ArticlePDF Available

Laying the foundations of evolutionary and systematic studies in crickets (Insecta, Orthoptera): A multilocus phylogenetic analysis

July 2015
Cladistics 32(early view online)

DOI:10.1111/cla.12114

Authors:

Ioana-Cristina Chintauan-Marquier

Muséum National d'Histoire Naturelle

Frédéric Legendre

Muséum National d'Histoire Naturelle

Sylvain Hugel

French National Centre for Scientific Research

Tony Robillard

Muséum National d'Histoire Naturelle

Show all 8 authorsHide

Orthoptera have been used for decades for numerous evolutionary questions but several of its constituent groups, notably crickets, still suffer from a lack of a robust phylogenetic hypothesis. We propose the first phylogenetic hypothesis for the evolution of crickets sensu lato, based on analysis of 205 species, representing 88% of the subfamilies and 71% tribes currently listed in the database Orthoptera Species File (OSF). We reconstructed parsimony, maximum likelihood and Bayesian phylogenies using fragments of 18S, 28SA, 28SD, H3, 12S, 16S, and cytb (~3600 bp). Our results support the monophyly of the cricket clade, and its subdivision into two clades: mole crickets and ant-loving crickets on the one hand, and all the other crickets on the other (i.e. crickets sensu stricto). Crickets sensu stricto form seven monophyletic clades, which support part of the OSF families, “subfamily groups”, or subfamilies: the mole crickets (OSF Gryllotalpidae), the scaly crickets (OSF Mogoplistidae), and the true crickets (OSF Gryllidae) are recovered as monophyletic. Among the 22 sampled subfamilies, only six are monophyletic: Gryllotalpinae, Trigonidiinae, Pteroplistinae, Euscyrtinae, Oecanthinae, and Phaloriinae. Most of the 37 tribes sampled are para- or polyphyletic. We propose the best-supported clades as backbones for future definitions of familial groups, validating some taxonomic hypotheses proposed in the past. These clades fit variously with the morphological characters used today to identify crickets. Our study emphasizes the utility of a classificatory system that accommodates diagnostic characters and monophyletic units of evolution. Moreover, the phylogenetic hypotheses proposed by the present study open new perspectives for further evolutionary research, especially on acoustic communication and biogeography.

Taxonomic sampling used in this study, with taxonomic assignment according to the internet database Orthoptera Species File

…

Specimens use for molecular analysis, with voucher data and GenBank accession numbers (sequences generated for this study are in bold)

…

Continued)

…

Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference: detailed topology for clade C (see ). Support values as in .

…

Figures - uploaded by Laure Desutter-Grandcolas

Content may be subject to copyright.

Content uploaded by Laure Desutter-Grandcolas

Content may be subject to copyright.

Laying the foundations of evolutionary and systematic studies in

crickets (Insecta, Orthoptera): a multilocus phylogenetic analysis

Ioana C. Chintauan-Marquier

a,†

,Fr



ed

eric Legendre

a,†

, Sylvain Hugel

Tony Robillard

, Philippe Grandcolas

, Andr

e Nel

, Dario Zuccon

and

Laure Desutter-Grandcolas

Institut de Syst

ematique, Evolution, Biodiversit

e, ISYEB - UMR 7205 CNRS, UPMC, EPHE, Mus

eum national d’Histoire naturelle, Sorbonne

Universit

es, CP 50, 45, rue Buffon, Paris 75005, France;

INCI, UPR3212 CNRS, Universit

e de Strasbourg, 21, rue Ren

e Descartes, Strasbourg

F-67084, France;

Service de Syst

ematique Mol

eculaire, UMS2700 MNHN-CNRS, D

epartement Syst

ematique et Evolution, Mus

eum national

d’Histoire naturelle, Paris Cedex 05, France

Accepted 27 January 2015

Abstract

Orthoptera have been used for decades for numerous evolutionary questions but several of its constituent groups, notably

crickets, still suffer from a lack of a robust phylogenetic hypothesis. We propose the ﬁrst phylogenetic hypothesis for the evolu-

tion of crickets sensu lato, based on analysis of 205 species, representing 88% of the subfamilies and 71% tribes currently listed

in the database Orthoptera Species File (OSF). We reconstructed parsimony, maximum likelihood and Bayesian phylogenies

using fragments of 18S, 28SA, 28SD, H3, 12S, 16S, and cytb (~3600 bp). Our results support the monophyly of the cricket

clade, and its subdivision into two clades: mole crickets and ant-loving crickets on the one hand, and all the other crickets on

the other (i.e. crickets sensu stricto). Crickets sensu stricto form seven monophyletic clades, which support part of the OSF fami-

lies, “subfamily groups”, or subfamilies: the mole crickets (OSF Gryllotalpidae), the scaly crickets (OSF Mogoplistidae), and the

true crickets (OSF Gryllidae) are recovered as monophyletic. Among the 22 sampled subfamilies, only six are monophyletic:

Gryllotalpinae, Trigonidiinae, Pteroplistinae, Euscyrtinae, Oecanthinae, and Phaloriinae. Most of the 37 tribes sampled are para-

or polyphyletic. We propose the best-supported clades as backbones for future deﬁnitions of familial groups, validating some

taxonomic hypotheses proposed in the past. These clades ﬁt variously with the morphological characters used today to identify

crickets. Our study emphasizes the utility of a classiﬁcatory system that accommodates diagnostic characters and monophyletic

units of evolution. Moreover, the phylogenetic hypotheses proposed by the present study open new perspectives for further evo-

lutionary research, especially on acoustic communication and biogeography.

©The Willi Hennig Society 2015.

Introduction

For more than 30 years now, phylogenetics has

become the reference system in a tree-thinking perspec-

tive for evolutionary biology (Eldredge and Cracraft,

1980; Carpenter, 1989; Brooks and McLennan, 1991,

2002; O’Hara, 1992; Larsen and Losos, 1996). Phylo-

genetic trees are currently used to propose and test

evolutionary hypotheses in all domains where evolu-

tion may interplay with systems studied. As a conse-

quence, phylogenies have also become the backbone of

modern classiﬁcations. Both ﬁelds of application are

important and require robust phylogenetic hypotheses

based on relevant and broad taxonomic sampling.

Studies on orthopteran insects have investigated

many important aspects of animal behaviour, from the

neural basis of behaviour to the ecology of acoustic

communication (Gwynne and Morris, 1983; Huber

et al., 1989; Bailey and Rentz, 1990; Field, 2001;

Gwynne, 2001). However, the lack of phylogenetic

*Corresponding author:

E-mail address: desutter@mnhn.fr

†

Both authors contributed equally to this work.

Cladistics

Cladistics 32 (2016) 54–81

10.1111/cla.12114

©The Willi Hennig Society 2015

foundation has made it difﬁcult to interpret the results

of these studies in an evolutionary or comparative

framework. In the past, taxonomy has been used as a

proxy for phylogeny, with hypotheses of “lower” (i.e.

“primitive”) and “higher” taxa, and varied assump-

tions about “ancestral” character states and evolution-

ary series (Baccetti, 1987; Bailey, 1991; Otte, 1992;

Field, 1993). This applies also to the numerous, and

frequently well preserve, orthopteran fossils, which are

currently not classiﬁed in a satisfactory, phylogenetic

manner, resulting in a majority of fossil families and

subfamilies not correctly deﬁned on the basis of clear

synapomorphies. Only one preliminary cladistic analy-

sis was made on the basis of the forewing venation

(B

ethoux and Nel, 2002), but it would need signiﬁcant

improvement by the addition of the numerous fossil

taxa more recently described and a better comparison

with the recent taxa.

Earlier attempts to reconstruct the molecular phy-

logeny of Orthoptera and their suborders took into

account too few taxa and markers to achieve any sta-

bility and robustness (Flook and Rowell, 1997a, 1998;

Rowell and Flook, 1998; Flook et al., 1999; Jost and

Shaw, 2006), as shown in Legendre et al. (2010) for

Ensifera, and most published phylogenies have been

performed at a limited taxonomic scale (Chapco et al.,

2001; Litzenberger and Chapco, 2001; Bugrov et al.,

2006; references in Heller, 2006; Allegrucci et al., 2009;

Ullrich et al., 2010; Chintauan-Marquier et al., 2011,

2014; but see Nattier et al., 2011a; Song et al., 2015).

Only recently, phylogenies relying on large taxonomic

and/or character samples have been performed, which

suggest that a comprehensive phylogeny for the

Orthoptera could be achieved in the near future: Lea-

vitt et al. (2013) explored large dataset partitions while

studying the phylogeny of caeliferan Acridoidea, and

Mugleston et al. (2013) studied the phylogeny of Tet-

tigonioidea. However, crickets, a large group of

Orthoptera (~5000 species), are missing in this global

achievement of orthopteran phylogeny and this is the

goal of our study.

As crickets have been used as a model system for

studies on speciation and acoustic communication (Hu-

ber et al., 1989; Gerhardt and Huber, 2002), the ﬁrst

phylogenies of crickets focused on restricted groups

based on model species. For example, hypotheses

about speciation have been tested in the Hawaiian

genus Laupala (Shaw, 2002), the Caribbean genus Am-

phiacusta (Oneal et al., 2010) and the New Caledonian

genus Agnotecous (Nattier et al., 2011b, 2012). Acous-

tic signal evolution has been analysed in the North

American species of Gryllus (Huang et al., 2000; Desut-

ter-Grand-colas and Robillard, 2003), and the diversi-

ﬁcation of stridulatory structures and calling songs

in the cricket subfamily Eneopterinae has been stud-

ied ﬁrst in a phylogenetic perspective (Robillard and

Desutter-Grandcolas, 2004, 2006, 2011a), and later

taking into account functional data (Robillard et al.,

2007, 2013).

These studies did not aim to analyse evolutionary

questions at the scale of the entire cricket clade, nei-

ther in terms of evolutionary origin nor in terms of

diversiﬁcation. Gwynne (1995, 1997) gathered all avail-

able information from local phylogenetic trees and

classiﬁcatory hypotheses to derive hypotheses about

cricket mating behaviour, acoustic communication,

and habitat. The lack of a wide-scale phylogeny of

crickets weakened, however, any evolutionary interpre-

tation, not only because of the lack of a historical

framework to follow character transformations, but

also because of a deﬁcient sampling of cricket diversity

(Gerhardt and Huber, 2002; Desutter-Grandcolas and

Robillard, 2004). For example, studies on cricket

acoustic communication have been based mostly on

just a few species of Gryllus,Teleogryllus and Acheta,

which has given rise to a straightforward, narrow view

of cricket acoustics (Nocke, 1972; Elliott and Koch,

1985; Otte, 1992; Bennet-Clark, 2003). However,

original sound emission and apparatus, including

non-resonant or high-frequency calls, and asymmetri-

cal or complex sound apparatus were discovered

in Phalangopsidae and Eneopterinae crickets (Desut-

ter-Grandcolas, 1992, 1997, 1998; Robillard and Des-

utter-Grandcolas, 2004). Their actual diversity and the

complexity of the stridulum functioning mechanism

(Robillard et al., 2013) escaped the classic “cricket

model”, and a possible explanation has emerged only

when a sound phylogenetic reference became available

(Robillard et al., 2007, 2013; Robillard and Desutter-

Grandcolas, 2011a). Therefore, cricket phylogenetic

relationships need to be investigated with state-of-the-

art phylogenetic tools.

The lack of a phylogeny for crickets goes along with

the lack of a stable and well-supported classiﬁcation

for this group. Deﬁned on various morpho-anatomical

datasets, different classiﬁcations have been proposed

(Brunner von Wattenwy, 1873; de Saussure, 1874,

1877; Scudder, 1897; Bruner, 1916; Blatchley, 1920;

Chopard, 1949, 1969; Vickery, 1977; Gorochov, 1986,

1995; emended in Storozhenko, 1997; Desutter, 1987,

1988). These classiﬁcations had various internal struc-

tures and were a mix of stable groups, well character-

ized by their morphology and used by a majority of

authors, and of artiﬁcial, vaguely deﬁned groups. This

situation resulted in much confusion about cricket tax-

onomy, increased by the assignment of newly

described taxa to higher taxonomic categories accord-

ing to ambiguous diagnoses. Today, the most widely

used classiﬁcation system for crickets is the internet

reference Orthoptera Species File (OSF; http://orthop-

tera.speciesﬁle.org), but this classiﬁcation system has

not been subject to recent and thorough phylogenetic

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 55

hypotheses. It is now an important challenge to build

a robust phylogeny of crickets, not only to understand

their evolution and that of Orthoptera in general, but

also to establish a stable classiﬁcation for this diverse

clade.

Here we present the ﬁrst attempt to reconstruct a

phylogeny of crickets using a wide taxonomic and

character sample (i.e. 205 species representative of

cricket diversity; four nuclear and three mitochondrial

markers), analysed with parsimony, maximum likeli-

hood, and Bayesian inference. Our aims are: (i) to test

the monophyly of a putative cricket clade comprising

true crickets, mole crickets, ant-loving crickets, and

scaly crickets; (ii) to determine the phylogenetic rela-

tionships between these groups, (iii) to determine their

main phylogenetic subdivisions and compare them

with the OSF; and (iv) to draw from this phylogenetic

hypothesis the backbone of a phylogenetic classiﬁca-

tion of crickets and the framework for future evolu-

tionary studies. We discuss some general outcomes

about acoustic communication and biogeography in

crickets, which may help guide future evolutionary

studies.

Material and methods

Taxon sampling

Taxon sampling was designed to lay the foundation

of a phylogenetic classiﬁcation of crickets sensu lato,

that is, true crickets, mole crickets, ant-loving crickets,

and scaly crickets. As no clear hypothesis of cricket

classiﬁcation exists today, we referred to the Internet

database OSF. We included species belonging to as

many suprageneric groups as possible among those

listed in the OSF on 1 September 2014. To improve

the phylogenetic diversity of the ingroup, and to avoid

sampling biases, we also sampled genera that are not

currently classiﬁed in a suprageneric category in the

OSF, and we took into account the genera that were

previously classiﬁed in tribal or subfamilial groups no

longer in use in the OSF.

According to the OSF (Table 1), crickets sensu lato

are classiﬁed into one superfamily, the Grylloidea,

comprising four families, the Mogoplistidae (Mogo-

plistinae –or scaly crickets –and the Malgasiinae with

the Malagasy genus Malgasia Uvarov, 1940), the Gry-

llotalpidae (Gryllotalpinae and Scapteriscinae –mole

crickets), the Myrmecophilidae (Myrmecophilinae –

ant-loving crickets) and the Gryllidae (true crickets).

Gryllidae include three “subfamily groups” (the Grylli-

nae, Phalangopsinae, and Podoscirtinae “subfamily

groups”, comprising 16 subfamilies) and four unclassi-

ﬁed subfamilies (Nemobiinae, Trigonidiinae, Oecanthi-

nae, Eneopterinae).

Our ingroup includes a total of 205 species (Tables 1

and 2), belonging to 152 genera (~23% of all known

genera). These samples represent 22 of the 25 subfami-

lies (~88%) and 37 of the 52 tribes (~71%) listed in

the OSF. All OSF families and “subfamily groups” are

represented.

In addition, two species of Schizodactylidae were

included: Schizodactylus monstrosus Drury, 1770 and

Comicus campestris Irish, 1986. Sand crickets have

been considered potentially close to crickets, on a mor-

phological (Gwynne, 1995) or molecular (Jost and

Shaw, 2006; Legendre et al., 2010) basis (see also Blan-

chard (1845) for S. monstrosus). They are classiﬁed as

a distinct superfamily in the OSF, that is the Schizo-

dactyloidea, but constitute the sister group of the leaf-

roller crickets (Stenopelmatoidea, Gryllacridinae) in

Gorochov (1995, 2001).

Table 1

Taxonomic sampling used in this study, with taxonomic assignment

according to the internet database Orthoptera Species File

Families/Subfamilies Tribes

Sampled

genera

Sampled

species

GRYLLIDAE

“Gryllinae subfamily group”

Gryllinae 6 of 7 28 31

Gryllomiminae No tribe ––

Gryllomorphinae 2 of 2 3 4

Itarinae No tribe ––

Landrevinae 1 of 2 5 6

Sclerogryllinae 0 of 1 1 1

“Phalangopsinae subfamily group”

Cachoplistinae 1 of 2 3 4

Luzarinae No tribe 15 17

Paragryllinae 1 of 1 12 15

Phalangopsinae 2 of 3 7 11

Phaloriinae 1 of 2 3 9

Pteroplistinae 1 of 1 2 2

No subfamily 1 of 2 3 7

No subfamily No tribe 2 2

“Podoscirtinae subfamily group”

Euscyrtinae No tribe 2 3

Hapithinae 2 of 2 5 5

Podoscirtinae 3 of 3 14 17

Pentacentrinae 1 of 5 2 2

No hypothesized “subfamily group”

Eneopterinae 5 of 5 15 19

Nemobiinae 4 of 6 13 18

Oecanthinae 1 of 2 1 3

Trigonidiinae 2 of 2 8 13

GRYLLOTALPIDAE

Gryllotalpinae No tribe 1 4

Scapteriscinae No tribe ––

MOGOPLISTIDAE

Malgasiinae No tribe 1 1

Mogoplistinae 2 of 2 5 9

MYRMECOPHILIDAE

Myrmecophilinae 1 of 2 1 2

4 of 4 families

22 of 25 subfamilies

37 of 52 152 205

–, not sampled.

56 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Table 2

Specimens use for molecular analysis, with voucher data and GenBank accession numbers (sequences generated for this study are in bold)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Absonemobius guyanensis Desutter-

Grandcolas, 1993

NEMO-Pte LDG 047 ENSIF3252 French Guiana,

Arataye

KR903868 ND KR903363 KR904058 KR903497 KR902996 KR903183

Acantoluzarida nigra Desutter-

Grandcolas, 1992

LUZA LDG 221 ENSIF3277 French Guiana,

Arataye

KR903995 KR903804 KR903467 KR904178 KR903644 KR903122 KR903301

Acheta domesticus (Linnaeus,

1758)

GRYL-Gry Adom ENSIF3523 Breeding strain KR903831 KR903672 KR903330 KR904025 KR903498 KR902997 KR903150

Acheta rufopictus Uvarov,

1957

GRYL-Gry LDG 178 RF-2010-10 Yemen, Socotra KR903964 KR903786 KR903446 KR904150 KR903623 KR903101 KR903272

Aclella nova Desutter-

Grandcolas, 2014

PARA-Par LDG 065 INBio

05/TH/06/016

Costa Rica KR903883 ND ND KR904074 KR903548 ND KR903199

Adenopterus

(Archenopterus)

sp1_NC PODO LDG 200 ENSIF3297 New Caledonia KR903979 KR903795 KR903454 KR904163 ND KR902993 KR903286

Adenopterus

(Archenopterus)

sp2_NC PODO LDG 218 ENSIF3271 New Caledonia KR903992 KR903802 KR903464 KR904175 ND KR903119 KR903299

Afrophaloria amani Desutter-

Grandcolas, 2015

PHOR LDG 037 ENSIF3341 Tanzania KR903858 KR903696 KR903353 KR904049 KR903524 KR903023 KR903173

Agnotecous tapinopus Saussure,

1878

ENEO-Leb ATaMo ENSIF2769 New Caledonia JX897379 JX897345 JX897326 JX897580 KR903499 ND JX897557

Allonemobius fasciatus (De Geer,

1773)

NEMO-Pte LDG 141 SH-2005-002 Quebec KR903934 ND KR903422 ND KR903595 KR903081 KR903244

Amphiacusta caraibea Saussure,

1897

LUZA LDG 020 ENSIF3045 West Indies,

Guadeloupe

KR903848 KR903687 KR903344 KR904039 KR903515 KR903014 KR903165

Amusodes sp afﬁnis estrellae

Hebard, 1928

LUZA LDG 242 MEUV Colombia KR904003 KR903812 KR903475 KR904185 KR903651 KR903128 KR903309

Amusurgus sp_Van TRIG-Tri LDG 167 ENSIF3368 Vanuatu, Espiritu

Santo

KR903957 KR903779 KR903439 ND KR903617 ND KR903265

Anaxipha sp afﬁnis nitida

(Chopard, 1912)

TRIG-Tri LDG 101 ENSIF3260 French Guiana,

Arataye

KR903906 KR903735 KR903396 KR904094 KR903570 KR903058 KR903220

Anaxipha sp_GDE TRIG-Tri LDG 151 SH-2010-038 West Indies,

Guadeloupe

KR903943 KR903768 KR903429 KR904130 KR903604 ND KR903253

Anaxipha sp afﬁnis fuscocinctum

(Chopard, 1925)

TRIG-Tri LDG 168 ENSIF3371 Vanuatu, Espiritu

Santo

KR903958 KR903780 KR903440 KR904144 KR903618 KR903096 KR903266

Antillicharis maximus (Desutter-

Grandcolas, 2003)

ENEO LDG 194 ENSIF3269 West Indies,

Guadeloupe

KR903975 KR903794 ND KR904159 ND KR903108 KR903282

Anurogryllus muticus (De Geer, 1773) GRYL-Gry Amu ENSIF3172 Nicaragua KR903832 AY905322 ND AY905346 ND ND ND

Anurogryllus

(Urogryllus)

sp_FGu GRYL-Gry LDG 103 ENSIF3262 French Guiana,

Arataye

KR903908 KR903737 KR903398 KR904096 KR903572 KR903060 KR903222

Aphonomorphus sp_FGu PODO-Pod LDG 210 ENSIF3299 French Guiana KR903986 ND KR903460 ND ND ND ND

Aphonomorphus

(Euaphonus)

sp_FGu PODO-Pod LDG 179 ENSIF3245 French Guiana KR903965 KR903787 ND ND KR903624 ND KR903273

