Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots by Strain-Specific Quantitative PCR

Abstract

Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide. Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N2 fixation. However, one of the most important factors for increase in crop yield by plant growth-promoting rhizobacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to develop quantitative PCR protocols for strain-specific quantification of A. brasilense FP2. A novel approach was applied to identify strain-specific DNA sequences based on comparison of genomic sequences within the same species. The draft-genome sequence of A. brasilense FP2 and Sp245 were aligned, FP2-specific regions were filtered and checked for other possible matches in public databases, Strain-specific regions were then selected to design and evaluate strain-specific primer pairs. The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were strain-specific for A. brasilense FP2. These primer pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and non-sterile growth conditions. In addition, co-inoculations with other plant-growth promoting bacteria in wheat were performed under non-sterile conditions. Results showed that A. brasilense FP2 inoculated to wheat roots is highly competitive and achieve high cell numbers (∼10(7) CFU/g of fresh weight root) in the rhizosphere even under non-sterile conditions and when co-inoculated with other rhizobacteria, maintaining the population rather stable for at least up to 13 days after inoculation. The strategy used here can be applied for other organisms whose genome sequences are available.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Full text

Quantification of Azospirillum brasilense FP2 Bacteria in Wheat Roots
by Strain-Specific Quantitative PCR
Maria Isabel Stets,
a,b
Sylvia Maria Campbell Alqueres,
b
Emanuel Maltempi Souza,
a
Fábio de Oliveira Pedrosa,
a
Michael Schmid,
b
Anton Hartmann,
b
Leonardo Magalhães Cruz
a
Department of Biochemistry and Molecular Biology, Federal University of Parana (UFPR), Curitiba, PR, Brazil
a
; Helmholtz Zentrum München, German Research Center for
Environmental Health (GmbH), Department for Environmental Sciences, Research Unit Microbe-Plant Interactions, Neuherberg, Germany
b
Azospirillum is a rhizobacterial genus containing plant growth-promoting species associated with different crops worldwide.
Azospirillum brasilense strains exhibit a growth-promoting effect by means of phytohormone production and possibly by N
2
fixation. However, one of the most important factors for achieving an increase in crop yield by plant growth-promoting rhizo-
bacteria is the survival of the inoculant in the rhizosphere, which is not always achieved. The objective of this study was to de-
velop quantitative PCR protocols for the strain-specific quantification of A. brasilense FP2. A novel approach was applied to
identify strain-specific DNA sequences based on a comparison of the genomic sequences within the same species. The draft ge-
nome sequences of A. brasilense FP2 and Sp245 were aligned, and FP2-specific regions were filtered and checked for other possi-
ble matches in public databases. Strain-specific regions were then selected to design and evaluate strain-specific primer pairs.
The primer pairs AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 were specific for the A. brasilense FP2 strain. These primer
pairs were used to monitor quantitatively the population of A. brasilense in wheat roots under sterile and nonsterile growth con-
ditions. In addition, coinoculations with other plant growth-promoting bacteria in wheat were performed under nonsterile con-
ditions. The results showed that A. brasilense FP2 inoculated into wheat roots is highly competitive and achieves high cell num-
bers (⬃10
7
CFU/g [fresh weight] of root) in the rhizosphere even under nonsterile conditions and when coinoculated with other
rhizobacteria, maintaining the population at rather stable levels for at least up to 13 days after inoculation. The strategy used
here can be applied to other organisms whose genome sequences are available.
Azospirillum is one of the most important genera of plant
growth-promoting rhizobacteria found worldwide under a
variety of environmental and soil conditions (1). The diazotroph
Azospirillum brasilense is the best-studied species of the genus, is
found in close association with many agriculturally important
crops, and exerts beneficial effects on plant growth and produc-
tivity (2–4). Nitrogen fixation (5,6) and the production of the
auxin 3-indoleacetic acid (IAA) by many representatives of the
genus Azospirillum are related to the growth promotion effects
observed in inoculated plants, such as increases in root length and
the numbers of root hairs and lateral roots (3).
The biotechnological use of A. brasilense inoculants in Latin
American and in Brazil, in particular, has increased in recent years
(7). Strain FP2 is a spontaneous mutant of A. brasilense Sp7 (8).
Strain Sp7 has been shown to be capable of stimulating the growth
of several members of the family Poaceae and increasing the pro-
ductivities of wheat and maize crops (2). Strain FP2 can also pro-
mote the growth of wheat (9) and enhance maize and wheat pro-
ductivity under field conditions (unpublished data). Most of the
A. brasilense inoculants in Brazil contain strains Ab-V5 and Ab-
V6, which are also derivatives of strain Sp7. Ab-V5 and Ab-V6
were shown to increase the productivity of maize and wheat under
field conditions (10) and were officially authorized for use as in-
oculants in these crops (10).
However, a major problem related to A. brasilense inoculants is
the survival of the inoculated strains in the rhizosphere soil (11,
12), which affects inoculant performance, since the effective col-
onization of roots is necessary for the successful stimulation of
plant growth by Azospirillum (13).
To assess the diversity and taxonomy of crop plant-associated
bacteria, many cultivation-dependent and -independent methods
are currently in use (14–16). However, most of these methods are
not quantitative and are based on the evaluation of the 16S rRNA
gene coding sequences. They are able to provide highly confident
results only at the genus and species levels and are not specific
enough to study the bacterial population dynamics at the strain
level, which is necessary for inoculant monitoring. Thus, in many
cases, it is not possible to quantitatively associate the failure or
success of plant growth promotion achieved with the inoculated
bacterial population at a strain-specific resolution, leaving the
outcome of the inoculation unexplained (17). Furthermore, the
crop response to inoculation under field conditions heavily de-
pends on the combination of the plant genotype and the bacterial
strain (18–20), stressing the need for methodologies to evaluate
the success of plant colonization accurately at a high resolution.
Previously, we used whole-cell matrix-assisted laser desorption
ionization–time of flight mass spectrometry (MALDI-TOF MS)
Received 23 April 2015 Accepted 13 July 2015
Accepted manuscript posted online 17 July 2015
Citation Stets MI, Alqueres SMC, Souza EM, Pedrosa FDO, Schmid M, Hartmann A,
Cruz LM. 2015. Quantification of Azospirillum brasilense FP2 bacteria in wheat roots
by strain-specific quantitative PCR. Appl Environ Microbiol 81:6700 –6709.
doi:10.1128/AEM.01351-15.
Editor: C. R. Lovell
Address correspondence to Leonardo Magalhães Cruz, leonardo@ufpr.br.
Supplemental material for this article may be found at http://dx.doi.org/10.1128
/AEM.01351-15.
Copyright © 2015, American Society for Microbiology. All Rights Reserved.
doi:10.1128/AEM.01351-15
6700 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

analysis to differentiate species of Azospirillum, including several
closely related A. brasilense strains (21). However, this method is
not quantitative, requires growth on a culture medium, and is
time and labor-intensive.
Quantitative PCR (qPCR) has been the method of choice to
quantify rhizosphere populations because it allows high specific-
ity, sensitivity, and speed (17,22,23). This technique has success-
fully been used to quantify several bacteria associated with plants.
