Content uploaded by Hasnain Hussain
Author content
All content in this area was uploaded by Hasnain Hussain on Aug 10, 2015
Content may be subject to copyright.
Borneo Journal of Resource Science and Technology (2013) 3(2): 36-39
SHORT COMMUNICATION
Preliminary Gene Characterization of α-Amylase from Bacillus
amyloliquefaciens UMAS 1002
MUHAMMAD SUHAIB MAT HUSSIN
1
, MOHD HASNAIN HUSSAIN*
1
, AWANG
AHMAD SALLEHIN AWANG HUSAINI
2
, KOPLI BUJANG
2
, DAYANG SALWANI AWG
ADENI
2
& MOHD AZIB SALLEH
2
1
Proteomics Laboratory,
2
Department of Molecular Biology, Faculty of Resource Science and
Technology, Universiti Malaysia Sarawak, 94300 Kota Samarahan, Sarawak, Malaysia
ABSTRACT
Characterization of α-amylase gene sequence produced by Bacillus amyloliquefaciens UMAS 1002, a
cellulolytic and amylolytic bacilli isolated from sago pith waste is described here. The amyE gene encoding the
α-amylase was isolated by polymerase chain reaction. The 1,980 bp of amyE gene corresponding to 660 amino
acids showed 99% homology to the α-amylase sequence from Bacillus subtilis X-23 (GenBank: BAA31528).
The α-amylase sequence of B. amyloliquefaciens UMAS 1002 (GenBank: KC800929) differs from that of B.
subtilis X-23 by 5 amino acids. In silico analysis of α-amylase from B. amyloliquefaciens UMAS 1002 showed
similar characteristics compared to α-amylase from B. subtilis X-23.
Keywords: Bacillus amyliquefaciens, starch degrading, amylase, in silico, sago waste
Starch is among the most abundant
polysaccharides on earth and a very important
source of energy for most organisms (van der
Maarel et al., 2002). However, for starch to be
transformed into usable energy it needs to be
hydrolyzed to its monomer, i.e. glucose.
Enzymes responsible for this action are the
starch-degrading enzymes. Among them is α-
amylase (EC 3.2.1.1). This enzyme catalyses
random hydrolysis of α-1,4-glycosidic linkages
in starch polymers, thus suitable for conversion
of starch into glucose, dextrins and limit
dextrins. Different amylases have a large
number of different substrate specificities in
addition to a huge variation in optimal
temperature and pH (Pandey et al., 2000). In
biotechnological application, this enzyme is of
great importance for use in various industries
such as food, fermentation, textile and paper
production (Pandey et al., 2000). For industrial
application, generally these amylases are
derived from animal and microbes.
Amylase group of enzymes are commonly
found in eubacteria and eukaryotes. Bacterial
amylases especially from Bacillus, and fungal
amylases have a widespread use in industry
because of the ease of manipulation for the type
of work they are involved in (Svensson &
Søgaard, 1992). In general, bacterial α-
amylases have been grouped into two; for
saccharification and liquefaction of soluble
starch (Gangadharan et al., 2009; Matsuzaki et
al., 1974; van der Maarel et al., 2002). The α-
amylases from B. amyloliquefaciens, B.
licheniformis and B. stearothermophilus belong
to the liquefaction group of α-amylase. B.
amyloliquefaciens is one of the most
extensively studied among all of the Bacillus
species due to its ability to secrete amylase at
relatively high concentrations (Gangadharan et
al., 2009; Priest, 1977). A previous study of B.
amyloliquefaciens UMAS 1002 showed an
interesting capability to degrade starch as well
as cellulose (Apun et al., 2000). This unique
characteristic of dual enzyme capability has not
been described elsewhere before, although it is
common to find description of either amylase
(Demirkan et al., 2005) or cellulase (Singh et
al., 2013) in a single strain. In this study, the
nucleotide sequence of α-amylase from B.
amyloliquefaciens UMAS 1002 is described for
the first time.
*Corresponding author: hhasnain@frst.unimas.my
PRELIMINARY GENE CHARACTERIZATION OF Α-AMYLASE FROM BACILLUS AMYLOLIQUEFACIENS UMAS 1002
37
B. amyloliquefaciens UMAS 1002 used in
this study was originally isolated from sago
pith waste (Apun et al., 2000). The inoculum
was revived from glycerol stock stored at -
80
o
C, and grown in Luria–Bertani (LB) broth
medium consisting of (g/l): peptone, 10.0;
yeast extract, 5.0; NaCl, 5.0. For the growth
medium used for α-amylase production,
inoculum was grown in the medium consisting
of (g/l): 5.0; soluble starch, 15.0; yeast extract,
1; MgSO
4
, 2.0; KH
2
PO
4
. The pH of the
medium was adjusted to 6.0. Following this,
the media were autoclaved at 120
o
C for 20 min.
