No full-text available
To read the full-text of this research,
you can request a copy directly from the authors.
Ecological Issues of Mulberry and Sustainable Development
Abstract
Mulberry is a perennial and broadleaf woody plant. Mulberry trees have long been cultivated for silkworm rearing. In recent years, the roles of mulberry trees in the prevention and control of desertification, water and soil conservation, saline—land management and returning the grain plots to forestry have been identified. Meanwhile, multi usage of mulberry as forage for livestock, for fruit and tea preparation has been gradually explored. Therefore, an innovation occurred in the mulberry industry. This article introduces the ecological and economic values of mulberry trees, the applications of mulberry, and the development of mulberry industry.
... Desert mulberry is an ecotype of mulberry that was successfully planted in desert areas of Xinjiang parts of China. This ecotype enables the mulberry plants to be cultivated in deserted conditions with minimum levels of irrigation, hence it is recommended for natural restoration of empty deserted lands and desertificated grasslands (Jian et al., 2012 ). Mulberry plants are also utilized and successfully demonstrated for ecorestoration of salinated lands and stony deserted areas (Jian et al., 2012). ...
... This ecotype enables the mulberry plants to be cultivated in deserted conditions with minimum levels of irrigation, hence it is recommended for natural restoration of empty deserted lands and desertificated grasslands (Jian et al., 2012 ). Mulberry plants are also utilized and successfully demonstrated for ecorestoration of salinated lands and stony deserted areas (Jian et al., 2012). ...
... (Lu and Jiang, 2003). Therefore, mulberry is categorised as a tree species resistant to sulphur dioxide pollution (Jian et al., 2012). Mulberry trees were likewise considered to be naturally resistant to chlorine, as their leaves were not damaged even when exposed to higher levels of chlorine (Lu et al., 2004). ...
Abstract
The present deliverable is a report on the results of a comprehensive study of ARACNE participating countries aimed at the identification, characterisation and preservation of old mulberry tree varieties, pivotal for sericulture and ecosystem services. The scope of this study encompasses:
A. Identification of mulberry tree varieties in European germplasm collections
The report outlines the assortment of mulberry tree varieties catalogued in germplasm collections across participating ARACNE countries, providing an overview of the collections and detailing the varieties available. Specifically, the collections from CREA, the Vratsa Sericultural Centre, and the University of Maribor were evaluated using morphological and phenological descriptors to gauge the diversity and characteristics of the mulberry varieties.
B. Inventory of Historical Local Mulberry Trees in Sericultural Regions of Participating
Countries
To record old local mulberry trees in sericulture regions of the participating partners, the MorusAPP was developed. This application has been instrumental in creating a
comprehensive database cataloguing the locations, basic information, and morphological descriptors of historical mulberry trees, offering insights into their morphological relationship and possibilities for their preservation.
C. Genetic analysis of the mulberry species relationships
Sophisticated genetic analyses utilizing SSR (simple sequence repeat) and SNP (single nucleotide polymorphism) markers are currently performed, aimed at defining the relationships among different mulberry varieties. This analysis is critical for tracing the ancient route of the mulberry from Asia to Western Europe, shedding light on the genetic relationship of these trees.
D. Recreation of Landscapes
The project has embarked on pioneering attempts to incorporate mulberries into various agroecosystems. These efforts are directed towards the recreation of distinctive landscapes, demonstrating the versatile role of mulberries in enhancing biodiversity and ecosystem service. The results are the starting point of the deliverable 4.3 in order to preserve mulberry trees and to maintain them in the germplasm collections, with the aim of having geneticmaterial available for further sericulture development and for the restoration of landscapes highlighting the rich heritage and ecological value of mulberry trees.
... It can be grown in cities along highway medians, riverbanks, flood plains, public gardens, field crop edges, street trees, and in recreation club areas. It can also be grown in public parks and public gardens [24]. Mulberry plantations can be used for reforestation to achieve a number of benefits, including the ability to restore soil carbon, maintain soil water holding capacity, prevent soil erosion during floods and water logging conditions, improve soil nutrients, nurture soil microflora, improve air quality, and withstand wind currents and sand storms [32,34,35]. ...
... Mulberry plantations can be used for reforestation to achieve a number of benefits, including the ability to restore soil carbon, maintain soil water holding capacity, prevent soil erosion during floods and water logging conditions, improve soil nutrients, nurture soil microflora, improve air quality, and withstand wind currents and sand storms [32,34,35]. The intercropping of grass, vegetables, or other cash crops with mulberry plantations is also possible which results in better eco-restoration [24,36]. For instance, mulberry plantations have shown promise in a number of areas, including soil improvement [37], air quality improvement [32], soil and water conservation [36] and sustaining unfavourable environmental conditions [38][39]. ...
... According to Lu and Jiang (2003) [43], mulberry trees can absorb 5.7 g of sulfur dioxide per kilogram of dried leaves, and they may also take in significant amounts of sulfur dioxide gas each day. Mulberry is therefore categorized as a type of tree that is resistant to sulfur dioxide pollution [24]. Mulberry roots have a specialised architecture with a larger diameter near the stem followed by rapid shrinking in size; they have a long rope-like structure made up of secondary and tertiary roots as well as root hairs that allow them to absorb large amounts of carbon pollutants from the soil [37,44]. ...
Mulberry (Morus spp.), a member of the Moraceae family, is identified as a special plant because of its wide geographic distribution across continents, its versatility in cultivation, many uses for its leafy foliage, and its benefits in safety measures of the environment like eco-restoration of the degraded soil, bioremediation of polluted specific sites, water conservation, soil erosion prevention, and improvement of air quality through carbon sequestration. In order to battle the issue of ongoing environmental degradation and population expansion, policymakers and scientists have begun to pay attention to the further exploitation of mulberry through the creation of diverse products in the pharmaceutical, food, and healthcare industries other than its use as the feed of Bombyx mori larvae in sericulture. As mulberry is used in the pharmaceutical and food industries and in environmental safety measures, it is appropriate to refer to it as the plant ideal for sustainable development. All the crucial mulberry traits were compiled in this review article in order to evaluate it as the perfect plant for ensuring a sustainable future.
... As compared to other continents, it is widely cultivated as a food plant for silkworm rearing in the countries of the Asian continent: majorly in China, India, Japan, Thailand, Malaysia, Indonesia, Korea, Vietnam, etc., (Sanchez 2000). Because of its economic importance in producing commercial cocoons, a lot of progress has been achieved concerning its cultivation, disease and pest management, agronomical practices, and also in developing and evolving new mulberry varieties which are suitable for specific ecological zones (Qin et al. 2012). ...
... Leaves of mulberry in mulberry forestry can absorb large quantities of sulfur dioxide gases on daily basis (approximately 5.7 g of sulfur dioxide per kg of mulberry leaves/day) from the atmospheric gaseous (Lu and Jiang 2003). Hence, mulberry plants are regarded as sulfur dioxide pollutionresistant tree species (Qin et al. 2012). Similarly, mulberry leaves were reported for stronger absorption and retention capabilities against harmful industrial pollutant metals such as lead and copper from the atmosphere of industrial areas (Lu and Li 2002). ...
... Further mulberry plants on urban plantation drive along the road sides, in public gardens, parks, along the banks of river channels, like street trees, as carbon sequestrating plants in the industrial areas, for effective utilization as city landscapes and also mulberry is regarded as green afforestation tree species (Wang et al. 2010;Qin et al. 2012;Jian et al. 2012). As mulberry is having the ability to remove air pollutants from the atmosphere with the help of its leaves and remove heavy metals and other types of soil pollutants through its roots, this plant species is considered ideal for providing a sustainable environment for future generations and helps in the sustainable development of nature (Jian et al. 2012). ...
Mulberry is a perennial, deciduous, out-breeding forest tree that grows under wide edapho-climatic conditions across the globe and is the sole food plant for mori silkworm. Mulberry is widely distributed with different species (more than 68 species), and major silk-producing countries have collected, evaluated, and conserved a good number of mulberry germplasm accessions for their utilization in a targeted breeding program for evolving superior varieties. It is well known for its diversified utilization in several industries such as cottage, pharmaceutical, cosmetics, food and beverages, and textiles. The leaf, fruits, and stem are rich sources of biochemical compounds such as carbohydrates, proteins, minerals, vitamins, antioxidants, and alkaloids, which makes mulberry the most suitable candidate for pharmaceutical industries. Due to the high nutritional value of mulberry leaf, it acts as an excellent feed for domesticated animals, i.e., cattle, goat, buffalo, rabbit, sheep, fish, etc., and increases the production of milk, meat, egg, and fish oil which acts as a source of protein and energy in human diet. In beverage industry also, mulberry leaves are utilized for preparing herbal tea. The wide range of usage of mulberry in different industries is helpful in sustainable development of society and makes it an economically important tree plant. This book chapter summarizes the cultivation, utilization, and economic benefits of mulberry.