Apterogryllus nsp_Van GRYL-Cep LDG 165 ENSIF3367 Vanuatu, Espiritu

Santo

KR903955 KR903778 KR903438 KR904142 KR903615 ND KR903263

Aracamby nsp_Bra LUZA LDG 039 ENSIF3305 Brazil, Sao Paulo KR903860 KR903698 KR903355 KR904051 KR903526 ND KR903175

Arachnocephalus vestitus Costa, 1855 MOGO-Ara LDG 215 SH-2007-001 France, Corse KR903990 ND ND KR904173 KR903640 ND ND

Arilpa gidya Otte &

Alexander, 1983

ENEO-Eur Agi ANIC Western Australia AY905268 AY905297 AY905351 AY905327 ND ND ND

Brachytrupes membranaceus

(Drury, 1770)

GRYL LDG 125 ENSIF3385 Mozambique KR903922 KR903749 KR903410 KR904109 KR903583 KR903071 KR903232

Brasilodontus riodocensis de

Mello, 1992

LAND-Lan LDG 227 ENSIF3338 Brazil, Espiritu

Santo

KR903999 KR903807 KR903470 ND ND ND ND

Brevizacla molisae Desutter-

Grandcolas, 2009

PARA-Par LDG 010 ENSIF2832 Vanuatu, Espiritu

Santo

KR903842 KR903681 KR903338 KR904033 KR903510 KR903008 KR903159

Bullita sp_NC NEMO-Nem LDG 235 ENSIF3393 New Caledonia KR904001 KR903810 KR903473 KR904183 KR903649 KR903126 KR903307

Calscirtus amoa Otte, 1987 PODO-Pod LDG 219 ENSIF3110 New Caledonia KR903993 ND KR903465 KR904176 KR903642 KR903120 KR903300

Caltathra sp_NC PARA-Par LDG 006 ENSIF3326 New Caledonia KR903841 KR903680 KR903337 KR904032 KR903509 KR903007 KR903158

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 57

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Caltathra sp afﬁnis doensis

Desutter-Grandcolas,

2006

PARA-Par LDG 134 ENSIF3087 New Caledonia KR903929 KR903756 KR903417 KR904116 KR903590 KR903078 KR903239

Cardiodactylus novaeguineae (Haan,

1842)

ENEO-Leb CnoPe ENSIF2030 Vanuatu, Espiritu

Santo

JF972506 JF972521 JF972490 JF972537 KR903500 KR902998 KR903151

Cardiodactylus kondo i Otte, 2007 ENEO-Leb Cphi2 ENSIF3154 Philippines,

Luc

ßon

KR903833 KR903673 ND KR904027 KR903501 KR902999 KR903152

Cearacesa nsp_Bra HAPI-Cea LDG 209 ENSIF3270 Brazil, Pernambuco KR903985 KR903798 KR903459 KR904170 KR903638 ND KR903294

Cearacesaini sp_Bra HAPI-Cea LDG 166 ENSIF3318 Brazil KR903956 ND ND KR904143 KR903616 ND KR903264

Coiblemmus sp_India GRYL LDG 072 ENSIF3410 India KR903888 KR903720 KR903380 KR904079 KR903553 ND KR903204

Cophogryllus sp_India GRYL-Cop LDG 080 ENSIF3412 India, Karnataka KR903892 KR903724 KR903383 KR904083 KR903557 KR903048 KR903208

Cophonemobius faustini Desutter-

Grandcolas, 2009

NEMO LDG 162 ENSIF2144 Vanuatu, Espiritu

Santo

KR903952 KR903776 KR903435 KR904139 KR903612 KR903093 KR903260

Cranistus sp_Mex TRIG-Phy LDG 114 ENSIF3376 Mexico, Jalisco KR903917 ND KR903405 ND ND ND KR903228

Creolandreva crepitans Hugel, 2009 LAND LDG 138 SH-2009-197 Mauritius KR903931 KR903758 KR903419 KR904118 KR903592 KR903079 KR903241

Cycloptiloides orientalis Chopard,

1925

MOGO-Mog LDG 188 SH-2009-195 La R

eunion KR903970 ND ND ND KR903630 KR903104 ND

Derectaotus sp_Com MOGO-Mog LDG 097 ENSIF3374 Comoros, Moheli KR903902 KR903731 KR903392 KR904090 KR903567 ND KR903217

Derectaotus sp_May MOGO-Mog LDG 098 ENSIF3375 Mayotte KR903903 KR903732 KR903393 KR904091 KR903568 ND KR903218

Diatrypa sp_FGu PODO-Aph LDG 092 ENSIF3261 French Guiana,

Arataye

KR903899 KR903728 KR903389 KR904087 KR903564 KR903054 KR903214

Ectatoderus brevipalpis

Chopard, 1957

MOGO-Mog LDG 146 SH-2009-106 La R

eunion KR903938 KR903763 KR903425 KR904125 KR903599 KR903083 KR903248

Ectatoderus sp_Mar MOGO-Mog LDG 193 SH-2008-040 West Indies,

Martinique

KR903974 ND KR903451 KR904158 ND ND KR903281

Ectatoderus sp_FGu MOGO-Mog LDG 105 ENSIF3275 French Guiana,

Arataye

ND KR903739 ND KR904085 ND KR902989 ND

Ectecous sp_FGu PARA-Par LDG 090 ENSIF3384 French Guiana KR903897 KR903726 KR903387 KR904085 KR903562 KR903052 KR903212

Eneoptera guyanensis

Chopard, 1931

ENEO-Ene Egu ENSIF2741 French Guiana AY905272 AY905301 AY905355 AY905331 KR903502 KR903000 JX897547

Eugryllodes pipiens (Dufour,

1820)

GRMP-Grm LDG 189 ES France KR903971 KR903792 ND ND ND KR903105 KR903278

Eunemobius carolinus

(Scudder, 1877)

NEMO-Pte LDG 149 SH-2005-01 Quebec KR903941 KR903766 ND KR904128 KR903602 KR903086 KR903251

Eurepa marginipennis

(White, 1841)

ENEO-Eur Ema ANIC South Australia AY905274 AY905303 AY905357 JF972540 ND ND ND

Eurepella moojerra Otte &

Alexander, 1983

ENEO-Eur Emo ANIC Australia,

Queensland

AY905277 AY905307 AY905361 ND ND ND ND

Eurepini sp_Aus ENEO-Eur Eursp ENSIF3155 Australia,

Northern

Territory

KR903834 KR903674 KR903331 KR904028 KR903503 KR903001 KR903153

Euscyrtus sp afﬁnis bipunctatus

Chopard, 1958

EUSC LDG 161 ENSIF3310 Vanuatu, Espiritu

Santo

KR903951 KR903775 ND KR904138 KR903492 KR902988 KR903259

Euscyrtus bivittatus Gu

erin-

M

eneville, 1844

EUSC LDG 187 SH-2008-071 Mauritius KR903969 KR903791 ND KR904155 KR903629 ND KR903277

Fryerius sp_Com PODO-Pod LDG 096 ENSIF3378 Comoros, Moheli KR903901 KR903730 KR903391 KR904089 KR903566 KR903056 KR903216

Ganoblemmus rasilis Karsch, 1893 GRYL-Gry LDG 158 ENSIF3387 Gabon, La Makande KR903948 ND KR903433 KR904135 KR903609 KR903091 KR903257

Gialaia strasbergi Hugel, 2014 GRYL-Gry LDG 148 SH-2009-173 Mauritius KR903940 KR903765 KR903427 KR904127 KR903601 KR903085 KR903250

Gryllinae sp_Moz GRYL LDG 121 ENSIF3602 Mozambique KR903920 KR903747 KR903408 KR904107 KR903581 KR903069 KR903230

Gryllodes sigillatus (Walker,

1869)

GRYL-Mod LDG 042 ENSIF3249 Comoros, Anjouan KR903863 KR903701 KR903358 KR904053 KR903529 KR903027 KR903178

Gryllomorpha dalmatina (Ocskay,

1832)

GRMP-Grm LDG 185 ENSIF3332 France KR903968 KR903790 KR903449 KR904153 KR903627 KR903103 KR903276

Gryllotalpa sp_Moz GRTL-Gtl LDG 171 ENSIF3315 Mozambique KR903961 KR903783 KR903443 KR904147 KR903621 KR903099 KR903269

Gryllotalpa africana Palisot de

Beauvois, 1805

GRTL-Gtl LDG 175 RF-2009-312 Yemen, Socotra KR903963 ND KR903445 ND ND ND ND

Gryllotalpa sp1_PNG GRTL-Gtl LDG 253 ENSIF3317 PNG, Mt Wilhelm KR904013 KR903821 KR903484 KR904195 KR903661 ND KR903317

58 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Gryllotalpa sp2_PNG GRTL-Gtl LDG 254 ENSIF3339 PNG, Mt Wilhelm KR904014 KR903822 KR903485 KR904196 KR903662 KR903138 KR903318

Gryllus bimaculatus De

Geer, 1773

GRYL-Gry Gbi2/LDG 075 ENSIF3524/3404 Breeding strain /

India, Karnataka

KR903835 KR903675 KR903332 KR904029 KR903504 KR903002 KR903154

Gymnogryllus sp_PNG GRYL-Gry LDG 249 ENSIF3320 PNG, Mt Wilhelm KR904009 KR903817 KR903480 KR904191 KR903657 KR903134 KR903314

Hapithinae n.

genus 15

ngen_Ven PODO LDG 226 ENSIF3377 Venezuela, Aragua KR903998 ND ND ND KR903647 ND KR903304

Hapithus sp_Mex HAPI-Hap LDG 204 ENSIF3316 Mexico, Chiapas KR903982 ND KR903456 KR904166 KR903635 KR903114 KR903289

Hemigryllus sp_FGu NEMO-Hem LDG 089 ENSIF3383 French Guiana KR903896 ND KR903386 KR904084 KR903561 KR903051 ND

Homoeogryllus gabonensis

Desutter, 1985

CACH-Hom LDG 033 ENSIF3400 Dem Rep Congo KR903856 ND KR903351 KR904047 KR903523 KR903021 ND

Homoeogryllus orientalis

Desutter, 1985

CACH-Hom LDG 129 ENSIF3603 Mozambique,

Cabo Delgado

KR903925 KR903752 KR903413 KR904112 KR903586 KR903074 KR903235

Homoeoxipha cf lycoides

(Walker, 1869)

TRIG-Tri LDG 140 SH-2010-135 Seychelles KR903933 KR903760 KR903421 KR904120 KR903594 ND KR903243

Hygronemobius amoenus

Chopard, 1912

NEMO-Pte LDG 048 ENSIF3250 French Guiana,

Arataye

KR903869 KR903706 ND KR904059 KR903534 ND KR903184

Itaropsis tenella (Walker,

1869)

GRYL It94 ENSIF3406 India, Karnataka KR903836 KR903676 JN411891 ND KR903496 KR902995 KR903155

Kempiola ﬂavipunctatus Desutter-

Grandcolas, 2012

CACH-Hom LDG 013 ENSIF3054 India, Karnataka KR903844 KR903683 KR903340 KR904035 KR903512 KR903010 KR903161

Kevanacla orientalis Desutter-

Grandcolas, 1992

PARA-Par LDG 110 ENSIF3272 French Guiana,

Arataye

KR903914 KR903743 KR903403 KR904103 KR903577 KR903066 KR903226

Koghiella sp_NC NEMO-Nem LDG 236 ENSIF3395 New Caledonia KR904002 KR903811 KR903474 KR904184 KR903650 KR903127 KR903308

Landreva nsp_India LAND-Lan LDG 032 ENSIF3292 India, Karnataka KR903855 KR903694 KR903350 KR904046 KR903522 KR903020 KR903171

Landrevini sp_PNG LAND-Lan LDG 255 ENSIF3298 PNG, Mt Wilhelm KR904015 KR903823 KR903486 KR904197 KR903663 KR903139 KR903319

Laurepa

(=Orochirus)

sp_GDE HAPI-Hap LDG 191 ENSIF3268 West Indies,

Guadeloupe

KR903972 KR903793 KR903450 KR904156 ND KR903106 KR903279

Lebinthus santoensis Robillard,

2009

ENEO-Leb LsaV ENSIF2437 Vanuatu, Espiritu

Santo

JF972511 JF972527 JF972495 JF972542 JX897467 ND JX897548

Lebinthus luae Robillard &

Tan, 2013

ENEO-Leb LbiS ENSIF2740 Singapour KR904017 JF972524 JF972493 KR904199 KR903665 KR903141 KR903321

Lepidogryllus comparatus

(Walker, 1869)

GRYL-Mod LDG 202 ENSIF3243 New Caledonia KR903980 KR903796 KR903455 KR904164 ND KR903112 KR903287

Leptopedetes idalimos Otte, 2006 LUZA LDG 011 ENSIF3398 Costa Rica KR903843 KR903682 KR903339 KR904034 KR903511 KR903009 KR903160

Lerneca fuscipennis (Saussure,

1874)

LUZA LDG 067 ENSIF3528 French Guiana,

Arataye

KR903884 KR903717 KR903376 KR904075 KR903549 KR903042 KR903200

Lernecella nsp_GDE LUZA LDG 021 ENSIF3301 West Indies,

Guadeloupe

KR903849 KR903688 KR903345 KR904040 KR903516 KR903015 KR903166

Lernecella minuta Desutter-

Grandcolas, 1992

LUZA LDG 053 ENSIF3255 French Guiana,

Arataye

KR903874 KR903711 ND KR904064 KR903539 KR903035 KR903189

Ligypterus fuscus Chopard, 1920 ENEO-Ene LfuNo2 ENSIF3156 French Guiana,

Arataye

KR904018 KR903825 KR903487 KR904200 KR903666 KR903142 KR903322

Loxoblemmus sp_Indo GRYL-Gry LDG 130 ENSIF3331 Indonesia,

Lombock

KR903926 KR903753 KR903414 KR904113 KR903587 KR903075 KR903236

Luzara brevipennis Desutter-

Grandcolas, 2014

LUZA LDG 015 ENSIF3399 Costa Rica KR903846 KR903685 KR903342 KR904037 ND KR903012 KR903163

Luzarida grandis Desutter-

Grandcolas, 1992

LUZA LDG 055 ENSIF3258 French Guiana,

Arataye

KR903876 KR903713 KR903369 KR904066 KR903541 KR903037 KR903191

Luzaridella obscura Desutter-

Grandcolas, 1992

LUZA LDG 050 ENSIF3253 French Guiana,

Arataye

KR903871 KR903708 KR903365 KR904061 KR903536 KR903033 KR903186

Luzaridella clara Desutter-

Grandcolas, 1992

LUZA LDG 054 ENSIF3254 French Guiana,

Arataye

KR903875 KR903712 KR903368 KR904065 KR903540 KR903036 KR903190

Malgasia sp_Com MALG LDG 026 ENSIF3382 Comoros, Grande

Comore

KR903852 KR903691 ND KR904043 KR903519 KR903017 KR903168

Matuanus caledonicus

(Saussure, 1878)

PODO-Pod Msp_Po IAC New Caledonia KR904019 KR903826 KR903488 ND ND KR903143 KR903323

Megacris lipsae Desutter-

Grandcolas, 2009

no LDG 084 ENSIF2901 Vanuatu, Espiritu

Santo

KR903895 KR903725 ND ND KR903560 KR903050 ND

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 59

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Meloimorpha japonica yunnanensis

(Yin, 1998)

CACH-Hom LDG 233 ENSIF3308 China, Padang KR904000 KR903808 KR903471 KR904181 KR903648 KR903125 KR903305

Microlandreva (?) nsp_May LAND-Lan LDG 170 ENSIF3307 Mayotte KR903960 KR903782 KR903442 KR904146 KR903620 KR903098 KR903268

Microlerneca leticia de Mello, 1995 LUZA LDG 040 ENSIF3072 Brazil KR903861 KR903699 KR903356 ND KR903527 KR903025 KR903176

Mikluchomaklaia sp_PNG PARA-Par LDG 252 ENSIF3294 PNG, Mt Wilhelm KR904012 KR903820 KR903483 KR904194 KR903660 KR903137 KR903316

Miogryllodes hebardi Desutter-

Grandcolas, 2014

LUZA LDG 059 ENSIF3397 Costa Rica KR903879 ND KR903371 KR904069 KR903544 KR903038 KR903194

Miogryllus verticalis (Serville,

1839)

GRYL-Mod LDG 102 ENSIF3248 French Guiana,

Arataye

KR903907 KR903736 KR903397 KR904095 KR903571 KR903059 KR903221

Mistshenkoana sp_Van PODO-Aph LDG 160 ENSIF3311 Vanuatu, Espiritu

Santo

KR903950 KR903774 KR903434 KR904137 KR903611 KR903092 KR903258

Modicogryllus siamensis Chopard,

1961

GRYL-Mod LDG 081 ENSIF3413 India KR903893 ND KR903384 ND KR903558 ND KR903209

Modicogryllus

(Eumodicogryllus)

bordigalensis

(Latreille, 1804)

GRYL-Mod LDG 174 RF-2010 The Netherlands KR903962 KR903785 KR903444 KR904149 KR903622 KR903100 KR903271

Munda sp afﬁnis asyrinx

(Saussure, 1878)

PODO-Aph LDG 131 ENSIF3373 Indonesia, Java KR903927 KR903754 KR903415 KR904114 KR903588 KR903076 KR903237

Myara sordida (Walker, 1869) ENEO-Eur Mso ANIC Australia,

Queensland

AY905282 AY905312 AY905367 AY905339 ND ND ND

Myrmecophilus

(Myrmecophilus)

quadrispinus Perkins,

1899

MYRM-Myr LDG 186 SH-2003-001 La R

eunion ND ND ND KR904154 KR903628 ND ND

Myrmecophilus

(Myrmophilina)

americanus Saussure,

1877

MYRM-Myr LDG 156 SH-Antigua517 Antigua KR903947 KR903772 KR903432 KR904134 KR903608 ND ND

Natula longipennis (Serville,

1839)

TRIG-Tri LDG 139 SH-2008-080 Mauritius KR903932 KR903759 KR903420 KR904119 KR903593 KR903080 KR903242

Nemobiinae ngen_NC NEMO LDG 246 ENSIF3394 New Caledonia KR904006 KR903814 KR903477 KR904188 KR903654 KR903131 KR903312

Nemobiinae sp_Com NEMO LDG 049 ENSIF3314 Comoros, Anjouan KR903870 KR903707 KR903364 KR904060 KR903535 KR903032 KR903185

Nemobius sylvestris (Bosc, 1792) NEMO-Nem LDG 206 ENSIF3244 France KR903983 ND KR903458 KR904168 KR903636 KR903115 KR903291

Neometrypus sp_FGu PODO-Pod LDG 224 ENSIF3264 French Guiana,

Arataye

KR903997 KR903806 KR903469 KR904180 KR903646 KR903124 KR903303

Niquirana phyxelis (Otte,2006) LUZA LDG 060 ENSIF3692 Costa Rica KR903880 KR903715 KR903372 KR904070 KR903545 KR903039 KR903195

Nisitrus vittatus (Haan, 1842) ENEO-Nis NviS ENSIF2742 Singapour AY905284 AY905314 AY905369 KR904201 KR903667 KR903144 KR903324

Noctivox nsp_Mex LUZA LDG 208 ENSIF3340 Mexico, Tamaulipas ND ND ND KR904169 KR903637 ND KR903293

Notosciobia nsp_NC GRYL-Cep LDG 164 ENSIF3325 New Caledonia KR903954 KR903777 KR903437 KR904141 KR903614 KR903095 KR903262

Odontogryllus setosus Saussure, 1877 LAND-Lan LDG 100 ENSIF3263 French Guiana,

Arataye

KR903905 KR903734 KR903395 KR904093 KR903495 KR902994 ND

Oecanthus sp_Com OECA LDG 045 ENSIF3293 Comoros, Grande

Comore

KR903866 KR903704 KR903361 KR904056 KR903532 KR903030 KR903181

Oecanthus sp_FGu OECA LDG 211 ENSIF3300 French Guiana KR903987 KR903799 KR903461 ND ND ND ND

Oecanthus chopardi Uvarov, 1957 OECA LDG 173 RF-2010-18 Yemen, Socotra ND KR903784 ND KR904148 KR903493 KR902990 KR903270

Opiliosina meridionalis Desutter-

Grandcolas, 2012

PHAL LDG 014 ENSIF2946 India, Karnataka KR903845 KR903684 KR903341 KR904036 KR903513 KR903011 KR903162

Ornebius xanthopterus Gu

erin-

M

eneville, 1844

MOGO-Mog LDG 153 SH-2011-016 Mauritius KR903944 KR903769 KR903430 KR904131 KR903605 KR903088 KR903254

Ornebius sp_GDE MOGO-Mog LDG 184 SH-2011-085 West Indies,

Guadeloupe

KR903967 KR903789 KR903448 KR904152 KR903626 ND KR903275

Orocharis sp afﬁnis lividus

Chopard, 1912

HAPI-Hap LDG 222 ENSIF3274 French Guiana,

Arataye

KR903996 KR903805 KR903468 KR904179 KR903645 KR903123 KR903302

Orthoxiphus sp_Com PENT LDG 220 ENSIF3379 Comoros, Anjouan KR903994 KR903803 KR903466 KR904177 KR903643 KR903121 ND

Paora sp_NC NEMO-The LDG 244 ENSIF3312 New Caledonia KR904005 ND ND KR904187 KR903653 KR903130 KR903311

Paragryllodes sp_Com no-End LDG 024 ENSIF3380 Comoros, Moheli KR903851 KR903690 KR903347 KR904042 KR903518 KR903016 ND

Paragryllodes sp_Mad no-End LDG 137 ENSIF3526 Madagascar KR903930 KR903757 KR903418 KR904117 KR903591 ND KR903240

