
S. Liang et al. / Neuroscience 310 (2015) 561–577 569

of pro-inflammatory cytokines (including IL-6, TNF-a, and
IFN-c) usually increase after chronic restraint stress, and
the levels of anti-inflammatory cytokines (like IL-10) tend
to decrease (Ferraz et al., 2011; Voorhees et al., 2013).
It was suggested that the immune regulation of probiotics
maybe correlated with IL-10 (Ochoa-Reparaz et al.,
2010a,b; Ohland et al., 2013). The present experiment
showed L. helveticus NS8 increased IL-10 release while
CIT decreased IFN-cand TNF-alevels, indicating different
mechanisms underlying the two treatments. This immune
regulatory effect of NS8 was consistent with that observed
in other studies of L. helveticus strain (Ohland et al.,
2013).
The hippocampus, one of several brain regions
related to behavior and cognition regulation, was
impaired after chronic stress (Marije aan het Rot et al.,
2009). Chronic restraint stress could induce hippocampus
impairment like neuronal loss, dendritic retraction, and
BDNF content reduction (McLaughlin et al., 2007;
Takuma et al., 2007; O’Mahony et al., 2011). While BDNF
was critical for neurogenesis and synaptic plasticity, both
of which were necessary to maintain hippocampus mor-
phology and function (Marije aan het Rot et al., 2009;
Lu et al., 2014). And the BDNF decrease was associated
with neuronal loss and could even induce hippocampus
atrophy which was very common in major depression
(Belmaker and Agam, 2008) while long time antidepres-
sant treatment could increase neurogenesis and BDNF
levels (Vaidya et al., 2007; Belmaker and Agam, 2008).
Moreover, hippocampus neurogenesis regulation was
also connected with gut microbiota (Gareau et al.,
2011). Germ-free mice exhibited increased adult hip-
pocampus neurogenesis compared to conventionally col-
onized mice (Ogbonnaya et al., 2015). The BDNF content
or BDNF mRNA levels reduction was possibly associated
with cognition impairment and the increase in depressive-
like behavior (Mehrpouya et al., 2014; Radahmadi et al.,
2015). Thus the antidepressant effect (sucrose consump-
tion increase) and spatial memory improvement (novel
location exploration time increase in OPT) of L. helveticus
NS8 and CIT was possibly reached by restoring BDNF
levels in hippocampus. Many probiotics were found to
have the potential of regulation BDNF levels, such as
L. helveticus R0052 and Bifidobacterium longum R0175
(Ait-Belgnaoui et al., 2014; Distrutti et al., 2014). Since
the BDNF content was greatly influenced by HPA activity
and monoamine transmission (Vaidya et al., 2007; Mahar
et al., 2014), the restoration of BDNF content maybe
related to the normalized stress hormones levels and
monoamine content (5-HT and NE). And the present
results also demonstrated that only L. helveticus NS8
administration increased novel object exploration time in
ORT, which might be correlated with its regulation to
plasma stress hormones, IL-10 and hippocampus NE
content.
5-HT and NE are crucial neurotransmitters of mood
and cognition regulation. Balances of both are easily
disturbed by chronic stress (Hamon and Blier, 2013).
The 5-HT and NE levels in the PFC and hippocampus
were decreased which might be connected with the
behavioral aberrations caused by chronic restraint stress
(Bowman et al., 2009; O’Mahony et al., 2011). In the pre-
sent study, the hippocampus 5-HT content was correlated
with depressive-like behavior in SPT while hippocampus
NE content was correlated with anxiety-like behavior in
OFT and recognition preference in ORT. Gut flora were
found to influence the serotonergic system in the
hippocampus (Clarke et al., 2013). Gut bacteria could
also affect catecholamine system. They could recognize
catecholamine signals and perform adaptive activities to
allow their populations to flourish; this affected the host
(Freestone et al., 2008; Sudo, 2014). In this way, the
antidepressant effects of L. helveticus NS8 may be
caused by the recovery of 5-HT content in the hippocam-
pus, which was similar to the results of selective serotonin
reuptake inhibitor (SSRI) therapy. Since CIT administra-
tion did not affect behavior (in OFT and ORT) and NE
content, the anti-anxiety and cognition improving effects
in ORT of L. helveticus NS8 might be related to the
restoration of NE content in the hippocampus. Both Bifi-
dobacterium strains and LB strains were found to reduce
the rate of anxiety-like and depressive-like behavior and
promote memory in both rodent models and human stud-
ies (Sullivan et al., 2009; Desbonnet et al., 2010; Bercik
et al., 2011; Bravo et al., 2011; Messaoudi et al., 2011;
Arseneault-Breard et al., 2012; Davari et al., 2013;
Ohland et al., 2013; Tillisch et al., 2013; Ait-Belgnaoui
et al., 2014; Distrutti et al., 2014). However, only one
study showed probiotics to have a therapeutic effect in a
depression model. This model used B. infantis in a rat
maternal separation model (Desbonnet et al., 2010).
Fig. 9. Lactobacillus helveticus NS8 supplementation increased both
5-HT and NE content in hippocampus while citalopram intervention
just increased 5-HT content. The monoamine neurotransmitters in
prefrontal cortex and hippocampus are shown in the above graphs.
Panels A and B show 5-HT, DA, and NE levels in the prefrontal cortex
and hippocampus respectively. All values are expressed as mean
± SEM. N= 8/group.
*
P< 0.05,
**
P< 0.01.
570 S. Liang et al. / Neuroscience 310 (2015) 561–577

Fig. 10. The behavioral results were correlated with relevant biological outcomes. Panel A shows the correlation between sucrose preferences and
hippocampus 5-HT content. Panel B and panel C show the correlation between time in open arms in EPM and plasma CORT and ACTH levels.
Panel D shows the correlation between distance traveled in center in OFT and hippocampus NE content. Panel E, panel F, panel G and panel H
show the correlation between time spend with new object in ORT and plasma CORT, plasma ACTH, plasma IL-10 and hippocampus NE content,
respectively.
S. Liang et al. / Neuroscience 310 (2015) 561–577 571

Although the behavior modulation effect has been
described in detail, the physiological and biochemical
mechanisms under therapeutic conditions remain
unclear.
The reduction in 5-HT synthesis is widely thought to
play a causative role in the etiology of major depression.
