ArticlePDF Available

Abstract and Figures

The aim of this study was to investigate the etiology of subclinical mastitis (SCM) in dairy Jersey cows with the use of bacteriological and molecular identifi cation methods. In the study 121 Jersey and 78 hybrid Jersey cows with SCM were observed in the Samsun district of Turkey. A total of 411 California mastitis test (CMT) positive milk samples from these animals were examined bacteriologically. The prevalence of subclinical mastitis was 54.75% and 67.2% in Jerseys and hybrids, respectively. On bacteriological examination, a total of 92 strains were isolated from 411 milk samples. The most prevalent bacteria were Staphylococcus spp. (69.56%). Among them 24 isolates were Staphylococcus aureus (26.08%) the other isolates were Streptococcus dysgalactiae (23.91%), Enterococcus spp. (3.26%) and Streptococcus agalactiae (3.26%). All strains were identifi ed with bacteriological culture methods, as well as by Polymerase Chain Reaction (PCR). Gram-negative bacteria were not isolated. In conclusion, the etiology of SCM in full blood and hybrid Jersey dairy cows in Samsun and the prevalence of bacteria were determined. The relatively high prevalence of SCM indicates the potential need for the consideration of some factors contributing to the formation of mastitis (e.g. management) as well as bacterial agents. The present study and further studies may be useful to develop mastitis vaccines by means of providing true vaccine strain sources.
Content may be subject to copyright.
358
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
UDK: 636.2.09:616.19-002-02(560)
DOI: 10.1515/acve-2015-0030
Research article
*Corresponding author: e-mail: hulusoy@omu.edu.tr, handeulusoy@gmail.com
INVESTIGATION ON THE ETIOLOGY OF SUBCLINICAL
MASTITIS IN JERSEY AND HYBRID JERSEY DAIRY COWS
GÜRLER Hande1*, FINDIK Arzu2, GÜLTKEN Nilgün1, AY Serhan Serhat1,
ÇFTÇ Alper2, KOLDA Ece3, ARSLAN Serhat4, FINDIK Murat1
1Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine, Ondokuz Mayıs University,
Samsun-Turkey; 2Department of Microbiology, Faculty of Veterinary Medicine, Ondokuz Mayıs
University, Samsun-Turkey; 3Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine,
Mustafa Kemal University, Hatay-Turkey; 4Department of Biometry, Faculty of Veterinary Medicine,
Ondokuz Mayıs University, Samsun-Turkey
(Received 10th December 2014; Accepted 8th April 2015)
The aim of this study was to investigate the etiology of subclinical mastitis (SCM) in
dairy Jersey cows with the use of bacteriological and molecular identi cation methods.
In the study 121 Jersey and 78 hybrid Jersey cows with SCM were observed in the
Samsun district of Turkey. A total of 411 California mastitis test (CMT) positive
milk samples from these animals were examined bacteriologically. The prevalence of
subclinical mastitis was 54.75% and 67.2% in Jerseys and hybrids, respectively. On
bacteriological examination, a total of 92 strains were isolated from 411 milk samples.
The most prevalent bacteria were Staphylococcus spp. (69.56%). Among them 24 isolates
were Staphylococcus aureus (26.08%) the other isolates were Streptococcus dysgalactiae
(23.91%), Enterococcus spp. (3.26%) and Streptococcus agalactiae (3.26%). All strains were
identi ed with bacteriological culture methods, as well as by Polymerase Chain Reaction
(PCR). Gram-negative bacteria were not isolated. In conclusion, the etiology of SCM
in full blood and hybrid Jersey dairy cows in Samsun and the prevalence of bacteria
were determined. The relatively high prevalence of SCM indicates the potential need
for the consideration of some factors contributing to the formation of mastitis (e.g.
management) as well as bacterial agents. The present study and further studies may be
useful to develop mastitis vaccines by means of providing true vaccine strain sources.
Key words: etiology, Jersey dairy cow, molecular identi cation, subclinical mastitis
INTRODUCTION
Subclinical mastitis still continues to be a major problem in dairy animals such as
cattle, buffalo and ewes due to economic losses to dairy farms all over the world.
These economic losses are caused by reduced milk yield, discarded milk, replacement
cost, extra labor, costs of treatment, veterinary care and culling [1-6].
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
359
Subclinical mastitis is a disease that is dif cult to detect due to the absence of any
visible indications either in the milk or in the mammary glands. The diagnosis of SCM
is based on the somatic cell count (SCC) and microbiological status of udder quarters
[7]. CMT is an advantageous test due to its inexpensiveness and allows the detection
of the number of somatic cells in the milk sample indirectly. In addition, it is the
only cow-side test giving real-time results for selection of the quarters for subsequent
bacteriological examination [8]. Bacteriological culture methods and biochemical tests
are used to isolate and identify the bacteria causing SCM [9]. The primary causes
of mastitis are bacteria, though it is also caused by non-bacterial pathogens such
as viruses, fungi, yeasts, chlamydia and mycoplasmas [10]. Many species of bacteria
have been determined as causative agents of mastitis in Turkey. Reported bacteria
are Staphylococcus aureus, Staphylococcus epidermidis, Streptococcus agalactiae, Streptococcus
dysgalactiae, Streptococcus uberis, Arcanobacterium pyogenes, Escherichia coli, Corynebacterium bovis,
Pasteurella multocida, Bacillus subtilis, Bacillus cereus and Micrococcus spp. [11]. Identi cation
of bacterial pathogens in the milk from cows with increased SCM is regarded as the
de nite diagnosis of mastitis and is important for epidemiological studies and disease
control. Culture of milk samples from cows with increased SCM may yield no bacteria
due to the presence of very low numbers of pathogens when samples are collected.
Besides, antibiotic residues and leukocytes might be the cause of negative culture
results [12]. Because of these limitations, molecular methods such as Polymerase
Chain Reaction (PCR) have been used successfully for the identi cation of various
mastitis pathogens. Furthermore, PCR is a rapid method with high sensitivity and
speci city which detects bacteria even in the presence of residual antimicrobials or
preservatives in the milk [13-16].
The aim of this study was to determine the etiology of subclinical mastitis (SCM) in
Jersey dairy cows using bacteriological and PCR methods as well as to investigate the
sensitivity of the isolated bacteria to antimicrobial drugs.
MATERIALS AND METHODS
A total of 337 dairy cattle (221 Jersey and 116 Jersey hybrid) at 25 family and
agricultural type farms were investigated from March 2011 to February 2012. Among
these cattle 199 (121 Jersey and 78 hybrid Jersey) were diagnosed SCM. California
mastitis test positive milk samples (225 and 186 were from Jersey and hybrid Jersey
cows, respectively) were examined bacteriologically. Afterwards, suspicious colonies
were identi ed morphologically, microscopically and biochemically. Ethical approval
was obtained from the Animal Ethics Committee, University of Ondokuz Mayis,
Samsun, Turkey (Approval Nr. 201001).
California mastitis test and milk sample collection
California mastitis test was used in order to detect the presence of SCM in the eld.
The procedures and interpretations were performed by traditional methods [17]. Teat
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
360
ends were disinfected with cotton swabs with 70% alcohol, allowed to dry and the
foremilks from quarters were discarded. CMT was performed and approximately 15
ml milk samples of positive quarters were collected in sterile tubes and immediately
transported under cold conditions to the laboratory.
Isolation and Identi cation of Microorganisms
After CMT positive samples were brought to the laboratory, they were homogenized
with a vortex mixer; each of them was plated on blood agar enriched with 5% sheep
blood and McConcey agar plates. The plates were incubated at 37°C for 24-48 hours.
Then, suspicious colonies were evaluated for cultural characteristics (haemolysis,
pigmentation), microscopy (Gram staining) and biochemical characteristics (catalase,
oxidase, coagulase, aesculin hydrolysis, CAMP tests) [18].