Paragryllus martini Gu

erin_

M

eneville, 1844

PARA-Par LDG 003 ENSIF3327 West Indies,

Guadeloupe

KR903838 ND KR903334 ND KR903506 KR903004 ND

Paranisitra longipes Chopard, 1925 ENEO-Nis Plo2 ENSIF3157 Philippines, Luc

ßon KR904020 KR903827 ND KR904202 KR903668 KR903145 KR903325

Parendacustes makassari Gorochov,

2006

PHAL-Pha LDG 001 ENSIF3330 Indonesia, Sulawesi KR903837 KR903677 KR903333 KR904030 KR903505 KR903003 KR903156

Parendacustes nsp_Indo PHAL-Pha LDG 016 ENSIF3372 Indonesia, Sumba KR903847 KR903686 KR903343 KR904038 KR903514 KR903013 KR903164

Parendacustes lifouensis Desutter-

Grandcolas, 2002

PHAL-Pha LDG 112 ENSIF2940 New Caledonia,

Lifou

KR903915 ND KR903404 ND ND ND ND

60 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Paroecanthus sp_FGu PODO-Pac LDG 091 ENSIF3525 French Guiana,

Arataye

KR903898 KR903727 KR903388 KR904086 KR903563 KR903053 KR903213

Pentacentrus cf biroi Chopard, 1927 PENT LDG 159 ENSIF3370 Vanuatu, Espiritu

Santo

KR903949 KR903773 ND KR904136 KR903610 ND ND

Petaloptila aliena (Brunner von

Wattenwyl, 1882)

GRMP-Pet LDG 183 ES1 France KR903966 KR903788 KR903447 KR904151 KR903625 KR903102 KR903274

Petaloptila andreini Capra, 1937 GRMP-Pet LDG 192 ES2 France KR903973 ND ND KR904157 ND KR903107 KR903280

Phaeogryllus fuscus Bolivar, 1912 PHAL-Het LDG 142 SH-2010-192 Seychelles KR903935 KR903761 KR903423 KR904122 KR903596 KR903082 KR903245

Phaeophilacris nsp_Com no-End LDG 022 ENSIF3381 Comoros, Anjouan KR903850 KR903689 KR903346 KR904041 KR903517 ND KR903167

Phaeophilacris nsp_Gha no-End LDG 035/066 ENSIF3337 Ghana KR903857 KR903695 KR903352 KR904048 ND KR903022 KR903172

Phaeophilacris sp_CAR no-End LDG 038 ENSIF3527 CAR KR903859 KR903697 KR903354 KR904050 KR903525 KR903024 KR903174

Phaeophilacris spectrum Saussure, 1878 no-End LDG 124 ENSIF3336 Mozambique,

Cabo Delgado

KR903921 KR903748 KR903409 KR904108 KR903582 KR903070 KR903231

Phalangopsis ﬂavilongipes Desutter-

Grandcolas, 1992

PHAL-Pha LDG 052 ENSIF3256 French Guiana,

Arataye

KR903873 KR903710 KR903367 KR904063 KR903538 KR903034 KR903188

Phaloria chopardi (Willemse, 1925) PHOR-Pho LDG 203 ENSIF2108 Vanuatu, Espiritu

Santo

KR903981 ND ND KR904165 KR903634 KR903113 KR903288

Phaloriinae sp_Indo PHOR-Pho LDG 132 ENSIF3324 Indonesia, Sumba KR903928 KR903755 KR903416 KR904115 KR903589 KR903077 KR903238

Phaloriinae sp_Phi PHOR-Pho LDG 243 ENSIF3604 Philippines, Luc

ßon KR904004 KR903813 KR903476 KR904186 KR903652 KR903129 KR903310

Phaloriinae sp1_PNG PHOR-Pho LDG 248 ENSIF3321 PNG, Mt Wilhelm KR904008 KR903816 KR903479 KR904190 KR903656 KR903133 ND

Phaloriinae sp2_PNG PHOR-Pho LDG 250 ENSIF3322 PNG, Mt Wilhelm KR904010 KR903818 KR903481 KR904192 KR903658 KR903135 KR903315

Phaloriinae sp3_PNG PHOR-Pho LDG 256 ENSIF3296 PNG, Mt Wilhelm KR904016 KR903824 ND KR904198 KR903664 KR903140 KR903320

Philippopsis guianae Desutter-

Grandcolas, 1992

PHAL-Pha LDG 051 ENSIF3257 French Guiana,

Arataye

KR903872 KR903709 KR903366 KR904062 KR903537 ND KR903187

Phonarellus minor (Chopard, 1959) GRYL-Gry LDG 078 ENSIF3414 India, Kerala KR903891 KR903723 KR903382 KR904082 KR903556 KR903047 KR903207

Phyllogryllus nsp_GDE PODO-Pod LDG 043 ENSIF3303 West Indies,

Guadeloupe

KR903864 KR903702 KR903359 KR904054 KR903530 KR903028 KR903179

Plebeiogryllus guttiventris

(Walker, 1871)

GRYL-Gry LDG 076 ENSIF3411 India KR903889 KR903721 KR903381 KR904080 KR903554 KR903046 KR903205

Polionemobius sp afﬁnis taprobanensis

(Walker, 1869)

NEMO-Pte LDG 057 ENSIF3396 India, Karnataka KR903877 KR903714 KR903370 KR904067 KR903542 ND KR903192

Ponca venosa Hebard, 1928 ENEO-Ene Pve ENSIF3158 Costa Rica KR904021 KR903828 KR903489 KR904203 KR903669 KR903146 KR903326

Prosthama tessellata Hebard, 1928 LUZA LDG 062 ENSIF3694 Costa Rica KR903881 ND KR903374 KR904072 KR903546 KR903040 KR903197

Protathra centralis Desutter-

Grandcolas, 2014

no-End LDG 005 ENSIF3124 New Caledonia KR903840 KR903679 KR903336 KR904031 KR903508 KR903006 ND

Proturana subapterus (Chopard,

1970)

EUSC LDG 163 ENSIF3076 New Caledonia KR903953 ND KR903436 KR904140 KR903613 KR903094 KR903261

Prozvenella bangalorensis Desutter-

Grandcolas, 2003

PODO-Pod LDG 216 ENSIF3329 India, Karnataka KR903991 ND KR903463 KR904174 KR903641 KR903118 KR903298

Pseudotrigonidium noctifolia (Desutter-

Grandcolas, 1997)

PHOR-Pho LDG 213 ENSIF3111 New Caledonia KR903988 KR903800 ND KR904171 ND KR903116 KR903296

Pteronemobius sp_Moz NEMO-Pte LDG 127 ENSIF3391 Mozambique,

Cabo Delgado

KR903924 KR903751 KR903412 KR904111 KR903585 KR903073 KR903234

Pteronemobius obscurior Chopard, 1957 NEMO-Pte LDG 155 SH-2009-192 La R

eunion KR903946 KR903771 KR903431 KR904133 KR903607 KR903090 KR903256

Pteronemobius heydeni (Fischer, 1853) NEMO-Pte LDG 207 ENSIF3246 France KR903984 ND ND ND ND ND KR903292

Pteroplistes masinagudi Jaiswara,

2014

PTER-Ptr LDG 031 BNHS India, Tamil Nadu KR903854 KR903693 KR903349 KR904045 KR903521 KR903019 KR903170

Rhicnogryllus viettei Chopard, 1957 TRIG-Tri LDG 144 SH-2004-010 La R

eunion KR903936 KR903762 KR903424 KR904123 KR903597 ND KR903246

Rumea guyanensis Desutter-

Grandcolas, 1992

PARA-Par LDG 104 ENSIF3273 French Guiana,

Arataye

KR903909 KR903738 ND KR904097 KR903573 KR903061 ND

Sciobia ﬁnoti (Brunner von

Wattenwyl, 1882)

GRYL-Sci LDG 082 ENSIF3386 Algeria, Tizi Ouzou KR903894 ND KR903385 ND KR903559 KR903049 KR903210

Sclerogryllus sp_India SCLE-Scl LDG 214 ENSIF3291 India, Tamil Nadu KR903989 KR903801 KR903462 KR904172 KR903639 KR903117 KR903297

Silvastella grahamae Desutter-

Grandcolas, 1992

PARA-Par LDG 106 ENSIF3265 French Guiana,

Arataye

KR903910 KR903740 KR903399 KR904099 KR903574 KR903062 ND

Silvastella fuscofasciata Desutter-

Grandcolas, 1992

PARA-Par LDG 107 ENSIF3259 French Guiana,

Arataye

KR903911 KR903741 KR903400 KR904100 KR903575 KR903063 KR903223

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 61

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Singapuriola separata Gorochov &

Tan, 2012

PTER LDG 120 ENSIF3091 Singapour KR903919 KR903746 KR903407 KR904106 KR903580 ND KR903229

Socotracris kleukersi Felix &

Desutter-Grandcolas,

2012

PHAL LDG 041 ENSIF2933 Yemen, Socotra KR903862 KR903700 KR903357 KR904052 KR903528 KR903026 KR903177

Stalacris nsp_Swa no LDG 247 ENSIF3084 Swaziland KR904007 KR903815 KR903478 KR904189 KR903655 KR903132 KR903313

Strogulomorphini sp_CR PARA-Par LDG 061 ENSIF3333 Costa Rica ND KR903716 KR903373 KR904071 ND ND KR903196

Superacla choreutes Otte, 2006 PARA-Par LDG 064 ENSIF3335 Costa Rica KR903882 ND KR903375 KR904073 KR903547 KR903041 KR903198

Svercus palmetorum (Krauss,

1902)

GRYL-Gry LDG 044 ENSIF3247 Comoros, Anjouan KR903865 KR903703 KR903360 KR904055 KR903531 KR903029 KR903180

Svistella chekjawa Tan &

Robillard, 2012

TRIG LDG 113 ENSIF3085 Singapour KR903916 KR903744 ND KR904104 KR903578 KR903067 KR903227

Swezwilderia sp_Fid ENEO Ssp ENSIF2737 Fidji, Viti Levu JF972514 JF972529 JF972498 JF972545 ND ND KR903327

Taciturna baiderae Hugel, 2014 GRYL LDG 154 SH-2009-389 Mauritius KR903945 KR903770 ND KR904132 KR903606 KR903089 KR903255

Tafaliscina sp_FGu PODO-Pac LDG 109 ENSIF3276 French Guiana,

Arataye

KR903913 ND KR903402 KR904102 ND KR903065 KR903225

Tarbinskiellus sp_India GRYL-Gry LDG 077 ENSIF3415 India, Kerala KR903890 KR903722 ND KR904081 KR903555 ND KR903206

Teleogryllus sp_India GRYL-Gry LDG 068 ENSIF3407 India, Kerala KR903885 ND KR903377 KR904076 KR903550 KR903043 KR903201

Thetella sp_Com NEMO-The LDG 028 ENSIF3313 Comoros, Moheli KR903853 KR903692 KR903348 KR904044 KR903520 KR903018 KR903169

Thetella sp_Mau NEMO-The LDG 150 SH-2011-025 Mauritius KR903942 KR903767 KR903428 KR904129 KR903603 KR903087 KR903252

Tremellia sp_PNG PHOR-Pho LDG 251 ENSIF3323 PNG, Mt Wilhelm KR904011 KR903819 KR903482 KR904193 KR903659 KR903136 ND

Trigonidium sp_Moz TRIG-Tri LDG 126 ENSIF3392 Mozambique, Cabo

Delgado

KR903923 KR903750 KR903411 KR904110 KR903584 KR903072 KR903233

Trigonidium cicindeloides

Rambur, 1838

TRIG-Tri LDG 147 SH-2009-099 Mauritius KR903939 KR903764 KR903426 KR904126 KR903600 KR903084 KR903249

Trigonidium sp_Van TRIG-Tri LDG 169 ENSIF3369 Vanuatu, Espiritu

Santo

KR903959 KR903781 KR903441 KR904145 KR903619 KR903097 KR903267

Trigonidium

(Trigonidomorpha)

obscuripennis

(Chopard, 1957)

TRIG-Tri LDG 145 SH-Reu2005-01 La R

eunion KR903937 ND ND KR904124 KR903598 ND KR903247

Truljalia sp_Chi PODO-Pod LDG 234 ENSIF3295 China, Padang ND KR903809 KR903472 KR904182 KR903494 KR902992 KR903306

Turanogryllus sp_India GRYL-Tur LDG 069 ENSIF3408 India, Karnataka KR903886 KR903718 KR903378 KR904077 KR903551 KR903044 KR903202

Unithema guadelupensis Desutter-

Grandcolas, 1991

PARA-Par LDG 004 ENSIF3328 West Indies,

Guadeloupe

KR903839 KR903678 KR903335 ND KR903507 KR903005 KR903157

Uvaroviella

(Aclodes)

spelaea Desutter-

Grandcolas, 1991

PHAL-Pha LDG 046 ENSIF3251 French Guiana,

Arataye

KR903867 KR903705 KR903362 KR904057 KR903533 KR903031 KR903182

Uvaroviella

(Aclodes)

scandens (Otte, 2006) PHAL-Pha LDG 058 ENSIF3334 Costa Rica KR903878 ND ND KR904068 KR903543 ND KR903193

Uvaroviella

(Paraclodes)

guyanensis Desutter-

Grandcolas, 1991

PHAL-Pha LDG 108 ENSIF3266 French Guiana,

Arataye

KR903912 KR903742 KR903401 KR904101 KR903576 KR903064 KR903224

Velariﬁctorus sp_India GRYL-Mod LDG 070 ENSIF3409 India KR903887 KR903719 KR903379 KR904078 KR903552 KR903045 KR903203

Xenogryllus eneopteroides

Bolivar, 1890

ENEO-Xen XenAC ENSIF3159 CAR KR904023 KR903829 KR903490 KR904205 KR903670 KR903148 KR903328

Xenogryllus marmoratus

(Haan, 1842)

ENEO-Xen Xma2 ENSIF3161/3562 Japan/Chine KR904024 KR903830 KR903491 KR904206 KR903671 KR903149 KR903329

Yoyuteris iviei Otte & Perez-

Gelabert, 2009

PARA-Par LDG 205 ENSIF3302 West Indies,

Guadeloupe

ND KR903797 KR903457 KR904167 ND KR902991 KR903290

Zebragryllus nouragui Desutter-

Grandcolas, 2014

GRYL LDG 094 ENSIF3267 French Guiana,

Arataye

KR903900 KR903729 KR903390 KR904088 KR903565 KR903055 KR903215

OUTGROUPS

Ceuthophilus sp OG-RH LDG 198 SH-2005-005 Quebec KR903978 ND ND KR904162 KR903633 KR903111 KR903285

Comicus campestris Irish, 1986 OG-SC C.cam no no Z97608_1 Z97624_1 ND Z97564_1 ND ND ND

Locusta migratoria

(Linnaeus, 1758)

OG-AC L.mig no no NC_001712.1 NC_001712.1 NC_001712.1 AF370793 ND ND AF370817

Lutosa sp OG-AN LDG 099 ENSIF3734 West Indies,

Guadeloupe

KR903904 KR903733 KR903394 KR904092 KR903569 KR903057 KR903219

Niphetogryllacris reunionis (Karny, 1932) OG-GC LDG 196 SH-2009-001 La R

eunion KR903977 ND KR903453 KR904161 KR903632 KR903110 KR903284

Schizodactylus monstrosus (Drury, 1770) OG-SC S.mon no no ND ND ND AF514545_1 ND ND ND

Schistocerca gregaria (Forsk



al, 1775) OG-AC Sgre MNHN_SG1 Africa, 1997 KR904022 GQ491031 JX033931.1 KR904204 ND KR903147 ND

62 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Table 3

PCR proﬁles and primers used, with their sources

Gene Primer Denaturation Annealing Elongation

Number

of cycles

Final

elongation Reference

12SF TACTATGTTACGACTTAT 30 s at 94 °C30s,30s

at 47 °C, 48 °C

40 s, 30 s

at 72 °C

10, 40 7 min at 72 °C Kamphambati (1995)

12SR AAACTAGGATTAGATACCC

16S-AG CGCCTGTTTATCAAAAACATGT 30 s at 94 °C 40 s at 55 °C 40 s at 72 °C 45 5 min at 72 °C Robillard and

Desutter-Grandcolas (2006)16S-BG AGATCACGTAAGAATTTAATGGTC

18S-A2 ATGGTTGCAAAGCTGAAAC 50 s at 94 °C 50 s at 52 °C 50 s at 72 °C 50 7 min at 72 °C Giribet et al. (1999)

18S-9R GATCCTTCCGCAGGTTCACCTAC

HisF ATGGCTCGTACCAAGCAGACGGC 50 s at 94 °C 40 s at 58 °C 40 s at 72 °C 45 7 min at 72 °C Svenson and Whiting (2004)

HisR ATATCCTTGGGCATGATGGTGAC

28S--R1.2a CCC SSG TAA TTT AAG CAT ATT A 40 s at 94 °C 40 s at 50 °C 60 s at 72°C 40 7 min at 72 °C Whiting (2002)

28S-Rd3b CCY TGA ACG GTT TCA CGT ACT Jarvis et al. (2004)

28SF4 CGA CAC GCC CCG ATC CTC AGA GCC A 35 s at 94 °C 35 s at 57 °C 50 s at 72°C 40 7 min at 72 °C This study

28SR4 GATTCTGACGTGCAAATCGATC

cytb427F YTWGTWCAATGARTMTGAGG 30 s at 94 °C 40 s at 48 °C 40 s at 72°C 50 7 min at 72 °C Robillard and Desutter-Grandcolas

(2006)cytb800R CCYARTTTATTAGGAATTGATCG

Table 2

(Continued)

Genus Species Subfam/tribe

Molecular

codes

Voucher/

repository Locality 12S 16S cyt b 18S 28SA 28SD H3

Tachycines asynamora (Adelung,

1902)

OG-RH LDG 115 ENSIF2923 France KR903918 KR903745 KR903406 KR904105 KR903579 KR903068 ND

Xanthogryllacris punctipennis (Walker,

1869)

OG-GC LDG 195 ENSIF2160 West Indies,

Guadeloupe

KR903976 ND KR903452 KR904160 KR903631 KR903109 KR903283

Voucher codes as indicated in Fig. 1 ND =No data. Subfamily abbreviations: CACH, Cachoplistinae; ENEO, Eneopterinae; EUSC, Euscyrtinae; GRMP, Gryllomorphinae;

GRTL, Gryllotalpinae; GRYL, Gryllinae; HAPI, Hapithinae; LAND, Landrevinae; LUZA, Luzarinae; MALG, Malgasiinae; MOGO, Mogoplistinae; MYRM, Myrmecophilinae;

NEMO, Nemobiinae; OECA, Oecanthinae; PARA, Paragryllinae; PENT, Pentacentrinae; PHAL, Phalangopsinae; PHOR, Phaloriinae; PODO, Podoscirtinae; PTER, Pteroplistinae;

SCLE, Sclerogryllinae; TRIG, Trigonidiinae. Tribe abbreviations: Aph, Aphonoidini; Ara, Arachnocephalini; Cae, Cearacesaini; Cep, Cephalogryllini; Cop, Cophogryllini; End, Enda-

custini; Ene, Eneopterini; Eur, Euripini; Grm, Gryllomorphini; Gry, Gryllini; Hap, Hapithini; Hem, Hemigryllini; Het, Heterogryllini; Hom, Homoeogryllini; Lan, Landrevini; Leb,

Lebinthini; Mod, Modicogryllini; Mog, Mogoplistini; Myr, Myrmecophilini; Nem, Nemobiini; Nis, Nisitrini; Oec, Oecanthini; Pac, Paroecanthini; Par, Paragryllini; Pet, Petaloptilini;

Pha, Phalangopsini; Pho, Phaloriini; Phy, Phylloscirtini; Pod, Podoscirtini; Pte, Pteronemobiini; Ptr, Pteroplistini; Sci, Sciobiini; Scl, Sclerogryllini; The, Thetellini; Tri, Trigonidiini;

Tur, Turanogryllini; Xen, Xenogryllini. Repository abbreviations: ANIC, Australian National Insect Collection, Australia; ES, Collection E. Sardet, France; IAC, Institut Agronomique

de Nouvelle-Cal

edonie, La Foa, New Caledonia; INBio, Instituto Nacional de Biodiversidad, Santo Domingo de Heredia, Costa Rica; ENSIF, Ensifera collection of the MNHN, Paris;

MEUV, Museo de Entomologia del Universidad de la Valle, Cali, Colombia; RF, Collection Rob Felix, The Netherlands; SH, Collection Sylvain Hugel, Strasbourg, France; ZSI,

Zoological Survey of India, Calcutta, India.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 63

Outgroup taxa were taken within the two suborders

of Orthoptera, that is, Caelifera and Ensifera (Table 2).

Caelifera were represented by two well-documented

grasshopper species, Schistocerca gregaria Forsk



al, 1775

and Locusta migratoria Linnaeus, 1758. A wider panel

of species was chosen for Ensifera, as the monophyly

and phylogenetic structure of this clade is unclear

(Legendre et al., 2010). It included representatives of

the families Anostostomatidae (one species), Rhaphido-

phoridae (two species) and Gryllacrididae (two species).

We assigned a voucher for number all the specimens

we used. Most of them are recorded in the specimen

database of the Mus

eum national d’Histoire naturelle

(MNHN), where they can be found, together with all

available geographical information at http://sci-

ence.mnhn.fr/institution/mnhn/collection/eo/search; the

others are deposited in the institutions and collections

listed in Table 2.

Molecular methods

We generated 1219 sequences (95.6% of the total

dataset) for this study (Table 2). When necessary,

additional sequences were obtained from the vouchers

used in previous phylogenetic studies (Robillard and

Desutter-Grandcolas, 2006; Nattier et al., 2011b, 2012;

Jaiswara et al., 2012). No sample could be obtained

for Schizodactylus monstrosus and Comicus campestris.

We therefore relied on sequences already published in

GenBank (Benson et al., 2005) for these taxa.

We extracted total genomic DNA from middle or

hind femora of dried, alcohol-preserved, or newly col-

lected specimens. We used QIAamp DNA tissue mi-

crokit (QIAGEN) according to the manufacturer’s

instructions. Molecular work was performed at the

Service de Syst

ematique Mol

eculaire of the MNHN.

