Content uploaded by Murat Findik
Author content
All content in this area was uploaded by Murat Findik on Sep 23, 2015
Content may be subject to copyright.
358
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
UDK: 636.2.09:616.19-002-02(560)
DOI: 10.1515/acve-2015-0030
Research article
*Corresponding author: e-mail: hulusoy@omu.edu.tr, handeulusoy@gmail.com
INVESTIGATION ON THE ETIOLOGY OF SUBCLINICAL
MASTITIS IN JERSEY AND HYBRID JERSEY DAIRY COWS
GÜRLER Hande1*, FINDIK Arzu2, GÜLTKEN Nilgün1, AY Serhan Serhat1,
ÇFTÇ Alper2, KOLDA Ece3, ARSLAN Serhat4, FINDIK Murat1
1Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine, Ondokuz Mayıs University,
Samsun-Turkey; 2Department of Microbiology, Faculty of Veterinary Medicine, Ondokuz Mayıs
University, Samsun-Turkey; 3Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine,
Mustafa Kemal University, Hatay-Turkey; 4Department of Biometry, Faculty of Veterinary Medicine,
Ondokuz Mayıs University, Samsun-Turkey
(Received 10th December 2014; Accepted 8th April 2015)
The aim of this study was to investigate the etiology of subclinical mastitis (SCM) in
dairy Jersey cows with the use of bacteriological and molecular identifi cation methods.
In the study 121 Jersey and 78 hybrid Jersey cows with SCM were observed in the
Samsun district of Turkey. A total of 411 California mastitis test (CMT) positive
milk samples from these animals were examined bacteriologically. The prevalence of
subclinical mastitis was 54.75% and 67.2% in Jerseys and hybrids, respectively. On
bacteriological examination, a total of 92 strains were isolated from 411 milk samples.
The most prevalent bacteria were Staphylococcus spp. (69.56%). Among them 24 isolates
were Staphylococcus aureus (26.08%) the other isolates were Streptococcus dysgalactiae
(23.91%), Enterococcus spp. (3.26%) and Streptococcus agalactiae (3.26%). All strains were
identifi ed with bacteriological culture methods, as well as by Polymerase Chain Reaction
(PCR). Gram-negative bacteria were not isolated. In conclusion, the etiology of SCM
in full blood and hybrid Jersey dairy cows in Samsun and the prevalence of bacteria
were determined. The relatively high prevalence of SCM indicates the potential need
for the consideration of some factors contributing to the formation of mastitis (e.g.
management) as well as bacterial agents. The present study and further studies may be
useful to develop mastitis vaccines by means of providing true vaccine strain sources.
Key words: etiology, Jersey dairy cow, molecular identifi cation, subclinical mastitis
INTRODUCTION
Subclinical mastitis still continues to be a major problem in dairy animals such as
cattle, buffalo and ewes due to economic losses to dairy farms all over the world.
These economic losses are caused by reduced milk yield, discarded milk, replacement
cost, extra labor, costs of treatment, veterinary care and culling [1-6].
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
359
Subclinical mastitis is a disease that is diffi cult to detect due to the absence of any
visible indications either in the milk or in the mammary glands. The diagnosis of SCM
is based on the somatic cell count (SCC) and microbiological status of udder quarters
[7]. CMT is an advantageous test due to its inexpensiveness and allows the detection
of the number of somatic cells in the milk sample indirectly. In addition, it is the
only cow-side test giving real-time results for selection of the quarters for subsequent
bacteriological examination [8]. Bacteriological culture methods and biochemical tests
are used to isolate and identify the bacteria causing SCM [9]. The primary causes
of mastitis are bacteria, though it is also caused by non-bacterial pathogens such
as viruses, fungi, yeasts, chlamydia and mycoplasmas [10]. Many species of bacteria
have been determined as causative agents of mastitis in Turkey. Reported bacteria
are Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus agalactiae, Streptococcus
dysgalactiae, Streptococcus uberis, Arcanobacterium pyogenes, Escherichia coli, Corynebacterium bovis,
Pasteurella multocida, Bacillus subtilis, Bacillus cereus and Micrococcus spp. [11]. Identifi cation
of bacterial pathogens in the milk from cows with increased SCM is regarded as the
defi nite diagnosis of mastitis and is important for epidemiological studies and disease
control. Culture of milk samples from cows with increased SCM may yield no bacteria
due to the presence of very low numbers of pathogens when samples are collected.
Besides, antibiotic residues and leukocytes might be the cause of negative culture
results [12]. Because of these limitations, molecular methods such as Polymerase
Chain Reaction (PCR) have been used successfully for the identifi cation of various
mastitis pathogens. Furthermore, PCR is a rapid method with high sensitivity and
specifi city which detects bacteria even in the presence of residual antimicrobials or
preservatives in the milk [13-16].
The aim of this study was to determine the etiology of subclinical mastitis (SCM) in
Jersey dairy cows using bacteriological and PCR methods as well as to investigate the
sensitivity of the isolated bacteria to antimicrobial drugs.