Antibiotic susceptibility test
Antibiotic susceptibilities of the strains isolated from the samples in the study were
determined by Kirby-Bauer Disc Diffusion Method according to the National
Committee for Clinical Laboratory Standards (NCCLS) (2003) [19]. The antibiotic
discs were penicillin G (10 U), vancomycin (30 g), ampicillin-dicloxacillin
(10k g/1 g), amoxicillin-clavulonic acid (20 g/10 g), teicoplanin (30 g), neomycin
(10 g), enro oxacin (5 g), oxytetracycline (30 g), spiramycin (100 g), rifaximin
(40 g), rifaximin-cefacetrile (40 g/30 g) and cefaperazone (75 g). The results were
recorded as susceptible (S) or resistant (R).
DNA extraction
DNA for direct PCR was extracted by boiling the intact bacteria. A tissue extraction
kit (Invitrogen®) was used for PCR application on milk samples according to the
manufacturer’s instructions.
Polymerase Chain Reaction (PCR)
PCR protocols were used for bacteria commonly isolated from SCM. To identify
Staphylococcus spp. by PCR a method by Ciftci et al. [16] was used. Brie y, 5 l of
extracted DNA was added to 25 l of PCR mixture. This PCR mixture consisted of
1XPCR buffer (50 mm KCl, 20 mM Tris HCl), 5 l of 25 mM MgCl2, 3 l of 10 mM
deoxynucleotide triphosphat (dNTP) mixture, 1 l of 20 M 16S rRNA (Staphylococcus
spp. speci c) primers and 2U Taq DNA polymerase. Ampli cation conditions were
as follows: Initial denaturation at 94ºC for 52 min, followed by 30 cycles of 45 s at
94ºC, 45 s at 68ºC, 90 s at 72ºC and nal extention at 72ºC for 10 min amplicons were
loaded onto 1.5% agarose gel containing 1 g/ml etidium bromide and ampli ed
DNA fragments were separated by agarose gel electrophoresis. Bands were visualized
under UV transilluminator. Identi cation of S. aureus strains by PCR was performed
using a method by Kuzma et al. [13]. Brie y, the total reaction volume was 50 l
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
361
and PCR mixture contained 1.5 mM MgCl2, 10 mM Tris-HCl (pH 9.0), 50 mM KCl,
0.1% Triton®X-100, 200 mM (each) deoxynucleotide triphosphat, 0.2 mM of primers
(Table 1) and 0.625 U Taq polymerase. Ampli cation conditions were as follows: initial
denaturation at 95°C for 10 min, 37 cycles of denaturation at 94°C for 1 s, annealing
at 55°C for 30 s, elongation at 72°C 1.5 min and nal elongation at 72°C 5 min PCR
products were separated and visualized as above. A PCR protocol by Abd El-Razik
et al. [12] was used to identify S. dysgalactiae and S. agalactiae strains. All reactions were
carried out in a 50 l volume. Two hundred microliter of extracted DNA, 5 M primer
(Table 1) and 25 l of Taq PCR Master Mix (Taq PCR Master Mix Kit, Cat no 201443,
Qiagen®) were brought together in this volume.
Ampli cation conditions were as follows: initial denaturation at 95°C for 2 min, 35
cycles of denaturation at 94°C for 45 s, annealing at 57°C and 60°C for 45 s for
S. dysgalactiae and S. agalactiae primers, respectively, elongation at 72°C for 45 s and
nal extention at 72°C for 10 min. Ampli cation products were evaluated as above.
The PCR protocol by Moatamedi et. al. [14] was used to identify S. uberis. Brie y,
in a 50 l volume, 5 l of extracted DNA, 2.5 U Taq polymerase, 0.4 mM of each
deoxynucleotide triphosphate, 50 pmol of each primer, 5 l of 10xPCR buffer (500
mM KCl, 200 mM tris-HCl, pH 8.4), MgCl2 with optimal concentration were brought
together. Ampli cation conditions were as follows: rst denaturation at 94°C for 2 min,
40 cycles of 94°C for 30 s, 55°C for 30 s, 72°C for 30 s and nal extention at 72°C for
Table 1. Primers used for identi cation of the isolates from cases of SCM by PCR
Target Primer Sequence (5’-3’)
PCR
product
(bp)
Source
Staphylococcus spp. 16SrRNA AACTCTGTTATTAGGGAAGAACA 756 Ciftci
et al. (2009)
16SrRNA CCACCTTCCTCCGGTTTGTCACC
S. aureus Sau327 GGACGACATTAGACGATCA 1318 Abd El-Razik
et al. (2010)
Sau1645 CGGGCACCTATTTTCTATCT
S. dysgalactiae Sdy105 AAAGGTGCAACTGCATCACTA 281 Abd El-Razik
et al. (2010)
Sdy386 GTCACATGGTGGATTTTCCA
S. agalactiae Sag40 CGCTGAGGTTTGGTGTTTACA 405 Abd El-Razik
et al. (2010)
Sag445 CACTCCTACCAACGTTCTTC
S. uberis STRU-UbI TAAGGAAGACGTTGGTTAAG 330 Moatamedi
et al. (2007)
STRU-UbII TCCAGTCCTTAGACCTTCT
Enterococcus spp. Ent1 TACTGACAAACCATTCATGATG 112 Ke et al.
(1999)
Ent2 AACTTCGTCACCAACGCGAAC
E. Coli Eco2083 GCTTGACACTGAACATTGAG 662 Abd El-Razik
et al. (2010)
Eco2745 GCACTTATCTCTTCCGCATT
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
362
7 min. PCR products were evaluated as above. For identi cation of Enterococcus spp. by
PCR, a protocol by Ke et al. [20,21] was used. Brie y, 1 ng of extracted DNA was added
to 19 l of PCR mixture (50 mM KCl, 10 mM Tris-HCl (pH 9.0), 0.1% Triton®X-100,
2.5 mM MgCl2, 0.2 mM of each Enterococcus-speci c primers (Ent1 and Ent2; Table
1), 200 mM of each deoxynucleotide triphosphate (Pharmacia Biotech®), 3.3 g/ml of
bovine serum albumin (BSA) (Sigma-Aldrich Canada Ltd., Oakville, Ontario, Canada),
0.5 U of Taq polymerase (Promega®). Ampli cation conditions were as follows: rst
denaturation at 95°C for 3 min, 35 cycles of 95°C for 30 s, 55°C for 30 s, 72°C for
1 min and nal extention at 72°C for 7 min. PCR products were evaluated as above.
Statistics
Data were evaluated with SAS (2009) statistics suited to summarize means, frequencies
and standard error of means.
RESULTS
Cultural Identi cation
Of the 411 milk samples, a total of 92 strains were isolated. Of sixty-four strains
(69.56%) identi ed as Staphylococcus spp., 24 strains (26.08%) were identi ed as S.
aureus according to their colony morphology (hemolysis, pigment production) and
biochemical reactions (coagulase, DNase, mannitol fermentation). Of 92 strains, 25
were (27.17%) Streptococcus spp. and three of them (3.26%) were S. agalactiae and 22
(23.91%) were S. dysgalactiae. Three of all the isolates were identi ed as Enterococcus
spp. (3.26%). S. uberis was not isolated. Isolated bacterial strains and their percentages
are given in Table 2.
Antibiotic Susceptibility Test
While all S. aureus and other Staphylococcus spp. strains were susceptible to rifaximin,
rifaximin+cefacetrile, they showed resistance against spiramycin. These strains showed
Table 2. Distribution of the isolates identi ed by cultural methods and PCR
Bacteria Cultural identi cation PCR from culture * PCR from milk
No ( %) No (%) No (%)
S. aureus 24 (26.08) 24 (26.08) 24 (5.83)
Staphylococcus spp. other
than S. aureus 40 (43.47) 40 (43.47) 40 (9.73)
S. agalactiae 3 (3.26) 3 (3.26) 3 (0.72)
S. dysgalactiae 22 (23.91) 22 (23.91) 22 (5.35)
S. uberis 0 (0) 0 (0) 0 (0)
Enterococcus spp. 3 (3.26) 3 (3.26) 3 (0.72)
*PCR analysis results from 411 milk samples
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
363
Table 3. Resistance percentages of the bacteria strains against antibiotics
Antibiotics (conc.)