... Different researchers have documented the importance of Mulberry as shown below ( (Datta et al., 2002). Recreational purposes and soil erosion control measures cultivated along the road sides, river banks, flood plains, public parks, gardens, edges of field crops, street trees (Qin et al., 2012). Singh (1997) revealed that mulberry fruit syrups and recipes are used against constipation and insomnia, anti-aging, hyperlipidemia, premonitory and apoplexy. ...
... AGRICULTURE INTEGRATIONAgriculture diversification has proved beneficial to farmers as they can't suffer total losses in case one of the enterprises fails due to both abiotic and biotic stresses. Mulberry plantation allows intercropping with grass which can be used as animal feed, vegetables for food and other cash crops for generating income(Shi et al., 2005;Qin et al., 2012). Intercropping Mulberry had a good number of benefits: soil fertility improvement(Farrar, 1995), soil and water conservation(Shi et al., 2005), environmental sustainability(Hashemi and Tabibian, 2018; Dai et al., 2009), boosting economy(Datta, 2000).VII. ...
... Treat of hypertension, hyperglycemia, inflammation, fever, cough and cancer in China,(Bown, 1995). Control of blood pressure in China when the young shoot and leaf tips were taken as tea, anthocyanin content and antioxidant(Datta, 2000;Qin et al., 2012), human health promotion (Del et al., 2013), animal feeding and environment protection ...
... Phytoremediation is a green, economical, operation-simple, eco-friendly, safe, and reliable technology, which is recognized by general public (Ali et al. 2013;Jiang et al. 2018). Mulberry belongs to the order Rosales, family Moraceae, genus Morus L., and species of Morus alba L., originated in China (Qin et al. 2012;Jiang et al. 2017). It is a perennial and woody plant species with the feature of strong adaptability, well-developed root system, and higher biomass (Qin et al. 2012;Jiang et al. 2019). ...
... Mulberry belongs to the order Rosales, family Moraceae, genus Morus L., and species of Morus alba L., originated in China (Qin et al. 2012;Jiang et al. 2017). It is a perennial and woody plant species with the feature of strong adaptability, well-developed root system, and higher biomass (Qin et al. 2012;Jiang et al. 2019). Also, mulberry has the ability to live under a wide range of soil conditions for its ease in establishment and management and the potential to tolerance heavy metals Jiang et al. 2017;Zeng et al. 2020). ...
... Meanwhile, mulberry leaf is a kind of forage resources with complete nutritional composition (Qin et al. 2012). In dry mulberry leaf, the content of crude protein is approximately 22~25%. ...
A 3-year field experiment was conducted to evaluate the accumulation ability of 3 forage mulberry (Morus atropurpurea Roxb.) varieties (Guisangyou 62, Guisangyou 12, Yuesang 11) for Cadmium (Cd). The results showed that the shoot biomass of forage mulberry could reach to 64.51~69.58 t/ha in 2018. The total production of Guisangyou 12 was the highest among the tested 3 cultivars in each year. However, the biomass of the 3 varieties displayed without significant differences at every sampling time. In addition, the concentrations of Cd in the roots of the 3 mulberry cultivars were higher than those in the corresponding shoots in 2018. But in 2019, the Cd content in roots was near to that of shoots. The Cd concentrations in the roots of the forage mulberry showed Guisangyou 62 > Yuesang 11 > Guisangyou 12. And the Cd concentrations in shoots of all the 3 tested forage mulberry varieties were less than 1 mg/kg, meeting the hygienical standard for feeds (China). Though the 3 forage mulberry varieties were not hyperaccumulators for Cd, they could be used as alternative plants to make use of the Cd-polluted (< 1.0 mg/kg) paddy soils.
... It demonstrated the better bioindicator and bioextraction capability of M. alba as compared to other plant species. The same findings were reported in prior conclusions where M. alba has been testified as a fast-growing woody plant with a deep root system, easy cultivated, capability to withstand the sand, wind, drought, and salinity, strong flexibility of various environments, capability to tolerate a wide range of pollutants, and high capability of leaves to absorb and endurance air pollutants (Jian et al., 2012;LU et al., 2003). Yasin et al. (2021) revealed the same finding where M. alba performed as a passive bioindicator for Cd, Cu, and Pb pollutants while E. camaldulensis was testified as an active bioindicator. ...
... This might be the reason for the phytoremediation and bioindicator capability of M. alba. In previous findings, M. alba has been emphasized as an active bioindicator for Cd, Cu, and Pb pollutants (Jian et al., 2012;LU et al., 2003). Moreover, M. alba has been demonstrated as a fast-growing woody plant with a deep root system, easy cultivated, capability to withstand the sand, wind, drought, and salinity, strong flexibility in various environments, capability to tolerate a wide range of pollutants, and high capability of leaves to absorb and endurance air pollutants . ...
Environmental pollution induced by heavy metals has been identified as a leading threat in the modern era. Woody tree species may play a crucial role in the removal of heavy metals from soil and air, thus minimizing pollution potential. The present study was designed to evaluate the phytoremediation potential of six tree species; Azadirachta indica, Cassia fistula, Conocarpus erectus, Eucalyptus camaldulensis, Morus alba, and Populus deltoids, respectively, in the industrial and residential areas of Faisalabad based on the concentrations of lead (Pb), zinc (Zn), cadmium (Cd), and copper (Cu) in their leaves and barks in winter (2018) and summer (2019) seasons. The seasonal contents of heavy metals in both the leaves and barks of these trees decreased in the order of: Zn > Pb > Cu > Cd at both study sites. The highest heavy metal contents were recorded in the leaves and barks of trees grown in the industrial areas as compared to residential areas, with leaves and barks having higher contents of heavy metals in the summer than winter. The tree species exhibited significantly different capacity for heavy metal accumulation, with the accumulation of Cd decreased in the order of: E. camaldulensis > M. alba > C. erectus > A. indica > P. deltoids > C. fistula, and while the order varied for different heavy metals. Overall, M. alba, E. camaldulensis and A. indica performed well in accumulating the targeted heavy metals from the ambient environment. Among the six tree species grown commonly in Faisalabad city, M. alba, E. camaldulensis, and A. indica are recommended for the industrial and residential areas due to their phytoremediation capacity for heavy metals.
... Global warming, occurrences of natural calamities (like flood and drought etc.), sudden soil erosion, high rate of disease outbreak are some of the phenomena assumed to have direct results with environmental pollution. Mulberry has a few significant trademark highlights and found to be helpful in controlling environmental pollution (Jian et al. 2012). For example, mulberry cultivation found encouraging results about improving air quality, increasing water maintenance capacity, remediation of heavy metals from polluted soils, atmosphere and nurturing useful soil micro flora and fauna (Lu et al. 2004, Yao et al. 2004, Chen et al. 2006). ...
... Mulberry trees acts as great carbon sink plants. According to the data, 1 ha mulberry trees were able to absorb about 6.24 × 10 4 kg of CO2 and released 4.60 × 10 4 kg of O2 each year (Jian et al. 2012). Mulberry is a perfect tree species for city landscaping due its great features in tree structure, leaf colour, development pattern, diligence and resistance. ...
Mulberry is a very hard and quickly developing plant belongs to the family of Moraceae. The leaf of mulberry is exclusively utilized for feeding and rising of the silkworm (Bombyx mori) for the production of silk yarn. It is evaluated that mulberry silk contributes around 90% of the total worldwide raw silk production that contributed to socio-economic development worldwide. The usage of mulberry leaves as silkworm feed, it is being utilized for food and medicinal purpose also. For instance, the mulberry fruit because of its high nutritive value and flavorful taste is getting significance as important foodstuff. The mulberry bark and wood are likewise helpful for assembling of paper and sports products things. Mulberry is a quickly developing with profound roots, flourish leaves, high protections from pollution, wind, sand, drought, and salinity with strong adaptability and simple cultivation. The broad environmental adaptability of mulberry to light, temperature, water, soil and other normal conditions objectively empowers it to have numerous environmental defensive capacities in water and soil protection, wind tolerance and sand consolidation, water source preservation, and air refreshment. Since earlier, Ayurveda and other literature have claimed the diverse medicinal properties against certain serious diseases e.g. hypertension, hyperglycemia, cancer, arthritis, diabetes and rheumatis, heart disease, inflammation, fever, cough and throat, stomach related disease, unsteadiness, hepatitis etc. The current studies of different pharmacological compounds of medicinal significance present in mulberry plants opens up new avenues of research in the medical science. Under this study briefly described about economic as well as environmental importance of mulberry taking into account different aspects of its role as animal feed, foodstuff, phytomedicine and remediation of polluted soils and atmosphere, etc. J. Bio-Sci. 29(1): 163-179, 2021 (June)
... Mulberry plants can withstand drought, effectively withstand wind, stabilize sand and soil conditions. Currently, mulberry plants are used as an ecological plant species for soil and water conservation, especially for the conservation in upland areas [18]. Mulberry plants have high adaptability to the soil. ...
