ArticlePDF Available

Anticancer Activity of Curcumin on Human Breast Adenocarcinoma: Role of Mcl-1 Gene

Authors:
  • Islamic Azad University,Tehran medical branch
  • Tehran medical Sciences, IAU

Abstract and Figures

Background: Breast cancer is the second leading cause of cancer-related death among females in the world. To date, chemotherapy has been the most frequently used treatment for breast cancer and other cancers. However, some natural products have been used, as alternative treatments for cancers including breast cancer, due to their wide range of biological activities and low toxicity in animal models. Objectives: The present study examined the anti-proliferative activity of curcumin and its effect(s) on the apoptosis of breast cancer cells. Materials and methods: This study was performed by an in vitro assay and the anticancer effects of curcumin were determined by MTT (3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide). We used quantitative real time Polymerase Chain Reaction (PCR) for detection of Mcl-1 gene expression in treated groups and then compared them to control samples. Results: In the treatment group, there were higher levels of cell death changes than the control group. The results also showed that the Mcl-1 gene expression declined in the tested group as compared to the control group. Conclusions: Our present findings indicated that curcumin significantly inhibited the growth of human breast cancer cell MCF-7 by inducing apoptosis in a dose- and time- dependent manner, accompanied by a decrease in MCF-7 cell viability. Furthermore, our results showed that quantitative real-time PCR could be used as a direct method for detection Mcl-1 gene expression in tested samples and normal samples.
Content may be subject to copyright.
Iran J Cancer Preven. 2015 May; 8(3):e2331. DOI: 10.17795/ijcp2331
Published online 2015 May 25. Research Article
Anticancer Activity of Curcumin on Human Breast Adenocarcinoma:
Role of Mcl-1 Gene
Zeinab Khazaei Koohpar
1,2
; Maliheh Entezari
3
; Abolfazl Movafagh
4
; Mehrdad Hashemi
3,*
1
Department of Herbal Medicine, Institute of Islamic and Complementary Medicine, Iran University of Medical Sciences, Tehran, IR Iran
2
Department of Biology, Tonekabon Branch, Islamic Azad University, Tonekabon, IR Iran
3
Department of Genetics, Tehran Medical Sciences Branch, Islamic Azad University, Tehran, IR Iran
4
Department of Medical Genetics, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, IR Iran
*Corresponding author: Mehrdad Hashemi, Department of Genetics, Tehran Medical Sciences Branch, Islamic Azad University, Tehran, IR Iran. Tel: +98-2122006664,
E-mail: mhashemi@iautmu.ac.ir
Received: April 17, 2015; Revised: April 25, 2015; Accepted: May 8, 2015
Background: Breast cancer is the second leading cause of cancer-related death among females in the world. To date, chemotherapy
has been the most frequently used treatment for breast cancer and other cancers. However, some natural products have been used, as
alternative treatments for cancers including breast cancer, due to their wide range of biological activities and low toxicity in animal
models.
Objectives: The present study examined the anti-proliferative activity of curcumin and its effect(s) on the apoptosis of breast cancer cells.
Materials and Methods: This study was performed by an in vitro assay and the anticancer effects of curcumin were determined by MTT
(3-[4,5-dimethylthiazol-2-yl]-2,5 diphenyl tetrazolium bromide). We used quantitative real time Polymerase Chain Reaction (PCR) for
detection of Mcl-1 gene expression in treated groups and then compared them to control samples.
Results: In the treatment group, there were higher levels of cell death changes than the control group. The results also showed that the
Mcl-1 gene expression declined in the tested group as compared to the control group.
Conclusions: Our present findings indicated that curcumin significantly inhibited the growth of human breast cancer cell MCF-7 by
inducing apoptosis in a dose- and time- dependent manner, accompanied by a decrease in MCF-7 cell viability. Furthermore, our results
showed that quantitative real-time PCR could be used as a direct method for detection Mcl-1 gene expression in tested samples and normal
samples.
Keywords: Breast Cancer; Curcumin; Mcl-1 gene; Apoptosis
Copyright © 2015, Iranian Journal of Cancer Prevention. This is an open-access article distributed under the terms of the Creative Commons Attribution-Non Com-
mercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial us-
ages, provided the original work is properly cited.
1. Background
It is known that breast cancer is the most common
cancer for women worldwide, and accounts for approxi-
mately 25% of all female malignancies with a higher prev-
alence in developed countries. Breast cancer is the second
leading cause of cancer-related death among females in
the world (1). The discovery of novel natural compounds
with low toxicity and high selectivity for killing cancer
cells is an important area in cancer research (2).
To date, chemotherapy has been the most frequently
used treatment for breast cancer and other cancers.
However, this method of treatment also destroys some
normal cells as well. Due to their wide range of biological
activities and low toxicity in animal models, some natu-
ral products have been used as alternative treatments for
cancers including breast cancer (2).
Curcumin or diferuloylmethane is the major yellow
pigment extracted from turmeric (Curcuma longa) and is
commonly used as a flavoring agent in food (3).
Curcumin has been widely studied for its anti-inflam-
matory, anti-angiogenic, antioxidant, wound healing,
and anti-cancer effects because of its medicinal proper-
ties in Indian and Chinese medicine (2). Moreover, exten-
sive research has shown that curcumin possesses anti-
proliferative and anti-carcinogenic properties in a wide
variety of cell lines and animals (4).
In addition, recent studies have shown that curcumin,
either alone or in combination with other anticancer
agents, can efficiently induce apoptosis (2).
Apoptosis is a tightly regulated process of programmed
cell death, including the activation of various molecules
for initiating cell death.
Specific activation of apoptosis in tumor cells offers a
promising approach for cancer therapy. However, the
specific mechanisms of curcumin-induced cytotoxicity
remain controversial due to the variable anti-and pro-
apoptotic signaling pathways in different cell types.
Oxidative stress derived from curcumin through pro-
duction of reactive oxygen species and oxidative dam-
age causes DNA modification. This process continues
and carries on proteolytic events and induces apoptosis
Khazaei Koohpar Z et al.