It was successfully used for the quantification of a functionally
specific subgroup of pseudomonads in the rhizosphere (24). The
pathogen Xylella fastidiosa was quantified in citrus plants (25),
while the endophytic bacterium Methylobacterium mesophilicum
was monitored by qPCR during Catharanthus roseus colonization
(26). In Brassica oleracea, the plant growth-promoting Enterobac-
ter radicincitans population was monitored by qPCR in associa-
tion with fluorescence in situ hybridization (FISH) (27), with not
only the amount of bacteria in the colonized plants but also their
location in the plants being determined. Although these reports
showed that qPCR is a valuable technique to quantitatively mon-
itor populations of unlabeled bacteria in greenhouse experiments,
none has used strain-specific primers. The application of strain-
specific primers is difficult in field experiments, where closely re-
lated indigenous bacteria may interfere with the amplification and
quantification. For strain-specific molecular monitoring, se-
quence-characterized amplified region (SCAR) markers obtained
from BOX-PCR, enterobacterial repetitive intergenic consensus
sequence-PCR, and randomly amplified polymorphic DNA
(RAPD)-PCR fragments were recently applied to design primers
for the qPCR quantification of A. brasilense and Azospirillum li-
poferum at the strain-specific level (17,22).
The objective of this study was to develop qPCR protocols for
the strain-specific quantification of the plant growth-promoting
bacterium A. brasilense FP2 on the basis of a comparison of its
whole-genome sequence (WGS) with that of the closely related
strain Sp245. The designed strain-specific primers were then ap-
plied for quantification to monitor the FP2 population in inocu-
lated wheat plants under sterile and nonsterile conditions.
MATERIALS AND METHODS
Bacterial strains. All Azospirillum strains (Table 1) were routinely grown
in NFbHPN medium (28) at 30°C under aeration with shaking at 120
rpm. Strains from other genera were grown in DYGS medium (29) con-
taining, per 1,000 ml, 0.10% glucose, 0.20% yeast extract, 0.15% peptone,
0.50% MgSO
4
·7H
2
O, and 0.15% L-glutamic acid at pH 6.0 to 6.5; the
cultures were incubated at 30°C under aeration with shaking at 120 rpm.
Colony counts of all strains were performed after dilutions were spread on
the respective medium plates and incubated for 72 h at 30°C.
Primer design. To design Azospirillum brasilense FP2 strain-specific
primer pairs, the following general strategy was used: (i) the WGS of A.
brasilense FP2 from the FASTA genome sequence was fragmented in silico
using in-house scripts, producing 500-bp nonoverlapping fragments; (ii)
the genome sequence of A. brasilense Sp245 was used to build a local
BLAST database, and A. brasilense FP2 sequence fragments were used as
queries for a BLASTn similarity search with default parameters; (iii) frag-
ments for which no hits were found were subjected to a second BLASTn
(30) search against the NCBI NT database (performed in July 2012;
GenBank release 190), using default parameters; and (iv) putative strain-
specific sequences, i.e., sequences without any match in the two BLAST
sequence analyses, were used to design sets of primer pairs specific for A.
brasilense FP2. In order to inspect the selected regions, the draft genome
sequence of A. brasilense FP2 was annotated and visually analyzed using
the RAST program, version 2.0 (31,32), and the Unipro UGENE tool kit,
version 1.14 (33).
The WGS of Azospirillum brasilense FP2 is publicly available in the
NCBI database under accession number APHV00000000 and assembly
GCA_000404045.1. Its total sequence length is 6,885,108 bp, it has 413
contigs (N
50
, 29,432 bp), it has a GC content of 68.1%, and it has a genome
coverage of 25 times. The WGS of Azospirillum brasilense Sp245 is avail-
able in the NCBI database under accession numbers HE577327 to
HE577333 (1 chromosome and 6 plasmids) and assembly GCA_
000237365.1. Its total sequence length is 7,530,241 bp (total assembly gap
length, 6,000 bp), it has 67 contigs (N
50
, 186,382 bp), and it has a GC
content of 68.6%.
Primer design was performed, using Primer Express software (version
3.0; Applied Biosystems, Foster City, CA), on the basis of (i) an amplicon
size inferior to 200 bp and primer lengths ranging from 18 to 22 bp; (ii) a
high melting temperature (T
m
) for the primers (T
m
, approximately 60°C)
and a low T
m
difference (⌬T
m
) between primers (⌬T
m
,⬍2°C); and (iii) a
lack of predicted hairpin loops, duplexes, and primer-dimer formation.
Primer selection and evaluation. The designed primer pairs were syn-
thesized by Eurofins (Ebersberg, Germany) and qualitatively analyzed by
conventional PCR with about 30 ng of genomic DNA, 10 pmol of each
primer,1UofTaq DNA polymerase (Taq Dream Invitrogen Inc.), Taq
DNA polymerase buffer, 200 mmol/␮l of desoxyribonucleotide, and ster-
ile ultrapure water to a final volume of 10 ␮l. The cycling program in-
cluded a 10-min initial denaturation, incubation at 95°C, 25 cycles con-
sisting of denaturation at 95°C for 15 s and annealing at 60°C for 60 s
followed by 72°C for 30 s, and a final elongation of 10 min at 70°C. A
primer pair was considered strain specific if (i) successful amplification
occurred using the DNA of the target strain as the template; (ii) cross-
amplification with nontarget strains was absent; and (iii) amplification in
the control tube reaction, to which no DNA was added, was absent.
Genomic DNAs from 14 strains of 10 species and 4 genera (Table 1) were
used as the templates for the PCRs. A second step was performed under
TABLE 1 Bacterial strains used in this study
Microorganism Reference or source
Azospirillum amazonense DSM 2787 Helmholtz Zentrum München
strain collection
Azospirillum brasilense FP2 8
Azospirillum brasilense NH Helmholtz Zentrum München
strain collection
Azospirillum brasilense Sp245 Helmholtz Zentrum München
strain collection
Azospirillum brasilense Sp7 Helmholtz Zentrum München
strain collection
Azospirillum canadense LMG 23617 Helmholtz Zentrum München
strain collection
Azospirillum irakense DSM 11586a Helmholtz Zentrum München
strain collection
Azospirillum lipoferum DSM 1691 Helmholtz Zentrum München
strain collection
Azospirillum rugosum DSM 19657 Helmholtz Zentrum München
strain collection
Burkholderia brasiliensis M171 Helmholtz Zentrum München
strain collection
Burkholderia tropica PPe5 Helmholtz Zentrum München
strain collection
Gluconacetobacter diazotrophicus DSM
5601
Helmholtz Zentrum München
strain collection
Roseomonas genomospecies 6 CCUG
33010
Helmholtz Zentrum München
strain collection
Roseomonas fauriae KACC 11694 Helmholtz Zentrum München
strain collection
qPCR Quantification of Azospirillum brasilense in Roots
October 2015 Volume 81 Number 19 aem.asm.org 6701Applied and Environmental Microbiology

quantitative PCR conditions to check the primer specificity (by the use of
melting curves) and amplification efficiency, as described below.