MATERIALS AND METHODS
A total of 337 dairy cattle (221 Jersey and 116 Jersey hybrid) at 25 family and
agricultural type farms were investigated from March 2011 to February 2012. Among
these cattle 199 (121 Jersey and 78 hybrid Jersey) were diagnosed SCM. California
mastitis test positive milk samples (225 and 186 were from Jersey and hybrid Jersey
cows, respectively) were examined bacteriologically. Afterwards, suspicious colonies
were identifi ed morphologically, microscopically and biochemically. Ethical approval
was obtained from the Animal Ethics Committee, University of Ondokuz Mayis,
Samsun, Turkey (Approval Nr. 201001).
California mastitis test and milk sample collection
California mastitis test was used in order to detect the presence of SCM in the fi eld.
The procedures and interpretations were performed by traditional methods [17]. Teat
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
360
ends were disinfected with cotton swabs with 70% alcohol, allowed to dry and the
foremilks from quarters were discarded. CMT was performed and approximately 15
ml milk samples of positive quarters were collected in sterile tubes and immediately
transported under cold conditions to the laboratory.
Isolation and Identifi cation of Microorganisms
After CMT positive samples were brought to the laboratory, they were homogenized
with a vortex mixer; each of them was plated on blood agar enriched with 5% sheep
blood and McConcey agar plates. The plates were incubated at 37°C for 24-48 hours.
Then, suspicious colonies were evaluated for cultural characteristics (haemolysis,
pigmentation), microscopy (Gram staining) and biochemical characteristics (catalase,
oxidase, coagulase, aesculin hydrolysis, CAMP tests) [18].
Antibiotic susceptibility test
Antibiotic susceptibilities of the strains isolated from the samples in the study were
determined by Kirby-Bauer Disc Diffusion Method according to the National
Committee for Clinical Laboratory Standards (NCCLS) (2003) [19]. The antibiotic
discs were penicillin G (10 U), vancomycin (30 g), ampicillin-dicloxacillin
(10k g/1 g), amoxicillin-clavulonic acid (20 g/10 g), teicoplanin (30 g), neomycin
(10 g), enrofl oxacin (5 g), oxytetracycline (30 g), spiramycin (100 g), rifaximin
(40 g), rifaximin-cefacetrile (40 g/30 g) and cefaperazone (75 g). The results were
recorded as susceptible (S) or resistant (R).
DNA extraction
DNA for direct PCR was extracted by boiling the intact bacteria. A tissue extraction
kit (Invitrogen®) was used for PCR application on milk samples according to the
manufacturer’s instructions.
Polymerase Chain Reaction (PCR)
PCR protocols were used for bacteria commonly isolated from SCM. To identify
Staphylococcus spp. by PCR a method by Ciftci et al. [16] was used. Briefl y, 5 l of
extracted DNA was added to 25 l of PCR mixture. This PCR mixture consisted of
1XPCR buffer (50 mm KCl, 20 mM Tris HCl), 5 l of 25 mM MgCl2, 3 l of 10 mM
deoxynucleotide triphosphat (dNTP) mixture, 1 l of 20 M 16S rRNA (Staphylococcus
spp. specifi c) primers and 2U Taq DNA polymerase. Amplifi cation conditions were
as follows: Initial denaturation at 94ºC for 52 min, followed by 30 cycles of 45 s at
94ºC, 45 s at 68ºC, 90 s at 72ºC and fi nal extention at 72ºC for 10 min amplicons were
loaded onto 1.5% agarose gel containing 1 g/ml etidium bromide and amplifi ed
DNA fragments were separated by agarose gel electrophoresis. Bands were visualized
under UV transilluminator. Identifi cation of S. aureus strains by PCR was performed
using a method by Kuzma et al. [13]. Briefl y, the total reaction volume was 50 l
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
361
and PCR mixture contained 1.5 mM MgCl2, 10 mM Tris-HCl (pH 9.0), 50 mM KCl,
0.1% Triton®X-100, 200 mM (each) deoxynucleotide triphosphat, 0.2 mM of primers
(Table 1) and 0.625 U Taq polymerase. Amplifi cation conditions were as follows: initial
denaturation at 95°C for 10 min, 37 cycles of denaturation at 94°C for 1 s, annealing
at 55°C for 30 s, elongation at 72°C 1.5 min and fi nal elongation at 72°C 5 min PCR
products were separated and visualized as above. A PCR protocol by Abd El-Razik
et al. [12] was used to identify S. dysgalactiae and S. agalactiae strains. All reactions were
carried out in a 50 l volume. Two hundred microliter of extracted DNA, 5 M primer
(Table 1) and 25 l of Taq PCR Master Mix (Taq PCR Master Mix Kit, Cat no 201443,
Qiagen®) were brought together in this volume.