Iran J Cancer Preven. 2015;8(3):e2331
2
www.ijcancerprevention.com
(4). Plenty of proteins and a number of genes regulate
apoptosis, in which two pairs of proteins play an impor-
tant part. Bcl-2 is a member of a family of proteins in-
volved both in preventing apoptosis (pro-survival) and
in promoting it (pro-apoptotic). Anti-apoptotic proteins
include the Bcl-2 family (such as Bcl-2, Bcl-XL, Mcl-1 etc.).
Pro-apoptotic proteins are sub-grouped into the Bax fam-
ily (such as Bax, Bak, etc.) and the BH3-only family (such as
Bid, Bad, Bim, etc.) (5).
The Tumor Necrosis Factor (TNF)-Related Apoptosis In-
ducing Ligand (TRAIL) has promising anticancer activity.
Curcumin enhances TRAIL-induced apoptosis of breast
cancer cells by regulating apoptosis-related proteins
(such as Mcl-1, ERK and Akt) (6, 7).
2. Objectives
The exact mechanism by which curcumin exerts its
apoptotic effects in breast cancer cells still remains un-
clear. The present study examined the anti-proliferative
activity of curcumin on breast cancer cells.
3. Materials and Methods
3.1. Reagents
Curcumin was purchased from Sigma-Aldrich Corpora-
tion and was prepared with Dimethyl Sulfoxide (DMSO)
at a concentration of 10 mM, stored as small aliquots at
-20°C, and thawed and diluted as needed in cell culture
medium. Dimethyl Sulfoxide, Propidium Iodide (PI) and
trypsin were purchased from sigma (St, Louis, Mo, USA).
Roswell Park Memorial Institute (RPMI) 1640, penicillin,
streptomycin and other cell culture supplies were from
Gibco BRL (Grand Island, NT, USA). Fetal bovine serum
was from Hyclone (Logan, UT, USA). MTT (3-(4,5-dimeth-
ylthiazol-2-yl)- 2,5- diphenyl trazolium bromide) was ob-
tained from Fluka (Ron Konkoma, NY, USA).
3.2. Cell Line and Culture
Human breast cancer cell line, MCF7, was obtained from
the Pasteur institute of Iran. These cells were cultivated
in T75 tissue culture flasks in RPMI-1640 supplemented
with 10% fetal calf serum, 100 μg/mL penicillin, 100 μg/mL
streptomycin, 2 mM L-glutamine, and 20 mM hydroxy-
ethyl piperazine ethanesulfonic acid, and incubated in a
humidified incubator containing 5% CO
2
at 37°C.
3.3. MTT Assay
Cell viability was assessed using the MTT assay. Breast
cancer (5 × 10
3
) cells were seeded in 200 μL of RPMI-1640
medium in 96-well plates, and cultured overnight. Next,
the medium was replaced with fresh RPMI-1640 or the
same media containing different concentrations of cur-
cumin. After a further incubation for 24 or 48 hours, 50
μL of MTT (2 mg/mL) was added to each well followed by
4 hours of incubation. The medium was discarded and
150 μL of dimethyl sulfoxide was added to each well, and
incubated for 20 minutes. The OD was measured at 490
nm. The cell viability index was calculated according to
the following Equations:
(1)
Cytotoxicity% =1
Mean absorbance of toxicant
Mean absorbance of negative control
×100
(2)
Viability% = 100 Cytotoxicity%
To diminish test error level, the MTT strain was added
to wells without cells and along with other wells, absor-
bance level was read and ultimately subtracted from the
entire absorbance.
3.4. Real-Time Polymerase Chain Reaction with
SYBR Green I
Total RNA was extracted from cells using an RNA isola-
tion reagent (sigma) as recommended by the manufac-
turer and the extracted RNA was purified using RNeasy
Mini Kit (Qiagen), and cDNA was synthesized using Quan-
titect Reverse Transcription Kit (Qiagen) according to the
manufacturer’s instructions. Reverse transcription was
carried out as follows: 42°C for two minutes, 42°C for 15
minutes, and 95°C for three minutes (one cycle). cDNA
was stored at -20°C for PCR.
Real-time PCR was performed in a 25 μL reaction solution.
The following sequences were used as primers (Table 1).
Real time PCR was carried out in optical grade 96-well
plates (Micro amp, Applied Biosystems, Singapore) at re-
action volume of 25 μL, including 12.5 SYBR Green Master
Mix (Primer design), 300 nm of each primer and 5 ng of
template DNA. All samples were run in duplicates. Ther-
mal cycling was performed on the Applied Biosystems
7300 real-time PCR system. Threshold cycle (Ct) data were
collected using ABI Prism 7300 sequence detection sys-
tem version 1.2.3 (Applied Biosystems, UK).
The relative gene expression was analyzed by the 2
- ΔΔCt
method. The fold change in target gene cDNA relative to
the HPRT (Hypoxanthine-guanine phosphoribosyltrans-
ferase) internal control was determined by:
Fold change= 2
- ΔΔCt
Where ΔΔCt = (Ct
Mcl-1
- Ct
HPRT
)-(Ct
Mcl-1
-Ct
HPRT
)
Table 1. Characteristics of the Primers Used in the Real-Time
Polymerase Chain Reaction
Gene Sequence
Mcl-1(F) GTGCCTTTGTGGCTAAACACT
Mcl-1® AGTCCCGTTTTGTCCTTACGA
3.5. Statistical Analysis
Statistical significances were calculated using the Stu-
dent’s t-test and one-way analysis of variance.
Khazaei Koohpar Z et al.
3
Iran J Cancer Preven. 2015;8(3):e2331 www.ijcancerprevention.com
4. Results
4.1. The Effects of Curcumin on Inhibition and Pro-
liferation of MCF7 Cell Line
The effect of curcumin was studied as a dose-response
experiment. Proliferation of MCF7 cells was significantly
inhibited by curcumin in a concentration-dependent
manner during 48 hours (P < 0.01). Different concentra-
tions of curcumin at 48 hours had different cytotoxicity
effects on MCF7 cell line (Figure 1).
The 50% inhibition concentration (IC50) values of cur-
cumin on MCF7 cells was determined (Figure 2). Further-
more, IC50 was determined by probit analysis using the
Pharm PCS (Pharmacologic Calculation System) statisti-
cal package (Springer-Verlag, USA). There were significant
differences in IC50 curcumin (P < 0.05).