Quantitative PCR conditions. qPCR was performed in a total reac-
tion volume of 25 ␮l containing 12.5 ␮l Power SYBR green PCR master
mix (Applied Biosystems), 6.25 ␮l of a primer mix (final concentration, 1
␮mol), and 6.25 ␮l of 2.5 ng/␮l diluted template DNA. A MicroAmp
optical 96-well reaction plate (Applied Biosystems) and an ABI Prism
7500 system (Applied Biosystems) were used. The cycling program in-
cluded a 10-min incubation at 95°C, 40 cycles consisting of 95°C for 15 s
and 60°C for 60 s followed by 72°C for 30 s, and an additional incubation
at 72°C for 10 min. Amplification specificity was verified by melting curve
analysis of the PCR products, performed using the ABI Prism 7500 system
sequence detection software (version 1.2.3; Applied Biosystems).
Primer efficiency determination. Genomic DNA from A. brasilense
FP2 was used to prepare 10-fold dilution series (in triplicate). Sterile water
was used as a negative control. The cycle threshold (C
T
) value was auto-
matically determined for each sample by the ABI Prism 7500 system se-
quence detection software (version 1.2.3; Applied Biosystems). A stan-
dard curve was generated by plotting the C
T
value against the logarithm of
the bacterial DNA concentration (data not shown) and used to calculate
the amplification efficiency (E)(
Table 2).
Generation of standard curves for qPCR quantification of A.
brasilense FP2 in wheat roots. The standard curves used for the quanti-
fication of A. brasilense FP2 in wheat were constructed as described pre-
viously (22), with the following modifications. Wheat plants were grown
under axenic condition as described below for 7 days, and roots were
collected and crushed in liquid nitrogen using a mortar and pestle. A
volume of 100 ␮lofanA. brasilense FP2 culture (dilution range, 10
2
to 10
9
CFU) was added to 100 mg of crushed roots, and the components were
mixed and incubated for1hatroom temperature. The whole mixture was
used for DNA extraction with a FastDNA spin kit (MP Biomedicals, USA)
according to the manufacturer’s instructions; qPCR was performed as
described above. The standard curve was generated by plotting the C
T
value versus the number of CFU added to each tube. No bacteria were
added to the negative control.
DNA preparation. Genomic DNA was extracted from the bacterial
cultures and wheat roots using a FastDNA spin kit (MP Biomedicals,
USA) according to the manufacturer’s instructions. DNA concentrations
were assessed by measurement of the optical density at 260 nm with a
NanoDrop device (NanoDrop Technologies, Wilmington, DE, USA).
qPCR quantification of Azospirillum brasilense FP2 on wheat roots.
For the sterile experiments, seeds of wheat (Triticum aestivum cv. Schön-
dorfer) were surface sterilized using a protocol described previously (25).
Afterward, the seeds were germinated on nutrient agar plates (Analytical
Fluka) for 3 days, transferred to glass tubes containing 16 ml of Hoagland
solution and quartz beads with a diameter of approximately 3 mm, and
then incubated in a greenhouse with a 14-h light/10-h dark cycle at 23°C
and a humidity above 50%.
For the experiments performed under nonsterile conditions, seeds
were germinated as described above but without surface sterilization in
commercial gardener soil (type ED-73; Bayerische Gärtnereigenossen-
schaft), suspended in Hoagland medium at a final concentration of 1%
(wt/vol), and filtered, and this suspension was used as the inoculum in
glass tubes containing quartz beads. The negative control consisted of
noninoculated plants. Different experiments were conducted to evaluate
plants inoculated with A. brasilense FP2 or coinoculated in the presence of
other wheat-associated diazotrophs (in the same amount), namely, A.
brasilense NH, Herbaspirillum seropedicae Z67, Gluconacetobacter di-
azotrophicus DSM 5601, and A. lipoferum DSM 1691. The control con-
sisted of A. brasilense FP2-inoculated plants. All microorganisms were
grown until the count was about 10
9
CFU/ml, and the cells were washed
once with 1⫻phosphate-buffered saline buffer (Applichem, Denmark).
In all experiments, approximately 10
7
CFU/plant was inoculated in the
plant growth medium and incubated for 14 days. The experiments were
performed in biological and technical triplicate, and samples were col-
lected every 2 days.
Determination of number of CFU. To determine the number of CFU,
the roots were crushed using a mortar, serially diluted (10
⫺1
to 10
⫺7
)in
saline (0.9% NaCl), and plated on NFbHPN medium, and the colonies
were counted.
Experimental design and statistical analysis. The experiments in a
growth chamber followed a randomized block design. Colony counts
were expressed as the number of CFU per gram (fresh weight) of root, and
qPCR quantification data were converted to the equivalent number of
CFU per gram (fresh weight) of root. The data were subjected to the
Student ttest (to compare means of two treatments) or to analysis of
variance (to compare many treatments), with means compared by the
Tukey test, using the SAEG program (version 8.0; Sistema para Análise
Estatísticas, Universidade Federal de Viçosa, Viçosa, Brazil).
RESULTS
Primer design and evaluation of amplification efficiency. For
strain-specific primer design, strain-specific genomic regions
TABLE 2 Primer characteristics and parameters evaluated by qPCR
Primer pair Orientation
a
Sequence Length (mer) GC content (%) R
2
Slope
Efficiency
b
E%E
16S rRNA gene
c
F TCGCTAGTAATCGCGGATCA 20 50 0.9995 3.3 2.01 101.3
R TGTGACGGGCGGTGTGTA 18 61
Azo-2 F GCGCGGGAAGTCCTGAAT 18 61 0.9934 3.4 1.97 96.8
R CCCTTCACCATCCAGTCGAT 20 55
AzoR2.1 F CGCCACCATGCGATCAA 17 59 0.9980 3.3 2.01 101.3
R GCATGCCCAGTACTGCAAGTC 21 57
AzoR2.2 F CCTTCACCTGGACGGTTCAG 20 60 0.9982 3.5 1.94 94.0
R CGCGGCCAGCAGACTT 16 69
AzoR5.1 F GATCACTGGACTCGGCTGTCA 21 57 0.9977 3.7 1.88 87.6
R ATCGACCGTTCTCAGCGTCTA 21 52
AzoR5.2 F TCACTGGACTCGGCTGTCAA 20 55 0.9996 3.6 1.89 88.8
R ATATCGACCGTTCTCAGCGTCTA 23 48
AzoR5.3 F AATTCTTTCCGTTGGCTTTCAA 22 36 0.9995 3.4 1.97 96.8
R GCTTGCCGACCGGAGTATC 19 63
a
F, forward primer; R, reverse primer.
b
Efficiency (E) was calculated using the equation 10
⫺1/slope
⫺1, and percent efficiency was calculated from the equation (E⫺1) ⫻100.
c
The forward primer binds the region from 1,267 to 1,286 bp and the reverse primer binds the region from 1,319 to 1,336 bp of the 16S rRNA gene sequence of Azospirillum
brasilense Sp7 (GenBank accession number X79739).