We sequenced seven markers, three mitochondrial

and four nuclear, used in previous phylogenetic studies

on insects (Table 3). These are the small (12SrRNA,

~400 bp) and large (16srRNA, ~500 bp) mitochondrial

ribosomal subunits, the mitochondrial gene coding for

cytochrome b protein (cytb, ~400 bp), a fragment of

the small nuclear ribosomal subunit (18SrRNA,

~650 bp), two fragments of the large nuclear ribo-

somal unit (28SA, ~400 bp and 28SD, ~900 bp rRNA)

and the gene coding for H3 protein (H3, ~330 bp).

Primers and annealing temperatures are given in

Table 3. Sequencing reactions were carried out on

both DNA strands. Ambiguous results were checked

by multiple sequencing either on a different DNA

extraction from the same individual, or of an extrac-

tion from another conspeciﬁc individual. The quality

of museum-preserved specimens varied considerably

and DNA degradation did not allow the ampliﬁcation

of all target sequences for each species: however, 85%

of the whole matrix was completed (Table 2).

Table 4

Descriptive statistics for the different sequence datasets with the outgroups included. Statistics were estimated after removal of primer sequences and the best model of evolution

selected with the AIC criterion in jModelTest 2.1.3

Loci

No.

taxa

No.

characters

No/%

variable

sites

No/% parsimony

informative sites

(gap as missing

character)

Model of

evolution AIC (–) lnL

Average frequencies

all sites/variable sites

Constancy of base frequencies

values/Pvalues/d.f.)

A C G T All sites Variable sites

18S 192 685 368/53.7 304/44.4 TIM2 +I+G 31301.042 15252.521 0.2/0.2 0.2/0.3 0.3/0.3 0.2/0.3 98.6/1/576 168.9/1/576

28SA 181 482 290/60.2 225/46.7 TIM2 +I+G 29250.050 14219.025 0.3/0.2 0.3/0.3 0.3/0.3 0.2/0.2 320.9/1/546 508.5/1/546

28SD 162 593 304/51.3 213/35.9 GTR +I+G 21538.126 10437.063 0.2/0.2 0.3/0.3 0.3/0.3 0.2/0.2 129.6/1/483 234.8/1/483

H3 180 328 142/43.3 130/39.6 TIM1 +I+G 25791.604 12491.802 0.2/0.1 0.3/0.5 0.3/0.3 0.2/0.1 322.8/1/549 793.6/0/549

12S 206 571 469/82.1 382/66.9 TIM2 +I+G 66519.833 32831.916 0.4/0.4 0.2/0.2 0.1/0.1 0.3/0.3 626.6/0/615 754.2/0/615

16S 174 592 443/74.8 382/64.5 TPM2uf +I+G 64338.811 31816.405 0.3/0.3 0.1/0.1 0.2/0.2 0.4/0.4 549.6/0.2/519 722.7/0/519

cytb 177 346 251/72.5 220/63.6 GTR +I+G 51714.423 25493.211 0.3/0.3 0.2/0.2 0.1/0.1 0.4/0.4 703.6/0/528 1027.3/0/528

Combined 214 3597 2262/62.8 1849/51.4 GTR +I+G 312107.864 155617.932 0.3/0.3 0.2/0.2 0.2/0.2 0.3/0.3 2930.8/0/639 3095.7/0/639

d.f., degrees of freedom.

64 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Sequence analyses

Newly generated sequences were edited in Sequen-

cher V. 4.9 (Gene Codes Corporation, Ann Arbor,

MI, USA), blasted with NCBI blast tools, and submit-

ted to GenBank (Table 2).

Multiple alignments were generated for each locus

using Muscle 3.8 (Edgar, 2004) with default parame-

ters, and reﬁned manually in terminal regions. The

positional homology of nucleotides in protein-coding

genes was constrained manually in BioEdit 7.0.5.3

(Hall, 1999) using the codon reading frame informa-

tion. For rDNA, we checked that our alignments

were congruent with published models of secondary

structure in insects (Flook and Rowell, 1997b; Buck-

ley et al., 2000; Page, 2000; Kjer, 2004), which was

the case for very conserved stems. Nevertheless, fol-

lowing the method proposed by Lutzoni et al. (2000),

three hypervariable and ambiguously aligned regions

(AARs), totalling 421 bp (positions 129–456, 548–556,

and 628–711 of the 28SD initial alignment) were iden-

tiﬁed in the 28SD fragment. We coded the AARs as

single multistate characters with the INAASE pack-

age (Lutzoni et al., 2000) for the parsimony analysis

and removed it from the likelihood and Bayesian

analyses.

We concatenated the different partitions with Se-

quenceMatrix 1.7.7 (Vaidya et al., 2011), which

resulted in an alignment of ~3600 bp (online Support-

ing Information).

Base composition, substitution rates, and rate het-

erogeneity across sites (Table 4) were estimated for

each dataset under the most likely model of evolution

suggested by the Akaike Information Criterion (AIC;

Akaike, 1973; Posada and Buckley, 2004) in jmoldel-

test 2.1.3 (Guindon and Gascuel, 2003; Darriba

et al., 2012). The constancy of base frequencies

across taxa was evaluated with a chi-square (v

)

“goodness of ﬁt” test using PAUP 4.0b10 (Swofford,

1995). Tests were performed with all sites and vari-

able sites only (Table 4) in order to assess the poten-

tial confounding effects of invariant sites (e.g.

Buckley et al., 2001).

Phylogenetic analyses

We conducted maximum parsimony (MP), maxi-

mum likelihood (ML) and Bayesian inference (BI)

analyses on separate and combined datasets to address

questions regarding the levels of homoplasy, tree

incongruence, and information content within and

among loci. We also conducted separate analyses to

check for obvious artefacts or contaminations. In

addition, we performed combined analyses (MP, BI)

of the whole dataset without the poorly documented

taxa Schizodactylus monstrosus and Comicus campes-

tris, to test their inﬂuence on the resultant topology.

Trees were visualized with FigTree 1.4.0. (http://tree.-

bio.ed.ac.uk/software/ﬁgtree/).

In a probabilistic framework, we used jModelTest

2.1.3 under the AIC to select the best model for each

marker among the models tested (Table 4). For all

markers, the best model was GTR +I+Γ. We did

not use though models mixing a proportion of invari-

ant sites (I) with a gamma distribution shape parame-

ter (Γ) because these two parameters are strongly

correlated (Sullivan et al., 1999; Yang, 2006). There-

fore each partition (i.e. marker) was analysed under a

GTR +Γmodel. We performed 500 ML replicates

under the rapid hill-climbing algorithm as imple-

mented in RAxML 7.4.2. (Stamatakis, 2006; Silvestro

and Michalak, 2012), branch lengths being estimated

together for all markers, and we selected the optimal

solution (with and without Schizodactylus monstrosus

and Comicus campestris). We ran two similar analyses

for the nuclear and mitochondrial partitions, respec-

tively. For the combined analyses, we also computed

bootstrap support values with 500 pseudoreplicates.

All these analyses were performed on a HP Z800

Workstation with 17.9 Gbits RAM and an Intel Xeon

CPU E5520, using seven threads.

The BI analyses (with and without Schizodactylus

monstrosus and Comicus campestris) were conducted

using the same model strategy with MrBayes 3.1.2

(Ronquist and Huelsenbeck, 2003) on the MNHN clus-

ter. We ran the analyses for 50 millions of generations

with the command stoprule =yes, sampling tree every

10 000 generations. We used Tracer 1.5 (Rambaut and

Drummond, 2009) to check that our effective sample

size was large enough for a meaningful estimation of

parameters and to assess the burn-in. Finally, we

checked for convergence of our results ensuring that

the potential scale-reduction factor approached 1.0 for

all parameters.

Heuristic searches, on nuclear and mitochondrial data,

separated or combined (with and without Schizodactylus

monstrosus and Comicus campestris), with or without the

coded AAR, were implemented in PAUP*under the MP

criteria with unordered (Fitch) characters, 100 random

sequence addition replicates, the TBR branch-swapping,

and gaps treated as missing data. Strict consensus trees

were then reconstructed. Support for internal branches

was assessed in PAUP*by nonparametric bootstrapping

(Felsenstein, 1985; Efron et al., 1996) with 100 pseudore-

plicates, using full heuristic searches with 10 random

addition sequence replicates, TBR branch swapping, and

one tree held at each step during stepwise addition (e.g.

DeBry and Olmstead, 2000).

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 65

0.2

Clade A

(Fig. 2)

Clade B

(Fig. 2)

Clade C

(Fig. 3)

Clade F

(Fig. 5)

Clade G

(Fig. 6)

CAELIFERA

1/100/100

1/100/89

1/93/-

1/99/64

1/100/93

1/100/98

1/33/57

0.96/24/-

0.95/81/74

0.69/47/-

1/100/88

0.99/63/59

1/6/-

0.93/55/70

Clade D (Fig. 4)

Clade E

(Fig. 4)

Fig. 1. Phylogeny of crickets based on 205 terminals and seven DNA markers, obtained by Bayesian inference. Support values (BI/ML/MP) are

indicated for the deeper nodes and the clades A to G. Taxa codes (i.e. voucher codes) as in Table 2, and made explicit in Figs 2–6.

66 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Taxonomic hypotheses

Although we sampled many cricket species, we con-

sider that we did not sample enough genera to accu-

rately represent cricket diversity below the subfamilial

level. The subfamilial rank is the classiﬁcation category

that has been most commonly retained by the succes-

sive authors of classiﬁcatory systems for crickets,

although they have been used in various systems com-

prising from one to thirteen families according to the

authors. For the sake of stability, and as a ﬁrst contri-

bution to cricket classiﬁcation, we consequently chose

to test the monophyly of the subfamilies currently used

in the OSF and to propose a new, phylogeny-based,

classiﬁcation of crickets from and above the subfami-

lial level.

Additional studies will be required to build compre-

hensive phylogenies below the subfamilial level. A

detailed analysis of the present results in terms of

cricket classiﬁcation will be published elsewhere (L. De-

sutter-Grandcolas, unpublished data).

Results

Sequence analyses

The sequences used have a high content of G/C (60–

80%) and A/T (70%) for the nuclear and mitochon-

drial DNA respectively (Table 4), in agreement with

values previously reported for other orthopterans (e.g.

Chintauan-Marquier et al., 2011, 2014) and insects in

general (Simon et al., 1994, 2006). Base frequencies

were constant for all nuclear partitions taking all sites,

and for the ribosomal nuclear partitions taking vari-

able sites only. Across all fragments, 2262 sites

(62.8%) were variable and 1849 sites (51.4%) were

parsimony-informative. The nuclear and mitochondrial

Clade A1

Clade A2

C-G

Clades

Derectaotus sp-Com

Ectatoderus sp-FGu

Gryllotalpa sp-Moz

Gryllotalpa sp1-PNG

M. Myrmophilina americanus

Ectatoderus sp-Mar

Ornebius xanthopterus

Xanthogryllacris punctipennis

Arachnocephalus vestitus

Ectatoderus brevipalpis

Malgasia sp-Com

Comicus campestris

Niphetogryllacris reunionis

Ceuthophilus sp-Que

Tachycines asynamorus

Lutosa sp-GDE

Ornebius sp-Gde

Myrmecophilus Myrmecophilus quadrispinus

Schizodactylus monstrosus

Gryllotalpa africana

Gryllotalpa sp2-PNG

Derectaotus sp-May

Cycloptiloides orientalis

1/74/-

1/100/89

1/100/81

1/100/82

0.83/67/77

0.89/78/-

1/99/64

1/93/-

0.54/56/-

1/100/100

1/100/98

0.99/47/-

1/100/98

1/100/100

0.99/63/59

0.2

0.98/47/-

1/100/-

1/99/-

1/98/-

Fig. 2. Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference: detailed topology for clades A and B (see

Fig. 1). Support values (BI/ML/MP) are indicated for all nodes. Ensiferan outgroups are displayed to show the position of the two schizodacty-

lid species, Comicus campestris Irish, 1986 and Schizodactylus monstrosus Drury, 1770 (squared). The analyses without these two taxa are pro-

vided as Supplementary Figs 15–17.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 67

partitions represent 47.1% and 52.9% of the informa-

tive sites, respectively. Models of evolution and associ-

ated parameters for the probabilistic analyses are

given in Table 4.

Phylogenetic analyses

For all phylogenetic methods, combining the nuclear

and mitochondrial data improved tree resolution and

nodal support (Figs 1–6; Figs S8–S10) by comparison

with separate analyses (e.g. Figs S1–S7). The nuclear

and mitochondrial partitions yielded very similar trees

(Figs S11–S14), except for a few taxa (namely sand

crickets and Pteroplistinae), the positions of which

remain unsupported in the combined analysis. The

addition of the coded AAR (in the MP analysis) had

no signiﬁcant effect on tree topologies. The MP, ML,

and BI methods yielded similar topologies for most of

the main clades (see below and Figs S8 and S10).

Removing Schizodactylus monstrosus and Comicus

campestris from the data did not modify the results of

the ML and BI analyses signiﬁcantly (see Figs S15 and

S16). In MP, it resulted in a less resolved strict consen-

sus that still shows most of the main clades (i.e. clades

A, B, C, D, E and F+G); a trifurcation between ensif-

eran outgroups, clade A and the rest of the crickets

forbids ﬁnding crickets sensu lato monophyletic.

Support values (posterior probabilities and nonpara-

metric bootstrap values) are given in Fig. 1 for the

deeper nodes, and in Figs 2–6 for the other nodes.

Our results with the complete data set (Fig. 1) sug-

gest that, within the monophyletic Ensifera, the crick-

ets sensu lato form a clade strongly supported in BI

(PP =1.00) and ML analyses (ML =93), provided

they include Schizodactylus. They are the sister group

to the other sampled Ensifera (i.e. Rhaphidophoridae,

Gryllacrididae, Anostostomatidae). The sand crickets

are not recovered as a monophyletic group: the genus

Comicus gathered with the Rhaphidophoridae (ML, BI

–Fig. 2; MP, Fig. S10), while Schizodactylus comes

within the ant-loving cricket clade. The position of

these two taxa may be, however, an artefact due

to incomplete data. Among the outgroups, the

Gryllacrididae are always monophyletic and sister-

group to the Anostostomatidae. All these relationships

are very well supported (PP ≥0.99). The analyses per-

D-G

Clades

Clade C1

0.2

Clade C2

Allonemobius fasciatus

Trigonidium (Trigonidomorpha) obscuripennis

Polionemobius affinis tabrobanensis

Hygronemobius amoenus

Svistella chekjawa

Anaxipha sp-Gde

Bullita sp-NC

Thetella sp-Com

Trigonidium sp-Moz

Homoeoxipha cf. lycoides

Trigonidium sp-Van

Eunemobius carolinus

Pteronemobius obscurior

Khoghiella sp-NC

Thetella sp-Mau

Cranistus sp-Mex

Natula longipennis

Nemobius sylvestris

Anaxipha affinis fuscocinctum

Nemobiinae n. gen-NC

Anaxipha affinis nitida

Trigonidium cicindeloides

Absonemobius guyanensis

Nemobiinae sp-Com

Paora sp-NC

Pteronemobius heydeni

Cophonemobius faustini

Pteronemobius sp-Moz

Amusurgus sp-Van

Rhicnogryllus viettei

1/96/75

1/83/-

1/72/-

0.57/56/56

0.62/100/64

0.81/-/-

1/100/100

0.82/55/-

1/100/88

1/100/75

0.95/61/-

1/99/83

1/100/100

1/92/58

1/100/100

0.88/56/-

1/100/100

1/97/98

1/97/96

1/81/-

1/100/100

1/100/85

1/100/100

0.54/-/-

0.78/65/-

1/97/97

0.94/44/85

Fig. 3. Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference: detailed topology for clade C (see Fig. 1).

Support values as in Fig. 2.

68 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

0.2

F-G

Clades

1/100/97

0.99/72/-

1/94/84

0.99/75/51

1/97/71

1/100/100

1/100/98

0.96/63/- 1/91/84

0.54/64/-

0.87/-/-

0.99/84/-

1/97/74

1/92/-

0.97/58/-

1/100/89

1/93/67

1/100/99

1/58/-

1/-/-

1/83/-

0.97/89/77

0.93/55/70

1/100/100

1/70/-

1/82/-

0.97/67/-

1/98/98

1/100/100

1/80/-

1/92/-

0.82/58/-

1/100/100

1/94/52

1/97/100

1/90/76

1/54/67

0.98/-/-

0.97/54/-

0.43/-/-

0.92/-/-

0.7/75/-

0.95/42/-

0.97/88/77

0.73/-/-

0.95/81/74

0.78/-/-

0.93/-/-

0.66/-/55

1/71/60

0.91/-/90

1/100/100

0.85/-/64

1/100/100

1/99/100

0.45/-/60

1/67/-

1/100/100

0.8/61/-

0.99/37/-

0.88/62/-

1/90/-

1/97/86

1/99/83

1/80/-

1/100/100

Pseudotrigonidium noctifolium

Phaloriinae sp-Indo

Uvaroviella Aclodes scandens

Phaloriinae sp-Phi

Megacris lipsae

Phaloriinae sp3-PNG

Phaloria chopardi

Phaloriinae sp1-PNG

Afrophaloria amani

Singapuriola separata

Tremellia sp-PNG

Phaloriinae sp2-PNG

Uvaroviella Aclodes spelaea

Uvaroviella Paraclodes guyanensis

Kevanacla orientalis

Caltathra affinis doensis

Aclella nova

Brevizacla molisae

Ectecous sp-FGu

Yoyuteris iviei

Strogulomorphini sp-CR

Unithema guadelupensis

Mikluchomaklaia sp-PNG

Silvastella fuscofasciata

Petaloptila aliena

Silvastella grahamae

Gryllomorpha dalmatina

Paragryllodes sp-Com

Protathra centralis

Rumea guyanensis

Paragryllodes sp-Mad

Petaloptila andreini

Paragryllus martini

Superacla choreutes

Caltathra sp-NC

Leptopedetes idalimos

Opiliosina meridionalis

Phaeogryllus fuscus

Homoeogryllus orientalis

Homoeogryllus gabonensis

Meloimorpha japonica yunnanensis

Noctivox sp-Mex

Kempiola flavipunctatus

Parendacustes n. sp-Indo

Amphiacusta caraibea

Socotracris kleukersi

Phaeophilacris sp-Com

Parendacustes makassari

Stalacris sp-Swa

Acantoluzarida nigra

Luzaridella clara

Prosthama tesselata

Philippopsis guianae

Phaeophilacris spectrum

Lernecella sp-GDE

Phaeophilacris sp-CAR

Niquirana phyxelis

Lernecella minuta

Phalangopsis flavilongipes

Miogryllodes hebardi

Phaeophilacris sp-Gha

Aracamby n.sp-Bra

Amusodes sp affinis estrellae

Lerneca fuscipennis

Luzara brevipennis

Luzaridella obscura

Luzarida grandis

Microlerneca leticia

Parendacustes lifouensis

Pteroplistes masinagudi

Clade E1

Clade E2Clade E3Clade E4Clade E5

Fig. 4. Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference: detailed topology for clades D and E (see

Fig. 1). Support values as in Fig. 2.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 69

formed without the partition 28SD gave the same rela-

tionships with a weaker support (0.5 <PP <0.7) (Fig.

S9).

Within the cricket clade (Figs 2–6), three main

clades are identiﬁed. They correspond to (i) ant-loving

crickets and mole crickets (Clade A), (ii) scaly crickets

(plus the Malagasy genus Malgasia) (clade B), and (iii)

true crickets, separated into ﬁve clades named C to G,

with the clade C being the sister group to all the oth-

ers. These clades and this structure are recovered in all

analyses: all the clades have a very high PP, but clades

E, F and G are not so well supported in MP and ML,

as are their internal relationships. The main differences

concern the clades F and G in MP (see infra) and in

the position of clade D: in ML, the clade D is the sis-

ter group of all true crickets (Fig. S8), while it is the

sister group of the clade (E +F+G) in MP and BI

(PP =0.69, Fig. 1; Fig. S10); in ML analysis per-

formed without the marker 28SD, the clade D is the

sister group of the clade C (PP =0.58, Fig. S9).

Within clade A (Fig. 2), the mole crickets and the

ant-loving crickets (+Schizodactylus) form two very

well-supported clades (A1 and A2, PP =1.00 for

both). Clade B, gathering the scaly crickets and Mal-

gasia (Fig. 1, PP =1.00), is subdivided into two sister

groups, with Malgasia nested within one of them,

which invalidates the separation of Malgasia as a sepa-

rate subfamily. Clade C (Fig. 3, PP =1.00) is made of

two very well-supported sister groups, which comprise

all the sampled species of the subfamilies Trigonidiinae

(clade C1, PP =1.00) and Nemobiinae (clade C2,

PP =1.00), at the exception of the genus Hemigryllus

Saussure, 1877, which is nested in clade G. The

current tribes of Trigonidiinae are not found to be

Clade A

Clade B

Clade C

Clade D

Clade E

Orocharis aff. lividus

Oecanthus sp-FGu

Oecanthus sp-Com

Mistshenkoana sp-Van

Diatrypa sp-FGu

Adenopterus Archenopterus sp-NC

Matuanus caledonicus

Fryerius sp-Com

Neometrypus sp-FGu

Euscyrtus bivittatus

Munda affinis asyrinx

Euscyrtus affinis bipunctatus

Adenopterus Archenopterus sp-NC

Calscirtus amoa

Proturana subapterus

Antillicharis maximus

Aphonomorphus sp-FGu

Cearacesaini sp-Bra

Tafaliscina sp-FGu

Paroecanthus sp-FGu

Truljalia sp-Chi

Cearacesa n.sp-Bra

Aphon. Euaphonus sp-FGu

Oecanthus chopardi

Phyllogryllus n.sp-Gde

Laurepa sp-GDE

Hapithinae n.gen-Ven

Hapithus sp-Mex

Prozvenella bangalorensis

0.98/78/-

1/76/-

0.45/-/-

1/96/- 0.49/-/-

0.95/-/-

1/6/-

0.96/96/90

1/74/-

0.89/-/-

1/54/-

1/100/94

1/95/64

1/100/98

0.84/-/-

1/100/98

1/100/100

0.72/53/100

1/33/57

0.97/-/-

1/100/100

1/62/-

1/56/-

1/97/89

1/100/100

1/84/-

1/100/55

1/100/100

1/93/77

Clade F1

Clade F2

Clade F3

Clade F4

Clade F5

Clade G

Clade F

0.2

Fig. 5. Phylogeny of crickets based on 205 terminals and seven DNA markers in BI: detailed topology for clade F (see Fig. 1). Support values

as in Fig. 2.