... Mature mulberry plants adapt from water puddles during their growth period. It is sporadic among other xerophyte plants [18]. Mulberry plants that experience more than 1 meter deep still grow well. ...
Mulberry plants have been cultivated for a long time ago. It is being grown for the supply of silkworms. Mulberry cultivation as a silkworms feeds in Indonesia increases because mulberry plants have many benefits, including leaves and fruit as animal feed, tea production, and pharmaceuticals. This study aims to select the right Mulberry species for silkworms cultivation in Indonesia. The study was conducted at BPTH Bali, Cianjur Natural Silk Nursery (West Java), and East Kutai Agricultural Nursery (East Kalimantan). The method used with Randomized Block Design (RBD) consists of mulberry type treatments (Morus alba and Morus cathayana) with the provision of growth regulators (Rootone F). The research results from 3 mulberry species locations studied showed that M. alba showed an optimal growth in West Java, Bali, and East Kalimantan. The results showed that M. alba species had a growth percentage (95%), shoots length (height) (80 cm), stem diameter (0.82 cm), number of shoots (4 branches), and number of leaves (20 strands). Where M. cathayana growth percentage (90%), shoots length (height (76 cm), stem diameter (0.75 cm), number of shoots (3 branches), and number of leaves (18 strands). Overall, M. alba and M. cathayana are the types
used to manage silkworms in Indonesia. The best mulberries type of the whole parameter is M. alba from West Java region.
... Mulberry, native to China, is of great economic importance as the sole food of the mulberry silkworm moth (Bombyx mori L.) and as a source of timber, fuelwood, fodder, food, drinks, medicines, constituents of cosmetics, etc. (Qin et al. 2012;Gozlekci et al. 2015;Dimobe et al. 2018). Recently, Li et al. (2020) found that the photosynthetic carbon sink of mulberry is greater compared to the total carbon emission, which indicates a beneficial effect for the environment. ...
... The variation in absorption of atmospheric CO 2 level can be explained in terms of variation in morphological variables attributed to genetic potentiality, tree age, leaf area, photosynthetic efficiency, edaphic and climatic conditions, and management of the mulberry plantation (Jana et al. 2009). Mulberry varieties have also been reported to differ in their absorption of atmospheric CO 2 (Qin et al. 2012;Jiang et al. 2017); however, the methodology and details of results were not published. ...
Mulberry is economically important and can also play a pivotal role in mitigating greenhouse gases. Leaf and shoot traits were measured for Morus alba var. Kanmasi, M. alba var. Karyansuban, M. alba var. Latifolia, and M. alba var. PFI-1 to assess aboveground biomass (AGB) and carbon sequestration. Variety-specific and multivariety allometric AGB models were developed using the equivalent diameter at breast height (EDBH) and plant height ( H ). The complete-harvest method was used to measure leaf and shoot traits and biomass, and the ash method was used to measure organic carbon content. The results showed significant ( p < 0.01) varietal differences in leaf and shoot traits, AGB and carbon sequestration. PFI-1 variety had the greatest leaf density (mean ± SE: 1828.3 ± 0.3 leaves tree ⁻¹ ), Karyansuban had the largest mean leaf area (185.94 ± 8.95 cm ² ). A diminishing return was found between leaf area and leaf density. Latifolia had the highest shoot density per tree (46.6 ± 1.83 shoots tree ⁻¹ ), total shoot length (264.1 ± 2.32 m), dry biomass (16.69 ± 0.58 kg tree ⁻¹ ), carbon sequestration (9.99 ± 0.32 kg tree ⁻¹ ) and CO 2 mitigation (36.67 ± 1.16 kg). The variety-specific AGB models b (EDBH) and b (EDBH) ² showed good fit and reasonable accuracy with a coefficient of determination ( R ² ) = 0.98–0.99, standard error of estimates (SEE) = 0.1125–0.3130 and root mean square error (RMSE) = 0.1084–0.3017. The multivariety models b ln(EDBH) and (EDBH) 0.756 showed good-fitness and accuracy with R ² = 0.85–0.86, SEE = 1.6231–1.6445 and RMSE = 1.609–1.630. On the basis of these findings, variety Latifolia has good potential for biomass production, and allometric equations based on EDBH can be used to estimate AGB with a reasonable accuracy.
... Mulberry plays a crucial role in environmental protection through the eco-restoration of degraded lands, bioremediation of polluted sites and air purification via carbon sequestration. Its dense and deeply rooted network contributes to soil and water conservation [13,33]. The drought-resistant characteristics of mulberry make it suitable for use as avenue trees, windbreaks and biomass belts where it aids in reducing wind speed and providing organic material. ...
Mulberry trees (Morus spp.) are emerging as ideal candidates for urban
forestry, playing a significant role in enhancing air quality and fostering sustainable
urban development. This abstract explores the multifaceted benefits of mulberries
in urban settings, highlighting their adaptability, resilience, and ecological contribu
tions. Mulberry trees are known for their fast growth and ability to thrive in various
urban environments, making them suitable for city landscapes. Their dense foliage
effectively captures airborne particulate matter and absorbs carbon dioxide, thereby
contributing to cleaner air. The robust root systems of mulberries prevent soil erosion
and promote soil health, further supporting urban sustainability. Beyond environ
mental benefits, mulberry trees offer social and aesthetic advantages. They provide
shade, reducing the urban heat island effect, and contribute to the visual appeal of
urban areas with their lush greenery. Additionally, mulberries produce edible fruit,
serving as a food source for both urban wildlife and city residents interested in
urban agriculture. Given their ecological, social, and aesthetic benefits, mulberry
trees are an ideal choice for urban forestry initiatives aimed at improving air quality
and supporting sustainable development in cities. This book chapter underscores
the importance of incorporating mulberries into urban planning to create greener,
healthier, and more sustainable urban environments.
Keywords Adaptability · City landscapes · Resilience · Ecological contributions ·
Urban sustainability
... Mulberry plays a crucial role in environmental protection through the eco-restoration of degraded lands, bioremediation of polluted sites and air purification via carbon sequestration. Its dense and deeply rooted network contributes to soil and water conservation [13,33]. The drought-resistant characteristics of mulberry make it suitable for use as avenue trees, windbreaks and biomass belts where it aids in reducing wind speed and providing organic material. ...
Mulberry trees (Morus spp.) are emerging as ideal candidates for urban forestry, playing a significant role in enhancing air quality and fostering sustainable urban development. This abstract explores the multifaceted benefits of mulberries in urban settings, highlighting their adaptability, resilience, and ecological contributions. Mulberry trees are known for their fast growth and ability to thrive in various urban environments, making them suitable for city landscapes. Their dense foliage effectively captures airborne particulate matter and absorbs carbon dioxide, thereby contributing to cleaner air. The robust root systems of mulberries prevent soil erosion and promote soil health, further supporting urban sustainability. Beyond environmental benefits, mulberry trees offer social and aesthetic advantages. They provide shade, reducing the urban heat island effect, and contribute to the visual appeal of urban areas with their lush greenery. Additionally, mulberries produce edible fruit, serving as a food source for both urban wildlife and city residents interested in urban agriculture. Given their ecological, social, and aesthetic benefits, mulberry trees are an ideal choice for urban forestry initiatives aimed at improving air quality and supporting sustainable development in cities. This book chapter underscores the importance of incorporating mulberries into urban planning to create greener, healthier, and more sustainable urban environments.
... Mulberry (Morus L.), boasting significant economic importance and deeply rooted in Chinese history, primarily serves as the key source of leaves for silkworm (Bombyx mori L.) rearing, contributing to the production of exquisite silk fibers [1][2][3]. The mulberry tree exhibits a robust and intricately networked root system, imparting resistance to drought, flood, and sandstorms, and facilitating water and soil conservation [4][5][6]. Renowned for its rich content of proteins, flavonoids, carotene, amino acids, pectin, carbohydrates, fiber, minerals, and vitamins, the mulberry fruit holds the status of a third-generation fruit, enjoying a lengthy history of use in traditional Chinese medicine as well as being an edible fruit [2,[7][8][9]. Recent clinical application studies have unveiled different pharmacological '8632' (M. ...
