Molecular barcoding of green bottle fly, Lucilia sericata (Diptera: Calliphoridae) using COI gene sequences

Full text

~10~
Journal of Entomology and Zoology Studies 2015; 3 (1): 10-12
ISSN 2320-7078
JEZS 2015; 3 (1): 10-12
© 2015 JEZS
Received: 13-12-2014
Accepted: 29-12-2014
Priya Bhaskaran K. P.
Molecular Biology Laboratory,
Department of Zoology, University of
Calicut, Kerala, India
Sebastian C. D.
Department of Zoology, University of
Calicut, Kerala, 673 635 India
Correspondence:
Dr. Sebastian C. D.
Department of Zoology, University of
Calicut, Kerala, 673 635 India
Email: drcdsebastian@gmail.com
Molecular barcoding of green bottle fly, Lucilia
sericata (Diptera: Calliphoridae) using COI gene
sequences
Priya Bhaskaran K. P. and Sebastian C. D.
Abstract
The mitochondrial cytochrome oxidase I (COI) gene has been proposed as standard DNA barcoding
marker for the identification of organisms. COI provides an ideal species identification marker in insects,
due to lack of introns, simple alignment, limited exposure to recombination and the availability of robust
primer sites. Sequence variation in this region generally shows large interspecific, but small intraspecific
divergence. Lucilia sericata (Diptera: Calliphoridae) is the common green bottle fly found in most areas
of the world, and the most well-known of the numerous green bottle fly species. L. sericata has much
importance in the field of forensic entomology. We have amplified and sequenced a 545 bp fragment of
cytochrome oxidase subunit I (COI) gene of L. sericata. The consensus sequence was searched for its
similarity using BLAST programme of NCBI. The phylogeny tree construction and sequence divergence
study were done.
Keywords: cytochrome oxidase I, Lucilia sericata, phylogeny, divergence
1. Introduction
To analyze diversity among and within species, molecular systematics provides an overview of
molecular methods currently used. Precise determination of closely related species, ecotypes
or intraspecies variability can be done using DNA based taxonomy. This complements with
traditional methods for species description and identification. Due to its simple genome
structure, mitochondrial DNA is one of the most widely used molecular markers for
phylogenetic studies in animals. Maximum number of mitochondrial genomes has been
characterized in order Diptera among insects [1]. Relevance of barcoding in insect studies was
investigated using sequence of Diatraea saccharalis [2]. This sequence has maximum
homology (99%) with barcode sequence of Crambidae (Lepidoptera). Molecular barcoding of
A. cerana demonstrates the efficiency of the barcoding gene in discriminating global
phylogeographical variants among the Apis species complex [3].
Studies revealed that the blowflies, Calliphora vomitoria (Linnaeus), C. vicina (Rob-
Desvoidy) and Lucilia sericata (Meigen) exhibited a limited ability to colonise pig liver baits
buried in loose soil. C. vomitoria colonised baits buried at 5 cm but not deeper. Whereas C.
vicina and L. sericata colonised remains at 10 cm but not at 20 cm. This provides the
information to determine whether a body was stored above ground before being buried and/or
the time since burial occurred [4].
Competitive interactions between insects and microbes were investigated using the blowfly
Lucilia sericata (Meigen) (Diptera: Calliphoridae) [5]. Studies showed that bacterial presence
has no detrimental effect on survival of L. sericata from egg to adult, or on pupal size.
Arthropod studies help to gather evidence in Medico legal forensic entomology at events such
as murder, suicide, rape, physical abuse and contraband trafficking. This can be helpful in
determining a post mortem interval (PMI) and location of a death in question [6]. Many insects
exhibit a degree of endemism, or have a well-defined phenology and hence their presence in
association with other evidence can reveal potential links to time and locations where other
events might have occurred. Forensic entomology is based on the analysis of those insects
which successively colonize a corpse as decomposition progresses and on the rate at which the
various stages of their progeny develop. To determine the time, mode and place of death, this
information can be useful in criminal investigations.