70 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Clade A

Clade B

Clade D

Clade F

Clade E

Clade G1

Clade G2

Clade G3

Clade G4

Clade G

Clade C

0.98/41/-

0.96/24/-

1/77/62

0.72/76/92

0.99/39/-

0.97/70/89

0.7/57/-

0.89/27/-

1/57/-

0.63/68/-

1/100/93

1/100/100

0.75/-/-

0.7/37/-

1/99/91

0.94/-/-

1/100/100

1/100/93

1/89/82

1/100/100

1/56/-

1/100/100

0.5/23/-

0.99/65/-

0.89/-/-

0.51/50/-

0.91/-/-

1/49/-

0.98/51/-

0.61/-/-

0.99/33/-

0.99/48/-

1/100/100

0.98/33/-

1/53/62

0.9/-/-

0.99/54/-

1/94/91

1/100/97

0.69/-/-

0.91/-/-

1/85/85

0.43/13/-

0.96/28/-

1/100/100

1/89/52

1/86/56

0.94/-/-

0.99/74/-

0.52/-/-

1/99/88

0.97/79/62

1/71/-

0.76/16/-

0.79/60/-

0.5/8/-

1/62/59

1/57/-

0.98/82/-

Arilpa gidya

Lepidogryllus comparatus

Xenogryllus marmoratus

Eurepini sp-Aus

Eugryllodes pipiens

Teleogryllus sp-India

Modico. Eumodicogryllus bordigalensis

Landreva n.sp-India

Sclerogryllus sp-India

Microlandreva n.sp-May

Apterogryllus sp-Van

Anurogryllus muticus

Modicogryllus siamensis

Xenogryllus eneopteroides

Ganoblemmus rasilis

Lebinthus luae

Gialaia strasbergi

Itaropsis tenella

Plebeiogryllus guttiventris

Lebinthus santoensis

Turanogryllus sp-IND

Ponca venosa

Acheta rufopictus

Gryllinae sp-Moz

Hemigryllus sp-FGu

Pentacentrus cf biroi

Zebragryllus nouragui

Cardiodactylus novaeguineae

Landrevini sp-PNG

Gymnogryllus sp-PNG

Tarbinskiellus sp-India

Agnotecous tapinopus

Svercus palmetorum

Taciturna baiderae

Brachytrupes membranaceus

Orthoxiphus sp-Com

Loxoblemmus sp-Indo

Brasilodontus riodocensis

Coiblemmus sp-IND

Ligypterus fuscus

Miogryllus verticalis

Swezwilderia sp-Fid

Cophogryllus sp-India

Acheta domesticus

Nisitrus vittatus

Paranisitra longipes

Cardiodactylus kondoi

Gryllodes sigillatus

Gryllus bimaculatus

Myara sordida

Creolandreva crepitans

Notosciobia n.sp-NC

Eurepella moojerra

Velarifictorus sp-India

Odontogryllus setosus

Eneoptera guyanensis

Eurepa marginipennis

Phonarellus minor

Sciobia finoti

Anur. Urogryllus sp-FGu

0.2

Fig. 6. Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference: detailed topology for clade G (see Fig. 1).

Support values as in Fig. 2.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 71

monophyletic, as the Phylloscyrtini, represented by

Cranistus sp., are nested within the Trigonidiini.

Nemobiinae separates into two groups (PP =1.00,

both): the ﬁrst one includes mostly Pteronemobiini,

whereas the second includes mostly Nemobiini. This

result supports the monophyly of these two tribes, pro-

viding that Absonemobius is transferred from the

Pteronemobiini to the Nemobiini. Also, the nested

position of the genus Thetella in the Nemobius group

invalidates the Thetellini tribe. The genus Cophonemo-

bius, not classiﬁed in the OSF, is nested within the

Nemobius group. In MP topology, the pteronemobiine

genus Allonemobius is the sister group of the Nemobius

clade, while Absonemobius is nested within the pterone-

mobiine clade (Fig. S10).

Clade D (Fig. 4) comprises the crickets belonging

to the tribe Pteroplistini of the subfamily Pteroplisti-

nae. This small clade is very well supported, unlike

its exact position within crickets (PP <0.7 –Fig. 1;

Figs S8–S10). Clade E (Fig. 4, PP =0.93) includes

mostly taxa presently classiﬁed in the “Phalangopsi-

nae subfamily group”. It comprises ﬁve well-sup-

ported clades (E1 to E5), recovered in all analyses

(except E1 in MP). The species Parendacustes lifouen-

sis is the sister group of Trigonidiinae +Nemobiinae

on ML topology, and nested with taxa of clade E2

on MP topology: this position maybe due to a lack

of data, this taxon being here documented for 12S

and cytb only. The clades E1 to E5 do not ﬁt with

the subfamilies of the “Phalangopsinae subfamily

group”, which are all but one (viz. Phaloriinae)

recovered as polyphyletic. Moreover, the genera

Gryllomorpha and Petaloptila, which are currently

classiﬁed in the tribes Gryllomorphini and Petalopte-

lini of the Gryllomorphinae subfamily inside the

“Gryllinae subfamily group”, are clearly nested within

clade E.

Clade E1 (PP =0.99) comprises genera classiﬁed in

the Phaloriinae (i.e. Afrophaloria,Phaloria,Pseudotri-

gonidium and Tremellia), together with the genera

Megacris, not assigned to a subfamily in the OSF but

originally described as a Phaloriinae.

Clade E2 (PP =1.00) comprises two sister clades.

The ﬁrst one corresponds to the wide Neotropical

genus Uvaroviella (Phalangopsinae, Phalangopsini),

and the second includes taxa classiﬁed in the polyphy-

letic Endacustini tribe (Paragryllodes,Protathra) and

all the sampled taxa presently classiﬁed in the Para-

gryllinae. This second clade (PP =1.00) could be con-

gruent with the deﬁnition of several taxonomic groups

described as tribes or subtribes, that is, Paragryllini

(Paragryllus), Benoistellini (Silvastella), Rumeini (Ru-

mea), and a mix of Neoaclini +Strogulomorphini

(Aclella,Superacla,Kevanacla,Ectecous,Unithema,

Strogulomorphini sp, Yoyuteris).

Clade E3 (PP =0.97) includes all sampled Gryllo-

morphini except Eugryllodes (nested in clade G4), in

addition to Phaeogryllus (classiﬁed in Phalangopsinae,

Heterogryllini), Meloimorpha and Homoeogryllus

(Cachoplistinae, Homoeogryllini), and Socotracris

(Phalangopsinae).

Clade E4 (PP =0.93) gathers Stalacris and Opiliosi-

na (respectively classiﬁed within the “Phalangopsinae

subfamily group” and the Phalangopsinae subfamily),

with Parendacustes (Phalangopsinae, Phalangopsini),

Kempiola (Cachoplistinae, Homoeogryllini), Leptopede-

tes,Amphiacusta and Noctivox (Luzarinae, Amphiacu-

stina), and the wide African genus Phaeophilacris

(“Phalangopsinae subfamily group”, Endacustini).

Internal relationships of clade E4 are strongly sup-

ported, except for the sister relationship between the

neotropical Amphiacustina and Phaeophilacris

(PP <0.5).

Clade E5 includes all the sampled taxa presently

classiﬁed in the subfamily Luzarinae, except Amphiacu-

sta,Leptopedetes, and Noctivox (in clade E4). Apart

from Lernecella and Miogryllodes, the positions of

which within the clade are weakly supported

(PP <0.8), the internal structure of E5 is strongly sup-

ported: a clade made of Phalangopsis and Philippopsis

(PP =1.00; Phalangopsinae, Phalangopsini) is the sis-

ter group of a clade comprising on one hand Arac-

amby,Lerneca,Microlerneca,andProstama

(PP =0.97), and on the other hand Luzara,Luzarida,

Acantoluzarida,Luzaridella,Niquirana, and Amusodes

(PP =1.00) (all Luzarinae).

In the MP topology (Fig. S10), clades E4 and E5

vary for the position of Lernecella and Miogryllodes.

Clade F (Fig. 5, PP =1.00) broadly corresponds

to the “Podoscirtinae subfamily group”; it is com-

posed of ﬁve main clades, which correspond roughly

to ﬁve subfamilies used in the OSF, provided their

content and deﬁnition are slightly modiﬁed. Clade

F1 (PP =1.00) is the sister-group of the other clades

and corresponds to the Euscyrtinae (“Podoscirtinae

subfamily group”). Clades (F2 +F3) and (F4 +F5)

are sister-groups (PP =0.95), with a weak (PP <0.5)

and strong (PP =1.00) support, respectively. Clade

F2 (PP =0.97) includes the Oecanthinae (not classi-

ﬁed), whereas clade F3 (PP =1.00) includes the gen-

era Neometrypus,Paroecanthus, Tafalisca,and

Diatrypa, which are today scattered in three different

tribes of the Podoscirtinae subfamily (Podoscirtini

Neometrypina, Paroecanthini Paroecanthina and

Tafaliscina, and Aphonoidini Diatrypina, respec-

tively). Clade F4 (PP =1.00) includes the

Podoscirtinae (minus the taxa listed above), and

clade F5 (PP =1.00) corresponds to the Hapithinae

plus some of the taxa presently classiﬁed in the

Eneopterinae.

72 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Finally, Clade G (Fig. 6) is strongly supported

(PP =0.96), but its internal relationships are not all

well supported. Four clades proposed by our results

partially cover the “Gryllinae subfamily group” used

in the OSF, but do not support the monophyly of the

subfamilies. Only two clades (G3, G4) are well sup-

ported (PP ≥0.96), the other two (G1, G2) having a

support <0.7. Clade G1 includes taxa currently classi-

ﬁed either in the Pentacentrinae (“Podoscirtinae sub-

family group”) or in the Landrevinae (“Gryllinae

subfamily group”). Clade G2 includes taxa once clas-

siﬁed in the tribe Odontogryllini (since then synony-

mized with the Landrevini), together with the genus

Hemigryllus, currently classiﬁed in the Nemobiinae

(see clade C2). Clade G3 includes the Eneopterinae

sensu stricto. Four tribes among the ﬁve acknowl-

edged today are recovered as monophyletic, the Ene-

opterini being polyphyletic, and the genus

Swezwilderia, classiﬁed as incertae sedis in the OSF, is

nested within the Lebinthini. Clade G4 includes two

monophyletic groups: the ﬁrst includes some Landre-

vinae (but see above, clade G1) and the taxa presently

classiﬁed in the Gryllinae, Sclerogryllinae, and Gryllo-

morphinae pro parte (p.p.) (genus Eugryllodes); the

second shows a sistership relation between Eugryllodes

and all the other taxa (minus the grylline genus Tacit-

urna). Finally, none of the sampled tribes of the Gryl-

linae subfamily (Cephalogryllini, Cophogryllini,

Gryllini, Modicogryllini, Sciobiini, Turanogryllini) are

recovered as monophyletic, the genera Cophogryllus,

Sciobia,andTuranogryllus being nested among the

other genera.

In the MP topology (Fig. S10), the clades F and G

are not sister-groups, but they form a paraphyletic

assemblage, where the clades F1 (Euscyrtinae), F3

(Tafaliscinae), F4 (Podoscirtinae) and F5 (Hapithinae)

are recovered, while the clades F2 (Oecanthinae), G1

(Pentacentrinae +Landrevinae p.p.) and G4 (Grylli-

nae +Sclerogryllus +Eugryllodes) are almost recov-

ered.

Figure 7 and Table 5 sum up how our results sup-

port the currently used classiﬁcation of crickets. We

can distinguish four different situations, according to

the congruence between the OSF classiﬁcation and our

phylogenetic hypothesis (Table 5): (i) groups recovered

as monophyletic in their current meaning; (ii) groups

that could be recovered as monophyletic providing

minor changes in cricket classiﬁcation (most often, this

means to move a few genera from one clade to

another); (iii) groups recovered as polyphyletic; (iv)

groups (most often isolated genera) nested within lar-

ger clades. Six subfamilies are thus monophyletic (Eus-

cyrtinae, Oecanthinae, Phaloriinae, Pteroplistinae,

Trigonidiinae, Gryllotalpinae), while ﬁve others are

almost recovered as monophyletic (Gryllinae, Paragryl-

linae, Nemobiinae, Mogoplistinae, Myrmecophilinae).

Discussion

Monophyly of the cricket clade, and its main

subdivisions

Our results are congruent with the current grouping

of crickets and their allies: in all analyses, crickets,

scaly crickets, ant-loving crickets, and mole crickets

are grouped together, attesting this long-lasting

hypothesis. Schizodactylus and Comicus, currently

gathered in the ensiferan family Schizodactylidae (sand

crickets), are not monophyletic here, a result that

could be an artefact, ensuing from an incomplete data

set for the sand crickets (Table 2). Overall, our data

conﬁrm the phylogenetic afﬁnity of sand crickets with

crickets sensu lato, but are insufﬁcient to propose a

clear phylogenetic pattern of basal relationships

between the cricket clade and its potential sister group

(but see Song et al., 2015).

The cricket clade is composed of seven main mono-

phyletic groups (Fig. 1, clades A to G). These clades,

together with their main subdivisions, support part of

the currently hypothesized families, “subfamily

groups”, or subfamilies (Fig. 7 and Table 5).

The higher rank categories, that is, families or “sub-

family groups”, correspond to the broad morphologi-

cal categories used since the beginning of modern

cricket classiﬁcation. Three of the four families used in

the OSF are recovered as monophyletic (Table 5,

Fig. 7), but their relationships are not consistent with

a similar taxonomic level (see below). These families

are: the mole crickets (OSF Gryllotalpidae), the scaly

crickets (OSF Mogoplistidae), and the true crickets

(OSF Gryllidae). The monophyly of the fourth family,

the Myrmecophilidae, sampled here for the Myrmeco-

philini tribe only, is also well supported in the analyses

without Schizodactylus (see above and Figs S15–S17).

Out of the three “subfamily groups” used in the OSF,

only one corresponds to a well-supported clade (“Pha-

langopsinae subfamily group”, clade E); the “Podo-

scirtinae subfamily group” and the “Gryllinae

subfamily group” are included in our clades F and G

respectively.

Among the 22 sampled subfamilies, only six are

monophyletic, that is, the Gryllotalpinae, Trigonidii-

nae, Pteroplistinae, Euscyrtinae, Oecanthinae (sampled

here for the Oecanthini tribe only), and Phaloriinae.

They correspond to the smallest groups currently rec-

ognized in terms of cricket classiﬁcation, except the

Trigonidiinae, and the most homogeneous morpholog-

ically. All the other subfamilies are para- or polyphy-

letic. Some “nearly monophyletic” subfamilies

correspond to morphologically well-characterized

groups, the deﬁnitions for which have been made con-

fused by the wrong placement of a few genera: their

monophyly may be obtained with slight taxonomic

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 73

Mogoplistinae

+ Malgasiinae

Trigonidiinae

Nemobiinae

Phaloriinae

Phalangopsinae

Endacustini

Paragryllinae

Gryllomorphinae

Phalangopsinae

Cachoplistinae

Endacustini

Phalangopsinae

Luzarinae

Phalangopsinae

Luzarinae

Euscyrtinae

Podoscirtinae

Hapithinae

Podoscirtinae

Oecanthinae

Eneopterinae

Sclerogryllinae

Gryllomorphinae

Pentacentrinae

Landrevinae

Pteroplistinae

Gryllinae

Family Trigonidiidae

Family Phalangopsidae

Family Gryllidae

Subfami ly Pteroplistinae incertae sedis

Family Mogoplistidae

Family Myrmecophilidae

Family Gryllotalpidae

Cachoplistinae

Paragryllinae

Nemobiinae

Gryllinae

Superfamily GRYLLOTALPOIDEA

Superfamily GRYLLOIDEA

Luzarinae

Phalangopsinae

Endacustini

Podoscirtinae

Hapithinae

Fig. 7. Phylogeny of crickets based on 205 terminals and seven DNA markers in Bayesian inference, and derived classiﬁcation of crickets, with two su-

perfamilies (Gryllotalpoidea, Grylloidea), including, respectively, two (Gryllotalpidae, Myrmecophilidae) and four families (Mogoplistidae, Trigoni-

diidae, Phalangopsidae, Gryllidae). The current position of each terminal species in the subfamilies used by the OSFis indicated on the right of the tree.

74 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

changes, that is, provided some particular genera are

moved from their current deﬁnition in the OSF. This

is the case of the Nemobiinae, which form a well-sup-

ported clade, from which the genus Hemigryllus is

excluded. Gorochov (1986) and Desutter (1987, 1988)

previously suggested that Hemigryllus is not a Nemo-

biinae: Gorochov (1986) had erected the Hemigryllinae

subfamily within an “Eneopteridae group” comprising

the Eneopterinae, Landrevinae, and Phalangopsinae,

and Desutter (1987, 1988) had tentatively placed

Hemigryllus within the newly erected Tafaliscinae sub-

family comprising the Neotropical Tafaliscini, Paroe-

canthini, Neometrypini, and Diatrypini. In the same

way, the genus Malgasia is nested within the Mogo-

plistinae from which it cannot be separated as a dis-

tinct subfamily. The Pentacentrinae are monophyletic

provided they include some genera currently classiﬁed

within the Landrevinae, a reorganization suggested by

several morphological characters (S. Hugel, unpub-

lished data). However, because these two subfamilies

belong to different “subfamily groups”, this modiﬁca-

tion implies their complete reassessment. Finally, the

Eneopterinae are monophyletic provided that they are

narrowed according to Robillard and Desutter-

Grandcolas (2008); the genera added in this group by

Otte and Perez-Gelabert (2009) must be transferred to

the Hapithinae.

The other subfamilies should be more deeply reas-

sessed: the Gryllinae should include the Sclerogryllinae

and some of the Gryllomorphinae (at least Eugryllodes

among the sampled genera). The Luzarinae, Phalang-

opsinae, Cachoplistinae, and Paragryllinae of the

“Phalangopsinae subfamily group” should be fully

redeﬁned and the genera reclassiﬁed. The subfamilies

proposed by Gorochov (2014) for the “Phalangopsinae

subfamily group” on a taxonomic basis are not vali-

Table 5

Results of the phylogenetic test of the current classiﬁcation used in the OSF, and its potential match with the phylogenetic topology

OSF classiﬁcation Topology

OSF Families/Subfamilies Monophyly status Resultant clades

GRYLLIDAE

“Gryllinae subfamily group”

Gryllinae Monophyletic without Gryllomorpha,

Petaloptila, and with Sclerogryllus

Included in clade G4

Gryllomiminae Not tested (1 genus) –

Gryllomorphinae Polyphyletic Dispatched in clades E3 and G4

Itarinae Not tested (2 genera) –

Landrevinae Polyphyletic Dispatched in clades G1, G2 and G4

Sclerogryllinae Nested clade Included in clade G4

“Podoscirtinae subfamily group”

Euscyrtinae Monophyletic Equal to clade F1

Hapithinae Polyphyletic Included in clade F5

Podoscirtinae Polyphyletic Dispathed in clades F3, F4 and F5

Pentacentrinae Polyphyletic Included in clade G1

No hypothesized “subfamily group”

Eneopterinae Nested clade Dispatched in clades F5 and G3

Oecanthinae Monophyletic Equal to clade F2

“Phalangopsinae subfamily group”

Cachoplistinae Polyphyletic Dispatched in clades E2, E3 and E4

Luzarinae Polyphyletic Dispatched in clades E1, E4 and E5

Paragryllinae Monophyletic with Caltathra and Protathra Included in clade E2

Phalangopsinae Polyphyletic Dispatched in clades E2, E3, E4 and E5

Phaloriinae Monophyletic Included in clade E1

Pteroplistinae Monophyletic Equal to clade D

Endacustini Polyphyletic Dispatched in clades E2 and E4

No hypothesized “subfamily group”

Nemobiinae Monophyletic without Hemigryllus Dispatched in clades C2 and G2

Trigonidiinae Monophyletic Equal to clade C1

MOGOPLISTIDAE

Malgasiinae Nested clade Included in clade B

Mogoplistinae Monophyletic with Malgasia Included in clade B

GRYLLOTALPIDAE

Gryllotalpinae Monophyletic Equal to clade A1

Scapteriscinae Not tested (2 genera) –

MYRMECOPHILIDAE

Myrmecophilinae Paraphyletic due to Schizodactylus, otherwise monophyletic Included in clade A2

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 75

dated here, his “Phalangopsinae” gathering taxa

belonging to our clades E2, E4, and E5. The position

of the taxa yet to be classiﬁed within the Podoscirtinae

and the Hapithinae of the “Podoscirtinae subfamily

group” should be revised.

At a lower taxonomic level, most of the 37 sampled

tribes are para- or polyphyletic. These non-monophy-

letic tribes belong to the “Phalangopsinae subfamily

group”, the “Podoscirtinae subfamily group”, and the

“Gryllinae subfamily group”, which are scattered

across our clades E, F and G, but also to the Trigoni-

diinae and the Nemobiinae (clade C).

The vast majority of the phylogenetic relationships

discussed above are well supported (PP >0.80), except

for the deﬁnition of the clades F and G (see above).