Background: Mulberry (Morus L.), a vital perennial woody plant with significant economic importance, is utilized for silkworm rearing, human consumption and medicinal use. The availability of mulberry’s whole-genome sequencing data has underscored the demand for an effective, user-friendly, and high-throughput protocol to facilitate the elucidation of gene functions. Methods and Results: In this investigation, we established a transient transformation approach using Agrobacterium tumefaciens-mediated sonication followed by vacuum infiltration in mulberry tissue culture seedlings. Simultaneously, we optimized the transformation conditions, including mulberry genotypes, A. tumefaciens strain, acetosyringone concentration, bacterial density, sonication time, and days after agroinfiltration. These optimizations aimed to achieve heightened transformation efficiency, employing GFP as a reporter gene to monitor transformation events. The optimized method included the use of an infiltration medium (10 mM MgCl2, 10 mM MES (2-(N-morpholino)ethanesulfonic acid sodium salt), 150 μM acetosyringone, and OD600 0.5 of A. tumefaciens LBA4404) supplemented with the surfactant 0.02% Silwet L-77, with 20 s sonication followed by 20 min vacuum infiltration (0.07 MPa). Among the four mulberry genotypes, ‘Taiguo’ was the most responsive genotype and produced the highest levels of GFP expression at 7 d after infiltration. Furthermore, the optimized transient transformation approach has been proven to be successfully applicable for transiently overexpressing MaANS and MaDFR in mulberry fruits of ‘Taiguo’, in vitro, which distinctly enhanced fruit coloring and significantly increased anthocyanin accumulation, respectively. Conclusions: In summary, we devised a dependable, stable and highly efficient transient transformation approach suitable for rapid gene function examination in mulberry leaves and fruits, in vitro.
... Desert mulberry is an ecotype of mulberry that has been successfully cultivated in desert areas of China's Xinjiang region. As this ecotype allows mulberry trees to be grown in deserted locations with minimal irrigation, it is recommended for natural restoration of deserted areas and desertified grasslands" [33]. ...
Mulberry is a woody, deciduous tree that is economically important. It is regarded as a distinctive plant on the planet due to its widespread geological distribution across continents, ability to be cultivated in various forms, multiple uses of leaf foliage and positive impact in environmental safety approaches such as ecorestoration of degraded lands, bioremediation of polluted sites, water conservation, soil erosion prevention, and enhancement of air quality through carbon sequestration. Mulberry has a robust root system. Mulberry root systems can significantly improve soil shear strength and anti-erosive capacity. Mulberry plantations are extremely effective in suppressing sand storms and conserving water and soil. The review investigates the role of mulberry trees in carbon sequestration, ecorestoration, soil and water conservation, bioremediation of heavy metals and afforestation.
... Mulberry (Morus alba) is a deciduous tree belonging to the genus Morus in the family Moraceae and has been cultivated in China for centuries due to its economic significance [1]. Its leaves serve as food for silkworms [2], and its fruits can be consumed directly or processed into jam, juice, and desserts [3][4][5][6]. However, mulberry viruses that impact the yield and quality of both mulberry leaves and fruits have been discovered and reported in recent years. ...
In this study, we discovered a new virus named Quanzhou mulberry virus (QMV), which was identified from the leaves of an ancient mulberry tree. This tree is over 1300 years old and is located at Fujian Kaiyuan Temple, a renowned cultural heritage site in China. We obtained the complete genome sequence of QMV using RNA sequencing followed by rapid amplification of complementary DNA ends (RACE). The QMV genome is 9256 nucleotides (nt) long and encodes five open reading frames (ORFs). Its virion was made of icosahedral particles. Phylogenetic analysis suggests that it belongs to the unclassified Riboviria. An infectious clone for QMV was generated and agroinfiltrated into Nicotiana benthamiana and mulberry, resulting in no visible disease symptoms. However, systemic movement of the virus was only observed in mulberry seedlings, suggesting that it has a host-specific pattern of movement. Our findings provide a valuable reference for further studies on QMV and related viruses, contributing to the understanding of viral evolution and biodiversity in mulberry.
... This cultivation pattern has played important roles in water and soil erosion control, collecting rainwater, increasing soil moisture content, and recycling fertilizers. According to an investigation, mulberry interspersed with grass in the back part of the leveled pits can reduce soil erosion in 124.5 t ha -1 increasing moisture content on the soil layer of 50-100 cm from 13% -5% and increasing organic substance content in 3% (Jian et al., 2012). With this respect, a more detailed review of the importance and experience in using mulberry in agriculture can be found in Rodríguez et al. (2022). ...
Background: Soil cover with crop residues is an ancient tradition that is gaining momentum in conservation agriculture´s current trends. Objective: The objective of this research is to evaluate the effect of soil mulching with corn-mulberry on Spodoptera frugiperda management in corn Zea mays variety Tuson after imbibition in vinasse. Methodology: The first part of the experiment evaluates the effect on germination with seed previously soaked in vinasse in 1:15 ratio under controlled conditions for 30 min. The second part was developed in the Unidad Empresarial de Base "Antonio Maceo" Yara, Granma, Cuba under field conditions, which consisted of two treatments: (T1) corn-mulberry soil mulching 2 t ha-1 before planting and (T2) control group without cover. The percentage of maize plants were evaluated from 1 to 3 and from 4 to 5 degrees in damage at 30 days, in addition to agricultural yield at 150 days. Both experimental stages were performed in a randomized complete block design (RCBD). Results: The results showed that germination percentages increased by using 1:15 vinasse, whereas the corn-mulberry soil cover decreased S. frugiperda incidence at the same time and increased agricultural yields. Implications: Future studies should find an equilibrium point that guarantees the use of crop residuals as agroecological practices in soil protection and conservation, as well as in animal feed sources in places and season where natural forage is affected. Conclusion: Soil cover with corn-mulberry mulching from leaf waste before sowing decreases S. frugiperda incidence and corn yield increases.
... nt (Huang et. al., 2012). The extent to which sericulture helps in achieving the entire set of SDGs has not, however, been thoroughly investigated. Through the regulation of environmental restoration, afforestation, carbon sequestration, and soil conservation, existing research has emphasised the significance of mulberry in achieving multiple SDGs (Qin et. al., 2012: Singhal et. al., 2010Zhang et. al., 2018). We specifically identify the actual and potential contributions of sericulture in achieving the SDGs and provide evidence to demonstrate how interconnected mulberry is with its backward and forward linkages from the viewpoint of an integrated system. (Yuan et. al., 2017). We examine the SDGs a ...
The present study attempted to scenario analysis study of sericulture resource which would cover its significance and provide the entire gamut of mulberry silk in order to create appropriate planning and thereby playing a significant role in enhancing GDP of silk dominant regions of the economy. This review study analyses our present knowledge of the current scenario of sericulture sustainability, potential, growth and silk crafts of a silk producing regions with the aim of supporting the regions' sustainable growth and development. It conducts bibliometric analysis of highly cited scientific research publications on sericulture sustainability using the Scopus and web of science databases. We investigate sericulture's contribution in accomplishing UN Sustainable Development Goals, and we claim that a better knowledge of sericulture's contribution to sustainable development is critical for assuring inclusive sustainable regional development.
... The mulberry (Morus alba) belongs to the genus Morus in the family Moraceae, which is a deciduous tree that has been grown for thousands of years in China [5] The leaves of mulberry trees are the only food source for silkworms [6] and also can be converted into mulberry tea [7] and other beverages [8]. Their fruits are rich in nutrients and can be used for preparing fruit juice and wine [9,10]. ...
Viruses-mediated genome editing in plants is a powerful strategy to develop plant cultivars with important and novel agricultural traits. Mulberry alba is an important economic tree species that has been cultivated in China for more than 5000 years. So far, only a few viruses have been identified from mulberry trees, and their application potential is largely unknown. Therefore, mining more virus resources from the mulberry tree can pave the way for the establishment of useful engineering tools. In this study, eight old mulberry plants were gathered in seven geographic areas for virome analysis. Based on transcriptome analysis, we discovered three viruses associated with mulberries: Citrus leaf blotch virus isolate mulberry alba 2 (CLBV-ML2), Mulberry-associated virga-like virus (MaVLV), and Mulberry-associated narna-like virus (MaNLV). The genome of CLBV-ML2 was completely sequenced and exhibited high homology with Citriviruses, considered to be members of the genus Citrivirus, while the genomes of MaVLV and MaNLV were nearly completed lacking the 5′ and 3′ termini sequences. We tentatively consider MaVLV to be members of the family Virgaviridae and MaNLV to be members of the genus Narnavirus based on the results of phylogenetic trees. The infection experiments showed that CLBV-ML2 could be detected in the inoculated seedlings of both N. benthamiana and Morus alba, while MaVLV could only be detected in N. benthamiana. All of the infected seedlings did not show obvious symptoms.
... Morus alba L. is a perennial and fast-growing woody plant of the family Moraceae and genus Morus. It is widely cultivated in China as one of the cash tree species, of which leaves are used as a feed of silkworm, fruit is regarded as delicious food, and trunk can serve as timber (Jian et al., 2012). Besides, Morus is also used as a traditional herb in Asia for treatment of diabetes, rheumatic, arthritis, and various lung diseases, including pulmonary asthma, bronchitis, hemoptysis, and cough (Min et al., 2019). ...