0
20
40
60
80
100
120
0102550100 200
Cell viability (%)
Concentration g/ml)
Curcumin
Untreated
Figure 1. Effects of Curcumin on MCF-7 Cell Viability
79.58
53.18
30.78
24h48h 72h
Curcumin
Figure 2. The IC50 of Curcumin for MCF-7 Cell Line
Mcl-1 gene
Fluorescence - d(F1)/dT
3.7
3.5
3.0
2.5
2.0
1.5
1.0
0.5
0.0
-0.5
HPRT gene
Temperature (°C)
07.0 03.0 70.0 72.0 74.0 76.0 73.0 80.0 82.0 84.0 85.0 88.0 00.0
Figure 3. Melting Curve Analysis of the Mcl-1 and HPRT Genes
As expected, there was a significant difference between
the tested and normal samples regarding Mcl-1 gene ex-
pression changes. To optimize and validate the real-time
PCR assay before using the ΔΔCT method for gene expres-
sion, a validation experiment was performed to deter-
mine the PCR efficiencies of the target and the reference
genes. Melting curve analysis was performed for every
single reaction to exclude amplification of non-specific
products. Each valid amplification reaction displayed a
single peak at the expected Tm (melting temperature).
The results also showed that Mcl-1 gene expression de-
clined in the control group as compared to the experi-
mental group. The mean ratio was determined for both
groups as follows: 1.04 ± 0.13 for control group, and 0.49 ±
0.12 for the experimental group.
5. Discussion
For centuries, curcumin has been consumed in the
diet and used as a herbal medicine in several Far Eastern
Countries (2). Curcumin has cancer chemopreventive
properties in a variety of animal models of chemical car-
cinogenesis, including those resulting in tumors of the
mammary gland (6, 7).
Oxidative stress and oxidative damage are involved in
the pathophysiology of many chronic inflammatory and
degenerative disorders, particularly cancer. The genera-
tion of Reactive Oxygen Species (ROS), particularly O
2−
and OH, play important roles in the development of can-
cer (8, 9). Curcumin has been shown to scavenge O
2−
and
OH radicals (10, 11).
As evident curcumin expresses anti-oxidant, anti-in-
flammatory, anti-antigenic, anti-mitotic and anti-meta-
static activities in vitro and in animal experiments, thus
it might be a promising molecule for the prevention and
treatment of cancer in humans. Curcumin has antiprolif-
erative effects in different types of cell lines in vitro. One
of the initial reported descriptions of curcumin cyto-
toxicity occurred in Dalton’s lymphoma ascites cells, in
which curcumin at a concentration of 4 μg/mL produced
50% cytotoxicity. Curcumin also inhibited the growth of
Chinese hamster ovary cells and human leukemic lym-
phocytes in culture (12). At a concentration of 20 μg/mL,
curcumin produced 50% growth arrest in K-562 human
chronic myelogenous leukemia cells (13).
Curcumin has also been shown to inhibit the growth
of human breast cancer cell lines in vitro (5), including
HL60, k562, MCF- 7 and Hela cells (14). Also, to date, no
curcumin-related toxicity was observed in either ex-
perimental animals or humans, even at very high doses
(15). Our data are consistent with previous studies that
reported curcumin exerts its anticancer effects via pro-
liferation inhibition and apoptosis induction in breast
cancer cells (15). In this study, the effect of different cur-
cumin doses (0 - 100 μm) on MCF-7 cell morphology was
examined. After a 24-hour period, curcumin treatment
caused MCF-7 cell shrinkage, rounding and partial de-
tachment, thus demonstrating the cytotoxic effects of
Khazaei Koohpar Z et al.
Iran J Cancer Preven. 2015;8(3):e2331
4
www.ijcancerprevention.com
curcumin on MCF-7 cells. On assaying the effect of cur-
cumin on cell viability by the MTT assay, we observed a
decrease in cell viability. At curcumin concentration of
40 μm, significant loss of viability can be detected during
the 0-24 hour treatment period.
It is important to mention that curcumin-mediated
reduction of cell viability was dose- and time- depen-
dent. Our present findings indicate that curcumin sig-
nificantly inhibited the growth of human breast cancer
cell MCF-7 by inducing apoptosis in a dose- and time-
dependent manner, accompanied by a decrease in MCF-
7 cell viability.
Curcumin is highly cytotoxic toward several colon can-
cer cell lines. Curcumin blocked the entry to cell cycle
from G2 to M by inhibiting expression of cdc2/cyclin B
(16). The proapoptotic members of the Bcl-2 family, such
as Bax, were activated, and antiapoptotic genes such as
Bcl-XL were inhibited by curcumin (17).
Curcumin also triggers caspase-3-mediated cell death. It
activated GADD153, which in turn acts as an activator of
apoptosis (18). Curcumin decreases the expression of an-
tiapoptotic members of the Bcl-2 family and elevates the
expression of p53, Bax, and procaspases-3, -8 and -9 (19).
We selected the Mcl-1 gene, because the bcl-2 family of
proteins functions as pro- and anti-apoptotic members
(20). The bcl-2 members such as bax, bak, bad or bcl-Xs
promote apoptosis, whereas other members such as bcl-
2 and bcl-Xl prevent apoptosis by blocking the transloca-
tion of cytochrome c, and subsequent caspase activation.
Mitochondria are involved in excitotoxic injury during
cerebral ischemia and the release of cytochrome C, an
apoptogenic factor that propagates death signals by trig-
gering caspases leading to cell death. Using these assay,
status of all subjects was successfully determined (5). We
expanded the coverage of the detectable Mcl-1 gene by
SYBR Green assay for Mcl-1 gene expression.
Given the potential and safety of curcumin, it is a prom-
ising candidate for therapy of breast cancer, although ad-
ditional studies are needed.
Acknowledgements
We sincerely thank the department of herbal medicine,
Institute for Islamic and Complementary Medicine of
Iran for their financial supports.
Authors' Contributions
Zeinab Khazaei Koohpar, Maliheh Entezari and Abolfazl
Movafagh: performed the laboratory experiments and
prepared the manuscript. Mehrdad Hashemi: designed
the study, provided technical support, performed the lab-
oratory experiments, analyzed the data and revised the
paper extensively.
Funding/Support
The Department of herbal medicine, Institute for Islam-
ic and Complementary Medicine of Iran provided fund-
ing for this research.