Staphylococcus
spp.
(n=40)
S.aureus
(n=24)
S.agalactiae
(n=3)
S.dysgalactiae
(n=22)
Enterococcus
spp.
(n=3)
n%n % n % n %n %
Penicillin (10 U) 35 87.5 24 100 3 100 20 90.9 3 100
Vancomycin (30 g) 27 67.5 18 75 3 100 22 100 3 100
Ampicillin+Dicloxacillin
(10 g+1 g) 11 27.5 4 16.6 0 0 0 0 0 0
Ampicillin (10 g) 26 65 22 91.66 0 0 0 0 0 0
Amoxicillin+Clavulanic acid
(20 g+10 g) 10 25 8 33.33 3 100 22 100 3 100
Spiramycin (100 g) 40 100 24 100 3 100 22 100 3 100
Teicoplanin (30 g) 5 12.5 3 12.5 3 100 22 100 3 100
Rifaximin (40 g) 0 0 0 0 0 0 6 27.27 0 0
Rifaximin+Cefacetril
(40 g+30 g) 0 0 0 0 0 0 2 9.09 0 0
Cefaperazon (75 g) 2 3.12 2 8.33 30 100 18 81.81 0 0
Neomycin (10 g) 35 87.5 24 100 3 100 3 100 3 100
Oxytetracycline (30 g) 21 52.5 16 66.66 3 100 3 100 3 100
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
364
a variety of resistance against other antibiotics. Namely, >50% of the Staphylococcus spp.
strains (other than S. aureus) showed resistance to penicillin (87.5%), neomycin (87.5%),
vancomycin (67.5%), ampicillin (65%) and oxytetracycline (52.5%). While all S. aureus
strains were resistant to spiramycin, penicillin and neomycin, 91.66% of them showed
resistance to ampicillin. Besides, S. aureus strains showed relatively high resistance to
vancomycin (75%) and oxytetracycline (66.6%). S. aureus and other Staphylococcus spp.
strains showed lower resistance to ampicillin+dicloxacillin, amoxicillin+clavulanic
acid, teicoplanin and cefaperazone. The resistance percentages of the strains to 12
antibiotics are given in Table 3. All S. agalactiae, S. dysgalactiae and Enterococcus spp. strains
were resistant to vancomycin, amoxicillin+clavulanic acid, spiramycin, teicoplanin,
neomycin and oxytetracycline. In addition, all of these strains were susceptiple to
ampicillin and ampicillin+dicloxacillin. Penicillin resistance occurred in all S. agalactiae
and Enterococcus spp. strains. Other resistance percentages are given in Table 3.
Molecular Identi cation
In Table 2, PCR results from both culture and milk (directly) are given. All strains
identi ed by cultural methods were further identi ed by PCR protocols from culture.
After PCR protocols from direct milk samples collected from respective quarters,
the same bacterial strains identi ed both by cultural and culture-PCR methods were
identi ed again. No Gram negative bacteria (including E. coli) was found in milk
samples neither by cultural nor by molecular methods.
DISCUSSION
Subclinical mastitis is a major problem since it does not present clinical symptoms in
dairy cows. The lack of visible symptoms makes it dif cult to recognize the infection
in udders and long-term effects which occur during the undetected period. Causative
organisms might lead to considerable economic losses because of decreased milk
production and altered milk composition [14]. In order to treat mastitis effectively
and create prevention strategies etiological agents must be determined. Treatment of
mastitis relies heavily on the use of antibiotics as the cause is mostly bacterial [4].
The present study was conducted to determine the etiology of subclinical mastitis
with bacteriological and molecular methods in Jersey and hybrids, as well as antibiotic
resistance of causative bacteria. Mastitis is a multifactorial disease for which more
than 250 microbial species, subspecies and serotypes have been isolated and identi ed
as causative agents [5]. These agents are grouped in three categories as contagious,
environmental and the others. Many studies have been performed concerning
subclinical mastitis in the world and S. aureus was reported to be the most important
contagious microorganism in cattle [5, 12-14]. Similarly, the studies conducted in
Turkey revealed that S. aureus was the most common agent [22-25]. The ratio from the
previous studies performed at different geographic regions in Turkey was 28.3% in the
eastern Anatolia region [22], 39.04% in Elazı [26], 24.63% in the southeast Anatolia
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
365
region [24], 32.5% in anlıurfa [27], 28.7% in the central Anatolia region [23]. In the
present study performed in the Black sea region of Anatolia, similar ratio of S. aureus
was detected (26.08%). In a study from Marmara region [24] S. aureus isolation rate was
found quite lower (4.44%) than in the other regions of Anatolia. Since management is
very important in mastitis prevention; diversity of housing conditions is thought to be
effective in the etiology of mastitis.
S. agalactiae is reported to be highly contagious and one of the important causes of
subclinical infections. It is an obligate bacteria in the bovine mammary gland that can
be transmitted to healthy cows via poor milking hygiene [14, 28]. In some studies, the
presence of S. agalactiae was detected to be between 6.16-10.7% [24, 26, 28]. In the
present study the ratio (3,26%) was determined to be lower than the other studies.
Among Streptococcus species, S. uberis and S. dysgalactiae were important species as
environmental agents [25]. The most important source of environmental organisms
is bedding material. It was reported that moisture in the environment should be
decreased to control the environmental microrganisms. Accordingly, clean pastures
and environment, dry milking equipment and pre-dipping hygiene are important
factors to reduce the exposure of these organisms [5]. Acar et al. [25] have reported
that 17 (28.81%) Streptococcus spp. were isolated from 59 SCM positive milk samples
(1 S.agalactiae, 8 S.dysgalactiae, 2 S.uberis, 6 S.fecalis). Similarly, Tel et al. [27] have also
reported that 16 (6.2%) Streptococcus spp. isolation was performed from 258 SCM
positive milk samples. In the present study, 25 (27.17%) were isolated from 92 bacteria
strain (3 S.agalactiae, 22 S.dysgalactiae). S. uberis was not isolated.
E. coli is an environmental mastitis agent similar to S. uberis and S. dysgalactiae [5, 22,
24]. Although in the present study E. coli was not isolated, in the studies carried out
in Kars [22], anlıurfa [27], Diyarbakır [24], Elazı [26] E.coli was determined as 5.9%,
6.2%, 8.58%, 8.9%, respectively. However, in the study carried out in Kırıkkale [23] the
presence of E.coli was determined to be very low (0.94%.)
Enterococci are the natural ora agent of the gastrointestinal system in humans and
animals and reported to be isolated in the dry period [19, 29]. Its ratio might be 6-42%
in mastitis cases [28]. In our study it was 3.6%.
Antimicrobial agents are the most frequently used therapeutics for subclinical
mastitis cases. A prudent antibiotic therapy improves udder health, decreases the
risk of exacerbating clinical mastitis and prevents economic losses. An important
factor affecting the success of antibiotic therapy is the resistance of the agents to
antibiotics. In several studies, many differences in the resistance against antibiotics
by the strains isolated from subclinical mastitis and different geographical regions
have been demonstrated [23, 24, 27, 28, 30, 31]. In our study, resistance of all strains
against twelve antimicrobials was tested. All S. aureus, S. agalactia and Enterococcus spp.
and also most of other Staphylococcus spp. (87.5%) and S. dysgalactiae (90.9%) were
resistant to penicillin. All Streptococcus and Enterococcus strains were found resistant
against vancomycin, amoxicillin+clavulanic acid, spiramycin, teicoplanin, neomycin
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
366
and oxytetracycline. In many reports [23, 24, 27, 30, 31] most of the Streptococcus
strains, even all of them isolated from bovine subclinical mastitis cases were reported
to be sensitive to penicillin. S. agalactiae, a group B Streptococcus (GBS) was not
reported to be resistant to penicillin so far. However, a few reports are available for
GBS clinical strains with reduced sensitivity to penicillin [33, 34]. Moreover, in recent
times 60 and 100% of resistance to penicillin have been reported in Streptococcus spp.