Increasing 5-HT content in synaptic cleft is one of the
commonest targets in depression treatment (Marije aan
het Rot et al., 2009). CIT is a frequently used antidepres-
sant aiming at inhibiting the reuptake of 5-HT without influ-
ence in other neurotransmitters (Hyttel, 1982). In the
present study, CIT treatment increased sucrose prefer-
ence in SPT, improved placement recognition in OPT,
decreased IFN-cand TNF-alevels in plasma, improved
hippocampus BDNF mRNA expression and increased 5-
HT content in the PFC and hippocampus, curing most
of the abnormalities in chronic restraint stress depression
model. The similar behavioral and biochemical correction
effect of LB treatment indicated the 5-HT system was also
involved in its therapy. L. helveticus NS8 treatment was
demonstrated to regulate 5-HT and its synthesis in the
hyperammonemia rat (Luo et al., 2014). In the present
study, the restoration of 5-HT content may be related to
the enhancement of tryptophan availability (Desbonnet
et al., 2008a; Borre et al., 2014a). The brain 5-HT content
is positively correlated with its precursor tryptophan
levels. However, tryptophan can also degrade into
kynurenine. This process can be catalyzed by either
indoleamine-2,3-dioxygenase (IDO) or tryptophan-2,3-
dioxygenase (TDO). Inflammation can accelerate IDO
activity and CORT can accelerate TDO activity. Both
can facilitate tryptophan catabolism through kynurenine
pathway, rendering tryptophan less available (Le Floc’h
et al., 2011; Maes et al., 2011; O’Mahony et al., 2014).
Improving inflammation and reducing CORT release can
decrease tryptophan consumption, leaving more trypto-
phan available for synthesis of 5-HT (Le Floc’h et al.,
2011; O’Mahony et al., 2014). It was possible that L. hel-
veticus NS8 restored hippocampus 5-HT levels by
increasing tryptophan availability by regulating the
immune response (enhancing IL-10 release) and HPA
axis function (reducing CORT and ACTH levels).
Orally administered L. helveticus NS8 can modulate
host behavior and biochemical aberrations through all
the three pathways of the brain–gut–microbiota axis. By
reducing CORT release to regulate the function of the
HPA axis, increasing anti-inflammatory cytokine IL-10
levels to correct the immune imbalance, and restoring 5-
HT, NE, and BDNF levels to mitigate brain injury, L.
helveticus NS8 supplementation normalized most of the
behavioral and cognitive abnormalities caused by
chronic restraint stress. The anti-depression effect may
relate to the restoration of hippocampus 5-HT content
and BDNF mRNA expression. The anti-anxiety effect
may correlate with the reduction of plasma stress
hormones release and the restoration of hippocampus
NE content. The cognition improvement effect in ORT
may connect with the reduction of plasma stress
hormones release and the restoration of plasma IL-10
content and hippocampus NE content. All of these
pathways are key physiological mechanisms in
depression treatment, indicating that L. helveticus NS8
may be a suitable alternative therapy for depression.
The present data suggest that probiotics may regulate
host behavior and biochemistry through many pathways
and that these pathways may be coordinated with each
other.
Although we achieved meaningful and improving
results in the present study, it was still an exploratory
study and the experimental design was not perfect.
Firstly, for animals grouping, although previous
researches demonstrated that L. helveticus NS8
treatment had only beneficial effects (Luo et al., 2014)
and CIT was a good antidepressant (Hyttel, 1982;
Desbonnet et al., 2010), it would be better if both treat-
ments had their own control groups. Secondly, for behav-
ior tests, the EPM could be executed after the OFT.
Although 5 min of OFT was often used for anxiety-like
behavior measurement (Bellani et al., 2006; Babri et al.,
2014), the locomotor activity data would be more accurate
if the test lasted longer than 5 min. Although the recogni-
tion memory tasks were useful measurements in animal
spatial memory and non-spatial memory (Bowman
et al., 2006; Luine, 2015), other cognition tests with longer
time and more trials could be used in future study. Thirdly,
for animal numbers, although eight rats per group were
effective in the present study, more rats would be better
to reduce individual errors and to find treatment differ-
ences. Lastly, for sex differences, in animal experiments,
the behavior of adult female rats was influenced by estrus
cycle while the male rats’ behavior was relatively stable
(Marcondes et al., 2001; Sayin et al., 2014). But the
female rats should not be ignored since male and female
rats made different responses to certain stressful proce-
dures (Bowman et al., 2003, 2006, 2009; Dalla et al.,
2005). Thus further studies should find out whether there
are sex differences in this treatment. In a word, more
studies are needed to illustrate how L. helveticus NS8
treatment works in depression and whether it works for
other kinds mental disorders.
CONCLUSION
In summary, this study provides preliminary evidence that
chronic treatment with probiotic L. helveticus NS8 can
have anxiolytic and antidepressant effects, promote
cognition, decrease plasma CORT and ACTH levels,
modulate pro-inflammatory and anti-inflammatory
balance, and restore 5-HT, NE, and BDNF content in
the hippocampus, inducing an effect similar to that of
SSRI. Ever since Logan proposed probiotics as an
adjuvant therapy for major depression in 2005 (Logan
and Katzman, 2005), many scientists have thought about
this issue deeply (Cryan and Dinan, 2012; Rook et al.,
2012, 2014; Borre et al., 2014a; Dash et al., 2015).
Dinan et al. (2013) proposed ’psychobiotics’ to emphasize
the potential therapy effects of probiotics in mental illness
(Dinan et al., 2013). In the present study, NS8 showed the
potential as one of the ’psychobiotics’ in treatment of
depression. So far, there are several studies exploring
and speculating on how gut bacteria influence brain and
behavior (Forsythe et al., 2010; Cryan and O’Mahony,
572 S. Liang et al. / Neuroscience 310 (2015) 561–577

2011; Al-Asmakh et al., 2012; Cryan and Dinan, 2012;
Montiel-Castro et al., 2013; Farmer et al., 2014; Fond
et al., 2014; Tillisch, 2014; Wang and Kasper, 2014), even
extending the treatment to other mental disorders such as
autism spectrum disorder, obsessive–compulsive disor-
der, bipolar disorder, and schizophrenia (Critchfield
et al., 2011; Hsiao et al., 2013; Severance et al., 2013;
Kantak et al., 2014; Savignac et al., 2014, 2015). Most
of these studies are either reviews or related experimental
studies of physiological diseases comorbid with depres-
sion (Sullivan et al., 2009; Arseneault-Breard et al.,
2012; Saulnier et al., 2013). Direct clinical and preclinical
studies of depression are very scarce. These data confirm
and demonstrate the hypothesis that probiotic supple-
mentation may be an effective and safe therapy for
chronic-stress-induced depression.
AUTHORS’ CONTRIBUTIONS
All authors listed have contributed to the work. LS
participated in designing the experimental protocol, data
collection, statistical analysis and writing the manuscript.