Amplifi cation conditions were as follows: initial denaturation at 95°C for 2 min, 35
cycles of denaturation at 94°C for 45 s, annealing at 57°C and 60°C for 45 s for
S. dysgalactiae and S. agalactiae primers, respectively, elongation at 72°C for 45 s and
fi nal extention at 72°C for 10 min. Amplifi cation products were evaluated as above.
The PCR protocol by Moatamedi et. al. [14] was used to identify S. uberis. Briefl y,
in a 50 l volume, 5 l of extracted DNA, 2.5 U Taq polymerase, 0.4 mM of each
deoxynucleotide triphosphate, 50 pmol of each primer, 5 l of 10xPCR buffer (500
mM KCl, 200 mM tris-HCl, pH 8.4), MgCl2 with optimal concentration were brought
together. Amplifi cation conditions were as follows: fi rst denaturation at 94°C for 2 min,
40 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s and fi nal extention at 72°C for
Table 1. Primers used for identifi cation of the isolates from cases of SCM by PCR
Target Primer Sequence (5’-3’)
PCR
product
(bp)
Source
Staphylococcus spp. 16SrRNA AACTCTGTTATTAGGGAAGAACA 756 Ciftci
et al. (2009)
16SrRNA CCACCTTCCTCCGGTTTGTCACC
S. aureus Sau327 GGACGACATTAGACGATCA 1318 Abd El-Razik
et al. (2010)
Sau1645 CGGGCACCTATTTTCTATCT
S. dysgalactiae Sdy105 AAAGGTGCAACTGCATCACTA 281 Abd El-Razik
et al. (2010)
Sdy386 GTCACATGGTGGATTTTCCA
S. agalactiae Sag40 CGCTGAGGTTTGGTGTTTACA 405 Abd El-Razik
et al. (2010)
Sag445 CACTCCTACCAACGTTCTTC
S. uberis STRU-UbI TAAGGAAGACGTTGGTTAAG 330 Moatamedi
et al. (2007)
STRU-UbII TCCAGTCCTTAGACCTTCT
Enterococcus spp. Ent1 TACTGACAAACCATTCATGATG 112 Ke et al.
(1999)
Ent2 AACTTCGTCACCAACGCGAAC
E. Coli Eco2083 GCTTGACACTGAACATTGAG 662 Abd El-Razik
et al. (2010)
Eco2745 GCACTTATCTCTTCCGCATT
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
362
7 min. PCR products were evaluated as above. For identifi cation of Enterococcus spp. by
PCR, a protocol by Ke et al. [20,21] was used. Briefl y, 1 ng of extracted DNA was added
to 19 l of PCR mixture (50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton®X-100,
2.5 mM MgCl2, 0.2 mM of each Enterococcus-specifi c primers (Ent1 and Ent2; Table
1), 200 mM of each deoxynucleotide triphosphate (Pharmacia Biotech®), 3.3 g/ml of
bovine serum albumin (BSA) (Sigma-Aldrich Canada Ltd., Oakville, Ontario, Canada),
0.5 U of Taq polymerase (Promega®). Amplifi cation conditions were as follows: fi rst
denaturation at 95°C for 3 min, 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for
1 min and fi nal extention at 72°C for 7 min. PCR products were evaluated as above.
Statistics
Data were evaluated with SAS (2009) statistics suited to summarize means, frequencies
and standard error of means.
RESULTS
Cultural Identifi cation
Of the 411 milk samples, a total of 92 strains were isolated. Of sixty-four strains
(69.56%) identifi ed as Staphylococcus spp., 24 strains (26.08%) were identifi ed as S.
aureus according to their colony morphology (hemolysis, pigment production) and
biochemical reactions (coagulase, DNase, mannitol fermentation). Of 92 strains, 25
were (27.17%) Streptococcus spp. and three of them (3.26%) were S. agalactiae and 22
(23.91%) were S. dysgalactiae. Three of all the isolates were identifi ed as Enterococcus
spp. (3.26%). S. uberis was not isolated. Isolated bacterial strains and their percentages
are given in Table 2.
Antibiotic Susceptibility Test
While all S. aureus and other Staphylococcus spp. strains were susceptible to rifaximin,
rifaximin+cefacetrile, they showed resistance against spiramycin. These strains showed
Table 2. Distribution of the isolates identifi ed by cultural methods and PCR
Bacteria Cultural identifi cation PCR from culture * PCR from milk
No ( %) No (%) No (%)
S. aureus 24 (26.08) 24 (26.08) 24 (5.83)
Staphylococcus spp. other
than S. aureus 40 (43.47) 40 (43.47) 40 (9.73)
S. agalactiae 3 (3.26) 3 (3.26) 3 (0.72)
S. dysgalactiae 22 (23.91) 22 (23.91) 22 (5.35)
S. uberis 0 (0) 0 (0) 0 (0)
Enterococcus spp. 3 (3.26) 3 (3.26) 3 (0.72)
*PCR analysis results from 411 milk samples
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
363
Table 3. Resistance percentages of the bacteria strains against antibiotics
Antibiotics (conc.)