strains isolated from subclinical bovine mastitis by Ikiz et al. [24] and Yeilmen et
al. [28], respectively. Although all S. agalactiae (3 strains) and 90.9% of S. dysgalactiae
strains were found to be penicillin resistant, it should be considered that streptococci
isolated in our study were few in number. Nevertheless, this resistance should not be
ignored. Usually intramammary infusion is the most commonly recommended route
to treat mastitis cases and one of the antibiotics that has a good distribution into the
mammary gland for mastitis treatment is spiramycin [35, 36]. In many studies [23, 25,
37], strains isolated from subclinical mastitis including Streptococcus spp., Staphylococcus
spp. and Enterococcus spp. have been found to be sensitive to spiramycin. However, in
our study all strains were resistant to spiramycin. While Malinowski et al. [30] have
reported that the neomycin resistance rates of S. agalactiae and S. aureus strains were
80% and 22.7%, respectively; low sensitivity to neomycin both to S. aureus (8.33%)
and S. agalactiae (4%) has been reported by Ikiz et al. [28]. In our study, all Streptococcus
spp, Enterococcus spp. and S. aureus strains and most of the other Staphylococci (87.5%)
were resistant to neomycin. Similarly, all Streptococcus spp., Enterococcus spp. and most of
S. aureus (75%) and other Staphylococci (67.5%) were resistant to vancomycin. These
ndings were compatible with the ndings reported by Ikiz et al. [28] indicating that
the percentage of susceptibility of S. aureus and S. agalactiae to vancomycin was 8.33%
and 8%, respectively. Generally in many studies, [23, 25, 28, 30, 38] it has been reported
that Streptococus spp. and Staphylococcus spp. isolates were sensitive to amoxicillin and/or
amoxicillin clavulanic acid. We found that all Streptococci and Enterococci were resistant
against amoxicillin clavulanic acid but only 33.33% of S. aureus and 25% of other
staphylococci were resistant to this antibiotic combination. In contrast to our ndings,
Yeilmen et al. [24] have reported that all Streptococci were sensitive and all S. aureus
isolates were resistant to amoxicillin clavulanic acid. Susceptibility of Staphylococci,
Streptococci and Enterococci to tetracycline/oxytetracycline has been evaluated in many
studies and although some researchers [23, 27, 38, 39] have found that the strains
isolated from subclinical mastitis in different regions showed varying percentages of
sensitivity to tetracycline, in some studies [24, 25, 28, 30] the sensitivity of the strains
to tetracycline/oxytetracycline has been showed to be relatively low and even resistant.
Ikiz et al. [28] determined only 16% and 16.6% sensitivity of S. agalactiae and S. aureus
to oxytetracycline, respectively. Acar et al. [25] have reported low sensitivity (35.3%)
of their isolates to oxytetracycline. Malinowski et al. [30] reported more than 40%
resistance to tetracycline in S. agalactiae (40.2%), other streptococci (62.3%) and S.
aureus (41.7%). In our study all Streptococci and Enterococci and most of S. aureus
(66.66%) and other Stapyhlococci (52.5%) were resistant to oxytetracycline. These
ndings were compatible with the results of the studies mentioned above.
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
367
The prominent antibiotic and antibiotic combination, to which most bacterial strains
were susceptible, were rifaximin and rifaximin+cefacetrile combination. While all
staphylococci were detected to be sensitive to these antibiotics, only 6 (27.27%) and
2 (9.09%) S. dysgalactiae strains were resistant to rifaximine and rifaximin+cefacetrile
combination, respectively. Rifaximin resistance is known to be rare despite concerns
about rifaximin resistance of some bacteria (e.g. Staphylococcus spp.) in vivo have been
raised [40, 41]. On the other hand, it has been reported that the development of
bacterial resistance to rifaximin appears to occur with a low frequency in vitro [41].
Several studies evaluated the resistance of mastitis pathogens against rifaximin in vitro.
Malinowski et al. [30] reported that the resistance of S. agalactiae and other streptococci
against rifaximin were 17.6% and 25.8% respectively and for coagulase negative
staphylococci the percentage of rifaximin resistance was only 2.9%. Idriss et al. [42]
reported that the percentage of rifaximin resistance of S. aureus and S. agalactiae were
5.26% and 50%, respectively.
Consequently, the present study revealed that the ratio of contagious (S. aureus, S.
agalactiae) and environmental (S. dysgalactiae, S.uberis, Enterococcus spp.) agents were
29.34% and 70.66%, respectively. High proportions of environmental agents indicate
the importance of milking hygiene and dry cow therapy. On the other hand antibiotic
susceptibility of mastitis pathogens to antibiotics was variable. In order to achieve the
desired effect of antibiotic treatment, the susceptibility status of the strains isolated
from mastitis cases in Samsun region should be considered.
Acknowledgements
This study was supported by University of Ondokuz Mayıs (Project Id: PYO.
VET.1901.10.005). We also would like to thank to TGEM Samsun, Karaköy
Agricultural Enterprises for its support.
REFERENCES
1. Bradley AJ: Bovine mastitis: An evolving disease. Vet J, 164, 117-126, 2002.
2. Ergun Y, Aslantas O, Kirecci E, Sarıbay MK, Ates AT, Ulku A, Demir C: Prevalence and
etiology of subclinical mastitis in Awassi dairy ewes in southern Turkey. Turk J Vet Anim
Sci, 33, 477-483, 2009.
3. Ozenc E, Vural MR, Seker E, Ucar M: An evaluation of subclinical mastitis during lactation
in Anatolian buffaloes. Turk J Vet Anim Sci, 32, 359-368, 2008.
4. Pellegrino M, Giraudo J, Raspanti C, Odierno L, Bogni C: Ef cacy of immunization against
bovine mastitis using Staphylococcus aureus avirulent mutant vaccine. Vaccine, 28, 4523-
4528, 2010.
5. Sudhan NA, Sharma N: Mastitis-An important production disease of dairy animals. SMVS’
DAIRY YEAR BOOK, 72-88, 2010.
6. Trajev M, Nakov D, Hristov S, Andonov S I, Joksimovi-Todorovi Mirjana: clinical
mastitis in Macedonian dairy herds. Acta Vet-Beograd, 63, 63-76, 2013.
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
368
7. Makovický P, Makovický P, Nagy M, Rimárová K, Diabelková J: Genetic parameters for
somatic cell count, logscc and somatic cell score of breeds: Improved valachian, tsigai,
lacaune and their crosses. Acta Vet-Beograd, 64, 386-396, 2014.
8. Pyorala S: Indicators of in ammation in diagnosis of mastitis. Vet Res, 34, 565-578, 2003.
9. Viguer C, Arora A, Gilmarti N, Welbeck K, O’Kennedy R: Mastitis detection: current
trends and future perspectives. Tib Tech, 27, 486-493, 2009.
10. Wellenberg GJ, van der Poel WHM, Van Oirschot JT: Viral infections and bovine mastitis:
A review. Vet Microbiol, 88, 27-45, 2002.
11. Turkyılmaz S, Yıldız O, Oryasın E, Kaynarca S, Bozdogan B: Molecular identi cation of
bacteria isolated from dairy herds with mastitis. Kafkas Univ Vet Fak Derg, 16, 1025-1032,
2010.
12. Abd El-Razik KA, Abdelrahman KA, Ahmed YF, Gomaa AM, Eldebaky HA: Direct
identi cation of major pathogens of the bubaline subclinical mastitis in Egypt using PCR.
J Am Sci, 10, 652-660, 2010.
13. Kuzma K, Malinowski E, Lassa H, Kossowska A: Speci c detection of Staphylococcus
aureus by PCR in intramammary infection. B Vet I Pulawy, 47, 183-190, 2003.
14. Moatamedi H, Sey abad Shapouri M, Chorbanpoor M, Jamshidian M, Gooraninejad SA:
Polymerase chain reaction based study on the SCM caused by S. agalactiae, S. dysgalactiae
and S. uberis in cattle in Ahvaz. IJVR, 8, 260-265, 2007.