These results will imply deep modiﬁcations in the cur-

rent cricket classiﬁcation, even if the general frame-

work looks preserved. The bulk of cricket diversity

will have to be reorganized to design a phylogeny-

based classiﬁcation of crickets, which also calls for a

reassessment of the morphological characters used to

deﬁne the different taxa.

Laying the foundation of a phylogenetic classiﬁcation

Our results (Fig. 7) support the monophyly of the

cricket clade (Schizodactylus), and its subdivision

into two main clades: mole crickets and ant-loving

crickets on the one hand, and all the other crickets on

the other. In the framework of the OSF classiﬁcation

of Ensifera, the separation of (Gryllotalpidae +Myrm-

ecophilidae) from the Grylloidea justiﬁes the erection

of a superfamily Gryllotalpoidea Leach, 1815, while

the Grylloidea Laicharting, 1781 is restricted to scaly

crickets and true crickets. The whole cricket clade

should consequently be elevated at the infraorder level,

that is, the Gryllidea, as proposed by several authors

in the past (Vickery, 1977; Desutter, 1987, 1988; Go-

rochov, 1995; see also Song et al., 2015). The mono-

phyly of Gryllidea, which is ascertained here for extant

taxa, will have to be checked relative to ensiferan fos-

sils, with a reanalysis of morphological characters in

fossils and extant taxa (see B

ethoux and Nel (2002)

for fossil taxa only).

A very similar classiﬁcation was proposed by Vic-

kery (1977), who kept, however, the Myrmecophilidae

within the Grylloidea. Gorochov (1995) separated the

Gryllotalpidae and possibly the Myrmecophilidae from

the Mogoplistidae and all other crickets within the

Gryllidea, but put Malgasia in a subfamily of the

Myrmecophilidae. Also his Gryllidea included both

extant and fossil taxa, but some of his clades were pa-

raphyletic (see Gorochov, 1995, his ﬁg. 1149).

Within the Grylloidea sensu stricto, we propose to

consider four families: the Mogoplistidae Brunner von

Wattenwy, 1873 (clade B), the Trigonidiidae Saussure,

1874 (clade C), the Phalangopsidae Blanchard, 1845

(clade E), and the Gryllidae Laicharting, 1781 (clade

F+G). The ﬁrst three are robust and highly supported,

while the latter has variable support and its inner struc-

ture needs to be studied more deeply. Clade D (Ptero-

plistinae Chopard, 1936), which is supported by all

analyses but its phylogenetic position remains unstable,

should be kept incertae sedis within Grylloidea. These

families ﬁt variously with morphological characters.

The monophyly of the Trigonidiidae, and of their

two traditional subfamilies, the Trigonidiinae and the

Nemobiinae (without Hemigryllus), is corroborated by

many morphological characters (Gorochov, 1986; Des-

utter, 1987, 1988). The morphological deﬁnition of the

Phalangopsidae, which has been recognized as a main

cricket group since Blanchard (1845), will have to be

checked to take into account at least Gryllomorpha

and Petaloptila, and possibly other genera of the Petal-

optilini tribe. Finally, the Gryllidae, as deﬁned here, is

not compatible with the morphological characters

currently used: it will have to be reanalysed to clarify

the situation. Except for the Trigonidiinae and

Nemobiinae (Desutter, 1987, 1988), the Eneopterinae

(Robillard and Desutter-Grandcolas, 2008), and the

Pentacentrinae (S. Hugel, unpublished data), the puta-

tive subfamilies will have to be reconsidered from the

point of view of their morphological diagnosis, a valid

concern for nearly all the groups of crickets below the

familial rank (L. Desutter-Grandcolas, unpublished

data).

The classiﬁcation system proposed here ﬁts the

structure of the phylogeny better than the OSF, and

uses the best-supported clades as a backbone for a

future classiﬁcation of crickets. It is intermediary

between the very split system proposed by several

authors, with up to 12 or 13 hypothesized families

(Bruner, 1916; Chopard, 1949; Vickery, 1977; McE

Kevan, 1982; Desutter, 1988), and the lumped system

with all crickets gathered in one family subdivided in

as many subfamilies (Scudder, 1897; Otte and Alexan-

der, 1983). This system is not incompatible with the

OSF, but beyond an apparent consistency, the classiﬁ-

cation of crickets needs to be deeply revised to achieve

a classiﬁcation system that accommodates monophy-

letic units of evolution.

Laying the foundation of future evolutionary studies

The proposed phylogenetic hypothesis brings new

perspectives for understanding cricket evolution, espe-

cially on communication, for which these insects are

important models (Gerhardt and Huber, 2002).

Acoustic evolution in Ensifera should be reconsid-

ered, as previous analyses of acoustic evolution in En-

sifera focused on the structural homology between

crickets sensu lato on the one hand, and katydids (Tet-

76 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

tigonioidea) on the other. The question was then to

decide whether acoustic communication has evolved

once (ancestral communication) or twice (convergent

evolution) within Ensifera as a whole: “crickets” being

considered an acoustically homogeneous group (see

e.g. Bailey, 1991). Structural analyses of forewing vena-

tion revealed an unsuspected diversity in crickets sensu

lato, supporting a hypothesis of convergence between

the mole crickets and the crickets sensu stricto; in other

words, the primary homology hypothesis was not

supported (Desutter-Grandcolas, 2003; Desutter-

Grandcolas et al., 2005; but see B

ethoux, 2012). By

deﬁnition, such a hypothesis cannot be tested by a phy-

logeny, but it may imply more or less complex patterns

of character change according to the phylogenetic

topology. Our present phylogeny is parsimoniously

consistent with the convergence hypothesis between

crickets and mole crickets, and is also consistent with

the fact that crickets sensu lato may have structurally

diverse acoustic structure (see below); their early acous-

tic evolution may then not have been straightforward,

especially as acoustic communication may have devel-

oped in Ensifera within a general framework of com-

munication by vibration and/or sound (Desutter-

Grandcolas, 2003 and references therein; Strauss and

Lakes-Harlan, 2008a,b; Stritih and Cokl, 2012).

Crickets sensu stricto moreover present a wide

acoustic diversity, both in terms of structures and in

terms of functional properties. The few species used to

generate the basic model of sound production in crick-

ets, that is, Acheta,Gryllus,orTeleogryllus grylline

species (Nocke, 1972; Elliott and Koch, 1985; Mont-

ealegre-Z et al., 2011; but see Bennet-Clark and Bailey,

2002), all belong to a small apical group nested within

our clade G. Recent bioacoustic analyses of more dis-

tantly related Eneopterinae species questioned this

basic cricket model: Eneopterinae emit high-frequency

calls using the second or third harmonic as a dominant

frequency (Robillard et al., 2013), or produce several

kinds of syllables using complex stridulatory behav-

iours and structures (Robillard and Desutter-Grandc-

olas, 2011b). Yet, Eneopterinae are quite close to

Gryllinae, both belonging to clade G, and the two

groups taken together do not reﬂect the high diversity

of sound-production structures in crickets. For exam-

ple, the sound generating system of an Oecanthus spe-

cies analysed with laser Doppler vibrometry proved

recently really different from the usual cricket model

when considering the vibratory properties of the wings

(Mhatre et al., 2012). To further study cricket bio-

acoustics, good targets to begin with could be the

Trigonidiidae, the sister group of all other crickets,

and non-mute Phalangopsidae, the sister group of our

Gryllidae. These two groups have very peculiar stridu-

lums that do not ﬁt well with the usual acoustic struc-

tures of crickets according to the current basic model

of sound production. Trigonidiidae are characterized

by a wide harp area, crossed by one vein and bordered

by a high diagonal vein that may extend the resonant

area of the wing to almost the whole forewing surface

(Desutter-Grandcolas and Nischk, 2000). Yet, Trigoni-

diidae emit either very loud calls (Trigonidiinae), or

soft, courting-like calls (Nemobiinae): this situation

reﬂects the presence versus absence of the mirror on

the forewings, whereas this structure is supposed to be

inactive in sound radiation (e.g. Nocke, 1972; Bennet-

Clark, 2003; Montealegre-Z et al., 2011). In addition,

many Phalangopsidae have a corneous, stiff right fore-

wing, and a soft and fragile left forewing, and they are

able to emit calling songs, which are either loud and

high-pitched, or soft and non-resonant. Such a highly

asymmetrical stridulum may not vibrate the same way

as a typical grylline stridulum (e.g. Simmons and

Ritchie, 1996; Bennet-Clark, 2003; Montealegre-Z

et al., 2011), and this situation is not as yet fully

understood. To study cricket call evolution deeper, or

even predict cricket calls in extant and fossil taxa from

the study of their stridulatory apparatus, as under-

taken for katydids (Montealegre-Z, 2009; Gu et al.,

2012), it is now essential to study the large diversity of

cricket bioacoustics within a phylogenetic perspective,

considering the explicit diversity documented by

behavioural observations, and the implicit diversity

suggested by the phylogeny.

In addition to acoustics, the Gryllotalpoidea

includes taxa inhabiting specialized acoustic burrows

(mole crickets), taxa living in symbiosis with ants

(Myrmecophilinae, Myrmecophilini), and taxa found

in deserts (Myrmecophilinae, Bothriophylacini). These

habitats and life habits require speciﬁc morphological,

physiological, and behavioural adaptations, for which

the main lines of evolution could be better deciphered

in a tree-thinking perspective.

Finally, cricket biogeography and diversiﬁcation

have never been analysed in a wide-scale context due

to the lack of properly deﬁned monophyletic groups,

but our study brings valuable insights in this respect.

Whereas familial and most subfamilial cricket clades

are distributed worldwide, some subfamilial taxa, as

modiﬁed according to our phylogenetic hypothesis,

show interesting new biogeographical patterns. This is

the case, for example, of the sister-groups Podoscirti-

nae and Hapitinae in clade F, which now both show a

biogeographical coherence: the former is distributed in

the Paleotropics and in Oceania, while the latter is

present in the Neotropics only. In the same way, the

nested positions of Gryllomorpha and Petaloptila

within the Phalangopsidae attest for the ﬁrst time the

presence, in the Mediterranean region, of cricket taxa

that diversiﬁed from a wide intertropical group. These

examples suggest new biogeographical scenarios, which

should be tested further as typically undertaken for all

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 77

organisms, with well-supported phylogenetic hypothe-

ses (Sanmartin et al., 2001; Sanmartin, 2003; Crisp

et al., 2011).

Acknowledgments

We thank Hojun Song (USA) for the opportunity to

present this work at the 11th Congress of Orthopterol-

ogy, Kunming, China, 11–16 August 2013. The labora-

tory work was carried in the Service de Syst

ematique

mol

eculaire (SSM, UMS 2700 CNRS) of the MNHN

(Paris, France): we thank M.C. Boisselier, C. Bonillo,

D. Gey, J. Lambourdi

ere and S. Leprieur for their

help in data acquisition. This work was partly sup-

ported by agreement no. 2005/67 between the Geno-

scope (Evry, France) and the MNHN project

‘Macrophylogeny of life’; sequencing was also under-

taken in the project @SpeedID proposed by F-BoL,

the French Barcode of life initiative and the network

‘Biblioth

eque du vivant’ funded by the CNRS, INRA

and MNHN. Part of the phylogenetic analyses were

carried out using the resources of the MNHN parallel

computing cluster (PCIA, UMS 2700). The following

institutions and programmes support ﬁeld work: the

Programme Pluriformation DRED/MNHN ‘Biodiver-

sit

e en Nouvelle-Cal

edonie’, the ANR ‘BioNeoCal’ (P.

Grandcolas), the IFCPAR (project 3009-1, P.I.s L.

Desutter-Grandcolas, MNHN and R. Balakrishnan,

IISc), the UMR 7205 CNRS (in respect of L. Dehar-

veng), the European programme ECOFAC (Universit

Rennes I, A. Gautier-Hion); the Mus

eum national

d’Histoire naturelle, Paris (ATM “Biodiversit

e actuelle

et fossile”, in respect of S. Peign

e and P. Janvier;

ATM “Formes possibles, forms r

ealis

ees”, V. Bels,

P.H. Gouyon), the Agence Nationale de la Recher-

che’s Investissement d’Avenir program referenced

ANR-11-INBS-0001AnaEE-Services and Labex CEBA

ANR-10-LABX-25-01, the subproject “Conna

ıtre pour

pr

eserver le patrimoine cach

e des Comores”, part of

“Biodiversit

e des ^

ıles de l’Oc

ean indien” (FRB,

MNHN, CNRDS), the programme ALAS (OTS,

NGS, INBio, J. Longino), The Parc National de la

R

eunion, the Parc National de la Guadeloupe, the

Minist

ere de l’Environnement et des for^

ets (Madagas-

car), the National Parks and Conservation Service

(Mauritius) and the Seychelles Bureau of Standards.

We are in debt to the numerous colleagues and institu-

tions who helped us during ﬁeld work. They can

unfortunately not be all named here. The following

colleagues provided material for molecular studies: R.

Felix (The Netherlands), B. Junger (France), K.-G.

Heller (Germany), A. Mohamed Sahnoun (Universit

de Tizi Ouzou, Algeria), E. Sardet (France) and P.

Terret (R

eserve des Nouragues, Guyane franc

ßaise). We

thank Hannah ter Hofstede for improving our manu-

script. We thank the associate Editors and two anony-

mous reviewers for their comments.

References

Akaike, H., 1973. Information theory as an extension of the

maximum likelihood principle. In: Petrov, B.N., Csaki, F.,

(Eds.), Second International Symposium on Information Theory.

Akademiae Kiado, Budapest, pp. 276–281.

Allegrucci, G., Rampini, M., Gratton, P., Todisco, V., Sbordoni, V.,

2009. Testing phylogenetic hypotheses for reconstructing the

evolutionary history of Dolichopoda cave crickets in the eastern

Mediterranean. J. Biogeogr. 36, 1785–1797.

Baccetti, B.M., 1987. Spermatozoa and phylogeny in orthopteroid

insects. In: Baccetti, B.M., (Ed.), Evolutionary Biology of

Orthopteroid Insects. Ellis Horwood Limited, Chichester, pp. 12–

112.

Bailey, W.J., 1991. Acoustic Behaviour of Insects. An Evolutionary

Perspective. Chapman and Hall, London.

Bailey, W.J., Rentz, D.C.F., 1990. The Tettigoniidae, Biology,

Systematics and Evolution. Crawford House Press, Bathurst,

Australia.

Bennet-Clark, H.C., 2003. Wing resonances in the Australian ﬁeld

cricket Teleogryllus oceanicus. J. Exp. Biol. 206, 1479–1496.

Bennet-Clark, H.C., Bailey, W.J., 2002. Ticking of the clockwork

cricket: the role of the escapement mechanism. J. Exp. Biol. 205,

613–625.

Benson, D.A., Karsch-Mizrachi, I., Lipman, D.J., Ostell, J., Wheeler,

D.L., 2005. GenBank. Nucleic Acids Res. 33, D34–D38.

B

ethoux, O., 2012. Grylloptera –a unique origin of the stridulatory

ﬁle in katydids, crickets, and their kin (Archaeorthoptera).

Arthropod System. Phylog. 70, 43–58.

B

ethoux, O., Nel, A., 2002. Venation pattern and revision of

Orthoptera sensu nov. and sister groups. Phylogeny of Palaeosoic

and Mesozoic Orthoptera sensu nov. Zootaxa 96, 1–88.

Blanchard, E., 1845. . Histoire des insectes: traitant de leurs mœurs

et de leurs m

etamorphoses en g

en

eral et comprenant une

nouvelle classiﬁcation fond

ee sur leurs rapports naturels. Tome 2.

F. Didot Fr

eres, Paris.

Blatchley, W.S., 1920. Orthoptera of Northeastern America with

Especial Reference to the Faunas of Indiana and Florida. The

Nature Publication Company, Indianapolis, IN.

Brooks, D.R., McLennan, D.A., 1991. Phylogeny, Ecology and

Behavior. University of Chicago Press, Chicago, IL.

Brooks, D.R., McLennan, D.A., 2002. The Nature of Biodiversity.

An Evolutionary Voyage of Discovery. University of Chicago

Press, Chicago, IL.

Bruner, L., 1916. South American crickets, Gryllotalpoidea and

Achetoidea. Ann. Carnegie Mus. 10, 344–428.

Brunner von Wattenwy, l.C., 1873. Syst

eme des Gryllides. Mitteil.

Schweiz. Entomol. Gesell. 4, 163–170.

Buckley, T.R., Simon, C., Flook, P.K., Misof, B., 2000. Secondary

structure and conserved motifs of the frequently sequenced

domains IV and V of the insect mitochondrial large subunit

rRNA gene. Insect Mol. Biol. 9, 565–580.

Buckley, T.R., Simon, C., Chambers, G.K., 2001. Exploring among-

site rate variation models in a maximum likelihood framework

using empirical data, effects of model assumptions on estimatesof

topology, branch lengths, and bootstrap support. Syst. Biol. 50,

67–86.

Bugrov, A., Novikova, O., Mayorov, V., Adkison, L., Blinov, A., 2006.

Molecular phylogeny of palaearctic genera of Gomphocerinae

grasshoppers (Orthoptera, Acrididae). Syst. Entomol. 31, 362–368.

Carpenter, J.M., 1989. Testing scenarios: wasp social behavior.

Cladistics 5, 131–144.

Chapco, W., Litzenberger, G., Kuperus, W.R., 2001. A molecular

biogeographic analysis of the relationship between North

American melanoploid grasshoppers and their Eurasian and

South American relatives. Mol. Phyl. Evol. 18, 460–466.

78 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

Chintauan-Marquier, I.C., Jordan, S., Berthier, B., Am

ed

egnato, C.,

Pompanon, F., 2011. Evolutionary history and taxonomy of a

short-horned grasshopper subfamily, the Melanoplinae

(Orthoptera, Acrididae). Mol. Phyl. Evol. 58, 22–32.

Chintauan-Marquier, I.C., Am

ed

egnato, C., Nichols, R.A.,

Pompanon, F., Grandcolas, P., Desutter-Grandcolas, L., 2014.

Inside the Melanoplinae: new molecular evidence for the

evolutionary history of the Eurasian Podismini (Orthoptera:

Acrididae). Mol. Phyl. Evol. 71, 224–233.

Chopard, L., 1949. Ordre des Orthopt

eres. In: Grass

e, P.P. (Ed.),

Trait

e de Zoologie. Masson, Paris, 9, pp. 617–722.

Chopard, L., 1969. The Fauna of India and Adjacent Countries.

Orthoptera. Volume 2. Grylloidea. Baptist Mission Press, Calcutta.

Crisp, M. D., Trewick, S. A, Cook, L. G., 2011. Hypothesis testing

in biogeography. Trends Ecol. Evol. 26, 66–72.

Darriba, D., Taboada, G.L., Doallo, R., Posada, D., 2012.

jModelTest 2: more models, new heuristics and parallel

computing. Nat. Methods 9, 772.

DeBry, R.W., Olmstead, R.G., 2000. A simulation study of reduced

tree-search effort in bootstrap resampling analysis. Syst. Biol. 49,

171–179.

Desutter, L., 1987. Structure et 

evolution du complexe phallique des

Gryllidea (Orthoptera) et classiﬁcation des genres n

eotropicaux

de Grylloidea. 1

ere partie. Ann. Soc. Entomol. Fr. (N.S.) 23,

213–239.

Desutter, L., 1988. Structure et 

evolution du complexe phallique des

Gryllidea (Orthoptera) et classiﬁcation des genres n

eotropicaux

de Grylloidea. 2

eme partie. Ann. Soc. Entomol. Fr. (N.S.) 24,

343–373.

Desutter-Grandcolas, L., 1992. Les Phalangopsidae de Guyane

franc

ßaise (Orthopt

eres, Grylloidea): syst

ematique, 

el

ements de

phylog

enie et de biologie. Bull. Mus

eum Natl Hist. Nat. Paris 14,

93–177.

Desutter-Grandcolas, L., 1997. Les grillons de Nouvelle-Cal

edonie

(Orthopt

eres, Grylloidea): esp

eces et donn

ees nouvelles. In: Najt,

J., Matile, L., (Eds.), Zoologia Neocaledonica, 4. M

emoires

Mus

eum Natl Hist. Nat. Paris 171, 165–177.

Desutter-Grandcolas, L., 1998. Broad-frequency modulation in

cricket (Orthoptera, Grylloidea) calling songs: two convergent

cases and a functional hypothesis. Can. J. Zool. 76, 2148–2163.

Desutter-Grandcolas, L., 2003. Phylogeny and the evolution of

acoustic communication in extant Ensifera (Insecta, Orthoptera).

Zool. Scr. 32, 525–561.

Desutter-Grandcolas, L., Nischk, F., 2000. Chant et appareil

stridulatoire de deux Trigonidiinae originaires d’Equateur

(Orthoptera: Grylloidea: Trigonidiidae). Annls. Soc. Entomol.

Fr. (N.S.) 36, 95–105.

Desutter-Grandcolas, L., Robillard, T., 2003. Phylogeny and the

evolution of calling songs in Gryllus (Insecta, Orthoptera,

Gryllidae). Zool. Scripta 32, 173–183.

Desutter-Grandcolas, L., Robillard, T., 2004. Acoustic evolution in

crickets: need for phylogenetic study and a reappraisal of signal

effectiveness. Anais Acad. Bras. Ci^

encias 76, 301–315.

Desutter-Grandcolas, L., Legendre, F., Grandcolas, P., Robillard,

T., Murienne, J., 2005. Convergence and parallelism: is a new life

ahead of old concepts? Cladistics, 21, 51–61.

Edgar, R.C., 2004. MUSCLE: multiple sequence alignment with high

accuracy and high throughput. Nucleic Acids Res. 32, 1792–1797.

Efron, B., Halloran, E., Holmes, S., 1996. Bootstrap conﬁdence

levels for phylogenetic trees. Proc. Natl Acad. Sci. USA 93,

13429–13434.