Conflict of Interest
The authors made no disclosures.
References
1. Liu D, Chen Z. The effect of curcumin on breast cancer cells. J Breast
Cancer. 2013;16(2):133–7.
2. Lv ZD, Liu XP, Zhao WJ, Dong Q, Li FN, Wang HB, et al. Curcumin
induces apoptosis in breast cancer cells and inhibits tumor
growth in vitro and in vivo. Int J Clin Exp Pathol. 2014;7(6):2818–24.
3. Kizhakkayil J, Thayyullathil F, Chathoth S, Hago A, Patel M, Galadari
S. Modulation of curcumin-induced Akt phosphorylation and
apoptosis by PI3K inhibitor in MCF-7 cells. Biochem Biophys Res
Commun. 2010;394(3):476–81.
4. Chen CC, Sureshbabul M, Chen HW, Lin YS, Lee JY, Hong QS, et al.
Curcumin Suppresses Metastasis via Sp-1, FAK Inhibition, and E-
Cadherin Upregulation in Colorectal Cancer. Evid Based Comple-
ment Alternat Med. 2013;2013:541695.
5. Hashemi M. The Study of Pentoxifylline Drug Effects on Renal
Apoptosis and BCL-2 Gene Expression Changes Following Isch-
emic Reperfusion Injury in Rat. Iran J Pharm Res. 2014;13(1):181–9.
6. Xia Y, Jin L, Zhang B, Xue H, Li Q, Xu Y. The potentiation of curcumin
on insulin-like growth factor-1 action in MCF-7 human breast car-
cinoma cells. Life Sci. 2007;80(23):2161–9.
7. Park S, Cho DH, Andera L, Suh N, Kim I. Curcumin enhances TRAIL-
induced apoptosis of breast cancer cells by regulating apoptosis-
related proteins. Mol Cell Biochem. 2013;383(1-2):39–48.
8. Aggarwal BB, Shishodia S. Molecular targets of dietary agents
for prevention and therapy of cancer. Biochem Pharmacol.
2006;71(10):1397–421.
9. Biesalski HK. Polyphenols and inflammation: basic interactions.
Curr Opin Clin Nutr Metab Care. 2007;10(6):724–8.
10. Sreejayan N, Rao MN. Free radical scavenging activity of curcumi-
noids. Arzneimittelforschung. 1996;46(2):169–71.
11. Ahsan H, Parveen N, Khan NU, Hadi SM. Pro-oxidant, anti-oxidant
and cleavage activities on DNA of curcumin and its derivatives
demethoxycurcumin and bisdemethoxycurcumin. Chem Biol In-
teract. 1999;121(2):161–75.
12. Kuttan R, Bhanumathy P, Nirmala K, George MC. Potential an-
ticancer activity of turmeric (Curcuma longa). Cancer Lett.
1985;29(2):197–202.
13. Anuchapreeda S, Limtrakul P, Thanarattanakorn P, Sit-
tipreechacharn S, Chanarat P. Inhibitory effect of curcumin on
WT1 gene expression in patient leukemic cells. Arch Pharm Res.
2006;29(1):80–7.
14. Shehzad A, Lee J, Lee YS. Curcumin in various cancers. Biofactors.
2013;39(1):56–68.
15. Simon A, Allais DP, Duroux JL, Basly JP, Durand-Fontanier S, Delage
C. Inhibitory effect of curcuminoids on MCF-7 cell proliferation
and structure-activity relationships. Cancer Lett. 1998;129(1):111–6.
16. Rashmi R, Kumar S, Karunagaran D. Human colon cancer cells
lacking Bax resist curcumin-induced apoptosis and Bax require-
ment is dispensable with ectopic expression of Smac or down-
regulation of Bcl-XL. Carcinogenesis. 2005;26(4):713–23.
17. Scott DW, Loo G. Curcumin-induced GADD153 gene up-regulation
in human colon cancer cells. Carcinogenesis. 2004;25(11):2155–64.
18. Narayan S. Curcumin, a multi-functional chemopreventive agent,
blocks growth of colon cancer cells by targeting beta-catenin-
mediated transactivation and cell-cell adhesion pathways. J Mol
Histol. 2004;35(3):301–7.
19. Aggarwal BB. Nuclear factor-kappaB: the enemy within. Cancer
Cell. 2004;6(3):203–8.
20. Zabel P, Schonharting MM, Schade UF, Schlaak M. Effects of pent-
oxifylline in endotoxinemia in human volunteers. Prog Clin Biol
Res. 1991;367:207–13.
... Curcumin (33) enhances TNFRSF10A-triggered apoptosis even in TNFRSF10A-resistant breast tumor cells, activating MAPK/ERK and AKT [300]. Furthermore, curcumin (33) can trigger TNFRSF10A-induced apoptosis in TNFRSF10A-resistant breast cancer cell lines via regulating apoptosis-related proteins such as MCL1, MAPK/ERK and AKT and genes such as MCL1 [300,301]. Curcumin (33) was reported to increase the susceptibility of prostate cancer LNCaP cells to TNFRSF10A by inhibiting NFKB stimulation through hindering phosphorylation of NFKBIA/IκBα and its degradation [302]. Moreover, when a combination of curcumin (33) was administered in hormone-refractory prostate cancer cells and TNFRSF10A, both NFKB and p-AKT are markedly decreased, causing apoptosis induction [303]. ...
Full-text available
Article
Macroautophagy (autophagy) has been a highly conserved process throughout evolution and allows cells to degrade aggregated/misfolded proteins, dysfunctional or superfluous organelles and damaged macromolecules, in order to recycle them for biosynthetic and/or energetic purposes to preserve cellular homeostasis and health. Changes in autophagy are indeed correlated with several pathological disorders such as neurodegenerative and cardiovascular diseases, infections, cancer and inflammatory diseases. Conversely, autophagy controls both apoptosis and the unfolded protein response (UPR) in the cells. Therefore, any changes in the autophagy pathway will affect both the UPR and apoptosis. Recent evidence has shown that several natural products can modulate (induce or inhibit) the autophagy pathway. Natural products may target different regulatory components of the autophagy pathway, including specific kinases or phosphatases. In this review, we evaluated ~100 natural compounds and plant species and their impact on different types of cancers via the autophagy pathway. We also discuss the impact of these compounds on the UPR and apoptosis via the autophagy pathway. A multitude of preclinical findings have shown the function of botanicals in regulating cell autophagy and its potential impact on cancer therapy; however, the number of related clinical trials to date remains low. In this regard, further pre-clinical and clinical studies are warranted to better clarify the utility of natural compounds and their modulatory effects on autophagy, as fine-tuning of autophagy could be translated into therapeutic applications for several cancers.