15. Raji Savi N, Kati V, Velebit B: Characteristics of coagulase positive staphylococci
isolated from milk in cases of subclinical mastitis. Acta Vet-Beograd, 64, 115-123, 2014.
16. Cengiz S, Dinç G, Söüt MÜ: Detection of several virulence properties, antibiotic resistance
and phylogenetic relationship in E. coli isolates originated from cow mastitis. Acta Vet-
Beograd, 64 , 413-425, 2014.
17. Bastan A: neklerde Meme Salıı ve Sorunları. 124, Kardelen Ofset, Ankara, 2010.
18. Quinn PJ, Carter ME, Markey BK, Carter GR: Clinical Veterinary Microbiology. Mosby-
Year Book Europe, London, 1994.
19. National Committee for Clinical laboratory Standards: Performance standards for
antimicrobial susceptibility testing; fourteenth informational supplement: M2-A8
performance standards for antimicrobial disk susceptibility test; approved Standard. 8thed.
National Committee for Laboratory Standards, Wayne, PA, 2003.
20. Ciftci A, Findik A, Onuk EE, Savasan S: Detection of methicillin resistance and slime
factor production of Staphylococcus aureus in bovine mastitis. Braz J Microbiol, 40, 254-
261, 2009.
21. Ke D, Picard FJ, Martineau F, Me´nard C, Roy PH, Ouellette M, Bergeron MGÇ:
Development of a PCR assay for rapid detection of Enterococci. J Clin Microbiol, 37,
3497-3503, 1999.
22. Sevinti DA, Sahin M: Determining of ß-lactamase activity and resistance against some
antibiotics of Staphylococcus strains isolated from bovine mastitis. Vet Bil Derg, 25, 23-28,
2009.
23. Macun HC, Yagcı IP, Unal N, Kalender H, Sakarya F, Yildirim M: Agent isolation and
antibiotic resistance in dairy cows with subclinical mastitis in Kırıkkale. J Fac Vet Med Univ
Erciyes, 8(2): 83-89, 2011.
24. Yesilmen S, Ozyurtlu N, Bademkıran S: The isolation of subclinical mastitis agents and
determination of the sensitive antibiotics in dairy cows in Diyarbakır province. Dicle Univ
Vet Fak Derg, 1, 24-29, 2012.
Gürler et al.: Investigation on the etiology of subclinical mastitis in Jersey and hybrid Jersey dairy cows
369
25. Acar G, Yılmaz E, Solmaz H, Cantekin Z: The isolation of streptococcal agents from cattle
with subclinical mastitis in Hatay region and detection of their susceptibilities against some
antibiotics. AVKAE Derg, 2, 1-5, 2012.
26. Gulcu HB, Ertas HB: Elazı yöresinde mezbahada kesilen ineklerde mastitisli meme
loblarınınn bakteriyolojik incelenmesi. Turk J Vet Anim Sci, 28, 91-94, 2004.
27. Tel OY, Keskin O, Zonturlu AK, Arserim Kaya NB: anlıurfa yöresinde subklinik
mastitislerin görülme oranı, aerobik bakteri izolasyonu ve duyarlı antibiyotiklerin
belirlenmesi. FU SBVD, 23, 101-106, 2009.
28. Ikiz S, Basaran B, Bingol EB, Cetin O, Kasikci G, Ozgur NY, Ucmak M, Yilmaz O, Gunduz
MC, Sabuncu A: Presence and antibiotic susceptibility patterns of contagious mastitis
agents (Staphylococcus aureus and Streptococcus agalactiae) isolated from milks of dairy
cows with subclinical mastitis, Turk J Vet Anim Sci, 37, 569-574, 2013.
29. Cengiz S, Tekin O, Akan M: Molecular typing of Enterococcus spp. isolated from cow
mastitis, Vet J Ankara Univ, 58, 17-20, 2011.
30. Malinowski E, Lassa H, Smulski S, Klossowka A,Kaczmarowski M: Antimicrobial
susceptibility of bacteria isolated from cows with mastitis in 2006-2007, Bull Vet Inst
Pulawy, 52, 565-572, 2008.
31. Persson Y, Nyman AKJ, Grönlund-Andersson U: Etiology and antimicrobial susceptibility
of udder pathogens from cases of subclinical mastitis in dairy cows in Sweden. Acta Vet
Scand, 53(1): 36, 2011.
32. El-Jakee J, Hableel HS, Kandil M, Hassan OF, Khairy EA, Marouf SA: Antibiotic resistance
patterns of isolated from mastitic cows and ewes in Egypt, Global Vet, 10, 264-270, 2013.
33. Lopardo H: Antimicrobial resistance in ß-hemolytic streptococci in Argentina. In, Méndez-
Vilas (Ed): Communicating Research and Educational Topics and Trends in Applied
Microbiology, 794-798, 2007.
34. Jain B, Tewari A, Bhandari BB, Jhala MK: Antibiotic resistance and virulence genes in
Streptococcus agalactiae isolated from cases of bovine subclinical mastitis. Vet Arhiv, 82,
423-432, 2012.
35. Pyorala S: Treatment of mastitis during lactation. Ir Vet J, 62(4): 40, 2009.
36. Du Preez JH: Bovine mastitis therapy and why it fails. JSAVA, 71, 201-208, 2000.
37. Bakir M, Sabrina R, Tou k M: Antibacterial susceptibility pro les of subclinical mastitis
pathogens isolated in Batna and Setif governorates (east of Algeria), Vet World, 4, 537-541,
2011.
38. Bulla TR, Rana YS, Sharma A: Comparison of different routes of administration of
antibiotic therapy for sub-clinical mastitis in buffaloes. Haryana Vet, 44, 86-87, 2005.
39. Ekin IH, Gurturk K: neklerde subklinik mastitis olgularından izole edilen streptokokların
serogruplandırılması ve çeitli biyokimyasal özellikleri üzerine aratırmalar, YYU Sag Bil
Ens Derg, 4, 21-27, 1998.
40. Kim M, Morales W, Hani AA, Kim S, Kim G, Weitsman S, Chang C, Pimentel M: The effect
of rifaximin on gut ora and staphyloccocus resistance, Dig Dis Sci, 58, 1676-1682, 2013.
41. Valentin T, Leitner E, Rohn A, Zollner-Schwetz I, Hoenigl M, Salzer HJF, Krause R:
Rifaximin intake leads to emergence of rifampin-resistant staphyloccocci, JINF, 62, 34-38,
2011.
42. Idriss S, Foltys V, Tancin V, Kirchnerova K, Tancinova D, Zaujec K: Mastitis pathogens
and their resistance againts antimicrobial agents in dairy cows in Nitra, Slovakisi, Slovak J
Anim Sci, 47, 33-38, 2014.
Acta Veterinaria-Beograd 2015, 65 (3), 358-370
370
ISPITIVANJE ETIOLOGIJE SUBKLINIČKOG MASTITISA
DŽERZEJ I HIBRID DŽERZEJ MLEČNIH KRAVA
GÜRLER Hande, FINDIK Arzu, GÜLTKEN Nilgün, AY Serhan Serhat, ÇFTÇ
Alper, KOLDA Ece, ARSLAN Serhat, FINDIK Murat
Cilj ove studije bio je ispitivanje etiologije subklinikog mastitisa (SCM) mlenih Jersey
krava uz primenu bakterioloških i molekularnih metoda identi kacije. Tokom studije
observirano je u Samsun oblasti u Turskoj 121 Jersey i 78 hibrid Jersey krava sa SCM.
Ukupno 411 Kalifornija mastitis test (CMT) pozitivnih uzoraka mleka je bakteriološki
ispitano. Prevalencija subklinikog mastitisa bila je 54,75% i 67,20% kod Jersey i hi-
bridnih krava. Tokom bakteriološkog ispitivanja ukupno 92 sojeva je izolovano iz
411 uzoraka mleka. Naje bakterije bile su Staphylococcus spp. (69,56%). Meu
njima bili su Staphylococcus aureus (26.08%), Streptococcus dysgalactiae (23.91%),
Enterococcus spp. (3.26%) i Streptococcus agalactiae (3.26%). Svi sojevi su identi-
kovani bakteriološkim metodama i PCRom. Gram negativne bakterije nisu izolovane.