Staphylococcus
spp.
(n=40)
S.aureus
(n=24)
S.agalactiae
(n=3)
S.dysgalactiae
(n=22)
Enterococcus
spp.
(n=3)
n%n % n % n %n %
Penicillin (10 U) 35 87.5 24 100 3 100 20 90.9 3 100
Vancomycin (30 g) 27 67.5 18 75 3 100 22 100 3 100
Ampicillin+Dicloxacillin
(10 g+1 g) 11 27.5 4 16.6 0 0 0 0 0 0
Ampicillin (10 g) 26 65 22 91.66 0 0 0 0 0 0
Amoxicillin+Clavulanic acid
(20 g+10 g) 10 25 8 33.33 3 100 22 100 3 100
Spiramycin (100 g) 40 100 24 100 3 100 22 100 3 100
Teicoplanin (30 g) 5 12.5 3 12.5 3 100 22 100 3 100
Rifaximin (40 g) 0 0 0 0 0 0 6 27.27 0 0
Rifaximin+Cefacetril
(40 g+30 g) 0 0 0 0 0 0 2 9.09 0 0
Cefaperazon (75 g) 2 3.12 2 8.33 30 100 18 81.81 0 0
Neomycin (10 g) 35 87.5 24 100 3 100 3 100 3 100
Oxytetracycline (30 g) 21 52.5 16 66.66 3 100 3 100 3 100
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
364
a variety of resistance against other antibiotics. Namely, >50% of the Staphylococcus spp.
strains (other than S. aureus) showed resistance to penicillin (87.5%), neomycin (87.5%),
vancomycin (67.5%), ampicillin (65%) and oxytetracycline (52.5%). While all S. aureus
strains were resistant to spiramycin, penicillin and neomycin, 91.66% of them showed
resistance to ampicillin. Besides, S. aureus strains showed relatively high resistance to
vancomycin (75%) and oxytetracycline (66.6%). S. aureus and other Staphylococcus spp.
strains showed lower resistance to ampicillin+dicloxacillin, amoxicillin+clavulanic
acid, teicoplanin and cefaperazone. The resistance percentages of the strains to 12
antibiotics are given in Table 3. All S. agalactiae, S. dysgalactiae and Enterococcus spp. strains
were resistant to vancomycin, amoxicillin+clavulanic acid, spiramycin, teicoplanin,
neomycin and oxytetracycline. In addition, all of these strains were susceptiple to
ampicillin and ampicillin+dicloxacillin. Penicillin resistance occurred in all S. agalactiae
and Enterococcus spp. strains. Other resistance percentages are given in Table 3.
Molecular Identifi cation
In Table 2, PCR results from both culture and milk (directly) are given. All strains
identifi ed by cultural methods were further identifi ed by PCR protocols from culture.
After PCR protocols from direct milk samples collected from respective quarters,
the same bacterial strains identifi ed both by cultural and culture-PCR methods were
identifi ed again. No Gram negative bacteria (including E. coli) was found in milk
samples neither by cultural nor by molecular methods.
DISCUSSION
Subclinical mastitis is a major problem since it does not present clinical symptoms in
dairy cows. The lack of visible symptoms makes it diffi cult to recognize the infection
in udders and long-term effects which occur during the undetected period. Causative
organisms might lead to considerable economic losses because of decreased milk
production and altered milk composition [14]. In order to treat mastitis effectively
and create prevention strategies etiological agents must be determined. Treatment of
mastitis relies heavily on the use of antibiotics as the cause is mostly bacterial [4].
The present study was conducted to determine the etiology of subclinical mastitis
with bacteriological and molecular methods in Jersey and hybrids, as well as antibiotic
resistance of causative bacteria. Mastitis is a multifactorial disease for which more
than 250 microbial species, subspecies and serotypes have been isolated and identifi ed
as causative agents [5]. These agents are grouped in three categories as contagious,
environmental and the others. Many studies have been performed concerning
subclinical mastitis in the world and S. aureus was reported to be the most important
contagious microorganism in cattle [5, 12-14]. Similarly, the studies conducted in
Turkey revealed that S. aureus was the most common agent [22-25]. The ratio from the
previous studies performed at different geographic regions in Turkey was 28.3% in the
eastern Anatolia region [22], 39.04% in Elazı [26], 24.63% in the southeast Anatolia
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
365
region [24], 32.5% in anlıurfa [27], 28.7% in the central Anatolia region [23]. In the
present study performed in the Black sea region of Anatolia, similar ratio of S. aureus
was detected (26.08%). In a study from Marmara region [24] S. aureus isolation rate was
found quite lower (4.44%) than in the other regions of Anatolia. Since management is
very important in mastitis prevention; diversity of housing conditions is thought to be
effective in the etiology of mastitis.