JF designed and supervised the study and revised the
manuscript. LS, LJ, LW, WXL, and DYF carried out
behavioral test and sample collection. WT, HX, and JF
provided administrative, technical, or material support.
All authors read and approved the final manuscript.
COMPETING INTERESTS
The authors declare that they have no competing
interests.
Acknowledgements—The study was granted by NS Bio Japan
and NS Bio Guangzhou. We also thank LetPub for its linguistic
assistance during the preparation of this manuscript.
REFERENCES
Abelaira HM, Reus GZ, Quevedo J (2013) Animal models as tools to
study the pathophysiology of depression. Rev Bras Psiquiatr 35(Suppl
2):S112–S120. http://dx.doi.org/10.1590/1516-4446-2013-1098.
Ait-Belgnaoui A, Durand H, Cartier C, Chaumaz G, Eutamene H,
Ferrier L, Theodorou V (2012) Prevention of gut leakiness by a
probiotic treatment leads to attenuated HPA response to an acute
psychological stress in rats. Psychoneuroendocrinology 37
(11):1885–1895. http://dx.doi.org/10.1016/j.psyneuen.2012.03.024.
Ait-Belgnaoui A, Colom A, Braniste V, Ramalho L, Marrot A, Cartier
C, Tompkins T (2014) Probiotic gut effect prevents the chronic
psychological stress-induced brain activity abnormality in mice.
Neurogastroenterol Motil 26(4):510–520. http://dx.doi.org/
10.1111/nmo.12295.
Al-Asmakh M, Anuar F, Zadjali F, Rafter J, Pettersson S (2012) Gut
microbial communities modulating brain development and
function. Gut Microbes 3(4):366–373. http://dx.doi.org/10.4161/
gmic.21287.
Alexander JL, Dennerstein L, Woods NF, McEwen BS, Halbreich U,
Kotz K, Richardson G (2007) Role of stressful life events and
menopausal stage in wellbeing and health. Expert Rev Neurother
7(11).
Arseneault-Breard J, Rondeau I, Gilbert K, Girard SA, Tompkins TA,
Godbout R, Rousseau G (2012) Combination of Lactobacillus
helveticus R0052 and Bifidobacterium longum R0175 reduces
post-myocardial infarction depression symptoms and restores
intestinal permeability in a rat model. Br J Nutr 107
(12):1793–1799. http://dx.doi.org/10.1017/S0007114511005137.
Babri S, Doosti MH, Salari AA (2014) Strain-dependent effects of
prenatal maternal immune activation on anxiety- and depression-
like behaviors in offspring. Brain Behav Immun 37:164–176. http://
dx.doi.org/10.1016/j.bbi.2013.12.003.
Bailey MT (2014) Influence of stressor-induced nervous system
activation on the intestinal microbiota and the importance for
immunomodulation. Adv Exp Med Biol 817:255–276. http://dx.doi.
org/10.1007/978-1-4939-0897-4_12.
Bailey MT, Coe CL (1999) Maternal separation disrupts the integrity
of the intestinal microflora in infant rhesus monkeys. Dev
Psychobiol 35(2):146–155.
Bailey MT, Dowd SE, Parry NMA, Galley JD, Schauer DB, Lyte M
(2010) Stressor exposure disrupts commensal microbial
populations in the intestines and leads to increased colonization
by Citrobacter rodentium. Infect Immun 78(4):1509–1519. http://
dx.doi.org/10.1128/Iai.00862-09.
Bailey MT, Dowd SE, Galley JD, Hufnagle AR, Allen RG, Lyte M
(2011) Exposure to a social stressor alters the structure of the
intestinal microbiota: implications for stressor-induced
immunomodulation. Brain Behav Immun 25(3):397–407. http://
dx.doi.org/10.1016/j.bbi.2010.10.023.
Bangsgaard Bendtsen KM, Krych L, Sorensen DB, Pang W, Nielsen
DS, Josefsen K, Hansen AK (2012) Gut microbiota composition is
correlated to grid floor induced stress and behavior in the BALB/c
mouse. PLoS ONE 7(10):e46231. http://dx.doi.org/10.1371/
journal.pone.0046231.
Barden N (2004) Implication of the hypothalamic–pituitary–adrenal
axis in the physiopathology of depression. J Psychiatry Neurosci
29(3):185–193.
Barouei J, Adams MC, Hodgson DM (2009) Prophylactic role of
maternal administration of probiotics in the prevention of irritable
bowel syndrome. Med Hypotheses 73(5):764–767. http://dx.doi.
org/10.1016/j.mehy.2009.04.023.
Beck KD, Luine VN (2002) Sex differences in behavioral and
neurochemical profiles after chronic stress role of housing
conditions. Physiol Behav 75:661–673.
Bekkering P, Jafri I, van Overveld FJ, Rijkers GT (2013) The intricate
association between gut microbiota and development of type 1,
type 2 and type 3 diabetes. Expert Rev Clin Immunol 9
(11):1031–1041. http://dx.doi.org/10.1586/1744666X.2013.848793.
Bellani R, Luecken LJ, Conrad CD (2006) Peripubertal anxiety profile
can predict predisposition to spatial memory impairments
following chronic stress. Behav Brain Res 166(2):263–270.
http://dx.doi.org/10.1016/j.bbr.2005.08.006.
Belmaker RH, Agam G (2008) Major depression disorder. New Engl J
Med 358(1):55–68.
Bercik P, Verdu EF, Foster JA, Macri J, Potter M, Huang XX, Collins
SM (2010) Chronic gastrointestinal inflammation induces anxiety-
like behavior and alters central nervous system biochemistry in
mice. Gastroenterology 139(6):U2102–U2409. http://dx.doi.org/
10.1053/j.gastro.2010.06.063.
Bercik P, Park AJ, Sinclair D, Khoshdel A, Lu J, Huang X, Verdu EF
(2011) The anxiolytic effect of Bifidobacterium longum NCC3001
involves vagal pathways for gut–brain communication.
Neurogastroenterol Motil 23(12):1132–1139. http://dx.doi.org/
10.1111/j.1365-2982.2011.01796.x.
Borre YE, Moloney RD, Clarke G, Dinan TG, Cryan JF (2014a) The
impact of microbiota on brain and behavior: mechanisms &
therapeutic potential. Adv Exp Med Biol 817:373–403. http://dx.
doi.org/10.1007/978-1-4939-0897-4_17.
Borre YE, O’Keeffe GW, Clarke G, Stanton C, Dinan TG, Cryan JF
(2014b) Microbiota and neurodevelopmental windows:
implications for brain disorders. Trends Mol Med 20(9):509–518.
http://dx.doi.org/10.1016/j.molmed.2014.05.002.