U zakljuku, utvrena je etiologija SCM kod istokrvnih i hibridnih Jersey krava u
Samsun oblasi kao i prevalencija bakterija. Relativno visoka uestalost SCM ukazu-
je na potencijanu potrebu razmatranja faktora koji doprinose razvoju mastitisa (npr.
menadžment), kao i bakterijskih agenasa. Predstavljena studija, kao i druge studije,
mogu doprineti razvoju vakcinalnih sojeva.
... Furthermore, S. agalactiae were the most frequent isolates for bovine SCM among Streptococcus species, and many previous reports supported this study (Alekish et al.,2013, Sztachanska et al.,2016 [4,46] . S. agalactiae is a highly contagious pathogen causing bovine SCM that can survive for a long period within the udder of cows and can be transmitted to healthy cows via poor milking hygiene, contaminated milking machine, utensils and contaminated milkers' hands (Hande et al.,2015) [20] . Therefore, the hygiene of the dairy farms should be improved to prevent and control SCM. ...
... Furthermore, S. agalactiae were the most frequent isolates for bovine SCM among Streptococcus species, and many previous reports supported this study (Alekish et al.,2013, Sztachanska et al.,2016 [4,46] . S. agalactiae is a highly contagious pathogen causing bovine SCM that can survive for a long period within the udder of cows and can be transmitted to healthy cows via poor milking hygiene, contaminated milking machine, utensils and contaminated milkers' hands (Hande et al.,2015) [20] . Therefore, the hygiene of the dairy farms should be improved to prevent and control SCM. ...
... Therefore, the hygiene of the dairy farms should be improved to prevent and control SCM. On the other hand, S. uberis and S. dysgalactiae were considered environmental pathogen, and their main source is the bedding material (Hande et al., 2015) [20] . Therefore, clean pastures and dry environments, dry milking machines and utensils, and optimum hygiene should be maintained inside dairy farms to decrease such pathogens' persistence. ...
Article
Full-text available
The major Objective of this study was focused on using of rapid & efficient methods for detection of Subclinical Mastitis and prevalence of Some Most Important Bacterial Pathogens in Sirohi District of Rajasthan. A total of 200 milk samples from Bovine i.e., Cow and Buffaloes were collected from period of July 2020 to December 2020 to detect and determine pathogens responsible for subclinical mastitis in Bovine. Screening Subclinical Mastitis (SCM) were done using modified California mastitis Test (MCMT) & and Somatic Cell Count (SCC). The prevalence percentage of SCM in California mastitis and Somatic Cell Count in age group of 5 to 8 years Bovines was (74% and 70%) respectively. Identification of the isolates was achieved using Gram’s staining, hemolytic pattern, colony morphology, Catalase, Coagulase test, IMVIC test and confirmation of bacteria species was done by growth on specific agar medium. Bacteriological examination of all milk samples found the presence of (48.00%) isolates where Staphylococcus was predominant species (27.00%) followed by Streptococcus agalactia (10.5%), other streptococci species (4.5%), while environmental pathogen represented E. coli third common pathogen was found in least presence (6.5%). Subclinical mastitis seems to be, as deduced from the high prevalence observed in this study, an important health problem for milking dairy cows and buffaloes in Sirohi. The Identification and biochemical identification is still the important aspect and could be practiced at selected samples from time to time to confirm identification of causative organisms.
... Despite the considerable efforts made by many scientists and experts in mastitis, the disease has not been eliminated on dairy farms and remains a serious problem, causing significant losses to farmers. According to the available literature, the prevalence of mastitis varies significantly between countries, regions, and farms worldwide [1][2][3][4]. The occurrence of mastitis is a complex of interactions between the host, the environment, and the etiological agent, and is influenced by several factors [5]. ...
Article
Full-text available
The aim of this study was to compare three on-farm commercial methods for the indirect detection of subclinical mastitis in dairy cows: the California mastitis test (CMT), the Porta side somatic cell count milk test (Porta SCC), and the DeLaval cell counter (DCC), with the Fossomatic cell count (FSCC), and to evaluate the relationship between the determined somatic cell count SCC and the occurrence of intramammary pathogens in the milk of dairy cows. A total of 284 sensory unchanged mixed milk samples, collected during the milking on a dairy farm, were analyzed in this study for somatic cell counts by the mentioned on-farm tests. Quarter milk samples (n = 583) from all the selected cows were cultured. The agreement, sensitivity, and specificity of the three indirect commercial diagnostic tests (the CMT, the Porta SCC, and the DeLaval cell counter) were calculated, and the FSCC was used as the gold standard. The results were analyzed statistically using the Pearson correlation test and the paired t-test. The CMT matched with the FSCC in 83.1% of the samples, with the Porta SCC in 80.6%, and with the DCC in 80.3% of the samples. The sensitivity and specificity reached 81.0% and 92.9% for the CMT, 79.4% and 90.7% for the Porta SCC, and 75.8% and 97.5% for the DCC, respectively. The correlation between the FSCC and the Porta SCC was 0.86 (p < 0.0001), and between the FSCC and the DCC, it was 0.92 (p < 0.0001). The differences between them were insignificant. Bacteria were detected in 130 (22.3%) quarter milk samples. The most prevalent bacteria were Enterococcus spp. (36.2%), followed by E. coli (20%), coagulase-negative staphylococci (13.1%), A. viridans (9.2%), Streptococcus spp. (9.2%), Proteus spp. (6.2%), and S. intermedius (3.9%). Contagious isolates (S. aureus) were detected in 3 quarter milk samples (2.3%). The agreement between the individual tests and the microbiological culture was as follows: 69.2% for the CMT; 73.7% for the Porta SCC; 71.6% for the DCC; and 76.5% for the FSCC. Higher SCCs were detected in the milk samples contaminated with bacteria than in the healthy milk (p < 0.001). No significance was found between the presence of individual species of intramammary pathogens and the different levels of SCCs. Based on the results, bacteria are the predominant cause of subclinical mastitis. The increased SCC of some milk samples with no presence of bacteria meant that the increase could have been caused by numerous other agents (viruses, fungi, or algae) or factors for mastitis in the dairy industry.
... and E. coli was 61% each from all bulk tank milk (BTM) using rt-PCR. Additionally, the recovery rate of S. aureus in the current study (81.8%) was higher than reported previously in Egypt 29.1%, 35.9% [19,32], 24.4% [33], Turkey 26.1% [34], but lower than those reported in Denmark 91% [35]. ...
Article
Full-text available
In dairy industry, bovine mastitis is the most prevalent disease, which reduces milk production and causes economic losses. This study was conducted to estimate the prevalence of Mycoplasma bovis and some bacteria causing mastitis in dairy farms and partial sequencing of 16SrRNA target genes and Quinolones Resistance Determining Regions (QRDRs) (gyrA and parC) in M. bovis isolates. 370 milk samples were obtained from farms located in villages in Fayoum governorate, Egypt. The examined milk samples (8,91%) were positive for the California mastitis test (CMT). Multiplex RT-PCR was used for the recognition of microorganisms causing mastitis (Staphylococcus (S.) aureus, Streptococcus species (spp.), Escherichia (E.) coli, and Mycoplasma (M.) bovis) from mastitic milk. The results revealed that E. coli was the most predominant (84.8%) followed by S. aureus (81.8%) while M. bovis was the lowest one (51.5%). Mixed infection with two or more mastitic bacterial agents was also identified. All 33 examined mastitic milk samples were diagnosed with mixed infection with E. coli, S. aureus, Streptococcus spp. and M. bovis (36.36%), E. coli and S. aureus (21.21%), and rephrase E. coli, M. bovis, and Streptococcus spp. (6.06%). The sequence analysis of M. bovis 16SrRNA genes illustrated a high similarity of examined isolates to strains previously deposited in the GenBank recovered from the same locality. The gyrA amino acids showed no substitution but showed 100% similarity with M. bovis isolates worldwide. However, the amino acid sequence of parC, showed substitution at positions 2 (Gln to Arg) (CAG >>CGT), 75 (Ile to Ser) (ATT>>AGC), and 79 (Asn to Asp) (AAC>>GAT). Sequence results can lead to the creation of appropriate treatment and control measures for M. bovis, while multiplex RT-PCR, can be exploited as a standard diagnostic method for major mastitis pathogens.