Stets et al.
6702 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

were selected after the whole-genome sequences (WGSs) of Azos-
pirillum brasilense FP2 and A. brasilense Sp245, the strain closest to
strain FP2 for which a genome sequence is available so far, were
compared using the procedures detailed in the Materials and
Methods section. The genome sequence comparison was based on
BLAST analysis of 500-bp sequence fragments of A. brasilense FP2
against the genome sequence of A. brasilense Sp245 in a local da-
tabase in the first round and against the sequence in the NCBI NT
database in the second round. Although this analysis is database
dependent and does not guarantee the selection of strain-specific
genomic regions, in practice, comparison of the genomes of two
very closely related strains (i.e., strains with very high genomic
synteny) allows the selection of genomic regions whose sequences
are not likely to match the sequence of a more distantly related
organism, as shown by the results of a search of the sequences in a
comprehensive database by BLAST analysis. Sequences for which
no hits were found in a BLAST analysis against the Sp245 genome
sequence also did not show significant hits against the sequences
in the NCBI NT database. Using this methodology, six coding and
intergenic regions from the A. brasilense FP2 genome were se-
lected, and a total of 10 primer pairs were designed and tested for
cross amplification against 13 different bacterial DNAs, including
DNAs from four A. brasilense strains, six other Azospirillum spp.,
and two Roseomonas species strains (Fig. 1 shows the most rele-
vant primer pairs).
Five out of 10 primer pairs were specific for A. brasilense FP2,
namely, AzoR2.1, AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3
(Table 2). For one of the primer pairs, Azo-2, amplicons were
generated for all four strains of Azospirillum brasilense tested (FP2,
NH, Sp245, and Sp7), but no amplification was observed for Ro-
seomonas genomospecies 6 CCUG 33010, Roseomonas fauriae
KACC 11694, Burkholderia tropica Ppe5, or Burkholderia
brasilense M171 (data not shown).
The genome sequences from strains FP2 and Sp245 of A.
brasilense share a high degree of synteny; however, strain-specific
primer pairs were designed from two FP2 contig sequences that
did not align along the chromosome or any plasmid sequences
from strain Sp245 (see Fig. S1A in the supplemental material). On
the contrary, primer pair Azo-2 was designed from a contig se-
quence of FP2 that aligns to the Sp245 chromosome sequence (see
Fig. S1B in the supplemental material), although the alignment in
the region of primer binding did not show a perfect match (data
not shown). Automatic annotation of the A. brasilense FP2 draft
genome sequence predicted that the amplicon from the Azo-2
primer pair is located at the end of a coding sequence (CDS) for a
hypothetical protein. On the other hand, amplicons from strain-
specific primer pairs were predicted to be located in a noncoding
region (AzoR2.1 and AzoR2.2) or fall into a CDS for the TniQ
domain-containing protein (AzoR5.1, AzoR5.2, and AzoR5.3; see
Fig. S2 in the supplemental material). Interestingly, the regions
surrounding amplicons from strain-specific primer pairs con-
tained some CDSs related to phages and mobile elements.
FIG 1 Specificities of the primer pairs designed to amplify Azospirillum brasilense FP2. Lanes: L, DNA ladder; 1, A. brasilense FP2; 2, A. brasilense NH; 3, A.
brasilense Sp7; 4, A. brasilense Sp245; 5, A. lipoferum DSM 1691; 6, Azospirillum rugosum DSM 19657; 7, Azospirillum canadense LMG 23617; 8, Azospirillum
amazonense DSM 2787; 9, Azospirillum irakense DSM 1158a; 10, Roseomonas genomospecies 6 CCUG 33010; 11, Roseomonas fauriae KACC 11694; 12, negative
control (no template DNA). The primer pair specific for the 16S rRNA-encoding gene was used as a positive amplification control. Primer pairs AzoR2.1,
AzoR2.2, AzoR5.1, AzoR5.2, and AzoR5.3 produced amplicons only when A. brasilense FP2 DNA was used as the template and were considered strain-specific
primer pairs; primer pair AzoR6.1 produced cross-species amplicons and was not able to amplify all A. brasilense strains tested (i.e., no amplification for strain
Sp7 was observed) and so was discarded from further analyses.
qPCR Quantification of Azospirillum brasilense in Roots
October 2015 Volume 81 Number 19 aem.asm.org 6703Applied and Environmental Microbiology

The efficiency of all strain-specific primer pairs obtained in this
study was tested by constructing a standard curve with increasing
concentrations of A. brasilense FP2 DNA (Table 2). The primer
pairs AzoR5.1 and AzoR5.2 were discarded from further analysis
because they had the lowest efficiency rate, and primer pairs
AzoR2.1, AzoR2.2, and AzoR5.3 were used to quantify A.
brasilense FP2.
qPCR quantification of Azospirillum brasilense FP2 on
wheat roots. In order to test the ability of the strain-specific
primer pairs to quantify A. brasilense FP2 in the rhizosphere, a
growth chamber experiment was conducted with wheat plants
inoculated with A. brasilense FP2 under sterile and nonsterile con-
ditions.
To monitor the population of A. brasilense FP2 in wheat roots,
three strain-specific primer pairs with the highest amplification
efficiency (AzoR2.1, AzoR2.2, and AzoR5.3) were selected. The
primer pair Azo-2 was used to quantify the total A. brasilense pop-
ulation, and a universal 16S rRNA gene-targeted primer pair
(Doumit Camilios Neto, personal communication) was used for
the quantification of all bacteria present (Table 2).
Initially, a standard curve was constructed from a fixed amount
of crushed plant root tissues mixed with each sample of serially
diluted total DNA of A. brasilense FP2 (see Materials and Meth-
ods). The inclusion of plant material during the construction of
the standard curve was based on the observation of Couillerot et
al. (17) that the presence of root extract decreases the detection
limit for the quantification of A. lipoferum CRT1 on maize. The
inclusion of root extract allowed conditions including the pres-
ence of plant background DNA to be integrated into the technical
sensitivity limit of the final standard curve, thereby making the
quantification closer to reality. The equation for the qPCR quan-
tification standard curve was used to estimate the amount of bac-
teria in wheat roots inoculated with A. brasilense FP2. The detec-
tion limit of the technique was 10
4
CFU/g of wheat root (see Fig.