... Curcumin (33) enhances TNFRSF10A-triggered apoptosis even in TNFRSF10A-resistant breast tumor cells, activating MAPK/ERK and AKT [300]. Furthermore, curcumin (33) can trigger TNFRSF10A-induced apoptosis in TNFRSF10A-resistant breast cancer cell lines via regulating apoptosis-related proteins such as MCL1, MAPK/ERK and AKT and genes such as MCL1 [300,301]. Curcumin (33) was reported to increase the susceptibility of prostate cancer LNCaP cells to TNFRSF10A by inhibiting NFKB stimulation through hindering phosphorylation of NFKBIA/IκBα and its degradation [302]. Moreover, when a combination of curcumin (33) was administered in hormone-refractory prostate cancer cells and TNFRSF10A, both NFKB and p-AKT are markedly decreased, causing apoptosis induction [303]. ...
Full-text available
Article
Macroautophagy (autophagy) has been a highly conserved process throughout evolution and allows cells to degrade aggregated/misfolded proteins, dysfunctional or superfluous organelles and damaged macromolecules, in order to recycle them for biosynthetic and/or energetic purposes to preserve cellular homeostasis and health. Changes in autophagy are indeed correlated with several pathological disorders such as neurodegenerative and cardiovascular diseases, infections, cancer and inflammatory diseases. Conversely, autophagy controls both apoptosis and the unfolded protein response (UPR) in the cells. Therefore, any changes in the autophagy pathway will affect both the UPR and apoptosis. Recent evidence has shown that several natural products can modulate (induce or inhibit) the autophagy pathway. Natural products may target different regulatory components of the autophagy pathway, including specific kinases or phosphatases. In this review, we evaluated ~100 natural compounds and plant species and their impact on different types of cancers via the autophagy pathway. We also discuss the impact of these compounds on the UPR and apoptosis via the autophagy pathway. A multitude of preclinical findings have shown the function of botanicals in regulating cell autophagy and its potential impact on cancer therapy; however, the number of related clinical trials to date remains low. In this regard, further pre-clinical and clinical studies are warranted to better clarify the utility of natural compounds and their modulatory effects on autophagy, as fine-tuning of autophagy could be translated into therapeutic applications for several cancers.
... Curcumin has drawn the attention of researchers as a potential drug resistance preventor [53]. It has been reported to boost sensitivity of cancer cells to treatment by focusing on several cancer stages, such as cell cycle control, inducing apoptosis, reducing metastasis, and reversing innate or acquired cellular resistance [56][57][58]. Some means by which it can overcome drug resistance are listed below. ...
Full-text available
Article
Throughout the world, cancer is one of the main causes of mortality, threatening the public health in many countries. As a result, cancer therapy researchers are paying increasing attention to biocompatible targeted drug delivery systems. Nanocarriers and co-delivery of active drugs is emerging as an essential research field for improving therapeutic efficiency. Although nutraceuticals are now being used to prevent and treat chronic illnesses such as cancers, some have shown limitations concerning solubility, bioavailability, and biodegradability. This review explores different types of nanostructures that can be used as drug delivery systems for curcumin, a biologically active polyphenol with high anticancer potential. However, poor solubility, short biological half-life and high metabolism rate limit its efficiency for cancer treatment. Different approaches recently developed to solve these issues are described herein, including the use of lipid-based nanoparticles (NPs), polymeric NPs, carbon-based nanostructures, and inorganic NPs. Besides, the characteristics, advantages and drawbacks of different curcumin nanocarriers are discussed. Furthermore, co-delivery systems involving curcumin and other anticancer drugs are reviewed, which are excellent future prospects for cancer therapy.
... This plant is used since ancient times for both food and pharmaceutical purposes, demonstrating many beneficial effects reducing glycemia, hyperlipidaemia, insulin resistance and improving pregnancy outcome [44][45][46][47]. In addition, due to its cytotoxic action on cancer cells, curcumin also showed promising effects as an anticancer agent inhibiting tumour proliferation and inducing apoptosis in various cancer types such as gastric, breast, lung and colon cancer [48][49][50][51]. It has been reported that low concentration of curcumin may exert chemo-preventive/therapeutic effects through epigenetic modification inhibiting Histone deacetylases (HDACs), histone acetyl transferases (HATs) and DNA Methyltransferases (DNMT) activity [52,53]. ...
Full-text available
Article
Background Prostate cancer (PCa) is one of the most common cancers worldwide and oxidative stress is involved in its occurrence, development and progression. In fact, in transgenic adenocarcinoma of mouse prostate (TRAMP) mice, prostate cancer onset is associated with the methylation of the first five CpG in the nuclear factor erythroid 2-related factor 2 (NRF2) promoter, a key regulator of oxidative stress response, leading to its downregulation and accumulation of reactive oxygen species (ROS). It has been demonstrated that both natural and synthetic compounds can reactivate NRF2 expression inhibiting the methylation status of its promoter by downregulation of DNA methyltransferases (DNMTs) and histone deacetylases (HDACs). Interestingly, NRF2 re-expression significantly reduced prostate cancer onset in TRAMP mice highlighting an important role of NRF2 in prostate tumorigenesis. Methods and results We analysed the current literature regarding the role of natural and synthetic compounds in modulating NRF2 pathway in TRAMP mice, an in vivo model of prostate cancer, to give an overview on prostate carcinogenesis and its possible prevention. Conclusion We can conclude that specific natural and synthetic compounds can downregulate DNMTs and/or HDACs inhibiting the methylation status of NRF2 promoter, then reactivating the expression of NRF2 protecting normal prostatic cells from ROS damage and tumorigenesis.
... Though many plantbased extracts and several compounds are studied for various Such responses for considered L929 cell lines on treating with Cur and Cur/CNS were investigated and the percent cell viability is given in Fig. 4. From ancient times, curcumin has proven its efficacy in wound healing, though the cell viability was neglected. However, recent research is considering cell proliferation assay as crucial component [43,44] ...