S. agalactiae is reported to be highly contagious and one of the important causes of
subclinical infections. It is an obligate bacteria in the bovine mammary gland that can
be transmitted to healthy cows via poor milking hygiene [14, 28]. In some studies, the
presence of S. agalactiae was detected to be between 6.16-10.7% [24, 26, 28]. In the
present study the ratio (3,26%) was determined to be lower than the other studies.
Among Streptococcus species, S. uberis and S. dysgalactiae were important species as
environmental agents [25]. The most important source of environmental organisms
is bedding material. It was reported that moisture in the environment should be
decreased to control the environmental microrganisms. Accordingly, clean pastures
and environment, dry milking equipment and pre-dipping hygiene are important
factors to reduce the exposure of these organisms [5]. Acar et al. [25] have reported
that 17 (28.81%) Streptococcus spp. were isolated from 59 SCM positive milk samples
(1 S.agalactiae, 8 S.dysgalactiae, 2 S.uberis, 6 S.fecalis). Similarly, Tel et al. [27] have also
reported that 16 (6.2%) Streptococcus spp. isolation was performed from 258 SCM
positive milk samples. In the present study, 25 (27.17%) were isolated from 92 bacteria
strain (3 S.agalactiae, 22 S.dysgalactiae). S. uberis was not isolated.
E. coli is an environmental mastitis agent similar to S. uberis and S. dysgalactiae [5, 22,
24]. Although in the present study E. coli was not isolated, in the studies carried out
in Kars [22], anlıurfa [27], Diyarbakır [24], Elazı [26] E.coli was determined as 5.9%,
6.2%, 8.58%, 8.9%, respectively. However, in the study carried out in Kırıkkale [23] the
presence of E.coli was determined to be very low (0.94%.)
Enterococci are the natural fl ora agent of the gastrointestinal system in humans and
animals and reported to be isolated in the dry period [19, 29]. Its ratio might be 6-42%
in mastitis cases [28]. In our study it was 3.6%.
Antimicrobial agents are the most frequently used therapeutics for subclinical
mastitis cases. A prudent antibiotic therapy improves udder health, decreases the
risk of exacerbating clinical mastitis and prevents economic losses. An important
factor affecting the success of antibiotic therapy is the resistance of the agents to
antibiotics. In several studies, many differences in the resistance against antibiotics
by the strains isolated from subclinical mastitis and different geographical regions
have been demonstrated [23, 24, 27, 28, 30, 31]. In our study, resistance of all strains
against twelve antimicrobials was tested. All S. aureus, S. agalactia and Enterococcus spp.
and also most of other Staphylococcus spp. (87.5%) and S. dysgalactiae (90.9%) were
resistant to penicillin. All Streptococcus and Enterococcus strains were found resistant
against vancomycin, amoxicillin+clavulanic acid, spiramycin, teicoplanin, neomycin
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
366
and oxytetracycline. In many reports [23, 24, 27, 30, 31] most of the Streptococcus
strains, even all of them isolated from bovine subclinical mastitis cases were reported
to be sensitive to penicillin. S. agalactiae, a group B Streptococcus (GBS) was not
reported to be resistant to penicillin so far. However, a few reports are available for
GBS clinical strains with reduced sensitivity to penicillin [33, 34]. Moreover, in recent
times 60 and 100% of resistance to penicillin have been reported in Streptococcus spp.
strains isolated from subclinical bovine mastitis by Ikiz et al. [24] and Yeilmen et
al. [28], respectively. Although all S. agalactiae (3 strains) and 90.9% of S. dysgalactiae
strains were found to be penicillin resistant, it should be considered that streptococci
isolated in our study were few in number. Nevertheless, this resistance should not be
ignored. Usually intramammary infusion is the most commonly recommended route
to treat mastitis cases and one of the antibiotics that has a good distribution into the
mammary gland for mastitis treatment is spiramycin [35, 36]. In many studies [23, 25,
37], strains isolated from subclinical mastitis including Streptococcus spp., Staphylococcus
spp. and Enterococcus spp. have been found to be sensitive to spiramycin. However, in
our study all strains were resistant to spiramycin. While Malinowski et al. [30] have
reported that the neomycin resistance rates of S. agalactiae and S. aureus strains were
80% and 22.7%, respectively; low sensitivity to neomycin both to S. aureus (8.33%)
and S. agalactiae (4%) has been reported by Ikiz et al. [28]. In our study, all Streptococcus
spp, Enterococcus spp. and S. aureus strains and most of the other Staphylococci (87.5%)
were resistant to neomycin. Similarly, all Streptococcus spp., Enterococcus spp. and most of
S. aureus (75%) and other Staphylococci (67.5%) were resistant to vancomycin. These
fi ndings were compatible with the fi ndings reported by Ikiz et al. [28] indicating that
the percentage of susceptibility of S. aureus and S. agalactiae to vancomycin was 8.33%
and 8%, respectively. Generally in many studies, [23, 25, 28, 30, 38] it has been reported
that Streptococus spp. and Staphylococcus spp. isolates were sensitive to amoxicillin and/or
amoxicillin clavulanic acid. We found that all Streptococci and Enterococci were resistant
against amoxicillin clavulanic acid but only 33.33% of S. aureus and 25% of other
staphylococci were resistant to this antibiotic combination. In contrast to our fi ndings,
Yeilmen et al. [24] have reported that all Streptococci were sensitive and all S. aureus
isolates were resistant to amoxicillin clavulanic acid. Susceptibility of Staphylococci,
Streptococci and Enterococci to tetracycline/oxytetracycline has been evaluated in many
studies and although some researchers [23, 27, 38, 39] have found that the strains
isolated from subclinical mastitis in different regions showed varying percentages of
sensitivity to tetracycline, in some studies [24, 25, 28, 30] the sensitivity of the strains
to tetracycline/oxytetracycline has been showed to be relatively low and even resistant.