S3 in the supplemental material). In the first attempt to monitor
the population of A. brasilense FP2, wheat was inoculated and
cultivated under sterile conditions. In noninoculated plants,
strain A. brasilense FP2 or any other bacteria were not detected by
the qPCR or the plate count technique. Figure 2A shows the num-
ber of bacteria in wheat inoculated under sterile conditions deter-
mined by qPCR using primer pair Azo-2 (specific for Azospirillum
spp.) and primer pairs AzoR2.1, AzoR2.2, and AzoR5.3 (specific
for strain FP2). There was no statistically significant difference
between the measurements obtained using the three strain-spe-
cific primer pairs or between those obtained using species- and
strain-specific primer pairs. A large number of bacteria were ob-
served in the first days after inoculation (roughly 10
7
to 10
8
CFU/g
of wheat root; Fig. 2B). The quantification of A. brasilense FP2 was
also analyzed by the plate count method in NFbHPN medium. A
higher degree of variability was observed by the plate count
method than by qPCR in the first days after inoculation. However,
no statistically significant differences between sampling points
were observed when cells were quantified using either qPCR or the
plate count method from day 7 (Fig. 2B). The results also revealed
an increase in the fresh weight of roots and shoots of plants inoc-
ulated with A. brasilense FP2 (Fig. 2C and D). This stimulation due
to inoculation was most evident in the roots. In the second at-
tempt, wheat was inoculated and cultivated under nonsterile con-
ditions. The results showed no statistically significant differences
in the results when A. brasilense FP2 was quantified by the qPCR
methodology using three different strain-specific primer pairs
(AzoR2.1, AzoR2.2, and AzoR5.3). Similar numbers of bacteria
FIG 2 Enumeration of Azospirillum brasilense FP2 in inoculated wheat roots under sterile conditions. (A) The primer pair Azo-2 was used for A. brasilense
enumeration, and strain-specific primer pairs AzoR2.1, AzoR2.2, and AzoR5.3 were used for A. brasilense FP2 enumeration. (B) Comparison of A. brasilense FP2
enumeration by qPCR and plate counting methods. The values for qPCR are the means from three experiments using strain-specific primer pairs. (C and D) A.
brasilense FP2 plant growth promotion effect observed for root fresh weight (C) and shoot fresh weight (D). *, statistically significant difference (P⬍0.01).
Stets et al.
6704 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

were observed when the strain-specific primer pairs and species-
specific primer pair Azo-2 were used. As expected, the universal
primer pair specific for 16S rRNA-encoding genes (which were
used to estimate the total number of bacteria) showed higher
numbers of cells per gram of wheat roots, although statistically
significant differences were not achieved for any sampling point.
Except at day 1, the differences in cell numbers obtained when the
results for the universal primer pair specific for 16S rRNA-encod-
ing genes and those for the species- and strain-specific primer
pairs were compared were 2- to 5-fold (Fig. 3A). No statistically
significant differences were also observed for most sampling
points when cell counting techniques were compared, although
the plate count method showed a higher degree of variability
(Fig. 3B). These results suggest that the population of the inocu-
lated bacteria is high and stable for at least 13 days after inocula-
tion and that the diversity of all bacteria and bacteria of the Azos-
pirillum genus present in the rhizosphere of wheat plants is
limited, reflecting the rather low level of diversity of bacteria in the
soil used for cultivation. The number of CFU in the soil was eval-
uated by the plate count method using DYGS medium and
reached values of 10
3
to 10
4
CFU, confirming the occurrence of a
low level of diversity of bacteria in the soil used for the cultivation
of wheat and the inoculation experiments.
The population of A. brasilense FP2 was stable, even when the
rhizobacteria Azospirillum brasilense NH, Herbaspirillum serope-
dicae Z67, Gluconacetobacter diazotrophicus DSM 5601, and Azos-
pirillum lipoferum DSM 1691 were coinoculated in wheat plants
under nonsterile conditions, leaving the FP2 counts above 10
7
CFU/g (fresh weight) of root. No statistically significant difference
in the A. brasilense FP2 numbers obtained by qPCR quantification
was achieved when the results obtained with the strain-specific
primer pairs and those obtained with the Azo-2 primer pair were
FIG 3 Enumeration by qPCR of Azospirillum brasilense FP2 associated with wheat roots under nonsterile conditions. (A) The species-specific primer pair Azo-2
was used for the quantification of A. brasilense; strain-specific primer pairs AzoR2.1, AzoR2.2, and AzoR5.3 were used for the quantification of A. brasilense FP2;
and the primer pair specific for the 16S rRNA-encoding gene was used for the quantification of all bacteria present. (B) Quantification of A. brasilense FP2
associated with wheat roots by qPCR and plate count methods. Values for qPCR are means for the three strain-specific primer pairs. *, statistically significant
difference (P⬍0.01).
qPCR Quantification of Azospirillum brasilense in Roots
October 2015 Volume 81 Number 19 aem.asm.org 6705Applied and Environmental Microbiology

compared (Fig. 4A), and no statistically significant differences for
most sampling points were observed when the results obtained by
qPCR and those obtained by the plate count technique were com-
pared (Fig. 4B). The differences in cell numbers obtained when the
universal primer pair for 16S rRNA-encoding genes and species-
specific primer pairs were used ranged from 2.2 ⫻10
9
(3 days after
inoculation) to 3.9 ⫻10
7
(13 days after inoculation) (Fig. 4A).
However, the total number of bacteria, including the number of
bacteria consisting of the other inoculants, was significantly
higher by qPCR with the universal primer pair specific for 16S
rRNA-encoding genes than qPCR with the species-specific primer
pairs until 7 days after inoculation, but after that sampling point
the levels dropped and the levels of A. brasilense and strain FP2
were roughly similar by qPCR with both sets of primers. These
results reinforce the finding that A. brasilense FP2 maintains a
stable population in the rhizosphere/roots of the plants during the
period of colonization and further indicate that strain FP2 is
highly competitive, a desirable characteristic for inoculant pro-
duction. When the primer pairs specific for strain FP2 developed
in this work (AzoR2.1, AzoR2.2, and AzoR5.3) were used with
DNA from plants inoculated with other rhizobacterial strains un-
der nonsterile conditions, there was no amplification product,
confirming the specificities of the primers for the detection of A.
brasilense FP2 (data not shown).
Taken together, the results from all inoculation experiments
show that the number of A. brasilense FP2 cells was stable and not
below 10
7
CFU/g (fresh weight) of root, indicating that this bac-
terium is competitive, maintaining its population at a high level
even in the presence of competing rhizobacteria (see Fig. S4 in the
supplemental material).
DISCUSSION
Inoculants containing Azospirillum spp. have been tested under
field conditions with important crops. A. brasilense strains, in-
FIG 4 Quantification of Azospirillum brasilense FP2 associated with wheat roots under nonsterile conditions coinoculated with Azospirillum brasilense NH,
Herbaspirillum seropedicae Z67, Gluconacetobacter diazotrophicus DSM 5601, and Azospirillum lipoferum DSM 1691 by the qPCR method. (A) The species-
specific primer pair Azo-2 was used for A. brasilense quantification; strain-specific primer pairs AzoR2.1, AzoR2.2, and AzoR5.3 were used for A. brasilense FP2
quantification; and a primer pair specific for the 16S rRNA-encoding gene was used for the quantification of all bacteria present. For each day, different letters
indicate statistically significant differences (P⬍0.01). (B) Quantification of Azospirillum brasilense FP2 associated with wheat roots by the qPCR and plate count
methods. Values for qPCR are the means obtained with the three strain-specific primer pairs. *, statistically significant difference (P⬍0.01).
Stets et al.
6706 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

cluding strain FP2, have been recognized to be very effective in
promoting plant growth, and some of them have been authorized
for use for the production of commercial inoculants in Brazil (10).