Full-text available
Article
Biowaste-derived carbon biomaterial scaffolds are being used for wound healing and are the focus of interest. Carbon nanospheres derived from oil palm leaves without any catalysts via pyrolysis were loaded with a traditional drug curcumin. The wound healing scaffolds were fabricated on the PP non-woven fabric support using chitosan as the biopolymer matrix. Prepared carbon nanospheres and the scaffolds were characterized using ATR-IR and FESEM techniques. The wettability of scaffolds was examined to ensure the feasible moisture absorption ability, in vitro drug release profile and in vitro antibacterial activity against two strains of bacteria. The in vivo wound healing feature of scaffolds was studied by excision wound model for MRSA infected wound. Measured wound contraction percentage and the bacterial count on wounds at regular time intervals proved that, the scaffold dressed with chitosan and curcumin loaded carbon nanospheres showed an efficient reconstruction of skin through histopathological investigations. Graphical abstract
... Curcumin also exert its anticancer potential via the inhibition or induction of the production of different cytokines, growth factors or enzymes such as nuclear factor-kappa B (NF-κB), mitogen-activated protein kinase (MAPK), epidermal growth factor (EGF), cyclooxygenase-2 (COX-2), tumor necrosis factor alpha (TNF-α), signal transducer and activator of transcription 3 (STAT3), and Iκ-Kβ [32]. Evidence supported that the curcumin can promote apoptosis and anti-proliferative activity against several cancer cell lines such as breast cancer (10, 25, 50, 100, 200 µg/ml) [33], prostate cancer (10, 25, 50 µM) [34], pancreatic cancer (25, 50 µM) [35], and kidney in dose dependent manner [36]. Curcumin at dose of 0.1-3 mg/kg decreases the expression of Bcl-2 and suppresses telomerase reverse transcriptase enzyme. ...
Full-text available
Article
Cancer is the second leading cause of fatality all over the world. Various unwanted side effects are being reported with the use of conventional chemotherapy. The plant derived bioactive compounds are the prominent alternative medicinal approach for reduction of chemotherapy associated side effects. The data is collected from Pubmed, Sci-hub, Google scholar, and Research gate were systematically searched up to year 2020. Several herbal drugs have been investigated and found with grateful anti-cancer potentials hence, it can be used in combination with chemotherapy for the depletion of associated side-effects. Herbal drugs and their extracts contain a mixture of active ingredients, which show interactions within themselves and along with chemotherapeutic agents to show either synergistic or antagonistic therapeutic effects. Therefore, it is necessary to develop alternative treatment to control chemotherapy associated side-effects. In this review, we discussed some of the significant chemical compounds, which could be efficient against cancer. This review focuses on the different herbal drugs that play an important role in the treatment of cancer and its associated side-effects. This study aimed to evaluate the efficacy of herbal treatment in combination with chemotherapy for cancer treatment.
... Curcumin has a relatively minimal toxicity potential in both humans and animals [28]. Like gemcitabine and cisplatin as chemotherapeutic medications, it inhibits the development of malignant cells with IC50 ranging from 5 to 30 μM [148][149][150]. A clinical trial involving 15 people with colorectal cancer found that the cancer was unresponsive to curcumin at 3.6 g/day over four months [151]. ...
Full-text available
Article
Throughout the United States, cancer remains the second leading cause of death. Traditional treatments induce significant medical toxic effects and unpleasant adverse reactions, making them inappropriate for long-term use. Consequently, anticancer-drug resistance and relapse are frequent in certain situations. Thus, there is an urgent necessity to find effective antitumor medications that are specific and have few adverse consequences. Curcumin is a polyphenol derivative found in the turmeric plant (Curcuma longa L.), and provides chemopreventive, antitumor, chemo-, and radio-sensitizing properties. In this paper, we summarize the new nano-based formulations of polyphenolic curcumin because of the growing interest in its application against cancers and tumors. According to recent studies, the use of nanoparticles can overcome the hydrophobic nature of curcumin, as well as improving its stability and cellular bioavailability in vitro and in vivo. Several strategies for nanocurcumin production have been developed, each with its own set of advantages and unique features. Because the majority of the curcumin-based nanoformulation evidence is still in the conceptual stage, there are still numerous issues impeding the provision of nanocurcumin as a possible therapeutic option. To support the science, further work is necessary to develop curcumin as a viable anti-cancer adjuvant. In this review, we cover the various curcumin nanoformulations and nanocurcumin implications for therapeutic uses for cancer, as well as the current state of clinical studies and patents. We further address the knowledge gaps and future research orientations required to develop curcumin as a feasible treatment candidate.
... Vulvovaginal atrophy (VVA) is a common chronic progressive condition secondary to low estrogen levels during and after menopause (1)(2)(3). The common symptoms include dryness, itching or burning sensation, dyspareunia, and bleeding after intercourse (4)(5)(6). ...
Full-text available
Article
Background: Vulvovaginal atrophy (VVA) usually occurs during and after menopause due to low estrogen levels and can cause frustrating symptoms. Existing treatments such as estrogen compounds have undesired side effects. Objectives: This study was conducted to assess the effectiveness of a chicken tallow product for vaginal use on subjective symptoms of VVA in women with breast cancer. Methods: Menopause induced by chemical drugs with subjective symptoms of VVA were selected from the Oncology-Radiotherapy Clinic of Shohadaye Tajrish Hospital between March and July 2020. Informed consent was obtained. Patients were instructed to apply 5g cream every other night before bedtime for 2 weeks, and 2 nights a week for the next 2 weeks and stop the medication. Patients were assessed at the time of initiation of medication, and 2, 4, 6, and 8 weeks after initiation of the trial, and VVA subjective symptoms were assessed. VVA subjective symptom score (VVA-SSS) form was used to assess itching, burning, dryness, and dyspareunia, using a 5-point Likert scale. Data were, then, analyzed. Results: Fifty women were included in the study (age above 18 years). All 5 monitored indices (itching, burning, dryness, dyspareunia, and VVA subjective symptoms score) diminished after initiation of intervention and reached a minimum level after 4 weeks of intervention (1.10 ± 1.16 baseline to 0.04 ± 0.20 at 4 weeks for itching, 1.42 ± 1.09 to 0.04 ± 0.20 for burning, 2.68 ± 0.91 to 0.30 ± 0.54 for dryness, 2.96 ± 0.88 to 0.50 ± 0.61 for dyspareunia, and 8.12 ± 2.70 to 0.86 ± 1.07 for VVA-SSS). During the 4 weeks following discontinuation of treatment, the symptoms slightly increased but remained significantly lower than the baseline (P-value < 0.001 for all 5 indices at all monitored time points). Conclusions: The proposed treatment, rooted in Persian traditional medicine, may offer a safe and effective treatment for VVA symptoms in BCS.