Ikiz et al. [28] determined only 16% and 16.6% sensitivity of S. agalactiae and S. aureus
to oxytetracycline, respectively. Acar et al. [25] have reported low sensitivity (35.3%)
of their isolates to oxytetracycline. Malinowski et al. [30] reported more than 40%
resistance to tetracycline in S. agalactiae (40.2%), other streptococci (62.3%) and S.
aureus (41.7%). In our study all Streptococci and Enterococci and most of S. aureus
(66.66%) and other Stapyhlococci (52.5%) were resistant to oxytetracycline. These
fi ndings were compatible with the results of the studies mentioned above.
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
367
The prominent antibiotic and antibiotic combination, to which most bacterial strains
were susceptible, were rifaximin and rifaximin+cefacetrile combination. While all
staphylococci were detected to be sensitive to these antibiotics, only 6 (27.27%) and
2 (9.09%) S. dysgalactiae strains were resistant to rifaximine and rifaximin+cefacetrile
combination, respectively. Rifaximin resistance is known to be rare despite concerns
about rifaximin resistance of some bacteria (e.g. Staphylococcus spp.) in vivo have been
raised [40, 41]. On the other hand, it has been reported that the development of
bacterial resistance to rifaximin appears to occur with a low frequency in vitro [41].
Several studies evaluated the resistance of mastitis pathogens against rifaximin in vitro.
Malinowski et al. [30] reported that the resistance of S. agalactiae and other streptococci
against rifaximin were 17.6% and 25.8% respectively and for coagulase negative
staphylococci the percentage of rifaximin resistance was only 2.9%. Idriss et al. [42]
reported that the percentage of rifaximin resistance of S. aureus and S. agalactiae were
5.26% and 50%, respectively.
Consequently, the present study revealed that the ratio of contagious (S. aureus, S.
agalactiae) and environmental (S. dysgalactiae, S.uberis, Enterococcus spp.) agents were
29.34% and 70.66%, respectively. High proportions of environmental agents indicate
the importance of milking hygiene and dry cow therapy. On the other hand antibiotic
susceptibility of mastitis pathogens to antibiotics was variable. In order to achieve the
desired effect of antibiotic treatment, the susceptibility status of the strains isolated
from mastitis cases in Samsun region should be considered.
Acknowledgements
This study was supported by University of Ondokuz Mayıs (Project Id: PYO.
VET.1901.10.005). We also would like to thank to TGEM Samsun, Karaköy
Agricultural Enterprises for its support.
REFERENCES
1. Bradley AJ: Bovine mastitis: An evolving disease. Vet J, 164, 117-126, 2002.
2. Ergun Y, Aslantas O, Kirecci E, Sarıbay MK, Ates AT, Ulku A, Demir C: Prevalence and
etiology of subclinical mastitis in Awassi dairy ewes in southern Turkey. Turk J Vet Anim
Sci, 33, 477-483, 2009.
3. Ozenc E, Vural MR, Seker E, Ucar M: An evaluation of subclinical mastitis during lactation
in Anatolian buffaloes. Turk J Vet Anim Sci, 32, 359-368, 2008.
4. Pellegrino M, Giraudo J, Raspanti C, Odierno L, Bogni C: Effi cacy of immunization against
bovine mastitis using Staphylococcus aureus avirulent mutant vaccine. Vaccine, 28, 4523-
4528, 2010.
5. Sudhan NA, Sharma N: Mastitis-An important production disease of dairy animals. SMVS’
DAIRY YEAR BOOK, 72-88, 2010.
6. Trajev M, Nakov D, Hristov S, Andonov S I, Joksimovi-Todorovi Mirjana: clinical
mastitis in Macedonian dairy herds. Acta Vet-Beograd, 63, 63-76, 2013.
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
368
7. Makovický P, Makovický P, Nagy M, Rimárová K, Diabelková J: Genetic parameters for
somatic cell count, logscc and somatic cell score of breeds: Improved valachian, tsigai,
lacaune and their crosses. Acta Vet-Beograd, 64, 386-396, 2014.