~11~
Journal of Entomology and Zoology Studies

The insects involved in this approach are mostly Dipterans,
especially those belonging to the families Calliphoridae and
Sarcophagidae. The first organisms to arrive are the blowflies
(Family Calliphoridae). C. vicina, L. sericata or Phormia
terraenovae which colonize the body even before the body
starts any signs of bloating.
L. sericata has much more importance in the field
of forensic entomology. Like most Calliphorids, the insect has
been deeply studied and its life cycle and habits are well
documented [7]. Due to this, the stage of the insect’s
development on a corpse is used to calculate a minimum
period of colonization, so that it can be used as an aid in
determining the time of death. Forensic entomology is an
emerging field in forensic sciences and an important tool in
criminal investigations. To determine time since death is easy
in the early post mortem period, but in the late stages it
becomes the major problem. But by studying insect evidence it
is possible to determine post mortem interval in decomposed
bodies. Blow flies in their different stages of development
were found on fresh and decaying corpses as insect evidence
[8].
In the present study, the sequencing of mitochondrial COI
gene of Lucilia sericata has been done which can be used as
its barcode for taxonomic identification. L. sericata is an
important species to forensic entomology as it helps to
calculate the post mortem index. Medically, research is
ongoing centered on the secretions produced by L. sericata as
an agent against MRSA and VRSA, and the larval applications
for maggot therapy.
2. Materials and Methods
The experimental insect, Lucilia sericata (Diptera:
Calliphoridae) is the common green bottle fly found in most
areas of the world and the most well-known of the
numerous green bottle fly species, were collected from Calicut
University Botanical Garden (CUBG, India) during post
monsoon period. The tissue from one of the thoracic legs was
homogenized and the extracted genomic DNA was isolated
using Genie Ultrapure Mammalian Genomic DNA Prep Kit
(Genie, Bangalore).
2.1 Sequencing of genomic DNA
About 2ng of genomic DNA was PCR amplified for
mitochondrial cytochrome oxidase subunit I (COI) gene using
the forward primer with DNA sequence 5'-
GGTCAACAAATCATAAAGATATTGG -3' and reverse
primer with DNA sequence 5'-
TAAACTTCAGGGTGACCAAAAAATCA -3’. The PCR
products were resolved on a 2% TAE- agarose gel, for
confirmation of the target gene amplification. After
ascertaining the PCR amplification of the corresponding COI
fragment, the remaining portion of the PCR product was
column purified using Mo Bio UltraClean PCR Clean-up Kit
(Mo Bio Laboratories, Inc. California). The purified PCR
product was sequenced at SciGenome Labs Private Ltd.,
Cochin. The forward and reverse sequences obtained were
trimmed for the primer sequences, assembled by using Clustal
W and the consensus was taken for the analysis.
2.2 Phylogenetic analysis
The nucleotide sequence and peptide sequence were searched
for its similarity using BLAST programme of NCBI [9]. The
phylogenetic tree was plotted in neighbor joining method
using MEGA 6 software [10].
3. Results and Discussion
The PCR amplification of the COI gene fragment of L.
sericata yielded a single product of 545 bp. The BLAST
search using sequence revealed that the sequence obtained in
this study was novel and the sequence was deposited in NCBI
GenBank (GenBank Accession Number: KM 096998). The
results indicate that nucleotide sequence showed great
similarity with sequence of same genus from Europe and
American continents. The intraspecies divergence was less and
interspecies divergence ranged from 0.7 to 3.8%. L. sericata
was found to be 99.3% similar to L. cuprina (KJ 496771). The
mitochondrial genome of closely allied species showed
sequence diversity to enable their discrimination. The
evolutionary divergence of L. sericata within the genus is
given in the Table 1.
The COI gene in the mitochondrial genome has been proved to
be an excellent source of information for the set of closely
related families belonging to the order Diptera. Sequencing
was done for COI gene for Armigeres subalbatus, to evaluate
its relationship between the different species of mosquitoes
and to generate a database for molecular barcoding [11]. The
partial sequence of COI gene of L. sericata (GenBank
Accession Number: KM 096998) is 100% identical with that
of L. sericata isolated from USA, Spain, Belgium, Portugal
and Brazil. This indicates that there is no geographical
variation between the species and all these species belongs to
the same clade. The COI sequence obtained in this study
showed nucleotide variation of 0.7% to that of L. cuprina CO I
gene (GenBank Accession Number: (KJ 496771), (KC
568275) and 3.4% to that of Lucilia silvarum (FR 719175),
(JQ 801751) COI gene sequences. The N-J tree with
nucleotide sequences revealed that it is closer to L. cuprina,
Hemipyrellia ligurriens, L. thatuna, L. silvarum, L. illustris in
their mitochondrial COI gene sequences. The phylogenetic
tree of DNA plotted using neighbour joining method is
attached as Figure 1.