The epidermis is the first layer of cells on leaves that receive UV-B radiation and the place where guard cells distribute. Their stress response mechanism was different from the mesophyll. However, there has been little research on leaf epidermis. To assess the response mechanism of epidermis to UV-B radiation, tissue-specific proteomics were performed on the epidermis of Morus leaf under UV-B radiation and UV-B radiation following dark incubation. A total of 935 proteins were identified and quantified. Changes of proteins involved in light reaction and Calvin cycle were not simultaneous. Antioxidant enzymes showed different patterns. And the contents of H 2 O 2 and Ca 2+ were increased after treatments. A UV-B radiation response mechanism of epidermis was proposed based on these results, in which photosystems perceives the stimulus of UV-B radiation to produce reactive oxygen species, and then the antioxidant system and protein homeostasis system were induced through the Ca 2+ crosstalk with reactive oxygen species signaling pathway.
... To some extent, this is due to strong environmental adaptability of the trees. In recent years, Chinese scientists of sericulture have proposed to expand the application of mulberry in ecological management and in diversified product development [1][2][3]. More and more mulberry trees have been planted in arid and semi-arid areas, especially in the northwestern of China, for ecological restoration [4][5][6]. ...
Mulberry (Morus alba L.) has been an economically important food crop for the domesticated silkworm, Bombyx mori, in China for more than 5000 years. However, little is known about the mechanism underlying mulberry response to environmental stress. In this study, quantitative proteomics was applied to elucidate the molecular mechanism of drought response in mulberry. A total of 604 differentially expressed proteins (DEPs) were identified via LC-MS/MS. The proteomic profiles associated with antioxidant enzymes, especially five glutathione peroxidase (GPX) isoforms, as a scavenger of reactive oxygen species (ROS), were systematically increased in the drought-stressed mulberry. This was further confirmed by gene expression and enzymatic activity. Furthermore, overexpression of the GPX isoforms led to enhancements in both antioxidant system and ROS-scavenging capacity, and greater tolerance to drought stress in transgenic plants. Taken together, these results indicated that GPX-based antioxidant enzymes play an important role in modulating mulberry response to drought stress, and higher levels of GPX can improve drought tolerance through enhancing the capacity of the antioxidant system for ROS scavenging.
... Natural calamities, global warming, disasters such as floods and droughts, abrupt soil erosion, and a high rate of a disease outbreaks are some of the phenomena thought to have direct links to environmental pollution. Mulberry has a number of unique characteristics that have been linked to its ability to reduce pollutants in the environment (Jian et al. 2012). Mulberry plantations, for example, have shown promising outcomes in terms of HAL3a, dehydrin Abiotic stress Das et al. (2013) a AlaBlb soyabean glycine gene; bch-L inhibitor 2-aminobicyclo-(2, 2, 1)-heptane-2-carboxylic acid; COR cold on regulation; GUS β-Glucuronidase; HVA1 Hevea brasiliensis abiotic stress gene; NHX Na+/H+ exchanger; OC osteocalcin; Osmotin osmotic stress-induced gene; SHN 1 schnurri from Drosophila melanogaster; WAP21 water allocation plan improving air quality, boosting water retention capacity, removing heavy metals from polluted soils and the environment, and fostering healthy soil microflora and fauna (Lu et al. 2004;Yao et al. 2004;. ...
This edited book is focusing on the novel and innovative procedures in tissue culture for large-scale production of plantation and horticulture crops. It is bringing out a comprehensive collection of information on commercial-scale tissue culture with the objective of producing high-quality, disease-free and uniform planting material. Developing low-cost commercial tissue culture can be one of the best possible ways to attain the goal of sustainable agriculture. Tissue culture provides a means for rapid clonal propagation of desired cultivars, and a mechanism for somatic hybridization and in vitro selection of novel genotypes. The application of plant tissue culture technology in horticulture and plantation crops provides an efficient method to improve the quality and nutrition of the crops.
This book includes a description of highly efficient, low cost in vitro regeneration protocols of important plantation and horticulture crops with a detailed guideline to establish a commercial plant tissue culture facility including certification, packaging and transportation of plantlets. The book discusses somatic embryogenesis, virus elimination, genetic transformation, protoplast fusion, haploid production, coculture of endophytic fungi, effects of light and ionizing radiation as well as the application of bioreactors.
This book is useful for a wide range of readers such as, academicians, students, research scientists, horticulturists, agriculturists, industrial entrepreneurs, and agro-industry employees.
... Natural calamities, global warming, disasters such as floods and droughts, abrupt soil erosion, and a high rate of a disease outbreaks are some of the phenomena thought to have direct links to environmental pollution. Mulberry has a number of unique characteristics that have been linked to its ability to reduce pollutants in the environment (Jian et al. 2012). Mulberry plantations, for example, have shown promising outcomes in terms of HAL3a, dehydrin Abiotic stress Das et al. (2013) a AlaBlb soyabean glycine gene; bch-L inhibitor 2-aminobicyclo-(2, 2, 1)-heptane-2-carboxylic acid; COR cold on regulation; GUS β-Glucuronidase; HVA1 Hevea brasiliensis abiotic stress gene; NHX Na+/H+ exchanger; OC osteocalcin; Osmotin osmotic stress-induced gene; SHN 1 schnurri from Drosophila melanogaster; WAP21 water allocation plan improving air quality, boosting water retention capacity, removing heavy metals from polluted soils and the environment, and fostering healthy soil microflora and fauna (Lu et al. 2004;Yao et al. 2004;. ...
Explant preference is a key factor for efficient and sustainable plant propagation under in vitro conditions. Plant genotype and structure must be well observed and identified for the best explant which may differ in the axillary bud breakings using terminal buds on stems located above ground or specialized/underground stems such as bulbs scales, base plates of corms, and the shoot tips of suckers. Since plant factory systems are aimed at uniform and cost-effective propagation systems, determination of explant type and culture conditions are the most critical factors for the establishment of shoot multiplication rate. In this chapter, several horticulture plants including house plants (Monstera, Philodendron, Begonia, etc.), and fruit trees (Aronia, banana, walnut, etc.) used in commercial-scale production in plant factories were investigated for the understanding of the nature of explants as per culture conditions. This phenomenon is also highly correlated with effective surface sterilization. Since plant factories rely on an automation system for particular crops, replenishment of starting material in each cloning cycle prevents the emergence of undesirable traits due to the somaclonal variations. This study reports a comparative and in situ analysis of explant choice for the scalable vitro-plant productions.
... The genus Morus L. family of Moruceace also known as mulberry is one of the earliest cultivated woody plants (Jian, Ningjia, Yong, & Zhonghuai, 2013) and had been categorized into 30 species, among which 15 are originally grown in China (Ramesh, Sivaram, & Yogananda, 2014). Morus which are Morus nigra (black mulberry) and Morus rubra (red mulberry) also known to be used in various forms such as syrup, jam, pulp, ice-cream, vinegar, concentrate, alcohol. ...
... Plant external physiological information did not affect the intracellular water status, indicating that the intracellular water metabolism of M. alba of leaves was independent of environmental water metabolism. Because M. alba was an acclimated species for a long time, it had gradually adapted to the shifting environment, and the rapid growth of new leaves was compatible with the activity of continuous leaf picking [3,49]. However, as shown in Table 6, contrary to M. alba, the electrophysiological indices of B. papyrifera were well correlated, except IWHT. ...
Plant electrical signals can quickly respond to the shifting environment. Almost all life activities of plants are dependent on water. The measurement of plant electrophysiological indices provides a more convenient method for studying the intracellular water utilization. In this study, Morus alba L. (Morus alba or M. alba) and Broussonetia papyrifera (L.) Vent. (Broussonetia papyrifera or B. papyrifera) were experimental materials, and the parameters were measured in two habitats (waterfront, well-water and arid slopes, deficient-water). The physiological and electrophysiological responses of leaves to different habitats were analyzed. The theoretically intrinsic relationships between the clamping force and leaf impedance (Z), capacitive reactance (Xc), resistance (R), and inductive reactance (Xl) were revealed as 3-parameter exponential decay and linear models based on bioenergetics, respectively. Leaf intrinsic electrophysiological parameters were successfully obtained by using the above-mentioned relationships and were used to manifest metabolic activity in plants. The intracellular water-holding capacity (IWHC), water use efficiency (IWUE), water-holding time (IWHT), and water transfer rate (WTR) of plant leaves were defined based on the intrinsic electrophysiological parameters and were used to reflect the intracellular water metabolism. The correlation between the physiological and electrophysiological parameters of the two plant species in the two habitats was also analyzed. The results showed that Morus alba continuously adapted to the shifting environment, the intracellular water metabolism was insensitive to soil water shortage and was independent from the external physiological state. The intracellular water metabolism in Broussonetia papyrifera was very sensitive to soil water shortage, and both intracellular water metabolism and immediate physiological parameters could characterize the response of Broussonetia papyrifera growth and development to soil water.