Eldredge, N., Cracraft, J., 1980. Phylogenetic Patterns and the

Evolutionary Process, Method and Theory in Comparative

Biology. Columbia University Press, New York.

Elliott, C.J.H., Koch, U.T., 1985. The clockwork cricket. Naturwiss

72, 150–152.

Felsenstein, J., 1985. Conﬁdence limits on phylogenies, an approach

using the bootstrap. Evolution 39, 783–791.

Field, L.H., 1993. Structure and evolution of stridulatory

mechanisms in New Zealand wetas (Orthoptera:

Stenopelmatidae). Int. J. Insect Morphol. Embryol. 22, 163–183.

Field, L.H., 2001. The Biology of Wetas, King Crickets and their

Allies. CABI, Wallingford, UK.

Flook, P.K., Rowell, C.H.F., 1997a. The phylogeny of the Caelifera

(Insecta, Orthoptera) as deduced from mtDNA gene sequences.

Mol. Phyl. Evol. 8, 89–103.

Flook, P.K., Rowell, C.H.F., 1997b. The effectiveness of

mitochondrial rRNA gene sequences for the reconstruction of the

phylogeny of an insect order (Orthoptera). Mol. Phyl. Evol. 8,

177–192.

Flook, P.K., Rowell, C.H.F., 1998. Inferences about orthopteroid

phylogeny and molecular evolution from small subunit nuclear

ribosomal DNA sequences. Insect Mol. Biol. 7, 163–178.

Flook, P.K., Klee, S., Rowell, C.H.F., 1999. Combined molecular

phylogenetic analysis of the Orthoptera (Arthropoda, Insecta)

and implications for their higher systematics. Syst. Biol. 48, 233–

253.

Gerhardt, H.C., Huber, F., 2002. Acoustic Communication in

Insects and Anurans. The University of Chicago Press, Chicago,

IL.

Giribet, G., Carranza, S., Riutort, M., Baguna, J., Ribera, C., 1999.

Internal phylogeny of the Chilopoda (Myriapoda, Arthropoda)

using complete 18S rDNA and partial 28S rDNA sequences.

Phil. Trans. R. Soc. Lond. B. Biol. Sci. 354, 215–222.

Gorochov, A.V., 1986. System and morphological evolution of

crickets from the family Gryllidae (Orthoptera) with description of

new taxa. Communication 2. Zool. J. 65, 851–858 (In Russian).

Gorochov, A.V., 1995. System and evolution of the suborder

Ensifera (Orthoptera). Parts 1, 2. Proc. Zool. Inst. Rus. Acad.

Sci., 260, 3–224, 223–212.

Gorochov, A.V., 2001. The higher classiﬁcation, phylogeny and

evolution of the superfamily Stenopelmatoidea. In: Field, L.H.,

(Ed.), The Biology of Wetas, King Crickets and their Allies.

CABI, Wallingford, UK, pp. 3–33.

Gorochov, A.V., 2014. Classiﬁcation of the Phalangopsinae

subfamily group, and new taxa from the subfamilies

Phalangopsinae and Phaloriinae (Orthoptera: Gryllidae).

Zoosyst. Ross. 23, 7–88.

Gu, J.-J., Montealegre-Z., F., Robert, D., Engel, M.S., Qiao, G.-X.,

Ren, D., 2012. Wing stridulation in a Jurassic katydid (Insecta,

Orthoptera) produced low-pitched musical calls to attract

females. Proc. Natl Acad. Sci. USA 109, 3869–3873.

Guindon, S., Gascuel, O., 2003. A simple, fast and accurate method

to estimate large phylogenies by maximum-likelihood. Syst. Biol.

52, 696–704.

Gwynne, D.T., 1995. Phylogeny of the Ensifera (Orthoptera): a

hypothesis supporting multiple origins of acoustical signalling,

complex spermatophores and maternal care in crickets, katydids

and wetas. J. Orth. Res. 4, 203–218.

Gwynne, D.T., 1997. The evolution of edible ‘sperm sacs’ and other

forms of courtship feeding in crickets, katydids and their kin

(Orthoptera: Ensifera). In: Choe, J.C., Crespi, B.J. (Eds.), Mating

Systems in Insects and Arachnids. Cambridge University Press,

Cambridge, pp. 110–129.

Gwynne, D.T., 2001. Katydids and Bush-crickets, Reproductive

Behavior and Evolution of Tettigoniidae. Cornell University

Press, Ithaca, NY.

Gwynne, D.T., Morris, G.K., 1983. Orthopteran Mating Systems.

Westview Press, Boulder, CO.

Hall, T.A., 1999. BioEdit: a user-friendly biological sequence

alignment editor and analysis program for Windows 95/98/NT.

Nucl. Acid. Symp. Ser. 41, 95–98.

Heller, K.-G., 2006. Song evolution and speciation in bushcrickets. In:

Drosopoulos, S., Claridge, M.F., (Eds.), Insect Sounds and

Communication. Taylor and Francis, Boca Raton, FL, pp. 137–

151.

Huang, Y., Orti, G., Sutherlin, M., Duhachek, A., Zera, A., 2000.

Phylogenetic relationships of North American ﬁeld crickets

inferred from mitochondrial DNA data. Mol. Phyl. Evol. 17, 48–

57.

Huber, F., Moore, T.E., Loher, W., 1989. Cricket Behavior and

Neurobiology. Cornell University Press, Ithaca, NY.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 79

Jaiswara, R., Balakrishnan, R., Robillard, T., Rao, K., Cruaud, C.,

Desutter-Grandcolas, L., 2012. Testing concordance in species

boundaries using acoustic, morphological, and molecular data in

the ﬁeld cricket genus Itaropsis (Orthoptera, Grylloidea,

Gryllidae: Gryllinae). Zool. J. Linn. Soc. 164, 285–303.

Jarvis, K.J., Haas, F., Whiting, M.F., 2004. Phylogeny of earwigs

(Insecta: Dermaptera) based on molecular and morphological

evidence: reconsidering the classiﬁcation of Dermaptera. Syst.

Entomol. 29, 359–370.

Jost, M.C., Shaw, K.L., 2006. Phylogeny of Ensifera (Hexapoda:

Orthoptera) using three ribosomal loci, with implications for the

evolution of acoustic communication. Mol. Phyl. Evol. 38, 510–530.

Kamphambati, S., 1995. A phylogeny of cockroaches and related

insects based on DNA sequence of mitochondrial ribosomal

RNA genes. Proc. Natl Acad. Sci. USA 92, 2017–2020.

Kjer, K.M., 2004. Aligned 18S and insect phylogeny. Syst. Biol. 53,

506–514.

Larsen, A., Losos, J.B., 1996. Phylogenetic systematics of

adaptation. In: Rose, M.R., Lauder, G.V., Adaptation.

Academic Press, San Diego, CA, pp. 187–219.

Leavitt, J.R., Hiatt, K.D., Whiting, M.F., Song, H., 2013. Searching

for the optimal data partitioning strategy in mitochondrial

phylogenomics: a phylogeny of Acridoidea (Insecta: Orthoptera:

Caelifera) as a case study. Mol. Phyl. Evol. 67, 494–508.

Legendre, F., Robillard, T., Song, H., Whiting, M.F., Desutter-

Grandcolas, L., 2010. One hundred years of instability in

ensiferan relationships. Syst. Entomol. 35, 475–488.

Litzenberger, G., Chapco, W., 2001. Molecular phylogeny of

selected Eurasian Podismine grasshoppers (Orthoptera:

Acrididae). Ann. Entomol. Soc. Am. 94, 505–511.

Lutzoni, F., Wagner, P., Reeb, V., Zoller, S., 2000. Integrating

ambiguously aligned regions of DNA sequences in phylogenetic

analyses without violating positional homology. Syst. Biol. 49,

628–651.

McE Kevan, D.K., 1982. Orthoptera. In: Parker, S.P. (Ed.),

Synopsis and Classiﬁcation of Living Organisms, Mc Graw Hill,

New York, pp. 352–379.

Mhatre, N., Montealegre-Z, F., Balakrishnan, R., Robert, D., 2012.

Changing resonator geometry to boost sound power decouples

size and song frequency in a small insect. Proc. Natl Acad. Sci.

USA 109, E1444–E1452.

Montealegre-Z, F., 2009. Scale effects and constraints for sound

production in katydids (Orthoptera: Tettigoniidae): generator size

constrains signal parameters. J. Evol. Biol. 22, 355–366.

Montealegre-Z, F., Jonsson, T., Robert, D., 2011. Sound radiation

and wing mechanics in stridulating ﬁeld crickets (Orthoptera:

Gryllidae). J. Exp. Biol. 214, 2105–2117.

Mugleston, J.D., Song, H., Whiting, M.F., 2013. A century of

paraphyly: a molecular phylogeny of katydids (Orthoptera:

Tettigoniidae) supports multiple origin of leaf-like wings. Mol.

Phyl. Evol. 69, 1120–1134.

Nattier, R., Robillard, T., Amedegnato, C., Couloux, A., Cruaud,

C., Desutter-Grandcolas, L., 2011a. Evolution of acoustic

communication in the Gomphocerinae (Orthoptera: Caelifera:

Acrididae). Zool. Scripta 40, 479–497.

Nattier, R., Robillard, T., Desutter-Grandcolas, L., Grandcolas, P.,

2011b. Older than New Caledonia emergence? A molecular

phylogenetic study of the eneopterine crickets (Orthoptera:

Grylloidea) J. Biogeogr. 38, 2195–2209.

Nattier, R., Grandcolas, P., Elias, M., Desutter-Grandcolas, L.,

Jourdan, H., Couloux, A., Robillard, T., 2012. Secondary

sympatry caused by range expansion informs on the dynamics of

microendemism in a biodiversity hotspot. PLoS ONE 7, e48047.

Nocke, H., 1972. Physiological aspects of sound communication in

crickets (Gryllus campestris L.). J. Comp. Physiol. 80, 141–162.

O’Hara, R.J., 1992. Telling the tree: narrative representation and the

study of evolutionary history. Biol. Philos. 7, 135–160.

Oneal, E., Otte, D., Knowles, L.L., 2010. Testing for biogeographic

mechanisms promoting divergence in Caribbean crickets (genus

Amphiacusta). J. Biogeogr. 37, 530–540.

Otte, D., 1992. Evolution of cricket songs. J. Orth. Res. 1, 25–49.

Otte, D., Alexander, R.D., 1983. The Australian crickets. Monogr.

Acad. Nat. Sci. Philad. 22, 1–477.

Otte, D., Perez-Gelabert, D.E., 2009. Caribbean Crickets.

Philadelphia, USA, The Orthopterists’ Society.

Page, R.D., 2000. Comparative analysis of secondary structure of

insect mitochondrial small subunit ribosomal RNA using

maximum weighted matching. Nucleic Acids Res. 28, 3839–3845.

Posada, D., Buckley, T.R., 2004. Model selection and model

averaging in phylogenetics: advantages of Akaike information

criterion and Bayesian approaches over likelihood ratio tests.

Syst. Biol. 53, 793–808.

Rambaut, A., Drummond, A.J., 2009. Tracer, Version 1.5. Available

at: http://tree.bio.ed.ac.uk/software/tracer

Robillard, T., Desutter-Grandcolas, L., 2004. Phylogeny and the

modalities of acoustic diversiﬁcation in extant extant

Eneopterinae (Insecta, Orthoptera, Grylloidea, Eneopteridae).

Cladistics 20, 271–293.

Robillard, T., Desutter-Grandcolas, L., 2006. Phylogeny of the

cricket subfamily Eneopterinae (Orthoptera, Grylloidea,

Eneopteridae) based on four molecular loci and morphology.

Mol. Phyl. Evol. 40, 643–661.

Robillard, T., Desutter-Grandcolas, L., 2008. Clariﬁcation of the

taxonomy of extant crickets of the subfamily Eneopterinae

(Orthoptera, Grylloidea, Eneopteridae). Zootaxa 1789, 66–68.

Robillard, T., Desutter-Grandcolas, L., 2011a. Evolution of calling

songs as multicomponent signals in crickets (Orthoptera:

Grylloidea: Eneopterinae). Behaviour 148, 627–672.

Robillard, T., Desutter-Grandcolas, L., 2011b. The complex

stridulatory behavior of the cricket Eneoptera guyanensis

Chopard (Orthoptera: Grylloidea: Eneopterinae). J. Insect

Physiol. 57, 694–703.

Robillard, T., Grandcolas, P., Desutter-Grandcolas, L., 2007. A shift

toward harmonics for high-frequency calling shown with

phylogenetic study of frequency spectra in Eneopterinae crickets

(Orthoptera, Grylloidea, Eneopteridae). Can. J. Zool. 85, 1264–1274.

Robillard, T., Montealegre-Z, F., Desutter-Grandcolas, L.,

Grandcolas, P., Robert, D., 2013. Mechanisms of high-frequency

song generation in brachypterous crickets and the role of ghost

frequencies. J. Exp. Biol. 216, 2001–2011.

Ronquist, F., Huelsenbeck, J.P., 2003. MrBayes 3: Bayesian

phylogenetic inference under mixed models. Bioinformatics 19,

1572–1574.

Rowell, C.H.F., Flook, P.K., 1998. Phylogeny of the Caelifera and

the Orthoptera as derived from ribosomal gene sequences. J.

Orth. Res. 7, 147–156.

Sanmartin, I., 2003. Dispersal vs. vicariance in the Mediterranean:

historical biogeography of the Palearctic Pachydeminae

(Coleoptera, Scarabaeoidea). J. Biogeogr. 30, 1883–1897.

Sanmartin, I., Enghoff, H., Ronquist, F., 2001. Patterns of animal

dispersal, vicariance and diversiﬁcation in the Holarctic. Biol. J.

Linnean Soc. 73, 345–390.

de Saussure, H., 1874. Family Gryllidae. In: de Saussure, H. (Ed.),

Mission scientiﬁque au Mexique et dans l’Am

erique centrale.

6

eme partie: 

etudes sur les Myriapodes et les Insectes. Section 1.

Imprimerie imp

eriale, Paris, pp. 296–515, pls. 297–298.

de Saussure, H., 1877. M

elanges orthopt

erologiques, V

eme fascicule.

Gryllides (1

ere partie). M

em. Soc. Phys. Hist. Nat. Gen

eve 25, 1–

352, pl. 311–315.

Scudder, S.H., 1897. Guide to the Genera and Classiﬁcation of the

North American Orthoptera. Edward W. Wheeler, Cambridge,

UK.

Shaw, K.L., 2002. Conﬂict between nuclear and mitochondrial DNA

phylogenies of a recent species radiation: what mtDNA reveals

and conceals about modes of speciation in Hawaiian crickets.

Proc. Natl Acad. Sci. USA 99, 16122–16127.

Silvestro, D., Michalak, I., 2012. raxmlGUI: a graphical front-end

for RAxML. Organ. Divers. Evol. 12, 335–337.

Simmons, L.W., Ritchie, M.G., 1996. Symmetry in the songs of

crickets. Proc. Biol. Sci. 263, 305–311.

Simon, C., Frati, F., Beckenbach, A., Crespi, B.J., Liu, H., Flook, P.,

1994. Evolution, weighting, and phylogenetic utility of mitochondrial

80 I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81

gene sequences and a compilation of conserved Polymerase Chain

Reaction primers. Ann. Entomol. Soc. Am. 87, 651–701.

Simon, C., Buckley, T.R., Frati, F., Stewart, J.B., Beckenbach, A.T.,

2006. Incorporating molecular evolution into phylogenetic

analysis, and a new compilation of conserved polymerase chain

reaction primers for animal mitochondrial DNA. Ann. Rev.

Ecol. Evol. Syst. 37, 545–579.

Song, H., Am

ed

egnato, C., Cicliano, M.M., Desutter-Grandcolas,

L., Heads, S.W., Huang, Y., Otte, D., Whiting, M.F., 2015. 300

million years of diversiﬁcation: elucidating the patterns of

orthopteran evolution based on comprehensive taxon and gene

sampling. Cladistics, doi: 10.1111/cla.12116.

Stamatakis, A., 2006. RAxML-VI-HPC: maximum likelihood-based

phylogenetic analyses with thousands of taxa and mixed models.

Bioinformatics 22, 2688–2690.

Storozhenko, S.Y., 1997. Fossil history and phylogeny of

orthopteroid insects. In: Gangwere, S.K., Muralirangan,

M.C., Muralirangan, M., (Eds.), The Bionomics of

Grasshoppers, Katydids and their Kin. CABI, Wallingford,

UK, pp. 59–82.

Strauss, J., Lakes-Harlan, R., 2008a. Neuroanatomy of the complex

tibial organ of Stenopelmatus (Orthoptera: Ensifera:

Stenopelmatidae). J. Comp. Neurol. 511, 81–91.

Strauss, J., Lakes-Harlan, R., 2008b. Neuroanatomy and physiology of

the complex tibial organ of an atympanate ensiferan, Ametrus tibialis

(Brunner von Wattenwyl, 1888) (Gryllacrididae, Orthoptera) and

evolutionary implications. Brain Behav. Evol. 71, 167–180.

Stritih, N., Cokl, A., 2012. Mating behaviour and vibratory

signalling in non-hearing cave crickets reﬂect primitive

communication of Ensifera. PLoS ONE 7, e47646.

Sullivan, J., Swofford, D.L., Naylor, G.J.P., 1999. The effect of

taxon sampling on estimating rate heterogeneity parameters of

maximum-likelihood models. Mol. Biol. Evol. 16, 1347–1356.

Svenson, G.J., Whiting, M.F., 2004. Phylogeny of Mantodea based

on molecular data: evolution of a charismatic predator. Syst.

Entomol. 29, 359–370.

Swofford, D.L., 1995. PAUP*. Phylogenetic Analysis Using Parsimony

(*and other methods). Sinauer Associates, Sunderland, MA.

Ullrich, B., Reinhold, K., Niehuis, O., Misof, B., 2010. Secondary

structure and phylogenetic analysis of the internal transcribed

spacers 1 and 2 of bush crickets (Orthoptera: Tettigoniidae:

Barbistini). J. Zool. Syst. Evol. Res. 48, 219–228.

Vaidya, G., Lohman, D.J., Meier, R., 2011. SequenceMatrix:

concatenation software for the fast assembly of multi-gene

datasets with character set and codon information. Cladistics 27,

171–180.

Vickery, V.R., 1977. Taxon ranking in Grylloidea and

Gryllotalpoidea. Mem. Lyman Entomol. Mus. Res. Lab. 4, 32–43.

Whiting, M.F., 2002. Mecoptera is paraphyletic: multiple genes and

phylogeny of Mecoptera and Siphanoptera. Zool. Scripta 31, 93–

104.

Yang, Z., 2006. Computational Molecular Evolution. Oxford

University Press, Oxford.

Supporting Information

Additional Supporting Information may be found in

the online version of this article:

Figures S1–S7. Results of the separate phylogenetic

analyses in ML for 12S, 16S, 18S, 28SA, 28SD, cytb and

H3 markers, respectively. ln L

12S

=32572.585003;

ln L

16S

=32702.581814; ln L

18S

=15462.852866;

ln L

28SA

=13704.500232; ln L

28SD

=10522.780197;

ln L

cytb

=25817.127967; ln L

=12141.167417.

Figure S8. Result of the combined phylogenetic

analysis in ML (ln L =150351.480431).

Figure S9. Results of the combined (without marker

28SD) phylogenetic analysis in ML

(ln L =137828.405642).

Figure S10. Result of the combined phylogenetic

analysis in parsimony (strict-consensus of four trees of

37341 steps).

Figure S11. Result of the phylogenetic analysis of

the nuclear data in MP.

Figure S12. Result of the phylogenetic analysis of

the nuclear data in ML.

Figure S13. Result of the phylogenetic analysis of

the mitochondrial data in MP.

Figure S14. Result of the phylogenetic analysis of

the mitochondrial data in ML.

Figure S15. Result of the combined phylogenetic

analysis in ML (ln L =149666.340159) without

Comicus campestris and Schizodactylus monstrosus.

Figure S16. Result of the combined phylogenetic

analysis in BI without Comicus campestris and Schizo-

dactylus monstrosus.

Figure S17. Result of the combined phylogenetic

analysis in MP (strict-consensus of 333 trees of 37155

steps) without Comicus campestris and Schizodactylus

monstrosus.

Data S1. Phylogenetic matrix used in this study.

I. C. Chintauan-Marquier et al. / Cladistics 32 (2016) 54–81 81

New scaly crickets (Orthoptera: Mogoplistidae) from mid-Cretaceous Kachin amber in northern Myanmar

Article

Full-text available

Mar 2025
Palaeontograph Abteilung

Multispecies comparisons support a startle response origin for a novel vibrational signal in the cricket tribe Lebinthini

Article

Jan 2025
J EXP BIOL

Many animals communicate using call and response signals, but the evolutionary origins of this type of communication are largely unknown. In most cricket species, males sing and females walk or fly to calling males. In the tribe Lebinthini, however, males produce calls that trigger a vibrational reply from females, and males use the substrate vibrations to find the responding female. Here we assess two hypotheses regarding the behavioral origin of this multimodal duet in the Lebinthini. We conducted playback experiments and measured behavioral and neuronal responses in multiple related cricket species to assess whether the precursor to the lebinthine duet was 1) a startle response to high-frequency sound, or 2) elaboration of a preexisting courtship behavior. We found behavioral similarities between the vibrational response of Lebinthini females and the acoustic startle behavior in other gryllid crickets. Specifically, the amplitude of the vibrational reply increases with male song amplitude in Lebinthini, and the magnitude of vibrations produced by two gryllid species when startled with ultrasound also correlates with the stimulus amplitude. Like in-flight startle behavior, the startle vibrations produced by perched crickets are suppressed when low-frequency sound is played simultaneously. We also observed courtship behavior in four gryllid species and found few instances of female vibration. Vibrational signals observed in Gryllus pennsylvanicus females were not correlated with male calls and occurred more frequently in pairs that did not mate after courtship. Combined, accumulating evidence supports the hypothesis that the lebinthine duet more likely evolved from a startle precursor than courtship behavior.