Full-text available
Article
In today’s scenario, when cancer cases are increasing rapidly, anticancer herbal compounds become imperative. Studies on the molecular mechanisms of action of polyphenols published in specialized databases such as Web of Science, Pubmed/Medline, Google Scholar, and Science Direct were used as sources of information for this review. Natural polyphenols provide established efficacy against chemically induced tumor growth with fewer side effects. They can sensitize cells to various therapies and increase the effectiveness of biotherapy. Further pharmacological translational research and clinical trials are needed to evaluate theirs in vivo efficacy, possible side effects and toxicity. Polyphenols can be used to design a potential treatment in conjunction with existing cancer drug regimens such as chemotherapy and radiotherapy.
Chapter
Polyphenols are secondary metabolites of plants, and one of the most important phytochemicals found in herb plants, vegetables, and fruits. In recent years, these compounds have attracted increased attention due to the potential health benefits of dietary plant polyphenols as antioxidants. Epidemiological studies have noted the lower risk of chronic diseases, such as cardiovascular diseases, cancer, hypertension, diabetes, and neurodegenerative diseases, with the consumption of diets rich in fruits and vegetables owing to the antioxidant and antiinflammatory properties of phenolic compounds. However, the bioavailability of each phenolic compound differs and there is no relation between the quantity of polyphenols in food and their bioavailability in human organisms. This chapter aimed to show the current evidence relating to polyphenols and health and the potential uses of polyphenols.
Full-text available
Article
Ischemia Reperfusion injury is the tissue damage caused when blood supply returns to the tissue after a period of ischemia or lack of oxygen. In this study, the effect of pentoxyfylline on BCL-2 gene expression changes and cell injury in kidney of rat following Ischemia Reperfusion were evaluated. In this experimental study, 20 male wistar rats with average weight of 250-300 g were selected and then were accidently divided them on two tenth group of control and treatment groups. In the control group, celiotomy was performed by ventral midline incision. The left kidney was isolated, and then both the renal artery and vein were obstructed. After 60 minutes of warm ischemia, vessel obstruction resolved and the right kidney was removed. 72 hours after reperfusion, tissue samples were taken from left kidney for Tunel assay. We used quantitative real time PCR for detection of BCL-2 gene expression in treated groups and then compared them to control samples. In the treatment group, the cell death changes, showed lower level than the control group. The results also showed the BCL-2 gene expression was declined in ischemia group as campared to PNT drug group. The pentoxyfylline might have a role in control of apoptosis result from Ischemia- reperfusion and quantitative real-time PCR can be used as a direct method for detection BCL-2 gene expression in tested samples and normal samples.
Full-text available
Article
Colorectal cancer (CRC) is a serious public health problem that results due to changes of diet and various environmental stress factors in the world. Curcumin is a traditional medicine used for treatment of a wide variety of tumors. However, antimetastasis mechanism of curcumin on CRC has not yet been completely investigated. Here, we explored the underlying molecular mechanisms of curcumin on metastasis of CRC cells in vitro and in vivo. Curcumin significantly inhibits cell migration, invasion, and colony formation in vitro and reduces tumor growth and liver metastasis in vivo. We found that curcumin suppresses Sp-1 transcriptional activity and Sp-1 regulated genes including ADEM10, calmodulin, EPHB2, HDAC4, and SEPP1 in CRC cells. Curcumin inhibits focal adhesion kinase (FAK) phosphorylation and enhances the expressions of several extracellular matrix components which play a critical role in invasion and metastasis. Curcumin reduces CD24 expression in a dose-dependent manner in CRC cells. Moreover, E-cadherin expression is upregulated by curcumin and serves as an inhibitor of EMT. These results suggest that curcumin executes its antimetastasis function through downregulation of Sp-1, FAK, and CD24 and by promoting E-cadherin expression in CRC cells.
Full-text available
Article
Curcumin, which is extracted from the plant Curcuma longa, has been used in the therapeutic arsenal for clinical oncology. Curcumin has chemopreventive and antitumoral activities against some aggressive and recurrent cancers. The expressions and activities of various proteins, such as inflammatory cytokines and enzymes, transcription factors, and gene-products linked with cell survivals and proliferation, can be modified by curcumin. Moreover, curcumin decreases the toxic effect of mitomycin C. Though curcumin has shown highly cytotoxic to some cancer cell lines, curcumin is insoluble and instable in water. The solubility of curcumin could be enhanced by utilizing the solubilizing properties of rubusoside. In addition, the selective delivery of synthetic analogs or nanotechnology-based formulations of curcumin to tumors may improve the chemopreventive and chemotherapeutic effects. The focus of this short review is to describe how curcumin participates in antitumor processes in breast cancer cells.
Article
Curcumin has shown therapeutic and/or adjuvant therapeutic effects on the treatment of some patients with breast cancer. However, its mechanisms of action are largely unknown. This study was designed to investigate its antitumor effect and underlying mechanisms in human breast cancer MDA-MB-231 and MCF-7 cells. The MTT assay was used to evaluate cell viability, and flow cytometry, acridine orange staining and transmission electron microscopy were used to detect apoptosis for cultured cells. The protein expression in cells was evaluated by western blot analysis. Breast tumors were established by subcutaneous injection of MDA-MB-231 cells in nude BALB/c mice, and curcumin was administered to the mice. The size of tumors was monitored and the weight of tumors was examined. The exposure of breast cancer cells to curcumin resulted in growth inhibition and the induction of apoptosis in a dose-dependent manner. We also found that the expression of Bcl-2 protein decreased and the expression of Bax protein increased which lead to an increase of the Bax/Bcl-2 ratio. In mice bearing MDA-MB-231 xenograft tumors, administration of curcumin showed a significant decrease of tumor volumes and tumor weight compared with the control. Our results showed that curcumin exhibited antitumor effects in breast cancer cells with an induction of apoptosis.