8. Pyorala S: Indicators of infl ammation in diagnosis of mastitis. Vet Res, 34, 565-578, 2003.
9. Viguer C, Arora A, Gilmarti N, Welbeck K, O’Kennedy R: Mastitis detection: current
trends and future perspectives. Tib Tech, 27, 486-493, 2009.
10. Wellenberg GJ, van der Poel WHM, Van Oirschot JT: Viral infections and bovine mastitis:
A review. Vet Microbiol, 88, 27-45, 2002.
11. Turkyılmaz S, Yıldız O, Oryasın E, Kaynarca S, Bozdogan B: Molecular identifi cation of
bacteria isolated from dairy herds with mastitis. Kafkas Univ Vet Fak Derg, 16, 1025-1032,
2010.
12. Abd El-Razik KA, Abdelrahman KA, Ahmed YF, Gomaa AM, Eldebaky HA: Direct
identifi cation of major pathogens of the bubaline subclinical mastitis in Egypt using PCR.
J Am Sci, 10, 652-660, 2010.
13. Kuzma K, Malinowski E, Lassa H, Kossowska A: Specifi c detection of Staphylococcus
aureus by PCR in intramammary infection. B Vet I Pulawy, 47, 183-190, 2003.
14. Moatamedi H, Seyfi abad Shapouri M, Chorbanpoor M, Jamshidian M, Gooraninejad SA:
Polymerase chain reaction based study on the SCM caused by S. agalactiae, S. dysgalactiae
and S. uberis in cattle in Ahvaz. IJVR, 8, 260-265, 2007.
15. Raji Savi N, Kati V, Velebit B: Characteristics of coagulase positive staphylococci
isolated from milk in cases of subclinical mastitis. Acta Vet-Beograd, 64, 115-123, 2014.
16. Cengiz S, Dinç G, Söüt MÜ: Detection of several virulence properties, antibiotic resistance
and phylogenetic relationship in E. coli isolates originated from cow mastitis. Acta Vet-
Beograd, 64 , 413-425, 2014.
17. Bastan A: neklerde Meme Salıı ve Sorunları. 124, Kardelen Ofset, Ankara, 2010.
18. Quinn PJ, Carter ME, Markey BK, Carter GR: Clinical Veterinary Microbiology. Mosby-
Year Book Europe, London, 1994.
19. National Committee for Clinical laboratory Standards: Performance standards for
antimicrobial susceptibility testing; fourteenth informational supplement: M2-A8
performance standards for antimicrobial disk susceptibility test; approved Standard. 8thed.
National Committee for Laboratory Standards, Wayne, PA, 2003.
20. Ciftci A, Findik A, Onuk EE, Savasan S: Detection of methicillin resistance and slime
factor production of Staphylococcus aureus in bovine mastitis. Braz J Microbiol, 40, 254-
261, 2009.
21. Ke D, Picard FJ, Martineau F, Me´nard C, Roy PH, Ouellette M, Bergeron MGÇ:
Development of a PCR assay for rapid detection of Enterococci. J Clin Microbiol, 37,
3497-3503, 1999.
22. Sevinti DA, Sahin M: Determining of ß-lactamase activity and resistance against some
antibiotics of Staphylococcus strains isolated from bovine mastitis. Vet Bil Derg, 25, 23-28,
2009.
23. Macun HC, Yagcı IP, Unal N, Kalender H, Sakarya F, Yildirim M: Agent isolation and
antibiotic resistance in dairy cows with subclinical mastitis in Kırıkkale. J Fac Vet Med Univ
Erciyes, 8(2): 83-89, 2011.
24. Yesilmen S, Ozyurtlu N, Bademkıran S: The isolation of subclinical mastitis agents and
determination of the sensitive antibiotics in dairy cows in Diyarbakır province. Dicle Univ
Vet Fak Derg, 1, 24-29, 2012.
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
369
25. Acar G, Yılmaz E, Solmaz H, Cantekin Z: The isolation of streptococcal agents from cattle
with subclinical mastitis in Hatay region and detection of their susceptibilities against some
antibiotics. AVKAE Derg, 2, 1-5, 2012.
26. Gulcu HB, Ertas HB: Elazı yöresinde mezbahada kesilen ineklerde mastitisli meme
loblarınınn bakteriyolojik incelenmesi. Turk J Vet Anim Sci, 28, 91-94, 2004.
27. Tel OY, Keskin O, Zonturlu AK, Arserim Kaya NB: anlıurfa yöresinde subklinik
mastitislerin görülme oranı, aerobik bakteri izolasyonu ve duyarlı antibiyotiklerin
belirlenmesi. FU SBVD, 23, 101-106, 2009.
28. Ikiz S, Basaran B, Bingol EB, Cetin O, Kasikci G, Ozgur NY, Ucmak M, Yilmaz O, Gunduz
MC, Sabuncu A: Presence and antibiotic susceptibility patterns of contagious mastitis
agents (Staphylococcus aureus and Streptococcus agalactiae) isolated from milks of dairy
cows with subclinical mastitis, Turk J Vet Anim Sci, 37, 569-574, 2013.