Bowman RE, Beck KD, Luine VN (2003) Chronic stress effects on
memory: sex differences in performance and monoaminergic
activity. Horm Behav 43(1):48–59. http://dx.doi.org/10.1016/
s0018-506x(02)00022-3.
S. Liang et al. / Neuroscience 310 (2015) 561–577 573

Bowman RE, Maclusky NJ, Diaz SE, Zrull MC, Luine VN (2006) Aged
rats: sex differences and responses to chronic stress. Brain Res
1126:156–166. http://dx.doi.org/10.1016/j.brainres.2006.07.047.
Bowman RE, Micik R, Gautreaux C, Fernandez L, Luine VN (2009)
Sex-dependent changes in anxiety, memory, and monoamines
following one week of stress. Physiol Behav 97(1):21–29. http://
dx.doi.org/10.1016/j.physbeh.2009.01.012.
Bravo JA, Forsythe P, Chew MV, Escaravage E, Savignac HM, Dinan
TG, Cryan JF (2011) Ingestion of Lactobacillus strain regulates
emotional behavior and central GABA receptor expression in a
mouse via the vagus nerve. Proc Natl Acad Sci U S A 108
(38):16050–16055. http://dx.doi.org/10.1073/pnas.1102999108.
Burcelin RM, Serino M, Chabo C, Garidou L, Pomie C, Courtney M,
et al. (2013) Metagenome and metabolism the tissue microbiota
hypothesis. Diabetes Obes Metab 15(3):61–70.
Chiba S, Numakawa T, Ninomiya M, Richards MC, Wakabayashi C,
Kunugi H (2012) Chronic restraint stress causes anxiety- and
depression-like behaviors, downregulates glucocorticoid receptor
expression, and attenuates glutamate release induced by brain-
derived neurotrophic factor in the prefrontal cortex. Prog
Neuropsychopharmacol Biol Psychiatry 39(1):112–119. http://dx.
doi.org/10.1016/j.pnpbp.2012.05.018.
Clarke G, Grenham S, Scully P, Fitzgerald P, Moloney RD, Shanahan
F, Cryan JF (2013) The microbiome–gut–brain axis during early
life regulates the hippocampal serotonergic system in a sex-
dependent manner. Mol Psychiatry 18(6):666–673. http://dx.doi.
org/10.1038/mp.2012.77.
Cleck JN, Blendy JA (2008) Making a bad thing worse: adverse
effects of stress on drug addiction. J Clin Invest 118(2):454–461.
http://dx.doi.org/10.1172/JCI33946.
Clemente Jose C, Ursell Luke K, Parfrey Laura W, Knight R (2012)
The impact of the gut microbiota on human health: an integrative
view. Cell 148(6):1258–1270. http://dx.doi.org/10.1016/
j.cell.2012.01.035.
Collins SM, Bercik P (2013) Gut microbiota: intestinal bacteria
influence brain activity in healthy humans. Nat Rev
Gastroenterol Hepatol 10(6):326–327. http://dx.doi.org/10.1038/
nrgastro.2013.76.
Critchfield JW, van Hemert S, Ash M, Mulder L, Ashwood P (2011)
The potential role of probiotics in the management of childhood
autism spectrum disorders. Gastroenterol Res Pract 2011:1–8.
http://dx.doi.org/10.1155/2011/161358.
Crumeyrolle-Arias M, Jaglin M, Bruneau A, Vancassel S, Cardona A,
Dauge V, et al. (2014) Absence of the gut microbiota enhances
anxiety-like behavior and neuroendocrine response to acute
stress in rats. Psychoneuroendocrinology 42:207–217. http://dx.
doi.org/10.1016/j.psyneuen.2014.01.014.
Cryan JF, Dinan TG (2012) Mind-altering microorganisms: the impact
of the gut microbiota on brain and behaviour. Nat Rev Neurosci 13
(10):701–712. http://dx.doi.org/10.1038/nrn3346.
Cryan JF, O’Mahony SM (2011) The microbiome–gut–brain axis:
from bowel to behavior. Neurogastroenterol Motil 23(3):187–192.
http://dx.doi.org/10.1111/j.1365-2982.2010.01664.x.
Dalla C, Antoniou K, Drossopoulou G, Xagoraris M, Kokras N,
Sfikakis A, Papadopoulou-Daifoti Z (2005) Chronic mild stress
impact: are females more vulnerable? Neuroscience 135
(3):703–714. http://dx.doi.org/10.1016/j.
neuroscience.2005.06.068.
Dash S, Clarke G, Berk M, Jacka FN (2015) The gut microbiome and
diet in psychiatry: focus on depression. Curr Opin Psychiatry 28
(1):1–6. http://dx.doi.org/10.1097/YCO.0000000000000117.
Davari S, Talaei SA, Alaei H, Salami M (2013) Probiotics treatment
improves diabetes-induced impairment of synaptic activity and
cognitive function: behavioral and electrophysiological proofs for
microbiome–gut–brain axis. Neuroscience 240:287–296. http://
dx.doi.org/10.1016/j.neuroscience.2013.02.055.
Desbonnet L, Garrett L, Clarke G, Bienenstock J, Dinan TG (2008a)
The probiotic Bifidobacteria infantis: an assessment of potential
antidepressant properties in the rat. J Psychiatr Res 43
(2):164–174. http://dx.doi.org/10.1016/j.jpsychires.2008.03.009.
Desbonnet L, Garrett L, Clarke G, Kiely B, Cryan JF, Dinan TG (2010)
Effects of the probiotic Bifidobacterium infantis in the maternal
separation model of depression. Neuroscience 170(4):1179–1188.
http://dx.doi.org/10.1016/j.neuroscience.2010.08.005.
Desbonnet L, Clarke G, Shanahan F, Dinan TG, Cryan JF (2014)
Microbiota is essential for social development in the mouse. Mol
Psychiatry 19(2):146–148. http://dx.doi.org/10.1038/mp.2013.65.
Di Mauro A, Neu J, Riezzo G, Raimondi F, Martinelli D, Francavilla R,
Indrio F (2013) Gastrointestinal function development and
microbiota. Ital J Pediatr 39:15. http://dx.doi.org/10.1186/1824-
7288-39-15.
Diamond B, Huerta PT, Tracey K, Volpe BT (2011) It takes guts to
grow a brain increasing evidence of the important role of the
intestinal microflora in neuro- and immune-modulatory functions
during development and adulthood. BioEssays 33:588–591.
http://dx.doi.org/10.1002/bies.201100042.
Dinan TG, Cryan JF (2012) Regulation of the stress response by the
gut microbiota: implications for psychoneuroendocrinology.