Bacterial culture was grown in 100 ml of
growth medium in 250 ml conical flasks at
40
o
C. Incubation was carried out with agitation
at 180 rpm for 12 h. The bacterial culture was
harvested by centrifugation for use in further
analysis.
Genomic DNA was extracted from B.
amyloliquefaciens UMAS 1002 cells and
purified according to Sambrook et al. (1989).
Two oligonucleotide primers were synthesized
based on the α-amylase genes of B.
amyloliquefaciens FZB42 (GenBank:
YP001419958) (Chen et al., 2009). These were
used for amplification and determination of the
α-amylase gene sequence (amyE) of B.
amyloliquefaciens UMAS 1002. The complete
sequence of amyE was amplified using
upstream primer designated as FZ Forward (5’-
ATGTTTGAAAAACGATTCAAAACCTCTT
TACTG-3’) and the downstream primer FZ
Reverse (5’-TTAATGCGGAAGATAACCAT
TCAAACC-3’) resulting in a fragment of
approximately 2.0 kb. Amplification of DNA
was carried out using a PCR thermocycler in
the following condition: 34 cycles of 94
o
C for 1
min, 65
o
C for 1 min 30 s and 72
o
C for 1 min.
The PCR products were analyzed on agarose
gel and purified. It was later cloned in E. coli
JM109 and sent for automated double-stranded
DNA sequencing service (Research Biolabs
Technologies, Singapore).
The nucleotide sequence of the amyE gene
and the deduced primary structure of the
protein encoded by this gene are shown in
Figure 1. Analysis of the nucleotide sequence
of amyE gene and its flanking DNA regions
showed an open reading frame (ORF) with the
size of 1,980 bp, starting with an ATG codon at
nucleotide position 1 and terminating with a
TAA stop codon at the position 1,980. This is
similar to the α-amylase gene from B. subtilis
X-23 (Chen et al., 2009) and B.
amyloliquefaciens FZB42 (Ohdan et al., 1999),
with the size of 1,979 bp and 1,980 bp
respectively. Analysis of the ORF revealed a
codon usage typical of B. amyloliquefaciens
with a G + C content in the amyE gene of
46.21%, which is very close to the values
reported for choromosomal DNA of other B.
amyloliquefaciens (Welker & Campbell, 1967).
The nucleotide sequence of the amyE gene
from B. amyloliquefaciens UMAS 1002
(GenBank: KC800929) showed 98% and 96%
homology with the α-amylase gene from B.
subtilis X-23 (GenBank: AB015592) and B.
amyloliquefaciens FZB42 (GenBank:
CP000560), respectively. The amino acid
sequence deduced from the nucleotide
sequence contained 660 amino acids with a
calculated molecular weight of 72.281 kDa.
The size is similar to the molecular weight of
α-amylase from B. subtilis X-23, which is
72.280 kDa. In silico analysis of polypeptide
sequence of both α-amylases showed that
although the size is very similar, they have
different isoelectric point (pI). The pI of α-
amylase from B. subtilis X-23 is 6.0 while the
pI for α-amylase from B. amyloliquefaciens
UMAS 1002 is 5.63. Difference in the pI is due
to changes in various parameters such as
number of positively- and negatively-charged
amino acid residues, number of amino acids
and molecular weight of the enzymes (Panda &
Chandra, 2012). Analysis of the charge of
protein at pH 7.0 also showed differences
between these α-amylases. For α-amylase from
B. subtilis X-23, the charge at pH 7.0 is -9.4
while for α-amylase from B. amyloliquefaciens
UMAS 1002, the charge at pH 7.0 is -14.2.
From this research work, we were able to
isolate and characterize the α-amylase gene of
B. amyloliquefaciens UMAS 1002. Based on
this study, the gene will be used for future work
on optimizing the conditions for recombinant
enzyme production in an expression host. Even
more interesting is this new knowledge on B.
amyloliquefaciens UMAS 1002 α-amylase and
cellulase would provide great potential for
protein engineering which can increase the
enzyme efficiency and stability at extreme pH
38 HUSSIN et al. 2013
and temperature. Future work will include
heterologous expression of α-amylase and
characterization of cellulase gene and enzyme
from B. amyloliquefaciens UMAS 1002.