Despite the importance of these plant growth-promoting bacteria
(PGPB), no rapid method has been available to monitor this strain
during experiments.
A nested PCR method for the detection of Azospirillum li-
poferum CRT1 in the rhizosphere was proposed by Baudoin et al.
(34). However, the primers, designed from 16S and 23S rRNA
intergenic region-encoding gene fragments, proved not to be spe-
cific enough for the development of a strain-specific qPCR quan-
tification method. Several optimizations regarding specificity and
efficiency were then applied to design strain-specific qPCR prim-
ers to detect bacterial strains on the basis of sequence-character-
ized amplified region (SCAR) markers (17,34). In this study, we
developed a strain-specific qPCR protocol based on comparative
genome analysis to quantify Azospirillum brasilense strain FP2, a
plant growth-promoting bacterium, inoculated into the roots of
wheat plants. To achieve this goal, we designed strain-specific
primers by in silico comparison of 500-bp fragments of a draft A.
brasilense FP2 genome with the sequence of the A. brasilense Sp245
genome. Unique strain FP2 fragments were also used to search the
NCBI nonredundant database for similar sequences. The strain-
specific fragments identified so far were used for primer design.
Many authors have reported on the use of different methods,
usually based on experimental approaches, to design taxon-spe-
cific primers. Konstantinov et al. (35) isolated specific genomic
fragments from the type strain and related strains by digesting the
genomic DNA with a restriction enzyme and then making a sub-
tractive hybridization with the closest strains to eliminate shared
DNA fragments. The unique fragments were extracted from the
gel, cloned, sequenced, and used to design specific primers to de-
tect Lactobacillus sobrius 001T. Fujimoto et al. (36) and Maruo et
al. (37) developed a PCR-based method for the identification and
quantification of Lactobacillus casei strain Shirota and Lactobacil-
lus lactis subsp. cremoris FC, respectively, using strain-specific
primers derived from RAPD analysis. The authors evaluated the
survival of these strains through the gastrointestinal tract by qPCR
with the strain-specific primers, where they monitored the cell
numbers before and after the administration of fermented milk
containing this strain. Pereira et al. (38) developed a qPCR
method for the quantification of the plant growth-promoting bac-
terium H. seropedicae in the rhizosphere of maize seedlings.
Primer pairs were designed from the genome sequence of H. sero-
pedicae SmR1 (39) and tested against 12 different species. Al-
though the selected genome regions did not match any other se-
quences in the NCBI database, the primers were not evaluated
against the sequences of other H. seropedicae strains, which did not
allow any conclusion about their strain specificities to be made.
In the past decade, whole-genome sequencing has become a
rapid and cost-effective way to provide comprehensive informa-
tion about an organism (40). Although the achievement of a com-
plete genome is a demanding process, a draft genome sequence
with a wide breadth of coverage can be obtained. In the present
work, we have shown that the direct comparison of the genomic
sequences of closely related organisms is a rapid and reliable ap-
proach to detect specific DNA regions to be used as strain-specific
genetic markers for the quantitative detection of bacterial strains
colonizing roots and the rhizosphere. The rationale for this ap-
proach relies on three facts: (i) the genome sequence provides
genetic information to the highest resolution; (ii) regions that
diverge between the genome sequences of very closely related or-
ganisms (i.e., strains of the same species) are most likely to diverge
from the genome sequences of more distant taxa; and (iii) the
absence of sequence similarity between possible strain-specific
genomic regions and sequences in large public databases covering
most of the taxa from different environments can be broadly ac-
cepted as the absence of these regions in other organisms.
The strain-specific primers developed in this work to monitor
the population of A. brasilense FP2 inoculated into wheat showed
that the bacteria colonize the roots of the plant at 10
7
to 10
8
CFU/g
of root in the first days after inoculation. The population is main-
tained at relatively stable levels until 13 days after inoculation, at
which time the rhizobacteria exert a plant growth promotion ef-
fect. Although for some experiments the plant growth promotion
effect was not evident during the period analyzed, this effect is
frequently observed at later stages of plant development (41).
Couillerot et al. (17) also observed a high number of bacteria (10
5
to 10
7
CFU/g of maize root) by either qPCR or the plate count
method 1 to 3 days after inoculation of A. brasilense UAP-154 and
CFN-535 into maize.
In conclusion, five primer pairs, AzoR2.1, AzoR2.2, AzoR5.1,
AzoR5.2, and AzoR5.3, specific for A. brasilense strain FP2 were
successfully designed and tested to monitor the fluctuation of the
population of this strain after inoculation into wheat roots under
sterile and nonsterile conditions. We demonstrated that A.
brasilense FP2 maintained a high number of cells in association
with the plant roots within 2 weeks after inoculation. Thus, in our
work we showed that the strain-specific primer pairs designed by
using available genome sequence information can be effectively
applied to quantitatively monitor the population of PGPB in the
rhizosphere of the inoculated plants. The strategy for the design of
strain-specific primers described here may theoretically be used
for any microorganism for which the whole-genome sequence is
available in a database. The qPCR methodology developed in this
work is a generally applicable tool that may be used to monitor the
population dynamics of bacteria inoculated into crop plants and is
potentially applicable in field experiments. Furthermore, this
technique could also be applied to the quality control of commer-
cially available inoculants, where rigid controls for contamination
and the number of inoculant cells have to guarantee the efficiency
of the final product.
ACKNOWLEDGMENTS
We are grateful to Roseli Prado, Valter Baura, and Marilza Lamour for
technical assistance.
This work was supported by CNPq, INCT da Fixação de Nitrogênio/
MCT, Fundação Araucária, and CAPES.
REFERENCES
1. Bashan Y, Holguin G, de-Bashan LE. 2004. Azospirillum-plant relation-
ships: physiological, molecular, agricultural, and environmental advances
(1997–2003). Can J Microbiol 50:521–577. http://dx.doi.org/10.1139/w04
-035.
2. Fibach-Paldi S, Burdman S, Okon Y. 2012. Key physiological properties
contributing to rhizosphere adaptation and plant growth promotion abil-
ities of Azospirillum brasilense. FEMS Microbiol Lett 326:99 –108. http:
//dx.doi.org/10.1111/j.1574-6968.2011.02407.x.
3. Dobbelaere S, Vanderleyden J, Okon Y. 2003. Plant growth-promoting
effects of diazotrophs in the rhizosphere. Crit Rev Plant Sci 22:107–149.
http://dx.doi.org/10.1080/713610853.
4. Okon Y, Labandera-Gonzalez CA. 1994. Agronomic applications of Azos-
qPCR Quantification of Azospirillum brasilense in Roots
October 2015 Volume 81 Number 19 aem.asm.org 6707Applied and Environmental Microbiology

pirillum: an evaluation of 20 years worldwide field inoculation. Soil Biol
Biochem 26:1591–1601. http://dx.doi.org/10.1016/0038-0717(94)90311-5.