Psychoneuroendocrinology 37(9):1369–1378. http://dx.doi.org/
10.1016/j.psyneuen.2012.03.007.
Dinan TG, Stanton C, Cryan JF (2013) Psychobiotics: a novel class of
psychotropic. Biol Psychiatry 74(10):720–726. http://dx.doi.org/
10.1016/j.biopsych.2013.05.001.
Distrutti E, O’Reilly JA, McDonald C, Cipriani S, Renga B, Lynch MA,
Fiorucci S (2014) Modulation of intestinal microbiota by the
probiotic VSL#3 resets brain gene expression and ameliorates the
age-related deficit in LTP. PLoS ONE 9(9):e106503. http://dx.doi.
org/10.1371/journal.pone.0106503.
Duman CH, Duman RS (2015) Spine synapse remodeling in the
pathophysiology and treatment of depression. Neurosci Lett.
http://dx.doi.org/10.1016/j.neulet.2015.01.022.
Eloe-Fadrosh EA, Rasko DA (2013) The human microbiome: from
symbiosis to pathogenesis. Annu Rev Med 64(1):145–163. http://
dx.doi.org/10.1146/annurev-med-010312-133513.
Eutamene H, Bueno L (2007) Role of probiotics in correcting
abnormalities of colonic flora induced by stress. Gut 56
(11):1495–1497. http://dx.doi.org/10.1136/gut.2007.124040.
Evaldson G, Heimdahl A, Kager L, Nord CE (1982) The normal
human anaerobic microflora. Scand J Infect Dis:9–15.
FAO, WHO (2001) Report of a joint FAO/WHO expert consultation on
evaluation of health and nutritional properties of probiotics in food
including powder milk with live lactic acid bacteria.
Farmer AD, Randall HA, Aziz Q (2014) It’s a gut feeling: how the gut
microbiota affects the state of mind. J Physiol 592(Pt
14):2981–2988. http://dx.doi.org/10.1113/jphysiol.2013.270389.
Ferraz AC, Delattre AM, Almendra RG, Sonagli M, Borges C, Araujo
P, Lima MMS (2011) Chronic omega-3 fatty acids supplementation
promotes beneficial effects on anxiety, cognitive and depressive-
like behaviors in rats subjected to a restraint stress; protocol. Behav
Brain Res 219(1):116–122. http://dx.doi.org/10.1016/j.bbr.2010.12.
028.
Fond G, Boukouaci W, Chevalier G, Regnault A, Eberl G, Hamdani N,
Leboyer M (2014) The ‘‘psychomicrobiotic”: targeting microbiota
in major psychiatric disorders: A systematic review. Pathol Biol
(Paris). http://dx.doi.org/10.1016/j.patbio.2014.10.003.
Forsythe P, Sudo N, Dinan T, Taylor VH, Bienenstock J (2010) Mood
and gut feelings. Brain Behav Immun 24(1):9–16. http://dx.doi.
org/10.1016/j.bbi.2009.05.058.
Foster JA (2013) Gut feelings: bacteria and the brain. Cerebrum:1–14.
Freestone PPE, Sandrini SM, Haigh RD, Lyte M (2008) Microbial
endocrinology: how stress influences susceptibility to infection.
Trends Microbiol 16(2):55–64. http://dx.doi.org/10.1016/j.tim.
2007.11.005.
Galley JD, Nelson MC, Yu ZT, Dowd SE, Walter J, Kumar PS, et al.
(2014) Exposure to a social stressor disrupts the community
structure of the colonic mucosa-associated microbiota. BMC
Microbiol 14. http://dx.doi.org/10.1186/1471-2180-14-189.
Gareau MG, Jury J, MacQueen G, Sherman PM, Perdue MH (2007)
Probiotic treatment of rat pups normalises corticosterone release
and ameliorates colonic dysfunction induced by maternal
574 S. Liang et al. / Neuroscience 310 (2015) 561–577

separation. Gut 56(11):1522–1528. http://dx.doi.org/10.1136/
gut.2006.117176.
Gareau MG, Wine E, Rodrigues DM, Cho JH, Whary MT, Philpott DJ,
et al. (2011) Bacterial infection causes stress-induced memory
dysfunction in mice. Gut 60(3):307–317. http://dx.doi.org/
10.1136/gut.2009.202515.
Glavin GB, Pare WP, Sandbak T, Bakke HK, Murison R (1994)
Restraint stress in biomedical-research – an update. Neurosci
Biobehav Rev 18(2):223–249. http://dx.doi.org/10.1016/0149-
7634(94)90027-2.
Goehler LE, Park SM, Opitz N, Lyte M, Gaykema RPA (2008)
Campylobacter jejuni infection increases anxiety-like behavior in
the holeboard: possible anatomical substrates for viscerosensory
modulation of exploratory behavior. Brain Behav Immun 22
(3):354–366. http://dx.doi.org/10.1016/j.bbi.2007.08.009.
Gold PW (2014) The organization of the stress system and its
dysregulation in depressive illness. Mol Psychiatry. http://dx.doi.
org/10.1038/mp.2014.163.
Grenham S, Clarke G, Cryan JF, Dinan TG (2011) Brain–gut–
microbe communication in health and disease. Front Physiol 2:94.
http://dx.doi.org/10.3389/fphys.2011.00094.
Hammen C (2005) Stress and depression. Annu Rev Clin Psychol
1:293–319. http://dx.doi.org/10.1146/annurev.clinpsy.1.102803.
143938.
Hamon M, Blier P (2013) Monoamine neurocircuitry in depression
and strategies for new treatments. Prog Neuropsychopharmacol
Biol Psychiatry 45:54–63. http://dx.doi.org/10.1016/j.pnpbp.2013.
04.009.
Holdeman LV, Good IJ, Moore WE (1976) Human fecal flora variation
in bacterial composition within individuals and a possible effect of
emotional stress. Appl Environ Microbiol 31(3):359–375.
Ho
¨rmannsperger G, Haller D (2010) Molecular crosstalk of probiotic
bacteria with the intestinal immune system: clinical relevance in
the context of inflammatory bowel disease. Int J Med Microbiol
300(1):63–73. http://dx.doi.org/10.1016/j.ijmm.2009.08.006.
Hsiao EY, McBride SW, Hsien S, Sharon G, Hyde ER, McCue T,
Mazmanian SK (2013) Microbiota modulate behavioral and
physiological abnormalities associated with neurodevelopmental
disorders. Cell 155(7):1451–1463. http://dx.doi.org/10.1016/
j.cell.2013.11.024.
Human Microbiome Project, C (2012a) A framework for human
microbiome research. Nature 486(7402):215–221. http://dx.doi.
org/10.1038/nature11209.