... In this study, the prevalence of enterococci was determined as 32.5%. In different studies carried out in Türkiye, the prevalence of enterococci in milk samples of bovine subclinical mastitis cases was reported to be 0.7% (3/421) in Samsun (Gürler et al., 2015), 10.9% (43/392) in Afyon (Kuyucuoğlu, 2011), and 16% (96/600) in Aydın (Herkmen and Türkyılmaz, 2016). On the other hand, in the studies conducted abroad, the prevelance of enterococci were reported as 4.8% (105/2185) in Korea (Nam et al., 2010), 15.23% (27/177) in Canada (Cameron et al., 2016), 16.7% (112/669) in the Czech Republic (Cervinkova et al., 2013), and21.3% ...
Article
Full-text available
This study aimed to investigate the antimicrobial resistance and virulence genes of enterococci isolated from water buffalo’s subclinical mastitis cases. The antimicrobial susceptibilities of the isolates were determined by the disc diffusion method. Identification at the species level of enterococci, virulence [aggregation substance (asa1), gelatinase (gelE), cytolysin (cylA), enterococcal surface protein (esp), and hyaluronidase (hyl)] and resistance genes [macrolide (ermA, ermB, mefA/E) and tetracycline (tetK, tetL, tetM, tetO, and tetS)] were investigated by polymerase chain reaction (PCR). Overall, Enterococcus spp. was recovered from 65 of 200 (32.5%) mastitic milk samples, comprising E. faecium (n=26), E. durans (n=22), E. faecalis (n=12), and E. hirae (n=5). Most isolates (56.9%) were susceptible to all tested antibiotics. The rest of the isolates showed various rate of resistance against rifampicin (23.1%), tetracycline (21.5%), quinupristin-dalfopristin (10.8%), ciprofloxacin (7.7%), erythromycin (6.2%), and chloramphenicol (3.1%). Out of 65 enterococci, only 16 (24.6%) were detected to have virulence genes, of which 12 were positive for gelE, seven were positive for esp, two were positive for asa1, and one was positive for hlyA. The gene cylA was not detected in any isolate tested. Resistance to tetracycline was mainly associated with tetM. Two erythromycin-resistant isolates were positive for ermB, and one was positive for mefA/E. This study was the first to report species distribution, antimicrobial susceptibility, and virulence traits of enterococci isolated from subclinical mastitis of water buffaloes in Çorum Province, Türkiye.
... The relatively low prevalence of S. aureus (29.1%) was also reported in Egypt (24.4%) (Awad et al. 2017), and Turkey (26.1%) (Hande et al. 2015). S. aureus moreover can elude and affect the cow's immune system by producing several toxins and enzymes producing injury to the mammary tissue (Abed et al. 2021). ...
Preprint
Full-text available
This study is providing new techniques for diagnosis of bovine mastitis using multiplex real-time PCR and detection of some inflammatory markers at an early stage of infection. The consequences of bacterial culture and PCR for the identification of the 8 etiological agents of mastitis clinical or subclinical were demonstrated. Some pathogens recognized by conventional culture techniques were confirmed by PCR. Corynebacterium and mycoplasma were only distinguished by PCR. These data indicated moderate accord among the positive results of bacterial culture and PCR. Mixed infection of 2 or more mastitic bacterial agents were also identified more frequently by PCR while the measured blood and milk indices could separate healthy from mastitis and subclinical mastitic animals, it could not do so either between mastitis and subclinical mastitis or between single and mixed infection. Regarding inflammatory markers, most blood indices differed significantly between healthy vs mastitis animals, except for monocyte. Haptoglobin expression in milk varied significantly altering on mastitis circumstances and type of infection with mean fold change values of 1.87 in negative cases, 7.26 in single infected, and 10.64 in mixed infection. Also, a highly significant between the type of infection and immune-histocompatibility was detected. As immune-histocompatibility was strongly expressed with mixed infection and wasn't detected in negative cases. From a diagnostic point of view, TLC, lymphocyte, and neutrophil were considered good biomarkers for mastitis (Area under curve >0.9), and haptoglobin was the best biomarker for subclinical mastitis (AUC>0.9). Haptoglobin and basophils were the only markers having high AUC (being 0.6 and 0.7, respectively) discriminating single from mixed infection. Therefore, our diagnostic strategy has been deservedly proved its effectiveness as a rapid, complementary, and sensitive substitute to traditional techniques.
... The current study have shown lower resistance rate of enterococcal isolates to spiramycin (51.2%) than that of Lim et al. (2002) and Hande et al. (2015) who reported resistance rate of (85.5%) and (100%). ...
... Among environmental bacteria, streptococci and enterococci are important etiological agents of this disease and are the main pathogens responsible for the high somatic cell count in dairy farms (Reinoso, 2017). Particularly, Gram-positive cocci such as Enterococcus faecium and E. faecalis have been the most frequently bacteria isolated from cows with mastitis (Carrillo-Casas and Miranda-Morales, 2012;Gürler et al., 2015). E. faecium has ability to form biofilm as well as to internalize in bovine mammary gland epithelial cells (MAC-T cell line) (Cerioli et al., 2018;Montironi et al., 2020). ...
Article
Design of innovative adjuvant strategies with an appropriate safety profile is relevant to developed subunit or inactivated microorganism vaccines for bovine mastitis. Minthostachys verticillata essential oil (EO) has demonstrated ability to stimulate the innate immune response and adjuvant effect similar to Al(OH)3. Here we evaluated the adjuvant effect of EO and its metabolite, limonene (L) alone and microencapsulated by spray-drying, using an inactivated Enterococcus faecium strain bovine-mastitis inducer. The gas chromatography–mass spectrometry analysis showed that microencapsulation process did not alter the EO or L chemistry. Microencapsulated EO (McEO) or L (McL) (2.0, 2.5 and 5.0 mg/ml) decreased the viability of bovine mammary gland epithelial cells in a dose-dependent way. Balb/c mice (n = 32) were subcutaneously inoculated (day 0) and revaccinated (day 14 and 28) with saline solution, inactivated bacteria alone or combined with Incomplete Freund's Adjuvant; EO or L (2.5 mg/ml); McEO or McL (5.0 mg/ml); or microcapsule wall material (Mc) alone (2.5 mg/ml). EO, L, McEO and McL stimulated E. faecium-specific IgG (IgG1 or IgG2a) with opsonizing capacity and increased the proportion of CD4⁺ and CD8⁺ T cells producers of IFN-γ. Microencapsulation was an effective strategy to increase the adjuvant potential of EO or L. These new adjuvants deserve further study to evaluate their incorporation into vaccines for bovine mastitis.
Article
Full-text available
Bacterial biofilm is one of the major hazards facing the food industry. Biofilm-forming ability is one of the most important virulence properties of enterococci. The genus Enterococcus includes pathogenic, spoilage, and pro-technological bacteria. The presence of enterococci in milk and dairy products is usually associated with inadequate hygiene practices. The study examined the isolates’ capacity for biofilm formation and identification of the genetic determinants of its formation among 85 Enterococcus strains isolated from raw milk (n = 49) and soft-ripened cheeses made from unpasteurized milk (n = 36). E. faecalis and E. faecium were the dominant species. The obtained results showed that 41.4% isolates from milk and 50.0% isolates from cheeses were able to form biofilm. All of the isolates analyzed had at least one of the studied genes. As regards the isolates from raw milk, the most prevalent gene was the gelE (85.6%), followed by the asa1 (66.7%). None of the isolates from cheeses showed the presence of cylA and sprE. The most prevalent gene among the strains from this source was the epbC (94.4%), followed by the gelE (88.9%). In isolates from both sources, the presence of proteins from the Fsr group was noted the least frequently. Nevertheless, results showed that were no significant differences between the biofilm-producing Enterococcus spp. and non-biofilm-producing isolates in term of occurrences of tested virulence genes. The ability to produce a biofilm by enterococci isolated from raw milk or ready-to-eat products emphasizes the need for continuous monitoring of the mechanisms of microbial adhesion.