Article
The TNF-related apoptosis inducing ligand (TRAIL) has promising anti-cancer therapeutic activity, although significant percentage of primary tumors resistant to TRAIL-induced apoptosis remains an obstacle to the extensive use of TRAIL-based mono-therapies. Natural compound curcumin could potentially sensitize resistant cancer cells to TRAIL. We found that the combination of TRAIL with curcumin can synergistically induces apoptosis in three TRAIL-resistant breast cancer cell lines. The mechanism behind this synergistic cell death was investigated by examining an effect of curcumin on the expression and activation of TRAIL-associated cell death proteins. Immunoblotting, RNA interference, and use of chemical inhibitors of TRAIL-activate signaling revealed differential effects of curcumin on the expression of Mcl-1 and activities of ERK and Akt. Curcumin-induced production of reactive oxygen species did not affect total expression of DR5 but it enhanced mobilization of DR5 to the plasma membrane. In these breast cancer cells curcumin also induced downregulation of IAP proteins. Taken together, our data suggest that a combination of TRAIL and curcumin is a potentially promising treatment for breast cancer, although the specific mechanisms involved in this sensitization could differ even among breast cancer cells of different origins.
Article
Curcumin (diferuloylmethane), an active constituent of turmeric, is a well-described phytochemical, which has been used since ancient times for the treatment of various diseases. The dysregulation of cell signaling pathways by the gradual alteration of regulatory proteins is the root cause of cancers. Curcumin modulates regulatory proteins through various molecular mechanisms. Several research studies have provided in-depth analysis of multiple targets through which curcumin induces protective effects against cancers including gastrointestinal, genitourinary, gynecological, hematological, pulmonary, thymic, brain, breast, and bone. The molecular mechanisms of action of curcumin in treating different types of cancers remain under investigation. The multifaceted role of this dietary agent is mediated through its inhibition of several cell signaling pathways at multiple levels. Curcumin has the ability to inhibit carcinogenicity through the modulation of the cell cycle by binding directly and indirectly to molecular targets including transcription factors (NF-kB, STAT3, β-catenin, and AP-1), growth factors (EGF, PDGF, and VEGF), enzymes (COX-2, iNOS, and MMPs), kinases (cyclin D1, CDKs, Akt, PKC, and AMPK), inflammatory cytokines (TNF, MCP, IL-1, and IL-6), upregulation of proapoptotic (Bax, Bad, and Bak) and downregulation of antiapoptotic proteins (Bcl(2) and Bcl-xL). A variety of animal models and human studies have proven that curcumin is safe and well tolerated even at very high doses. This study elaborates the current understanding of the chemopreventive effects of curcumin through its multiple molecular pathways and highlights its therapeutic value in the treatment and prevention of a wide range of cancers. © 2012 BioFactors, 2013.
Article
Curcumin has been shown to induce apoptosis in various malignant cancer cell lines. One mechanism of curcumin-induced apoptosis is through the PI3K/Akt signaling pathway. Akt, also known as protein kinase B (PKB), is a member of the family of phosphatidylinositol 3-OH-kinase regulated Ser/Thr kinases. The active Akt regulates cell survival and proliferation; and inhibits apoptosis. In this study we found that curcumin induces apoptotic cell death in MCF-7 cells, as assessed by MTT assay, DNA ladder formation, PARP cleavage, p53 and Bax induction. At apoptotic inducing concentration, curcumin induces a dramatic Akt phosphorylation, accompanied by an increased phosphorylation of glycogen synthase kinase 3beta (GSK3beta), which has been considered to be a pro-growth signaling molecule. Combining curcumin with PI3K inhibitor, LY290042, synergizes the apoptotic effect of curcumin. The inhibitor LY290042 was capable of attenuating curcumin-induced Akt phosphorylation and activation of GSK3beta. All together, our data suggest that blocking the PI3K/Akt survival pathway sensitizes the curcumin-induced apoptosis in MCF-7 cells.
Article
The following effects of pentoxifylline in endotoxinemia in man could be demonstrated: 1. Il-6 release and Il-6 mediated effects such as clinical responses and leukocytosis are not inhibited by POF treatment. 2. TNF-alpha release is suppressed which might be the most important result, because TNF seems to play the major role in the pathophysiological events of endotoxinemia. Furthermore, pentoxifylline is able to counteract the initial leukocytopenia caused by sticking of leukocytes in the microcirculation. 3. De-novo-synthesis of cytokines by monocytes ex vivo is totally abolished. This may possibly reflect the in vivo situation. In conclusion, beneficial effects of pentoxifylline in respiratory distress syndrome, multi-organ failure and septic shock are suggested. Furthermore, our data indicate that endotoxin-induced formation of Il-6 and TNF-alpha are regulated independently in vivo.
Article
Anticancer activity of the rhizomes of turmeric was evaluated in vitro using tissue culture methods and in vivo in mice using Dalton's lymphoma cells grown as ascites form. Turmeric extract inhibited the cell growth in Chinese Hamster Ovary (CHO) cells at a concentration of 0.4 mg/ml and was cytotoxic to lymphocytes and Dalton's lymphoma cells at the same concentration. Cytotoxic effect was found within 30 min at room temperature (30 degrees C). The active constituent was found to be 'curcumin' which showed cytotoxicity to lymphocytes and Dalton's lymphoma cells at a concentration of 4 micrograms/ml. Initial experiments indicated that turmeric extract and curcumin reduced the development of animal tumours.
Article
Three natural curcuminoids (curcumin (CAS 458-37-7), demethoxycurcumin, bisdemethoxycurcumin) and acetylcurcumin were compared for their ability to scavenge superoxide radicals and to interact with 1,1-diphenyl-2-picryl-hydrazyl (DPPH) stable free radicals. The results showed that curcumin is the most potent scavenger of superoxide radicals followed by demethoxycurcumin and bisdemethoxycurcumin. Acetylcurcumin was inactive. Interaction with DPPH showed a similar activity profile. The study indicates that the phenolic group is essential for the free radical scavenging activity and presence of methoxy group further increases the activity.