Human Microbiome Project, C (2012b) Structure, function and
diversity of the healthy human microbiome. Nature 486
(7402):207–214. http://dx.doi.org/10.1038/nature11234.
Huynh TN, Krigbaum AM, Hanna JJ, Conrad CD (2011) Sex
differences and phase of light cycle modify chronic stress
effects on anxiety and depressive-like behavior. Behav Brain
Res 222(1):212–222. http://dx.doi.org/10.1016/j.bbr.2011.03.038.
Hyttel J (1982) Citalopram – pharmacological profile of a specific
serotonin uptake inhibitor with antidepressant activity. Prog
Neuropsychopharmacol Biol Psychiatry 6(3):277–295.
Kantak PA, Bobrow DN, Nyby JG (2014) Obsessive-compulsive-like
behaviors in house mice are attenuated by a probiotic
(Lactobacillus rhamnosus GG). Behav Pharmacol 25(1):71–79.
http://dx.doi.org/10.1097/FBP.0000000000000013.
Kaur IP, Kuhad A, Garg A, Chopra K (2009) Probiotics: delineation of
prophylactic and therapeutic benefits. J Med Food 12(2):219–235.
http://dx.doi.org/10.1089/jmf.2007.0544.
Kessler RC (1997) The effects of stressful life events on depression.
Annu Rev Psychol 48:191–214. http://dx.doi.org/10.1146/
annurev.psych.48.1.191.
Le Floc’h N, Otten W, Merlot E (2011) Tryptophan metabolism, from
nutrition to potential therapeutic applications. Amino Acids 41
(5):1195–1205. http://dx.doi.org/10.1007/s00726-010-0752-7.
Ljungh A, Wadstro
¨m T (2006) Lactic acid bacteria as probiotics. Curr
Issues Intest Microbiol 7(2):73–89.
Logan AC, Katzman M (2005) Major depressive disorder: probiotics
may be an adjuvant therapy. Med Hypotheses 64(3):533–538.
http://dx.doi.org/10.1016/j.mehy.2004.08.019.
Lu B, Nagappan G, Lu Y (2014) BDNF and synaptic plasticity,
cognitive function, and dysfunction. Handb Exp Pharmacol
220:223–250. http://dx.doi.org/10.1007/978-3-642-45106-5_9.
Luine V (2015) Recognition memory tasks in neuroendocrine
research. Behav Brain Res 285:158–164. http://dx.doi.org/
10.1016/j.bbr.2014.04.032.
Luo J, Wang T, Liang S, Hu X, Li W, Jin F (2014) Ingestion of
Lactobacillus strain reduces anxiety and improves cognitive
function in the hyperammonemia rat. Sci China Life Sci 57
(3):327–335. http://dx.doi.org/10.1007/s11427-014-4615-4.
Lupien SJ, McEwen BS, Gunnar MR, Heim C (2009) Effects of stress
throughout the lifespan on the brain, behaviour and cognition. Nat
Rev Neurosci 10(6):434–445. http://dx.doi.org/10.1038/nrn2639.
Lyte M (2010) The microbial organ in the gut as a driver of
homeostasis and disease. Med Hypotheses 74(4):634–638.
http://dx.doi.org/10.1016/j.mehy.2009.10.025.
Lyte M, Li W, Opitz N, Gaykema RP, Goehler LE (2006) Induction of
anxiety-like behavior in mice during the initial stages of infection
with the agent of murine colonic hyperplasia Citrobacter
rodentium. Physiol Behav 89(3):350–357. http://dx.doi.org/
10.1016/j.physbeh.2006.06.019.
Maes M, Leonard BE, Myint AM, Kubera M, Verkerk R (2011) The
new ‘5-HT’ hypothesis of depression: cell-mediated immune
activation induces indoleamine 2,3-dioxygenase, which leads to
lower plasma tryptophan and an increased synthesis of
detrimental tryptophan catabolites (TRYCATs), both of which
contribute to the onset of depression. Prog Neuropsychopharmacol
Biol Psychiatry 35(3):702–721. http://dx.doi.org/10.1016/j.pnpbp.
2010.12.017.
Mahar I, Bambico FR, Mechawar N, Nobrega JN (2014) Stress,
serotonin, and hippocampal neurogenesis in relation to
depression and antidepressant effects. Neurosci Biobehav Rev
38:173–192. http://dx.doi.org/10.1016/j.neubiorev.2013.11.009.
Malaguarnera M, Greco F, Barone G, Gargante MP, Malaguarnera
M, Toscano MA (2007) Bifidobacterium longum with fructo-
oligosaccharide (FOS) treatment in minimal hepatic
encephalopathy: a randomized, double-blind, placebo-controlled
study. Dig Dis Sci 52(11):3259–3265. http://dx.doi.org/10.1007/
s10620-006-9687-y.
Malkesman O, Austin DR, Tragon T, Henter ID, Reed JC, Pellecchia
M, et al. (2012) Targeting the BH3-interacting domain death
agonist to develop mechanistically unique antidepressants. Mol
Psychiatry 17(8):770–780. http://dx.doi.org/10.1038/mp.2011.77.
Manco M (2012) Gut microbiota and developmental programming of
the brain: from evidence in behavioral endophenotypes to novel
perspective in obesity. Front Cell Infect Microbiol 2:109. http://dx.
doi.org/10.3389/fcimb.2012.00109.
Marcondes FK, Miguel KJ, Melo LL, Spadari-Bratfisch RC (2001)
Estrous cycle influences the response of female rats in the
elevated plus-maze test. Physiol Behav 74:435–440.
Marije aan het Rot M, Mathew SJ, Charney DS (2009)
Neurobiological mechanisms in major depressive disorder.
CMAJ 180(3):305–313. http://dx.doi.org/10.1503/cmaj.080697.
Marin MF, Lord C, Andrews J, Juster RP, Sindi S, Arsenault-Lapierre
G, Lupien SJ (2011) Chronic stress, cognitive functioning and
mental health. Neurobiol Learn Mem 96(4):583–595. http://dx.doi.
org/10.1016/j.nlm.2011.02.016.
McArthur R, Borsini F (2006) Animal models of depression in drug
discovery: a historical perspective. Pharmacol Biochem Behav 84
(3):436–452. http://dx.doi.org/10.1016/j.pbb.2006.06.005.
McLaughlin KJ, Gomez JL, Baran SE, Conrad CD (2007) The effects
of chronic stress on hippocampal morphology and function: An
evaluation of chronic restraint paradigms. Brain Res 1161:56–64.
http://dx.doi.org/10.1016/j.brainres.2007.05.042.