29. Cengiz S, Tekin O, Akan M: Molecular typing of Enterococcus spp. isolated from cow
mastitis, Vet J Ankara Univ, 58, 17-20, 2011.
30. Malinowski E, Lassa H, Smulski S, Klossowka A,Kaczmarowski M: Antimicrobial
susceptibility of bacteria isolated from cows with mastitis in 2006-2007, Bull Vet Inst
Pulawy, 52, 565-572, 2008.
31. Persson Y, Nyman AKJ, Grönlund-Andersson U: Etiology and antimicrobial susceptibility
of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet
Scand, 53(1): 36, 2011.
32. El-Jakee J, Hableel HS, Kandil M, Hassan OF, Khairy EA, Marouf SA: Antibiotic resistance
patterns of isolated from mastitic cows and ewes in Egypt, Global Vet, 10, 264-270, 2013.
33. Lopardo H: Antimicrobial resistance in ß-hemolytic streptococci in Argentina. In, Méndez-
Vilas (Ed): Communicating Research and Educational Topics and Trends in Applied
Microbiology, 794-798, 2007.
34. Jain B, Tewari A, Bhandari BB, Jhala MK: Antibiotic resistance and virulence genes in
Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Vet Arhiv, 82,
423-432, 2012.
35. Pyorala S: Treatment of mastitis during lactation. Ir Vet J, 62(4): 40, 2009.
36. Du Preez JH: Bovine mastitis therapy and why it fails. JSAVA, 71, 201-208, 2000.
37. Bakir M, Sabrina R, Toufi k M: Antibacterial susceptibility profi les of subclinical mastitis
pathogens isolated in Batna and Setif governorates (east of Algeria), Vet World, 4, 537-541,
2011.
38. Bulla TR, Rana YS, Sharma A: Comparison of different routes of administration of
antibiotic therapy for sub-clinical mastitis in buffaloes. Haryana Vet, 44, 86-87, 2005.
39. Ekin IH, Gurturk K: neklerde subklinik mastitis olgularından izole edilen streptokokların
serogruplandırılması ve çeitli biyokimyasal özellikleri üzerine aratırmalar, YYU Sag Bil
Ens Derg, 4, 21-27, 1998.
40. Kim M, Morales W, Hani AA, Kim S, Kim G, Weitsman S, Chang C, Pimentel M: The effect
of rifaximin on gut fl ora and staphyloccocus resistance, Dig Dis Sci, 58, 1676-1682, 2013.
41. Valentin T, Leitner E, Rohn A, Zollner-Schwetz I, Hoenigl M, Salzer HJF, Krause R:
Rifaximin intake leads to emergence of rifampin-resistant staphyloccocci, JINF, 62, 34-38,
2011.
42. Idriss S, Foltys V, Tancin V, Kirchnerova K, Tancinova D, Zaujec K: Mastitis pathogens
and their resistance againts antimicrobial agents in dairy cows in Nitra, Slovakisi, Slovak J
Anim Sci, 47, 33-38, 2014.
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
370
ISPITIVANJE ETIOLOGIJE SUBKLINIČKOG MASTITISA
DŽERZEJ I HIBRID DŽERZEJ MLEČNIH KRAVA
GÜRLER Hande, FINDIK Arzu, GÜLTKEN Nilgün, AY Serhan Serhat, ÇFTÇ
Alper, KOLDA Ece, ARSLAN Serhat, FINDIK Murat
Cilj ove studije bio je ispitivanje etiologije subklinikog mastitisa (SCM) mlenih Jersey
krava uz primenu bakterioloških i molekularnih metoda identifi kacije. Tokom studije
observirano je u Samsun oblasti u Turskoj 121 Jersey i 78 hibrid Jersey krava sa SCM.
Ukupno 411 Kalifornija mastitis test (CMT) pozitivnih uzoraka mleka je bakteriološki
ispitano. Prevalencija subklinikog mastitisa bila je 54,75% i 67,20% kod Jersey i hi-
bridnih krava. Tokom bakteriološkog ispitivanja ukupno 92 sojeva je izolovano iz
411 uzoraka mleka. Naješe bakterije bile su Staphylococcus spp. (69,56%). Meu
njima bili su Staphylococcus aureus (26.08%), Streptococcus dysgalactiae (23.91%),
Enterococcus spp. (3.26%) i Streptococcus agalactiae (3.26%). Svi sojevi su identi-
fi kovani bakteriološkim metodama i PCRom. Gram negativne bakterije nisu izolovane.
U zakljuku, utvrena je etiologija SCM kod istokrvnih i hibridnih Jersey krava u
Samsun oblasi kao i prevalencija bakterija. Relativno visoka uestalost SCM ukazu-
je na potencijanu potrebu razmatranja faktora koji doprinose razvoju mastitisa (npr.
menadžment), kao i bakterijskih agenasa. Predstavljena studija, kao i druge studije,
mogu doprineti razvoju vakcinalnih sojeva.