... Recently, more and more studies reported the great phytoremediation potential of mulberry and the safe utilization of Cd polluted soil by sericulture (Zhou et al., 2015;Wan et al., 2017;Feng et al., 2019aFeng et al., , 2019bZeng et al., 2020;Jiang et al., 2021). Mulberry is a perennial woody plant and has various desirable properties, including well-developed root systems, high biomass, widespread distribution, being readily adaptable, and being capable of withstanding pruning (Jian et al., 2012;Jiang et al., 2017). Mulberry leaves are the main feed of silkworms, and the main economic product silk is mainly used in textiles rather than food. ...
Recently, the phytoremediation and safe utilization of cadmium (Cd) polluted soil by mulberry planting and sericulture have attracted researchers' attention. However, the understandings of related molecular mechanisms of mulberry response to Cd are still limited. Meanwhile, there are few reports on the diversity of Cd tolerance and accumulation ability of different mulberry cultivars. Here, we obtained two mulberry cultivars with significant differences in Cd accumulation: high Cd accumulation cultivar FC and low Cd accumulation cultivar G12. Ionomics analysis showed that the distribution pattern of Na is the most similar to that of Cd in both G12 and FC. In transcriptomics analysis, the results of GO and KEGG enrichment analyses showed that cell wall organization-related genes were significantly affected by Cd stress, while cell division-related genes were significantly down-regulated. The expression levels of several Cd-chelation and transporter genes (AGT2, MT2, HIPP26, MTP9 and DTX43/44) were higher in all groups of G12 than those of FC, while the expression level of PCR2 and ABCC2 were higher in all groups of FC than those of G12. In untargeted metabolomics analysis, compared with FC, the metabolites of G12 were less affected by Cd stress in phenylpropanoid, flavonoid and isoflavonoid biosynthesis pathways. Notably, the content of rutin in FC was significantly lower than that of G12. These results provide theoretical support and candidate cultivars for mulberry application in Cd polluted soil, and candidate genes for mulberry genetic modification and molecular breeding in the future.
... Mulberry (Morus spp) is an economically and traditionally very important deciduous plant for the development of sericulture industry. This plant is mainly cultivated to harvest leaves for the rearing of silkworms [1]. The quality mulberry leaf fed to silkworms is the most important factor that influences the successful cocoon production by mulberry silkworm [2]. ...
Nitrogen (N) has potential to improve leaf yield and quality of mulberry plant. However, optimum doses of N for mulberry cultivation have not been updated for long times on the newly developed mulberry varieties in Bangladesh. A study was conducted at the research field and laboratories of Bangladesh Sericulture Research and Training Institute (BSRTI), Rajshahi to determine the nitrogen (N) requirements and optimum age of mulberry plants to get higher leaf yield, better quality of leaves, successful silkworm rearing performance and suppresses of foliar diseases in mulberry plant. The six treatments executed for trials on N requirements of mulberry plants were: N: 0, 80, 160, 240, 320 and 400 kg/ha/yr. The blanket doses of P & K for N trial were fixed as per recommended doses of BSRTI. Research results indicated that the added nutrient elements (N) favored in increasing growth, leaf yield, improving quality of mulberry leaves, suppresses foliar diseases as well as improved silk cocoon productivity. The leaf yield increased with increased rates of N application. The highest leaf yield was 51.88 Mt/ha/yr found in older plants of 6-10 years of age with the application of N @ 400 kg/ha/yr which was 6.57% higher than the maximum average yield of less than 5 years ages of mulberry plant. All the growth and quality parameters of leaves viz: moisture, chlorophyll-a, chlorophyll-b, total sugar, soluble carbohydrate, reducing sugar and crude protein exhibited the best performance with the better silkworm rearing performances viz: wt. of 10 matured larval (g), effective rate of rearing by number, single cocoon wt. (g), single shell wt. (g), SR%, highest filament length (m), rendita and cocoon yield/100 dfls (kg) through the treatment of N400 P150 K100 kg/ha/yr (T5) with four split doses in 6-10 years ages of mulberry plant, where the cocoon productivity was 57.85% greater than the control treatment. Furthermore, the average incidence percentages of leaf spot, tukra and powdery mildew diseases were also reduced for the increasing doses of nitrogen. This study concluded that elevated N enhances mulberry leaf yield, quality, silk cocoon productivity as well as suppresses the foliar diseases incidence of mulberry plant.
... A potential solution to any heavily contaminated site with forage species that bioaccumulate metals could be to dilute the concentrations with the additional of a fodder species to the system, such as mulberry. In addition to being a valuable fodder species (Jian et al., 2012), mulberry is also tolerant of soils contaminated with heavy metals (Jiang et al., 2019(Jiang et al., , 2020(Jiang et al., , 2021 and has been suggested as an alternative cash crop species in contaminated paddy soils in China (Jiang et al., 2020). Mulberry trees are tolerant of contaminated soils and do not bioaccumulate metals in the leaves beyond the MTL levels defined by the NRC, 2006). ...
The growing urban and peri‐urban populations around the world creates strain on food and environmental security. Alleviation of these stressors may be possible by enhancing regional food production and ecosystem services provided by urban and peri‐urban agriculture (UPA). Despite the growing popularity of UPA in the United States, incorporating livestock in these settings is challenging. A review of the literature identified three key barriers to adoption of urban and peri‐urban livestock keeping that have the potential to be ameliorated using agroforestry practices to facilitate integration: animal feed resources, water quality and nutrient cycling, and use of sites contaminated with heavy metals. A discussion focused on the solutions to those barriers resulted in two theoretical silvopasture systems; we propose one for the urban setting and another for the peri‐urban setting. We have determined small‐scale livestock keeping provides a potential strategy to meet the demands of growing urban and peri‐urban environments, but sustainable and effective integration of livestock under these conditions must be considered to mitigate environmental risks associated with urban livestock keeping. Urban silvopasture has the potential to enhance specialty crop and niche food production in these environments. Future research should seek to better understand small‐scale silvopasture at the whole‐system level in a variety of resource contexts and with local species and practices.
... Especially mulberries which have weeping canopy is commonly used in landscape areas ( Figure 14). Mulberry adapts well to various environmental conditions such as biotic and abiotic stress (Jian et al., 2013;Sasmita et al., 2019). Some species are shade resistant and usually grows in coastal areas (Sasmita et al., 2019). ...
... Dried mulberry twigs and branches are used as fuel in place of firewood and therefore reduce the pressure on forest. Mulberry can also be cultivated as inter-crop with numerous plantations and is having diverged ecological adoptability (Qin et al., 2012). As the mulberry plant is a deep-rooted perennial tree, it can be raised in vacant lands, hill slopes and watershed areas which ultimately protect soil erosion. ...
In West Bengal Aleuroclava pentatuberculata (Sundarraj and David), a whitefly,
is a pest causing extensive damage to the mulberry plant. General leaf yield
losses of this plant were estimated as 24%, but in severe cases, leaves become
unfit for silkworm rearing resulting in huge crop losses. The feeding habit of
whitefly, Aleuroclava pentatuberculata (Homoptera: Aleryrodidae) causes depletion
in qualitative and quantitative parameters of mulberry leaves. Protection of
silkworm and its host plants from various kinds of pests, parasites and predators
is a chronic problem in sericulture. Biological control is one of the most effective
means of achieving insect control. While screening the whitefly infested mulberry
leaves, a native predator, Brumoides suturalis (Fabricius) was found to feed on
eggs and nymphal stages of whitefly. Complexities in the behaviour and life
cycle of the natural predator population warrant a special attention for their
use as effective biological control agents in modern sericulture. In this present
investigation, feeding potential of the predator and its larval stages was studied.
The data generated on the feeding efficacy are used in determining the life cycle
stage of the predators which is most effective to keep the pest under control. The
above study provides basic information about the lifecycle, feeding habits of the
male and female adults of Brumoides suturalis (Fabricius) which suggests that
it is a potent predator of the mulberry pest. Further mass multiplication and
field efficacy studies need to be undertaken in order to use Brumoides suturalis
(Fabricius) as a biocontrol agent in sericulture in future.
... Mulberry is regarded as multipurpose plant due to recognition of its role in environmental safety approach, as a medicinal plant and its industrial uses in various sectors [1]. The broad ecological adaptability of mulberry to different environmental conditions such as temperature, water, and soil, and enables it to have multiple ecological protective functions in water and soil conservation, wind resistance and sand consolidation, water source preservation and air refreshment [2]. The health-promoting effect of white mulberry (Morus alba L.) results from the presence of many compounds with biological activity. ...