5. Sant’Anna FH, Almeida LG, Cecagno R, Reolon LA, Siqueira FM,
Machado MR, Vasconcelos AT, Schrank IS. 2011. Genomic insights into
the versatility of the plant growth-promoting bacterium Azospirillum
amazonense. BMC Genomics 12:409. http://dx.doi.org/10.1186/1471
-2164-12-409.
6. Eckert B, Weber OB, Kirchhof G, Halbritter A, Stoffels M, Hartmann
A. 2001. Azospirillum doebereinerae sp. nov., a nitrogen-fixing bacterium
associated with the C4-grass Miscanthus. Int J Syst Evol Microbiol
51:17–26.
7. Castro-Sowinski S, Herschkovitz Y, Okon Y, Jurkevitch E. 2007. Effects
of inoculation with plant growth-promoting rhizobacteria on resident
rhizosphere microorganisms. FEMS Microbiol Lett 276:1–11. http://dx
.doi.org/10.1111/j.1574-6968.2007.00878.x.
8. Pedrosa FO, Yates MG. 1984. Regulation of nitrogen fixation (nif) genes
of Azospirillum brasilense by nifA and ntr (gln) type gene products. FEMS
Microbiol Lett 23:95–101. http://dx.doi.org/10.1111/j.1574-6968.1984
.tb01042.x.
9. Camilios-Neto D, Bonato P, Wassem R, Tadra-Sfeir MZ, Brusamarello-
Santos LC, Valdameri G, Donatti L, Faoro H, Weiss VA, Chubatsu LS,
Pedrosa FO, Souza EM. 2014. Dual RNA-seq transcriptional analysis of
wheat roots colonized by Azospirillum brasilense reveals up-regulation of
nutrient acquisition and cell cycle genes. BMC Genomics 15:378. http://dx
.doi.org/10.1186/1471-2164-15-378.
10. Hungria M, Campo RJ, Souza EM, Pedrosa FO. 2010. Inoculation with
selected strains of Azospirillum brasilense and A. lipoferum improves
yields of maize and wheat in Brazil. Plant Soil 331:413– 425. http://dx.doi
.org/10.1007/s11104-009-0262-0.
11. Bashan Y. 1999. Interactions of Azospirillum spp. in soils: a review. Biol
Fertil Soils 29:246 –256. http://dx.doi.org/10.1007/s003740050549.
12. Bashan Y, Puente ME, Rodriguez-Mendoza MN, Toledo G, Holguin G,
Ferrera-Cerrato R, Pedrin S. 1995. Survival of Azospirillum brasilense in
the bulk soil and rhizosphere of 23 soil types. Appl Environ Microbiol
61:1938 –1945.
13. Dobbelaere S, Croonenborghs A, Thys A, Ptacek D, Okon Y, Vander-
leyden J. 2002. Effect of inoculation with wild type Azospirillum
brasilense and A. irakense strains on development and nitrogen uptake of
spring wheat and grain maize. Biol Fertil Soils 36:284 –297. http://dx.doi
.org/10.1007/s00374-002-0534-9.
14. Magnani GS, Cruz LM, Weber H, Bespalhok JC, Daros E, Baura V,
Yates MG, Monteiro RA, Faoro H, Pedrosa FO, Souza EM. 2013.
Culture-independent analysis of endophytic bacterial communities asso-
ciated with Brazilian sugarcane. Genet Mol Res 12:4549 – 4558. http://dx
.doi.org/10.4238/2013.October.15.3.
15. Magnani GS, Didonet CM, Cruz LM, Picheth CF, Pedrosa FO, Souza
EM. 2010. Diversity of endophytic bacteria in Brazilian sugarcane. Genet
Mol Res 9:250 –258. http://dx.doi.org/10.4238/vol9-1gmr703.
16. Pisa G, Magnani GS, Weber H, Souza EM, Faoro H, Monteiro RA,
Daros E, Baura V, Bespalhok JP, Pedrosa FO, Cruz LM. 2011.
Diversity of 16S rRNA genes from bacteria of sugarcane rhizosphere
soil. Braz J Med Biol Res 44:1215–1221. http://dx.doi.org/10.1590
/S0100-879X2011007500148.
17. Couillerot O, Bouffaud M-L, Baudoin E, Muller D, Caballero-Mellado
J, Moënne-Loccoz Y. 2010. Development of a real-time PCR method to
quantify the PGPR strain Azospirillum lipoferum CRT1 on maize seed-
lings. Soil Biol Biochem 42:2298-2305. http://dx.doi.org/10.1016/j.soilbio
.2010.09.003.
18. Sánchez AC, Gutiérrez RT, Santana RC, Urrutia AR, Fauvart M,
Michiels J, Vanderleyden J. 2014. Effects of co-inoculation of native
Rhizobium and Pseudomonas strains on growth parameters and yield of
two contrasting Phaseolus vulgaris L. genotypes under Cuban soil condi-
tions. Eur J Soil Biol 62:105–112. http://dx.doi.org/10.1016/j.ejsobi.2014
.03.004.
19. Araújo AEDS, Baldani VLD, Galisa PDS, Pereira JA, Baldani JI. 2013.
Response of traditional upland rice varieties to inoculation with selected
diazotrophic bacteria isolated from rice cropped at the northeast region of
Brazil. Appl Soil Ecol 64:49 –55. http://dx.doi.org/10.1016/j.apsoil.2012
.10.004.
20. Sasaki K, Ikeda S, Eda S, Mitsui H, Hanzawa E, Kisara C, Kazama Y,
Kushida A, Shinano T, Minamisawa K, Sato T. 2010. Impact of plant
genotype and nitrogen level on rice growth response to inoculation with
Azospirillum sp. strain B510 under paddy field conditions. Soil Sci Plant
Nutr 56:636 – 644. http://dx.doi.org/10.1111/j.1747-0765.2010.00499.x.
21. Stets MI, Pinto AS, Jr, Huergo LF, de Souza EM, Guimarães VF, Alves
AC, Steffens MBR, Monteiro RA, Pedrosa FDO, Cruz LM. 2013. Rapid
identification of bacterial isolates from wheat roots by high resolution
whole cell MALDI-TOF MS analysis. J Biotechnol 165:167–174. http://dx
.doi.org/10.1016/j.jbiotec.2013.04.001.
22. Couillerot O, Poirier M-A, Prigent-Combaret C, Mavingui P, Ca-
ballero-Mellado J, Moënne-Loccoz Y. 2010. Assessment of SCAR
markers to design real-time PCR primers for rhizosphere quantifica-
tion of Azospirillum brasilense phytostimulatory inoculants of maize.
J Appl Microbiol 109:528 –538. http://dx.doi.org/10.1111/j.1365-2672
.2010.04673.x.
23. Sørensen J, Haubjerg Nicolaisen M, Ron E, Simonet P. 2009. Molecular
tools in rhizosphere microbiology—from single-cell to whole-community
analysis. Plant Soil 321:483–512. http://dx.doi.org/10.1007/s11104-009
-9946-8.