ACKNOWLEDGEMENTS
The authors thank the Ministry of Higher
Education for funding this research through
FRGS Grant 01(08)/657/2007(22).
Figure 1. Nucleotide sequence of amyE gene (GenBank: KC800929) and deduced amino acid sequence of the
a-amylase of B. amyloliquefaciens UMAS 1002. Numbers on the right side of the amino acid and nucleotide
sequences represent amino acid and nucleotide positions, respectively. Position 1 indicates start codon and
asterisk (*) indicates a stop codon.
PRELIMINARY GENE CHARACTERIZATION OF Α-AMYLASE FROM BACILLUS AMYLOLIQUEFACIENS UMAS 1002
39
REFERENCES
Apun, K., Jong, B.C., & Salleh, M.A. (2000).
Screening and isolation of a cellulolytic and
amylolytic Bacillus from sago pit waste.
Journal of General and Applied
Microbiology, 46: 263-267.
Chen, X.H., Koumoutsi, A., Scholz, R.,
Schneider, K., Vater, J., Süssmuth, R., Piel,
J., & Borriss, R. (2009). Genome analysis
of Bacillus amyloliquefaciens FZB42
reveals its potential for biocontrol of plant
pathogens. Journal of Biotechnology, 140:
27-37.
Demirkan, E.S., Mikami, B., Adachi, M.,
Higasa, T., & Utsumi, S. (2005). α-
Amylase from B. amyloliquefaciens:
purification, characterization, raw starch
degradation and expression in E. coli.
Process Biochemistry, 40(8): 2629-2636.
Gangadharan, D., Nampoothiri, K.M.,
Sivaramakrishnan, S., & Pandey, A. (2009).
Biochemical characterization of raw-starch-
digesting alpha amylase purified from
Bacillus amyloliquefaciens. Applied
Biochemistry and Biotechnology, 158(3):
653-662.
Matsuzaki, H., Yamane, K., Yamaguchi, K.,
Nagata, Y., & Maruo, B. (1974). Hybrid α-
amylases produced by transformants of
Bacillus subtilis. I. Purification and
characterization of extracellular α-amylases
produced by the parental strains and
transformants. Biochimica et Biophysica
Acta (BBA) - Protein Structure, 365: 235-
247.
Ohdan, K., Kuriki, T., Kaneko, H., Shimada, J.,
Takada, T., Fujimoto, Z., Mizuno, H., &
Okada, S. (1999). Characteristics of two
forms of alpha-amylases and structural
implication. Applied and Environmental
Microbiology, 65: 4652-4658.
Panda, S. & Chandra, G. (2012).
Physicochemical characterization and
functional analysis of some snake venom
toxin proteins and related non-toxin
proteins of other chordates. Bioinformation,
8(18): 891.
Pandey, A., Nigam, P., Soccol, C.R., Soccol,
V.T., Singh, D., & Mohan, R. (2000).
Advances in microbial amylases.
Biotechnology and Applied Biochemistry,
31: 135-152.
Priest, F.G. (1977). Extracellular enzyme
synthesis in the genus Bacillus.
Bacteriological Reviews, 41: 711-753.
Sambrook, J., Fritsch, E.F., & Maniatis, T.
(1989). Molecular Cloning: A Laboratory
Manual. 3
rd
Edition. J. Argentine (Ed). New
York: Cold Spring Harbor Press.
Singh, S., Moholkar, V.S., & Goyal, A. (2013).
Isolation, identification, and
characterization of a cellulolytic Bacillus
amyloliquefaciens strain SS35 from
rhinoceros dung. ISRN Microbiology, 2013:
Article ID 728134.
Svensson, B. & Søgaard, M. (1992). Protein
engineering of amylases. Biochemical
Society Transactions, 20(1): 34-42.
van der Maarel, M.J.E.C., Van-der-Veen, B.,
Uitdehaag, J.C.M., Leemhuis, H., &
Dijkhuizen, L. (2002). Properties and
application of starch converting enzymes of
the α-amylases family. Journal of
Biotechnology, 94: 137-155.
Welker, N.E. & Campbell, L.L. (1967).
Unrelatedness of Bacillus
amyloliquefaciens and Bacillus subtilis.
Journal of Bacteriology, 94: 1124-1130.