As an economically important tree species, mulberry (Morus spp.) has exhibited a remarkable tolerance for salinity, drought and heavy metals. However, the precise mechanism of metabolome‐mediated drought adaptation is unclear. In this study, two new mulberry varieties—‘drought‐sensitive guisangyou62 (GSY62) and highly drought‐tolerant guiyou2024 (GY2024)’—after three days (62F or 2024F) and six days (62B or 2024B) of drought–stress conditions were subjected to transcriptome and metabolome analyses. The enrichment analysis demonstrated that the differentially expressed genes (DEGs) were mainly enriched in carbohydrate metabolism, amino acid metabolism, energy metabolism and secondary metabolite biosynthesis under drought–stress conditions. Notably, compared with the CK group (without drought treatment), 60 and 70 DEGs in GY2024 and GSY62 were involved in sucrose and starch biosynthesis, respectively. The genes encoding sucrose phosphate synthase 2 and 4 were downregulated in GY2024, with a lower expression. The genes encoding key enzymes in starch biosynthesis were upregulated in GY2024 and the transcriptional abundance was significantly higher than in GSY62. These results indicated that drought stress reduced sucrose synthesis but accelerated starch synthesis in mulberry.
This study looks at the role of sericulture resources, in increasing the GDP of silk-dominant regions. It examines sericulture sustainability, growth, and silk crafts utilizing Scopus and Web of Science databases. The study underlines the significance of sericulture's contribution to the UN Sustainable Development Goals for inclusive regional growth. For thousands of years, sericulture, or the ancient practice of producing silk, has played an important part in civilizations' socioeconomic and cultural development. This study examines the historical history of sericulture, beginning in China and spreading throughout Asia and Europe, focusing on the cultural exchanges and inventions that affected its expansion. Through an assessment of ancient techniques, the study reveals the inherent sustainability qualities of early sericulture, such as low environmental impact and dependence on natural resources like mulberry trees and silkworms. which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made.
Mulberry, a member of the Moraceae family, is regarded as a special plant because of its wide geographic distribution across continents, its adaptability to different cultivation methods, and the various uses of its leafy foliage. It has several benefits for environmental safety measures like soil erosion prevention, bioremediation of polluted sites, water conservation, and air quality improvement through carbon sequestration. The Mulberry is also employed as a medicinal plant to improve and enhance the quality of human life. The potential antibacterial, anti-inflammatory, antioxidant, antihyperglycemic, anti-cancer, and anti-tyrosinase inhibitory action of mulberry extracts from the leaf, stem, root, and bark have been documented. Mulberries are a great source of nutrients and phytochemicals with potent medicinal properties, making them a highly nourishing food for humans. The mulberry fruit is a key ingredient in many value-added products, such as jams, jellies, wines, and syrups, since it is high in carbohydrates, protein, and dietary fibre. Mulberry leaves are an excellent source for creating of protein-rich food products with built-in antioxidants. Although Mulberry is produced professionally for sericulture in many nations, its potential for use as a human food source is not well known. The review discusses the value of mulberry as a source for various food, cosmetics, beverage, and pharmaceutical industries. All of the crucial mulberry species were compiled in this review article to evaluate it as the perfect plant for ensuring a better future.
Several active biochemical compounds with pharmacological actives have been identified from the leaf, stem, fruit, and root of M. alba and M. nigra. These are given in Tables 7.1 and 7.2. The reports on the M. alba leaves mention about various phytochemicals, notable among these being alkaloids (1-deoxynojirimycin, fagomine) (Taniguchi et al. 1998; Hu et al. 2013), phenols, and polyphenols (flavonoids, quercetin, isoquercitrin, rutin, kaempferide, neochlorogenic acid, cryptochlorogenic acid, chlorogenic acid isomer, kaempferol-3-O-(6-malonyl)-glucoside, quercetin-3-O-(6-malonyl)-glucoside, quercetin-3-O-glucoside, quercetin-3,7-O-β-glucopyranoside, quercetin-rutinoside isomer, kaempferol-3,7-glucopyranoside, quercetin-3-O-6″-O-acetyl-β-glucopyranoside, and kaempferol-3-O-6″-O-acetyl-β-glucopyranoside) (Memon et al. 2010; Thabti et al. 2012; Eva et al. 2015).
The perennial trees or shrubs belonging to the genus Morus (mulberry) are economically important and widely distributed in different ecological and geographical areas, being intensively cultivated in temperate, subtropical, as well as tropical areas. They are also found to show natural occurrence in forests all over the world. This indicates that mulberry shows high degree of morphological and physiological buffering to the environmental changes (Hashemi and Khadivi 2020).
Mulberry plants are widely recognized for centuries as a food plant for mori silkworm (Bombyx mori L.) in order to produce the mori silk (Datta 2000; Vijayan 2010; Vijayan et al. 2011). Monophagous silkworm larvae utilize high moisture and biochemical contents of mulberry leaf and produce quality cocoons which have been and are utilized in making high-quality commercial silk products (Absar et al. 2005). There is high correlation between content of protein in mulberry leaves and quality of cocoon produced (Machii et al. 2002). Mulberry leaf proteins are mainly composed of amino acids like valine, histidine, glycine, threonine, phenylalanine, tryptophan, methionine, leucine, lysine, and arginine (Coto 1996; Chan et al. 2016; Rohela et al. 2020). These amino acids are required for the growth of silkworm larvae and for production of silk proteins (seresin and fibroin) of cocoon and overall for quality cocoon production (Chan et al. 2016).
Background
Mulberry (Morus spp.) is an economically important woody plant, which has been used for sericulture (silk farming) for thousands of years. The genetic background of mulberry is complex due to polyploidy and frequent hybridization events.
Results
Comparative genomic in situ hybridization (cGISH) and self-GISH were performed to illustrate the chromosome constitution and genetic relationships of 40 mulberry accessions belonging to 12 species and three varietas in the Morus genus and containing eight different ploidy levels. We identified six homozygous cGISH signal patterns and one heterozygous cGISH signal pattern using four genomic DNA probes. Using cGISH and self-GISH data, we defined five mulberry sections (Notabilis, Nigra, Wittiorum, and Cathayana, all contained only one species; and Alba, which contained seven closely related species and three varietas, was further divided into two subsections) and proposed the genetic relationships among them. Differential cGISH signal patterns detected in section Alba allowed us to refine the genetic relationships among the closely related members of this section.
Conclusions
We propose that GISH is an efficient tool to investigate the chromosome constitution and genetic relationships in mulberry. The results obtained here can be used to guide outbreeding of heterozygous perennial crops like mulberry.
Drought stress often leads to heavy losses in mulberry planting, especially for fruits and leaves. Application of plant growth-promoting fungi (PGPF) endows various plant beneficial traits to overcome adverse environmental conditions, but little is known about the effects on mulberry under drought stress. In the present study, we isolated 64 fungi from well-growing mulberry trees surviving periodical drought stress, and Talaromyces sp. GS1, Pseudeurotium sp. GRs12, Penicillium sp. GR19, and Trichoderma sp. GR21 were screened out due to their strong potential in plant growth promotion. Co-cultivation assay revealed that PGPF stimulated mulberry growth, exhibiting increased biomass and length of stems and roots. Exogenous application of PGPF could alter fungal community structures in the rhizosphere soils, wherein Talaromyces was obviously enhanced after inoculation of Talaromyces sp. GS1, and Peziza was increased in the other treatments. Moreover, PGPF could promote iron and phosphorus absorption of mulberry as well. Additionally, the mixed suspensions of PGPF induced the production of catalase, soluble sugar, and chlorophyll, which in turn enhanced the drought tolerance of mulberry and accelerated their growth recovery after drought. Collectively, these findings might provide new insights into improving mulberry drought tolerance and further boosting mulberry fruit yields by exploiting interactions between hosts and PGPF.