24. Mavrodi OV, Mavrodi DV, Thomashow LS, Weller DM. 2007. Quan-
tification of 2,4-diacetylphloroglucinol-producing Pseudomonas fluore-
scens strains in the plant rhizosphere by real-time PCR. Appl Environ
Microbiol 73:5531–5538. http://dx.doi.org/10.1128/AEM.00925-07.
25. Pinheiro RDO, Boddey LH, James EK, Sprent JI, Boddey RM. 2002.
Adsorption and anchoring of Azospirillum strains to roots of wheat seedlings.
Plant Soil 246:151–166. http://dx.doi.org/10.1023/A:1020645203084.
26. Lacava PT, Li WB, Araújo WL, Azevedo JL, Hartung JS. 2006. Rapid,
specific and quantitative assays for the detection of the endophytic
bacterium Methylobacterium mesophilicum in plants. J Microbiol
Methods 65:535–541. http://dx.doi.org/10.1016/j.mimet.2005.09.015.
27. Ruppel S, Rühlmann J, Merbach W. 2006. Quantification and localiza-
tion of bacteria in plant tissues using quantitative real-time PCR and on-
line emission fingerprinting. Plant Soil 286:21–35. http://dx.doi.org/10
.1007/s11104-006-9023-5.
28. Machado HB, Funayama S, Rigo LU, Pedrosa FO. 1991. Excretion of
ammonium by Azospirillum brasilense mutants resistant to ethylenedi-
amine. Can J Microbiol 37:549 –553. http://dx.doi.org/10.1139/m91-092.
29. Rodrigues J, III, Malavolta VA, Jr, Victor O. 1986. Meio simples para o
isolamento e cultivo de Xanthomonas campestris pv. citri tipo B Summa.
Phytopathology 12:32.
30. Altschul SF, Madden TL, Schäffer AA, Zhang J, Zhang Z, Miller W,
Lipman DJ. 1997. Gapped BLAST and PSI-BLAST: a new generation of
protein database search programs. Nucleic Acids Res 25:3389 –3402. http:
//dx.doi.org/10.1093/nar/25.17.3389.
31. Overbeek R, Olson R, Pusch GD, Olsen GJ, Davis JJ, Disz T, Edwards
RA, Gerdes S, Parrello B, Shukla M, Vonstein V, Wattam AR, Xia F,
Stevens R. 2014. The SEED and the rapid annotation of microbial ge-
nomes using subsystems technology (RAST). Nucleic Acids Res 42:D206 –
D214. http://dx.doi.org/10.1093/nar/gkt1226.
32. Aziz RK, Bartels D, Best AA, DeJongh M, Disz T, Edwards RA,
Formsma K, Gerdes S, Glass EM, Kubal M, Meyer F, Olsen GJ, Olson
R, Osterman AL, Overbeek RA, McNeil LK, Paarmann D, Paczian T,
Parrello B, Pusch GD, Reich C, Stevens R, Vassieva O, Vonstein V,
Wilke A, Zagnitko O. 2008. The RAST server: rapid annotations using
subsystems technology. BMC Genomics 9:75. http://dx.doi.org/10.1186
/1471-2164-9-75.
33. Okonechnikov K, Golosova O, Fursov M, the UGENE team. 2012.
Unipro UGENE: a unified bioinformatics toolkit. Bioinformatics 28:
1166 –1167. http://dx.doi.org/10.1093/bioinformatics/bts091.
34. Baudoin E, Couillerot O, Spaepen S, Moënne-Loccoz Y, Nazaret S.
2010. Applicability of the 16S-23S rDNA internal spacer for PCR detection
of the phytostimulatory PGPR inoculant Azospirillum lipoferum CRT1 in
field soil. J Appl Microbiol 108:25-38. http://dx.doi.org/10.1111/j.1365
-2672.2009.04393.x.
35. Konstantinov SR, Smidt H, de Vos WM. 2005. Representational differ-
ence analysis and real-time PCR for strain-specific quantification of Lac-
tobacillus sobrius sp. nov. Appl Environ Microbiol 71:7578 –7581. http:
//dx.doi.org/10.1128/AEM.71.11.7578-7581.2005.
36. Fujimoto J, Matsuki T, Sasamoto M, Tomii Y, Watanabe K. 2008.
Identification and quantification of Lactobacillus casei strain Shirota in
human feces with strain-specific primers derived from randomly ampli-
fied polymorphic DNA. Int J Food Microbiol 126:210 –215. http://dx.doi
.org/10.1016/j.ijfoodmicro.2008.05.022.
37. Maruo T, Sakamoto M, Toda T, Benno Y. 2006. Monitoring the cell
number of Lactococcus lactis subsp. cremoris FC in human feces by real-
Stets et al.
6708 aem.asm.org October 2015 Volume 81 Number 19Applied and Environmental Microbiology

time PCR with strain-specific primers designed using the RAPD tech-
nique. Int J Food Microbiol 110:69 –76. http://dx.doi.org/10.1016/j
.ijfoodmicro.2006.01.037.
38. Pereira TP, do Amaral FP, Dall’Asta P, Brod FCA, Arisi ACM. 2014.
Real-time PCR quantification of the plant growth promoting bacteria
Herbaspirillum seropedicae strain SmR1 in maize roots. Mol Biotechnol
56:660 – 670. http://dx.doi.org/10.1007/s12033-014-9742-4.
39. Pedrosa FO, Monteiro RA, Wassem R, Cruz LM, Ayub RA, Colauto
NB, Fernandez MA, Fungaro MHP, Grisard EC, Hungria M, Madeira
HMF, Nodari RO, Osaku CA, Petzl-Erler ML, Terenzi H, Vieira LGE,
Steffens MBR, Weiss VA, Pereira LFP, Almeida MIM, Alves LR, Marin
A, Araujo LM, Balsanelli E, Baura VA, Chubatsu LS, Faoro H, Favetti
A, Friedermann G, Glienke C, Karp S, Kava-Cordeiro V, Raittz RT,
Ramos HJO, Ribeiro EMSF, Rigo LU, Rocha SN, Schwab S, Silva AG,
Souza EM, Tadra-Sfeir MZ, Torres RA, Dabul ANG, Soares MAM,
Gasques LS, Gimenes CCT, Valle JS, Ciferri RR, Correa LC, Murace
NK, et al. 2011. Genome of Herbaspirillum seropedicae strain SmR1, a
specialized diazotrophic endophyte of tropical grasses. PLoS Genet
7:e1002064. http://dx.doi.org/10.1371/journal.pgen.1002064.
40. Havlak P, Chen R, Durbin KJ, Egan A, Ren Y, Song X-Z, Weinstock
GM, Gibbs RA. 2004. The Atlas genome assembly system. Genome Res
14:721–732. http://dx.doi.org/10.1101/gr.2264004.
41. Kloepper JW, Schroth MN, Miller TD. 1980. Effects of rhizosphere
colonization by plant growth-promoting rhizobacteria on potato plant
development and yield. Phytopathology 70:1078 –1082. http://dx.doi.org
/10.1094/Phyto-70-1078.
qPCR Quantification of Azospirillum brasilense in Roots
October 2015 Volume 81 Number 19 aem.asm.org 6709Applied and Environmental Microbiology