Mehrpouya S, Nahavandi A, Khojasteh F, Soleimani M, Ahmadi M,
Barati M (2014) Iron administration prevents BDNF decrease and
depressive-like behavior following chronic stress. Brain Res.
http://dx.doi.org/10.1016/j.brainres.2014.10.057.
Messaoudi M, Lalonde R, Violle N, Javelot H, Desor D, Nejdi A,
Cazaubiel JM (2011) Assessment of psychotropic-like properties
of a probiotic formulation (Lactobacillus helveticus R0052 and
S. Liang et al. / Neuroscience 310 (2015) 561–577 575

Bifidobacterium longum R0175) in rats and human subjects. Br J
Nutr 105(5):755–764. http://dx.doi.org/10.1017/S0007114510004319.
Moloney RD, Desbonnet L, Clarke G, Dinan TG, Cryan JF (2014) The
microbiome: stress, health and disease. Mamm Genome 25(1–
2):49–74. http://dx.doi.org/10.1007/s00335-013-9488-5.
Montiel-Castro AJ, Gonzalez-Cervantes RM, Bravo-Ruiseco G,
Pacheco-Lopez G (2013) The microbiota–gut–brain axis:
neurobehavioral correlates, health and sociality. Front Integr
Neurosci 7:70. http://dx.doi.org/10.3389/fnint.2013.00070.
Morgan XC, Segata N, Huttenhower C (2013) Biodiversity and
functional genomics in the human microbiome. Trends Genet 29
(1):51–58. http://dx.doi.org/10.1016/j.tig.2012.09.005.
Naert G, Ixart G, Maurice T, Tapia-Arancibia L, Givalois L (2011)
Brain-derived neurotrophic factor and hypothalamic–pituitary–
adrenal axis adaptation processes in a depressive-like state
induced by chronic restraint stress. Mol Cell Neurosci 46
(1):55–66. http://dx.doi.org/10.1016/j.mcn.2010.08.006.
Nicholson JK, Holmes E, Kinross J, Burcelin R, Gibson G, Jia W,
Pettersson S (2012) Host-gut microbiota metabolic interactions.
Science 336(6086):1262–1267. http://dx.doi.org/10.1126/science.
1223813.
O’Mahony L, McCarthy J, Kelly P, Hurley G, Luo F, Chen K, et al.
(2005) Lactobacillus and bifidobacterium in irritable bowel
syndrome: symptom responses and relationship to cytokine
profiles. Gastroenterology 128(3):541–551. http://dx.doi.org/
10.1053/j.gastro.2004.11.050.
Ochoa-Reparaz J, Mielcarz DW, Ditrio LE, Burroughs AR, Begum-
Haque S, Dasgupta S, et al. (2010a) Central nervous system
demyelinating disease protection by the human commensal
Bacteroides fragilis depends on polysaccharide A expression. J
Immunol 185(7):4101–4108. http://dx.doi.org/10.4049/jimmunol.
1001443.
Ochoa-Reparaz J, Mielcarz DW, Wang Y, Begum-Haque S,
Dasgupta S, Kasper DL, Kasper LH (2010b) A polysaccharide
from the human commensal Bacteroides fragilis protects against
CNS demyelinating disease. Mucosal Immunol 3(5):487–495.
http://dx.doi.org/10.1038/mi.2010.29.
Ogbonnaya ES, Clarke G, Shanahan F, Dinan TG, Cryan JF, O’Leary
OF (2015) Adult hippocampal neurogenesis is regulated by the
microbiome. Biol Psychiatry. http://dx.doi.org/10.1016/j.biopsych.
2014.12.023.
Ohland CL, Kish L, Bell H, Thiesen A, Hotte N, Pankiv E, Madsen KL
(2013) Effects of Lactobacillus helveticus on murine behavior are
dependent on diet and genotype and correlate with alterations in
the gut microbiome. Psychoneuroendocrinology 38(9):1738–1747.
http://dx.doi.org/10.1016/j.psyneuen.2013.02.008.
Ohsawa K, Uchida N, Ohki K, Nakamura Y, Yokogoshi H (2015)
Lactobacillus helveticus-fermented milk improves learning and
memory in mice. Nutr Neurosci 18(5):232–240. http://dx.doi.org/
10.1179/1476830514Y.0000000122.
O’Mahony SM, Marchesi JR, Scully P, Codling C, Ceolho AM,
Quigley EM, et al. (2009) Early life stress alters behavior,
immunity, and microbiota in rats: implications for irritable bowel
syndrome and psychiatric illnesses. Biol Psychiatry 65
(3):263–267. http://dx.doi.org/10.1016/j.biopsych.2008.06.026.
O’Mahony CM, Clarke G, Gibney S, Dinan TG, Cryan JF (2011)
Strain differences in the neurochemical response to chronic
restraint stress in the rat: relevance to depression. Pharmacol
Biochem Behav 97(4):690–699. http://dx.doi.org/10.1016/j.
pbb.2010.11.012.
O’Mahony SM, Clarke G, Borre YE, Dinan TG, Cryan JF (2014)
Serotonin, tryptophan metabolism and the brain–gut–microbiome
axis. Behav Brain Res. http://dx.doi.org/10.1016/j.bbr.2014.07.
027.
Park AJ, Collins J, Blennerhassett PA, Ghia JE, Verdu EF, Bercik P,
Collins SM (2013) Altered colonic function and microbiota profile
in a mouse model of chronic depression. Neurogastroenterol Motil
25(9):e733–e775. http://dx.doi.org/10.1111/nmo.12153.
Quigley EM, Shanahan F (2014) The future of probiotics for disorders
of the brain–gut axis. Adv Exp Med Biol 817:417–432. http://dx.
doi.org/10.1007/978-1-4939-0897-4_19.
Radahmadi M, Alaei H, Sharifi MR, Hosseini N (2015) Effects of
different timing of stress on corticosterone, BDNF and memory in
male rats. Physiol Behav 139:459–467. http://dx.doi.org/10.1016/
j.physbeh.2014.12.004.
Rao AV, Bested AC, Beaulne TM, Katzman MA, Iorio C, Berardi JM,
Logan AC (2009) A randomized, double-blind, placebo-controlled
pilot study of a probiotic in emotional symptoms of chronic fatigue
syndrome. Gut Pathogens 1(1):6. http://dx.doi.org/10.1186/1757-
4749-1-6.
Rhee SH, Pothoulakis C, Mayer EA (2009) Principles and clinical
implications of the brain–gut–enteric microbiota axis. Nat Rev
Gastroenterol Hepatol 6(5):306–314. http://dx.doi.org/10.1038/
nrgastro.2009.35.