Article
Full-text available
The purpose of the present study was to identify environmental and contagious aerobic pathogen agents causing bovine clinical and subclinical mastitis using sequencing. A total of 244 cows were studied for the presence of mastitis using California Mastitis Test (CMT), clinical observations and microbiological isolations. Milk samples were obtained from 226 quarters of 123 cows which were diagnosed having clinical (11.4%) and subclinical (88.6%) mastitis. From these milk samples, 38 (16.8%) had no bacterial growth and from remaining 188 samples (83.2%) microorganisms were isolated. A total of 42 species were identified by sequencing amplified 16S rRNA fragments. The most common species were Staphylococcus aureus (22.9%) followed by Escherichia coli (10.1%), S. chromogenes (8.5%), S. haemoliticus (7.5%) and Hafnia alvei (6.4%). Of 188 isolates 43 were found contagious (22.9%), and 145 (77.1%) environmental agents. Use of sequencing offer identification of aetiological agent species level useful and practical that can help to chose a suitable therapeutic agent.
Article
Full-text available
Coagulase-positive staphylococci are the most common pathogen causing subclinical mastitis in cows. Their main characteristic is a high virulence which leads to chronic infection. A total of 213 isolates of coagulase-positive staphylococci were tested. The majority of isolates (58%) formed a gold pigment, then light gold (28%), white gold (8%), golden gray, creamy white and white (2%). The majority of isolated coagulase-positive staphylococci produce beta hemolysis on esculin blood agar (50%), alpha and beta hemolysis (36%), beta and delta hemolysis (8%), delta hemolysis (4%), and alpha hemolysis (2%). Biochemical and molecular identification was performed by APISTAPH and multiplex PCR method. The majority of isolates were identified as S. aureus (88%), S. chromagenes (4%), and 2% of the isolates were identified as S. lentus, S. scum; S. xylosus, S. intermedius by APISTAPH. Antimicrobial susceptibility to penicillin G, was found by the Kirby Bauer disk diffusion method to be resistant (62.44%). For disc diffusion penicillin G sensitive isolates the minimal inhibitory concentration (MIC) was established for MIC50 and MIC90 as 0.003 mg/ml and 2 mu g/ml, respectively. For disc diffusion penicillin G resistant isolates MIC50 and MIC90 was 1.0 mu g/ml and 16 mu g/ml, respectively. The study of phenotypic resistance to methicillin, as recommended by CLSI, established resistance to oxacillin in 5.26% of the isolates, while no resistance was found to cefoxitine. None of the tested isolates have the mecA gene.
Article
Bacteriological examinations were performed on 206 mammary tissue samples taken from 160 cows with mastitis in Elazig. The isolates were identified as Staphylococcus aureus (39.04%). Staphylococcus epidermidis (17.81%), Actinomyces pyogenes (14.38%), Escherichia coli (8.9%), Streptococcus agalactiae (6.16%), Streptococcus uberis (4.11%), Streptococcus dysgalactiae (3.42%), Corynebacterium bovis (1.37%), Pasteurella haemolytica (1.37%) and Bacillus cereus (1.37%).
Article
The objectives of this study were to the determine the presence of Enterococcus spp. in cow mastitis and to characterize the isolated strains using molecular techniques. A total of 75 Enterococcus spp. isolated from dairy farms in Ankara and Bali{dotless}kesir cities were examined. Sixty-one Enterococcus faecium and 14 Enterococcus avium strains were identified according to Restriction Fragment Length Polymorphism-Polymerase Chain Reaction results. Additionally different 10 and 7 Random Amplified Polymorphic DNA- Polymerase Chain Reaction profiles were detected in E. faecium and E. avium strains, respectively. These finding showed the importance and the role of Enterococcus spp. in cow mastitis.
Article
Twenty-seven S. agalactiae isolates obtained after screening 89 cows for subclinical mastitis were studied for antibiotic resistance and virulence genes. The highest resistance was found by Disc diffusion method for Streptomycin (85.1%) whereas the lowest resistance was found for Gentamicin (3.7%). Resistance against Tetracycline, Erythromycin, Co-trimoxazole, Ampicillin and Enrofloxacin was 55.5%, 33.3%, 11.1%, 11.1%, and 7.4% respectively. PCR based detection revealed three isolates carrying the tetO gene associated with Tetracycline resistance and seven isolates carrying the ErmB gene associated with Erythromycin resistance. Molecular detection of virulence associated genes revealed that out of 27 isolates of S. agalactiae, none was carrying the bca gene, while 6, 7, 8 and 6 isolates were positive for ScpB, rib, lmb and cylE genes respectively.
Article
Streptococcal mastitis causes great economic losses in dairy industries allover the world. For humans, S. agalactiae is responsible for persistent disease in adults and neonates. The present study investigated the prevalence of streptococci in mastitic cows and ewes as well as, the antibiotic resistance patterns of Streptococcus agalactiae isolates. A total of 570 milk samples collected from cow (n=300) and ewes (n=270) were examined. Streptococcus species were isolated from cows (55%) and ewes (50.4%). S. agalactiae, S. dysgalactiae S. uberis, S. pyogenes and S. pneumoniae were isolated from the examined cow samples with incidence of 19.3, 17, 15.3, 2.7 and 0.7% respectively. Also, S. agalactiae, S. dysgalactiae S. uberis, S. pyogenes and S. pneumoniae were isolated from the examined ewes with incidence of 20.4, 15.9, 10.4, 2.6 and 1.1% respectively. The objective of this work was to characterize S. agalactiae isolated from mastitic cows and ewes by RAPD and antibiotic sensitivity test to detect the diversity of the isolates. S. agalactiae isolated from dairy cows and ewes was sensitive to ampicillin, penicillin and cefotaxime. Resistant to vancomycin, chloramphenicol, tetracycline and clindamycin was recorded among the examined S. agalactiae isolated from cows and ewes. The data indicated the existence of different RAPD patterns among the multidrug resistant S. agalactiae isolates
Article
The purpose of the study was determining the in vitro sensitivity of Streptococcus agalactiae, other Streptococcus sp., Staphylococcus aureus, coagulase-negative staphylococci, Escherichia coli, and Arcanobacterium pyogenes strains to antibiotics commonly used in veterinary praxis. These pathogens were isolated from cows with clinical or subclinical mastitis in 2006-2007. The activity of 10-14 antibiotics to each bacterial species was examined. The sensitivity was tested by disk diffusion method and performed according to CLSI guidelines in Mueller-Hinton agar. Streptococcus agalactiae strains were mostly sensitive to amoxicillin (93.6%), cefquinom (96%), cefapirin (94.1%), cefoperazone (88.9%, bacitracin (87.1%), and cephalexin (79%). Other streptococci were most susceptible to amoxicillin (91.4%), cefquinom (84.1%), bacitracin (89%), and cephalexin (79.7%). Amoxicillin/clavulanic acid (97.4%), cloxacillin (90%), cefquinom (92.9%), cephalexin (90.5%), and bacitracin (88.6%) were the most active against Staphylococcus aureus. Coagulase-negative staphylococci were sensitive to amoxicillin/clavulanic acid (100%), cefquinom (89.2%), cephalexin (89.3%), bacitracin (86,.1%), rifaximin (86.8%), and cefapirin (86.5%). Norfloxacin (85.1%), enrofloxacin (83.9%), and marbofloxacin (84.4%) were active against Gram-negative bacilli. Only amoxicillin (87.1%) from ten analysed antibiotics exhibited very high activity against Arcanobacterium pyogenes.