Soil is the most important carbon pool of the mulberry plantation ecosystem, so understanding the characteristics of the soil carbon pool in mulberry plantations provides an important basis for the research of carbon sinks in economic forest ecosystems and farmland ecosystems. In order to explore the spatial differentiation pattern of the relationship between carbon and nitrogen in mulberry plantation soil, this study analyzed the organic carbon content and total nitrogen content of the surface soil layer (020 cm) and the subsurface soil layer (2040 cm) of 475 mulberry plantations in five major regions of China, Southwest China (SWC), Central South China (CSC), East China (EC), North China (NC), and Northwest China (NWC). The research showed seven key aspects of this system. (1) The soil organic carbon of mulberry plantations was significantly different at the two soil depths. The average content of organic carbon in the surface layer of mulberry plantation soil was 10.717.01g kg1, which was 37.13% higher than that of the subsurface layer. (2) The soil organic carbon of mulberry plantations had significant differences in spatial differentiation, which was manifested as SWC>CSC>EC>NC>NWC. (3) The total nitrogen content in mulberry plantation soil had significant responses to the region, the soil layer depth, and the interaction between the region and soil layer depth. Among the regions, NWC had no significant difference between the surface layer and subsurface layer of the soil. EC had the maximum difference in total nitrogen content, with the total nitrogen content in the surface soil layer being 56.68% higher than that of the subsurface soil layer. The total nitrogen contents of the surface soil layers in the SWC and NC were 34.27% and 20.79% higher than those of the respective subsurface soil layers. (4) The mulberry plantation soil C/N ratios had a significant response to regional differences, as NWC>SWC> EC>CSC>NC, but this ratio had no significant response to soil depth. (5) Soil pH had significant spatial differentiation in relation to soil organic carbon and total nitrogen content in mulberry plantations. NWC had no significant correlation between pH and organic carbon or total nitrogen content, while CSC had a significant positive correlation between pH and both soil organic carbon and total nitrogen content. Other regions showed significant negative correlations between pH and both organic carbon and total nitrogen content. (6) There was a significant negative correlation between the C/N ratio of the surface soil layer and pH in mulberry plantations, which was mainly contributed by SWC, while the other regions' surface soil layers had no significant correlations between C/N ratio and pH. (7) There was no significant correlation between the C/N ratio and pH in the subsurface soil layer in mulberry plantations. These results reveal that in either the research on mulberry plantation carbon pools or the innovation of green and low-carbon planting technology in mulberry plantations, the spatial differentiation characteristics of soil must be considered. Furthermore, the spatial differentiation of soil organic carbon can be used as the basic foundation for the planning and design of mulberry afforestation or ecological restoration projects.
Mulberry (Morus sp.) is one of the economically important plants across many countries having numerous attributes of sustainable development. Mostly, it is cultivated for the sericulture industry, an agro-based cottage domain that supports the upliftment of the rural economy. The leaf foliage of such hardy, woody, perennial tree species of Morus is used for silkworm feeding for better and optimum production of commercial raw silk. However, mulberry crop improvement through modern biotechnological approaches over conventional breeding methods plays a significant role in the production of qualitative and quantitative leaf foliage within a short period of time for commercial purposes. Development of biotic and abiotic stress-tolerant mulberry varieties under various environmental conditions, biotechnological tools such as micropropagation of hard to root genotypes, in vitro tissue culture, callus culture, protoplast fusion, marker-assisted selection, and genetic engineering made a successful contribution towards optimum foliage production followed by healthy economy return. Apart from silkworm feed, mulberry is also being exploited by pharmaceutical, cosmetic, food, and beverage industries along with its utilization in environmental safety approach. Considering all the important characteristics of mulberry, it had established as an ideal crop plant in providing sustainable future and economic growth.KeywordsCrop improvementIn vitro propagationMorus speciesSustainable developmentRural economy
For centuries, civilizations across the world have utilized tree berry florae in various capacities from stimulating economic growth, improving agricultural practices, to improving health and nutrition. More recently, tree berry fruits have gained mainstream popularity through celebrity endorsements and are often referred to as a superfood, in part, due to their polyphenol content. Polyphenols are bioactive compounds produced exclusively in plants when they undergo stress (Manach et al., 2004). They are most known for their antioxidant capacity but have also been shown to have a wide range of beneficial health effects. This chapter will focus on açaí, amla, and mulberry, which are tree berries that possess great antioxidant capacity and health benefits.KeywordsAçaíAmlaMulberrySuperfoodsPolyphenolsBioactivesAntioxidantsPolysaccharidesCardio-protectiveAntidiabetic effects
Mulberry (Morus spp.) is an important horticultural plant in the sericulture industry. It belongs to the family Moraceae. The leaf of mulberry is used to feed the silkworm Bombyx mori L. It is also used as a fodder. Due to its economic and agricultural importance, mulberry is cultivated in many parts of the world. An estimated 60% of the total cost of silk cocoon production is for production and maintenance of mulberry plants. Therefore, much attention is needed to improve the quality and quantity of mulberry leaves. It is vital to increase the production of superior quality mulberry leaves with high nutritive value for the sericulture industry.
Although a lot of research is going on in mulberry, very little effort has been made to compile the results of this research in a single book. This book provides an update of recent research works going on in this plant. It describes the taxonomy, conservation of germplasm, genetic diversity of various mulberry species, application of breeding techniques to improve the quality of mulberry, in vitro conservation, application of tissue culture techniques to improve mulberry species, production of haploids and triploids in mulberry and improvement of abiotic stress adaptive traits in mulberry with relevance to adaptiveness to global warming
Acid rain, which has negative impacts on the vegetation of ecological systems, is widespread in Northern and Southern China. However, relatively little is known about the effects of acid rain on the growth and yield of economically important tree species in China. To address this issue, we studied the responses of mulberry seedlings to simulated acid rain (SAR) at different pH values. At pH 4.5, SAR induced increased antioxidant activities, total antioxidant capacity, and the accumulation of reactive oxygen species (OFR) relative to controls. However, the growth of the seedlings under SAR treatments at pH 4.5 and pH 5.6 was greater than controls. No significant differences in photosynthesis and chlorophyll a fluorescence quenching parameters were observed between the SAR treatments at pH 4.5 and pH 5.6 and controls. However, the SAR treatment at pH 3.5 resulted in altered leaf surface characteristics and changes to chloroplast ultrastructure, together with an increase in membrane electrical conductivity and an accumulation of OFR and malondialdehyde. In contrast, and leaf antioxidant enzyme activities were decreased, together with electron transport parameters and photosynthesis. Taken together, these results show that the effects of acid rain on the growth and leaf physiology of mulberry seedling are dependent on pH. Moreover, mulberry seedlings had a high tolerance to acid rain at pH 4.5.
This article is protected by copyright. All rights reserved.
Mulberries (Morus spp., family Moraceae) are economically important deciduous woody plants. Their leaves are food for silkworms, and both the fruits and leaves have nutritional and medicinal values (Qin et al. 2012). The plants are widely distributed globally and have been cultivated in China for more than 5,000 years (Xie et al. 2014). In April 2019, virus-like symptoms of chlorotic leaf spots and, occasionally witches' broom were observed in trees of white mulberry (M. alba) in Shapingba district of Chongqing province. To investigate if any potential viral agent is associated with the symptoms, total RNA was extracted from leaves of one symptomatic tree using an RNAprep Pure Plant Plus Kit (TianGen, China). Ribosomal RNAs were depleted using a TruSeq RNA Sample Prep Kit (Illumina, USA), and the depleted RNA was used for construction of a cDNA library for sequencing using an Illumina HiSeq X-ten platform with pair-ended reads length layout 150 bp. Adaptors, low-quality reads and mulberry genomes-derived reads (He et al. 2013) were removed from a total of 25,433,798 reads using the CLC Genomics Workbench 11 (Qiagen, USA) and the clean reads of 936,562 were subjected to de novo assembly that generated 4,278 contigs (200-3,862 bp). These sequences were annotated by Blastx searches to local Viruses_NR and viroid datasets downloaded from GenBank. Finally, except three contigs (3,862 nt, 1,950 nt, and 1,179 nt) with 81.4-90% nucleotide sequence identities to citrus leaf blotch virus (CLBV, genus Citrivirus, family Betaflexiviridae), no other contigs were identified as viral-related. Total clean reads of 113,185 were mapped to the viral contigs with average coverage depth of 1,915, suggesting the presence of CLBV in the symptomatic tree. To recover the complete genome of CLBV, overlapping fragments were amplified by RT-PCR using virus-specific primer pairs. The 5' and 3' termini were determined by rapid amplification of cDNA ends (RACE kit, Invitrogen, USA). Five clones per amplicon were sequenced in two directions (Cao et al. 2018). The complete genome of the mulberry strain of CLBV (CLBV-ML, GenBank accession no. MT767171) is 8,776 nucleotides (nt) in length, excluding the poly (A) tail. CLBV-ML is similar to extant CLBV isolates in genome structure. BLASTn analysis showed that CLBV-ML had highest nucleotide sequence identities of 79.65-81.56% with Actinidia isolates (Liu et al. 2019) of CLBV at the whole genome. Phylogenetic analysis also placed it with the Actinidia isolates, indicating they are closely related. Thus, CLBV-ML is a highly divergent strain of CLBV. To study the occurrence of CLBV-ML, a total of 62 mulberry samples (42 with similar symptoms and 20 without symptoms) were randomly collected from Shapingba and tested by conventional RT-PCR using an isolate-specific primer pair (CLBV-F7182: ACCAATGACAATGCCACA; CLBV-R7857: TTATGAAACTCTTCCCACTT) designed in the CP gene to amplify a 676 bp fragment. The virus was detected in 37 symptomatic trees (88%) and 2 (10%) asymptomatic trees, suggesting the association of CLBV-ML with the symptoms. To the best of our knowledge, this is the first report of CLBV infection in mulberry which expands the host range of CBLV.
ResearchGate has not been able to resolve any references for this publication.