Rook GAW, Lowry CA (2008) The hygiene hypothesis and psychiatric
disorders. Trends Immunol 29(4):150–158. http://dx.doi.org/
10.1016/J.It.2008.01.002.
Rook GAW, Raison CL, Lowry CA (2012) Can we vaccinate against
depression? Drug Discovery Today 17(9–10):451–458. http://dx.
doi.org/10.1016/j.drudis.2012.03.018.
Rook GA, Raison CL, Lowry CA (2014) Microbiota, immunoregulatory
old friends and psychiatric disorders. Adv Exp Med Biol
817:319–356. http://dx.doi.org/10.1007/978-1-4939-0897-4_15.
Russo F, Linsalata M, Orlando A (2014) Probiotics against neoplastic
transformation of gastric mucosa: effects on cell proliferation and
polyamine metabolism. World J Gastroenterol 20(37):13258–13272.
http://dx.doi.org/10.3748/wjg.v20.i37.13258.
Saulnier DM, Ringel Y, Heyman MB, Foster JA, Bercik P, Shulman
RJ, et al. (2013) The intestinal microbiome, probiotics and
prebiotics in neurogastroenterology. Gut Microbes 4(1):17–27.
http://dx.doi.org/10.4161/gmic.22973.
Savignac HM, Kiely B, Dinan TG, Cryan JF (2014) Bifidobacteria
exert strain-specific effects on stress-related behavior and
physiology in BALB/c mice. Neurogastroenterol Motil 26
(11):1615–1627. http://dx.doi.org/10.1111/nmo.12427.
Savignac HM, Tramullas M, Kiely B, Dinan TG, Cryan JF (2015)
Bifidobacteria modulate cognitive processes in an anxious mouse
strain. Behav Brain Res 287:59–72. http://dx.doi.org/10.1016/j.
bbr.2015.02.044.
Sayin A, Derinoz O, Yuksel N, Sahin S, Bolay H (2014) The effects of
the estrus cycle and citalopram on anxiety-like behaviors and c-
fos expression in rats. Pharmacol Biochem Behav 124:180–187.
http://dx.doi.org/10.1016/j.pbb.2014.06.002.
Schiepers OJ, Wichers MC, Maes M (2005) Cytokines and major
depression. Prog Neuropsychopharmacol Biol Psychiatry 29
(2):201–217. http://dx.doi.org/10.1016/j.pnpbp.2004.11.003.
Severance EG, Gressitt KL, Stallings CR, Origoni AE, Khushalani S,
Leweke FM, et al. (2013) Discordant patterns of bacterial
translocation markers and implications for innate immune
imbalances in schizophrenia. Schizophr Res 148(1–3):130–137.
http://dx.doi.org/10.1016/j.schres.2013.05.018.
Sudo N (2014) Microbiome, HPA axis and production of endocrine
hormones in the gut. Adv Exp Med Biol 817:177–194. http://dx.
doi.org/10.1007/978-1-4939-0897-4_8.
Sudo N, Chida Y, Kubo C (2005) Postnatal microbial colonization
programs the hypothalamic–pituitary–adrenal system for stress
response in mice. J Psychosom Res 58(6):S60.
Sullivan A, Nord CE, Evengard B (2009) Effect of supplement with
lactic-acid producing bacteria on fatigue and physical activity in
patients with chronic fatigue syndrome. Nutr J 8. http://dx.doi.org/
10.1186/1475-2891-8-4.
Swaab DF, Bao AM, Lucassen PJ (2005) The stress system in the
human brain in depression and neurodegeneration. Ageing Res
Rev 4(2):141–194. http://dx.doi.org/10.1016/j.arr.2005.03.003.
Takuma K, Hoshina Y, Arai S, Himeno Y, Matsuo A, Funatsu Y,
Yamada K (2007) Ginkgo biloba extract EGb 761 attenuates
hippocampal neuronal loss and cognitive dysfunction resulting from
chronic restraint stress in ovariectomized rats. Neuroscience 149
(2):256–262. http://dx.doi.org/10.1016/j.neuroscience.2007.07.042.
Tannock GW, Savage DC (1974) Influences of dietary and
environmental stress on microbial-populations in murine
gastrointestinal-tract. Infect Immun 9(3):591–598.
576 S. Liang et al. / Neuroscience 310 (2015) 561–577

Tillisch K (2014) The effects of gut microbiota on CNS function in
humans. Gut Microbes 5(3):404–410. http://dx.doi.org/10.4161/
gmic.29232.
Tillisch K, Labus J, Kilpatrick L, Jiang Z, Stains J, Ebrat B, Mayer EA
(2013) Consumption of fermented milk product with probiotic
modulates brain activity. Gastroenterology 144(7):1394–1401.
http://dx.doi.org/10.1053/j.gastro.2013.02.043. 1401 e1391-1394.
Vaidya VA, Fernandes K, Jha S (2007) Regulation of adult
hippocampal neurogenesis: relevance to depression. Expert
Rev Neurother 7(7):853–864.
Voorhees JL, Tarr AJ, Wohleb ES, Godbout JP, Mo XK, Sheridan JF,
et al. (2013) Prolonged restraint stress increases IL-6, reduces IL-
10, and causes persistent depressive-like behavior that is
reversed by recombinant IL-10. PLoS ONE 8(3). http://dx.doi.
org/10.1371/journal.pone.0058488.
Vyas U, Ranganathan N (2012) Probiotics, prebiotics, and synbiotics:
gut and beyond. Gastroenterol Res Pract 2012:872716. http://dx.
doi.org/10.1155/2012/872716.
Wang Y, Kasper LH (2014) The role of microbiome in central nervous
system disorders. Brain Behav Immun 38:1–12. http://dx.doi.org/
10.1016/j.bbi.2013.12.015.
Wang Z, Klipfell E, Bennett BJ, Koeth R, Levison BS, DuGar B, et al.
(2011) Gut flora metabolism of phosphatidylcholine promotes
cardiovascular disease. Nature 472(7341):57–63. http://dx.doi.
org/10.1038/nature09922.
Wichers M, Maes M (2002) The psychoneuroimmuno-
pathophysiology of cytokine-induced depression in humans. Int
J Neuropsychopharmacol 5(4):375–388. http://dx.doi.org/
10.1017/S1461145702003103.
Yatsunenko T, Rey FE, Manary MJ, Trehan I, Dominguez-Bello MG,
Contreras M, Gordon JI (2012) Human gut microbiome viewed
across age and geography. Nature 486(7402):222–227. http://dx.
doi.org/10.1038/nature11053.
(Accepted 11 September 2015)
(Available online 25 September 2015)
S. Liang et al. / Neuroscience 310 (2015) 561–577 577