An integrative taxonomy of Oecanthinae in China (Orthoptera: Grylloidea; Oecanthidae) and its implication as a model for investigating sexual selection

Article

Nov 2024

Rich materials can provide more opportunities for exploring the mechanisms of speciation driven by sexual selection. Being the fastest‐evolving arthropods to date, the sword‐tailed crickets of Nudilla Gorochov, 1988 (= Laupala Otte, 1994) have rapidly diverged primarily due to the variability of their calling songs (sexual signals). In addition, they also exhibit morphological conservatism, with little variation between species. Similar circumstances can be seen in tree crickets (Oecanthinae), which have conservative morphology and a diverse range of song variations. Thus, we believe that tree crickets could serve as a model for research on sexual selection since they share a similar evolutionary history and mode of differentiation with Nudilla . However, due to the improper methods in analyzing the calling songs and nearly identical morphological features between taxa, there are many problems with the taxonomy of Oecanthinae in China. To solve these problems, we conducted an integrative taxonomic study of Chinese Oecanthinae based on comparative morphology, species delimitation, acoustical analysis, and phylogenetic analysis. This study recognized 12 Oecanthinae species in China, including four new species, and confirmed one new synonym and two misidentifications. Meanwhile, we confirmed the morphological stability of Oecanthinae, and revealed that variation in color, size, and morphology may be intraspecific polymorphism, which sometimes does not reflect the species relationships. The result indicates that the acoustic parameter freq.median can be used for efficient and accurate species delimitation in Oecanthinae. We speculate that incomplete species divergence leads to complexity in species relationships at the genetic level of Oecanthinae. The conservation of morphological characters, the interspecificity of songs and the complexity of species relationships suggest that sexual selection have played a role in the evolution of Oecanthinae. Our study resolves some systematic and taxonomic problems of Oecanthinae, clarifies the species relationships of Oecanthinae in China, and provides clues for expanding the cricket groups to be used in speciation studies.

Improving and reconstructing data about the network between Orthoptera and flowers in Southeast Asia

Article

Full-text available

Mar 2025

Flower visitation by orthopterans, particularly by taxa from Southeast Asia, was only recently brought to light in a report on the diversity and network of 41 orthopteran taxa from Southeast Asia visiting flowers of 35 plant taxa. Continued efforts to document flower visitation by orthopterans have led to 104 new incidences of flower visitation by orthopterans, including 17 new orthopteran taxa. A total of 247 incidences of 58 flower-visiting orthopteran taxa visiting 71 genera of flowers are reported here. In accordance with previous studies, the subfamily Phaneropterinae remains the most prominent flower-visiting orthopterans reported in Southeast Asia and is very likely undisputedly floriphilic. Using a dataset from previous years, the phylogenetic signals of flower-visiting orthopterans and the floral traits of the plant taxa visited are also discussed. However, we recommend caution against drawing too much inference at present owing to the unresolved phylogenetic relationships between the taxa involved and the incompleteness of the current dataset. Therefore, this paper primarily offers an updated list of flower-visiting orthopteran taxa and the flowers they visited. For a more comprehensive understanding of the flower-visiting orthopterans in the region and their ecological impacts, continued natural history research is needed.

Reliable reconstruction of cricket song from biophysical models and preserved specimens

Preprint

Full-text available

Oct 2024

Predicting the function of a biological structure solely from its morphology can be a very powerful tool in several fields of biology, but especially in evolutionary reconstruction. In the field of invertebrate acoustic communication, reconstructing the acoustic properties of sound-producing forewings in crickets has been based on two very divergent methods, finite element modelling (FEM) and vibrometric measurements from preserved specimens. Both methods, however, make strong simplifying assumptions which have not been tested and the reliability of inferences made from either method remains in question. Here we rigorously test and refine both reconstruction methods using the well-known Teleorgryllus oceanicus model system and determine the appropriate conditions required to reconstruct the vibroacoustic behaviour of male forewings. We find that when using FEM it is not necessary to assume simplified boundary conditions if the appropriate parameters are found. When using preserved specimens, we find that the sample needs to be rehydrated for reliable reconstruction, however, it may be possible to accomplish rehydration in silico using FEM. Our findings provide a refined methodology for the reliable reconstruction of cricket songs, whether from fossils or preserved specimens from museums or field collections.

Lineage-specific head development in the coffin-headed cricket Loxoblemmus equestris links concentrated insect metamorphosis with novel trait evolution

Preprint

Full-text available

Mar 2025

Background Lineage-specific adult structures form through modifications of preexisting juvenile body parts during postembryonic development in insects. It remains unclear how these novel traits originate from ancestral structures within the constrained body plan. In the coffin-headed cricket Loxoblemmus equestris , an ancestral rounded head shape directly transforms into a flattened, derived form in a sex-specific manner. To understand the origin of novel traits, we investigated the development of the adult head in L . equestris as a model of lineage-specific novelty. Results Detailed two- and three-dimensional analyses of the developing head revealed that sexually dimorphic epithelial patterns formed in a specific region, the frons, during the preadult instar. The male-specific head shapes are formed following the final molt to adulthood even after timing shifts of the metamorphosis induced by RNA interference targeting the evolutionarily conserved metamorphic gene network. Conclusions These findings demonstrate that adult metamorphosis, led by E93, locally relaxes the body plan constraint to permit dramatic transformation of juvenile body parts into a novel head shape by modifying epithelial folding in L . equestris . This highlights concentrated metamorphosis through the final molt as a driver that creates lineage- and sex-specific adult forms in the hexapod lineage.

The grasshoppers and crickets (Orthoptera) of the Socotra Archipelago (Yemen): a comprehensive overview and a description of a new Oecanthus Tree Cricket (Oecanthidae)

Article

Full-text available

Mar 2025

This paper presents all available information on the Orthoptera of the Socotra Archipelago, an area well-known for its endemic flora and fauna. General information is provided about the climate and geology of the Socotra Archipelago. The various habitats where grasshoppers have been found are described and illustrated, followed by a concise history of Orthoptera research on Socotra. Besides an identification key to the species, additional information about the material examined, taxonomy, diagnostic notes, distribution and occurrence, including maps, habitat, biology and bioacoustics, is provided for each species. In total, 65 Orthoptera species are reported here from Socotra, Abd el Kuri, Samha and Darsa, including Oecanthus castaneus Felix & Bouwman, sp. nov. and two unknown species assigned to Ectatoderus. Of these 65 species, 30 (46%) are endemic to the Socotra Archipelago. Re-descriptive notes on Acrotylus innotatus Uvarov, 1933 and Glomeremus capitatus Uvarov, 1957 are provided, including the description of the female of the latter species and the male of Oxytruxalis ensis (Burr, 1899). Acrotylus innotatus Uvarov, 1933, Dictyophorus griseus (Reiche & Fairmaire, 1850), Eumodicogryllus chivensis (Tarbinsky, 1930), Ochrilidia geniculata (Bolívar, 1913), Sphingonotus rubescens (Walker, 1870) and S. balteatus (Serville, 1838) are recorded for the first time from the Archipelago. Bioacoustics are presented for: Ochrilidia socotrae Massa, 2009, Stenohippus socotranus (Popov, 1957), Sphingonotus ganglbaueri Krauss, 1907, S. insularis (Popov, 1957), Acheta rufopictus Uvarov, 1957, Eumodicogryllus chivensis (Tarbinsky, 1930), Ectatoderus guichardi Gorochov, 1993 as well as two other species assigned to Ectatoderus, Oecanthus castaneus Felix & Bouwman, sp. nov., Ruspolia aff. R. basiguttata (Bolívar, 1906) and Pachysmopoda abbreviata (Taschenberg, 1883). Red List Assessments for 29 endemic species have been prepared including Oxytruxalis ensis (Burr, 1899) (Critically Endangered, CR), Cataloipus brunneri (Kirby, 1910) (Endangered, EN) and Glomeremus capitatus Uvarov, 1957, Phaneroptila insularis Uvarov, 1957, Phaulotypus granti Burr, 1899, Socotracris kleukersi Felix & Desutter-Grandcolas, 2012, Socotrella monstrosa Popov, 1957 and Xenephias socotranus Kevan, 1973 (all Vulnerable, VU).

Two new species of Aclodes Hebard, 1928 (Orthoptera: Phalangopsidae: Paragryllinae) from caves in El Peñón, Central-East Andean Colombia

Article

Feb 2025
ZOOTAXA

The genus Aclodes (orthoptera: grylloidea: Phalangopsidae) currently comprises 36 species. In this study, we describe two new species—Aclodes guane sp. nov. and Aclodes oscari sp. nov.—found in caves in Central-East Andean Colombia, based on distinguished male genitalia characteristics and number of teeth in the stridulatory file of the right tegmina of adult males. Furthermore, we provide comprehensive insights about the conservation status of the caves where the novel species were collected.

Advances in the Species Diversity of the Infraorder Gryllidea of the World

Article

Full-text available

May 2021

According to the Orthoptera Species File (OSF), the effective genera and species of the infraorder Gryllidea published from 1758 to 2019 are counted, which are 6161 species or subspecies of 765 genera. According to the statistics and regular analysis of the number of effective genera, species and subspecies published over the years, the results showed that the cognition of the diversity of the infraorder Gryllidea can be divided into three stages: initial stage (1758~1868), transitional period of development (1869~1982) and rapid development stage (1983~2019). Among them, only 153 species or subspecies of 29 genera were recorded in 111 years of the first stage, which was in the primary stage. A total of 2279 species or subspecies belonging to 278 genera were recorded during the 114 years of the second stage, which showed that a large number of new taxa were found and established, and more taxonomic features were found and applied. The phyloge netic relationships among different taxonomic taxa were constantly concerned. In the 37 years of the third stage, a total of 3729 species or subspecies of 458 genera were recorded, which showed that the study area was more extensive, the classification methods were increased, and the research team was more professional. The species diversity increased greatly in the short term. As of December 2019, there are 691 extant genera, 6012 extant species or subspecies of the infraorder Gryllidea, accounting for 90.33% and 97.58% of the total known species, respectively; in the family level, the species diversity of the family Gryllidae is the most abundant, reaching 3316 species or subspecies, accounting for 55.16% of the total species of the infraorder Gryllidea. In the macroscopic diversity pattern, Asia (tropical part), South America and Africa are the most abundant areas of cricket species diversity. These areas are still important areas for the improvement of diversity potential in the future. Finally, the main problems in the research on the diversity of the infraorder Gryllidea were analyzed, and the future research was prospected.

New and little-known crickets of the subfamily Phalangopsinae (Orthoptera, Gryllidae). 16. The subtribe Luzarina from Panama and Peru

Article

Jul 2024
ZOOL ZH

A. V. Gorokhov

Position and diagnostic characters of the subtribe Luzarina Hebard 1928, аs well as the genera Niquirana Hebard 1928, Luzara Walker 1869, Amusodes Hebard 1928 and Prosthama Hebard 1928 are briefly discussed, the latter genus being herewith returned to this subtribe. The following new taxa of Luzarina are described from Panama and Peru: Niquirana? chiriqui sp. n.; Luzara cusco sp. n.; L. panama sp. n.; Prosthama chagres sp. n.; P. amistad sp. n.; Azulzara minutissima gen. et sp. n. The male genitalia of Amusodes и Prosthama are described and illustrated for the first time, and A.?festae Hebard 1928 is redescribed on the base of new material.

The higher classification, phylogeny and evolution of the superfamily Stenopelmatoidea.

Chapter

Mar 2001

A. V. Gorochov

Wetas are native to New Zealand and in evolutionary terms are insect 'dinosaurs' within the Orthoptera. Related species occur in South Africa, Australia, North America and to a lesser extent, Europe. This book brings together all known information on these groups (mostly in superfamilies Stenopelmatoidea and Gryllacridoidea) to form a compendium of existing scientific knowledge for future biological investigation and conservation. It is particularly useful for those working and researching in the areas of entomology, ecology and evolution, and contains 26 chapters by various authors in sections on: Systematics and biogeography (7 chapters); Morphology and anatomy (4 chapters); Ecology (3 chapters); Behaviour (5 chapters); Reproduction and development (2 chapters); Physiology (4 chapters); and Conservation of endangered species (1 chapter). A review of the Gryllacrididae is included, because of confusion over common names. A list of contributors and an index are also provided.

The evolution of edible ‘sperm sacs’ and other forms of courtship feeding in crickets, katydids and their kin (Orthoptera: Ensifera)

Chapter

Jun 1997

Darryl T. Gwynne

Insects and arachnids display the most impressive diversity of mating and social behaviour among all animals. This book investigates sexual competition in these groups, and the variety of ways in which males and females pursue, persuade, manipulate, control and help one another, enabling us to gain a better understanding of how conflicts and confluences of interest evolve together. Each chapter provides a comprehensive review of mating systems in particular insect and arachnid groups, discusses intrinsic and extrinsic factors responsible for observed mating strategies, and suggests fruitful avenues for further research. The book culminates in a synthesis, reviewing the date in terms of the theory of sexual conflict. This broad-based book will be of immense value to students and researchers interested in reproductive strategies, behavioural ecology, entomology and arachnology.

Clarification of the taxonomy of extant crickets of the subfamily Eneopterinae (Orthoptera: Grylloidea; Gryllidae)

Article

Jun 2008

The cricket subfamily Eneopterinae has recently been the focus of many research papers on various subjects ranging from systematics and phylogeny (Robillard & Desutter-Grandcolas, 2004a, 2005, 2006; Desutter-Grandcolas & Robillard, 2006; Robillard, 2006; Otte, 2007), acoustic communication (Desutter-Grandcolas, 1998; Robillard & Desutter-Gradcolas, 2004b; Robillard et al., 2007), behavioural studies (Preston-Mafham, 2000), life history (Zefa et al., 2006; Miyoshi et al., 2007), to chromosomal structure (Ferreira & Cella, 2006, and references within).

CONFIDENCE LIMITS ON PHYLOGENIES: AN APPROACH USING THE BOOTSTRAP

Article

Jul 1985
EVOLUTION

Joseph Felsenstein

The recently-developed statistical method known as the "bootstrap" can be used to place confidence intervals on phylogenies. It involves resampling points from one's own data, with replacement, to create a series of bootstrap samples of the same size as the original data. Each of these is analyzed, and the variation among the resulting estimates taken to indicate the size of the error involved in making estimates from the original data. In the case of phylogenies, it is argued that the proper method of resampling is to keep all of the original species while sampling characters with replacement, under the assumption that the characters have been independently drawn by the systematist and have evolved independently. Majority-rule consensus trees can be used to construct a phylogeny showing all of the inferred monophyletic groups that occurred in a majority of the bootstrap samples. If a group shows up 95% of the time or more, the evidence for it is taken to be statistically significant. Existing computer programs can be used to analyze different bootstrap samples by using weights on the characters, the weight of a character being how many times it was drawn in bootstrap sampling. When all characters are perfectly compatible, as envisioned by Hennig, bootstrap sampling becomes unnecessary; the bootstrap method would show significant evidence for a group if it is defined by three or more characters.

Phylogenetic systematics of adaptation

Article

Jan 1996
Adaptation

System and evolution of the suborder Ensifera (Orthoptera)

Article

Jan 1995

A.V. Gorochov

The higher classification, phylogeny and evolution of the superfamily Stenopelmatoidea

Article

Jan 2001

A.V. Gorochov

The effect of taxon sampling on estimating rate heterogeneity parameters of maximum-likelihood models

Article

Oct 1999

As maximum-likelihood approaches to the study of molecular systematics and evolution become both more flexible and more accessible, the importance of understanding the statistical properties of parameter estimation becomes critical. Using variation in NADH-2 sequences for 40 species of requiem sharks, we illustrate that estimates of rate heterogeneity parameters are highly sensitive to taxon sampling when the data are best explained by a mixed-distribution model of among-site rate variation (invariable sites plus gamma distribution [I+Gamma]). Using computer simulation, we attempt to differentiate two possible causes of this sensitivity. While the possibility of nonstationarity cannot be definitively rejected, our results suggest that sampling error alone provides an adequate explanation for the pattern of uncertainty observed in estimates from the real data. Furthermore, we illustrate that two parameters estimated under the I+Gamma model (the proportion of sites not free to change and the gamma distribution shape parameter) are highly correlated and that the likelihood surface across the rate heterogeneity parameter space can be poorly behaved when only a small number of sequences (taxa) are considered.

Classification of the Phalangopsinae subfamily group, and new taxa from the subfamilies Phalangopsinae and Phaloriinae (Orthoptera: Gryllidae)

Article

Jun 2014

A.V. Gorochov

Preliminary classification of the Phalangopsinae subfamily group (= group "Phalangopsidae": Phalangopsinae, Cacoplistinae, Phaloriinae and Pteroplistinae) are given. Some problems of evolution and taxonomy of this group are discussed. The former tribe Luzarini (= Luzarinae auct.) is synonymized with the tribe Phalangopsini divided into several subtribes (including the subtribe Luzarina). Sixty eight new taxa from Neotropical, Indo-Malayan and Papuan regions are described: Palpigera aluzara sp. nov., Asymmetracla subgen. nov. and Glandulacla subgen. nov. (in the genus Ochraperites Desutter-Grandcolas, 1993), O. (A.) asymmetricus sp. nov., O. (O.) cuyabeno sp. nov., O. (G.) aguarico sp. nov., Laozacla gen. nov., L. furca sp. nov., Eidmanacris longa sp. nov., Caribacusta gen. nov., C. antigua sp. nov., Noctivox orizaba sp. nov., Modestozarina subtrib. nov., Modestozara gen. nov., M. modesta sp. nov., M. troglophila sp. nov., M. satipo sp. nov., Notendecous subgen. nov. and Pedroecous subgen. nov. (in the genus Endecous Saussure, 1878), Daedalonotum gen. nov., D. daedalum sp. nov., Nemozarina subtrib. nov., Nemozara gen. nov., N. rio sp. nov., N. riorio sp. nov., N. pastaza sp. nov., N. vulcanica sp. nov., Anemozara gen. nov., Zacmozara subgen. nov. (in the genus Anemozara), A. (A.) vera sp. nov., A. (A.) propria sp. nov., A. (A.) umbrosa sp. nov., A. (Z.) eximia sp. nov., Lernecina subtrib. nov.; Lerneca sylvestris sp. nov., L. inalata amboro subsp. nov., L. inalata pantanal subsp. nov., Parendacustina subtrib. nov., ?Uvaroviella problematica sp. nov., Bolivacla gen. nov., B. boliviana sp. nov., Brevizaclina subtrib. nov., Stridulacla subgen. nov. (in the genus Mikluchomaklaia Gorochov, 1986), M. (M.) enarotali sp. nov., Papuzacla subgen. nov. and Lobulacla subgen. nov. (in the genus Brevizacla Gorochov, 2003), B. (P.) fawi sp. nov., B. (L.) nabire sp. nov., B. (L.) halmahera sp. nov., Terrozacla gen. nov., T. jambi sp. nov., T. harau sp. nov., T. trusmadi sp. nov., T. borneo sp. nov., T. kubah sp. nov., T. gading sp. nov., Vescelia mulu sp. nov., Phaloria (Papuloria) latiuscula sp. nov., Ph. (P.) tristis sp. nov., Ph. (P.) paratristis sp. nov., Ph. (P.) tariku sp. nov., Ph. (P.) manifesta sp. nov., Ph. (P.) waena sp. nov., Ph. (P.) neorava sp. nov.; Ph. sulawesi sp. nov.; Tremellia timah orientalis subsp. nov.; Pseudotrigonidium borneo sp. nov.; P. gaponi sp. nov. One former genus is included in the genus Longuripes Desutter-Grandcolas et Hubbell, 1993 as its subgenus Prolonguripes Desutter-Grandcolas, 1993, stat. nov. Prosthacusta beliza (Otte et Perez-Gelabert, 2009), comb. nov. is transferred from the synonymic genus Doposia Otte et Perez-Gelabert, 2009 (= Lerneca Walker, 1869) to Prosthacusta Saussure, 1874. The genus Otteus Koçak et Kemal, 2009, gen. dist. is restored from synonymy with Cubacophus Ruiz-Baliú et Otte, 1997. Phaloria galoa Otte et Cowper, 2007, syn. nov. is synonymized with Ph. heterotrypoides Gorochov, 1999, and this species as well as Ph. insularis Bolivar, 1912 are transferred from the nominotypical subgenus to the subgenus Papuloria Gorochov, 1996.

Songs and stridulatory apparatus of two trigonidiine species from Ecuador (Orthoptera : Grylloidea : Trigonidiidae).

Article

Jan 2000

How the cricket stridulum functions is still only partly understood. The number of studied species is however very low and the diversity of acoustic communication modes observed in crickets is rarely taken into account. In the present paper, we analyse the stridulatory apparatus and the song of two new trigonidiine species (Anaxipha bradephona, sp. n. et A. tachephona, sp. n., described in the present paper), which represent the first description of these characters for the subfamily. By comparing the physical parameters of their songs and the ultrastructure of their stridulatory apparatus with that of other cricket species, a hypothesis on the functioning of the trigonidiine stridulum is proposed.

Laying the foundations of evolutionary and systematic studies in crickets (Insecta, Orthoptera): A multilocus phylogenetic analysis

Abstract and Figures

Recommended publications

A Phylogenetic Analysis of the Evolution of the Stridulatory Apparatus in True Crickets (Orthoptera,...

Mechanisms of high-frequency song generation in brachypterous crickets and the role of ghost frequen...

Bioacoustics of the Neotropical Eneopterinae (Orthoptera, Grylloidea, Gryllidae)

A taxonomic review of common but little known crickets from Singapore and the Philippines (Insecta:...

3-D imaging reveals four extraordinary cases of convergent evolution of acoustic communication in cr...