Table 1: Evolutionary divergence between sequences of Lucilia
sericata within the genus

Organism with Accession Number % of divergence
L. sericata (KM 096998)
L. sericata (KF 225236) 0.0%
L. sericata (KF 908125) 0.0%
L. sericata (JX 438041) 0.0%
L. sericata (KC 473902) 0.0%
L. sericata (JQ 246679) 0.0%
L. sericata (KF 225235) 0.0%
L. sericata (FJ 614824) 0.3%
L. cuprina (KJ 496771) 0.7%
L. cuprina (KC 568275) 0.7%
L. sericata (JN 257225) 0.9%
L. thatuna (DQ 453489) 1.7%
L. illustris (EU 880198) 3.1%
L. silvarum (JQ 801751) 3.4%
L. silvarum (FR 719175) 3.4%
L. illustris (JX 295709) 3.4%
L. bufonivora (KF 751384) 3.8%


~12~
Journal of Entomology and Zoology Studies

Lucilia sericata (KF225236)
Lucilia sericata (KF908125)
Lucilia sericata (JX438041)
Lucilia sericata (KC473902)
Lucilia sericata (JQ246679)
Calliphora sp. (DQ295312)
Lucilia sericata (JN257225)
Lucilia sericata (KERALA)
Lucilia sericata (FJ614824)
Lucilia sericata (KF225235)
Lucilia cuprina (KJ496771)
Lucilia cuprina (KC568275)
Lucilia thatuna (DQ453489)
Lucilia illustris (JX295709)
Lucilia illustris (EU880198)
Lucilia bufonivora (KF751384)
Lucilia silvarum (JQ801751)
Lucilia silvarum (FR719175)
0.005
Fig 1: Phylogenetic tree of Lucilia sericata using neighbour joining method
4. Conclusion
DNA barcoding is an excellent source for genetic and
phylogeographical variants. Variation in the nucleotide is
fundamental property of all living organisms which can be
used for their identification and phylogenetic status.
Phylogenetically the nearest relatives of L. sericata is L.
cuprina, showing 99.3% similarity and H. ligurriens, showing
99% similarity.
5. Acknowledgements
The financial assistance from University Grants Commission,
New Delhi and Kerala State Council for Science Technology
and Environment under Research Projects is gratefully
acknowledged.
6. References
1. Cameron SL, Lambkin CL, Barker SC, and Whiting M et
al. 2007. A mitochondrial genome phylogeny of Diptera.
Whole genome sequence data accurately resolve
relationship over broad time scales with high precision.
Systemic Entomology 2007; 32:40-59.
2. Bravo JP, Silva JLC, Munhoz REF, Fernandez MA et al.
DNA barcode information for the sugar cane moth borer
Diatraea saccharalis. Genetics and Molecular Research
2008; 7(3):741-748.
3. Rukhsana K, Akhilesh VP, Sebastian CD et al.
Deciphering the molecular phylogenetics of the Asian
honey bee, Apis cerana (Hymenoptera: Apidae) and
inferring the phylogeographical relationships using DNA
barcoding. Journal of Entomology and Zoology Studies
2014; 2(4):218-220.
4. Gunn A, Bird J. The Ability of the Blowflies Calliphora
vomitoria (Linnaeus), Calliphora vicina (Rob-Desvoidy)
and Lucilia sericata (Meigen) (Diptera: Calliphoridae)
and the Muscid Flies Muscina stabulans (Fallén) and
Muscina prolapsa (Harris) (Diptera: Muscidae) to
Colonise Buried Remains. Forensic Science International
2011; 207:198-204.
5. Barnes AS, Gennard D. The effect of bacterially-dense
environments on the development and immune defences
of the Blowfly Lucilia sericata. Physiological
Entomology 2011; 36(1):96-100.
6. Campobasso CP, Vella GD, Introna F et al. 2001. Factors
affecting decomposition and Diptera colonization.
Forensic Science International 2001; 120:18-27.
7. Joseph I, Mathew DG, Sathyan P, Varghese G et al. The
use of insects in forensic investigations: An overview on
the scope of forensic entomology. Journal of Forensic
Dental Sciences 2011; 3(2):89-91.
8. Goyal PK. An entomological study to determine the time
since death in cases of decomposed bodies. Journal of
Indian Academy of Forensic Medicine 2012; 34(1):10- 12.
9. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ et
al. Basic local alignment search tool. Journal of Molecular
Biology 1990; 215:403-410.
10. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S et
al. MEGA6: Molecular Evolutionary Genetics Analysis
Version 6. Molecular Biology and Evolution 2013;
30(12): 2725–2729.
11. Bindu PU, Sebastian CD. 2014. Genetic structure of
mitochondrial cytochrome oxidase subunit I gene of the
mosquito, Armigeres subalbatus. International Journal of
Research 2014; 1(10):49-56.